Forensic Anthropology Identification Techniques

FORENSIC ANTHROPOLOGY
A REPORT IN FOREN 2
PERSONAL IDENTIFICATION TECHNIQUES
Submitted TO:
MRS SHARON P CORDERO

SUBJECT INSTRUCTOR
Submitted by:
Jaydel Abagon
Rona Mae Aguillon
Jan Franzel Alonzo
Jethanie Aive Clataro
Dayanara Juanites
Xena Gadayan
Alexandra Gem Posada
RJ Rosal
BS CRIM 2-A
April 19, 2022

Objectives
In the end of this discussion the students should be able to:
1. Know what is Forensic Anthropology and its History.

2. Determine the role of forensic anthropologist and its role to the court.
3. Be familiar with the Systematic Techniques to recover physical remains and associated materials.
4. Determine how to apply Forensic Anthropology in criminal investigation.
Introduction
Forensic anthropology is the application of the anatomical science of anthropology and its various
subfields, including forensic archaeology and forensic taphonomy in a legal setting. A forensic anthropologist
can assist in the identification of deceased individuals whose remains are decomposed, burned, mutilated or
otherwise unrecognizable, as might happen in a plane crash. Forensic anthropologists are also instrumental
in the investigation and documentation of genocide and mass graves.
Along with forensic pathologists, forensic dentists, and

homicide investigators, forensic anthropologists commonly testify
in court as expert witnesses. Using physical markers present on
a skeleton, a forensic anthropologist can potentially determine a
person's age, sex, stature, and race.
This is useful in identifying living individuals for legal

purposes such as illegal immigrants. This is extremely important
in legal cases where the court needs to decide if they will judge
an individual as an adult or a minor. In addition to identifying
physical characteristics of the individual, forensic anthropologists
can use skeletal abnormalities to potentially determine cause of
death, past trauma such as broken bones or medical procedures,
as well as diseases such as bone cancer.
The methods used to identify a person from a skeleton

relies on the past contributions of various anthropologists and the
study of human skeletal differences. Through the collection of thousands of specimens and the analysis of
differences within a population, estimations can be made based on physical characteristics. Through these,
a set of remains can potentially be identified. The field of forensic anthropology grew during the twentieth
century into a fully recognized forensic specialty involving trained anthropologists as well as numerous
research institutions gathering data on decomposition and the effects it can have on the skeleton.
Forensic Anthropology
➢ Forensis (Latin- pertaining to the forum)
➢ Anthropos (Greek- human or man)
➢ Logia (Greek- study)
The study of man for the purposes of the COURT.

➢ Establishing the identity of the deceased that involves skeletal remains.
➢ Forensic anthropology applies the science of physical or biological anthropology to the legal process.
Anthropology is the study of humans, and in this forensic discipline physical or biological
anthropologists focus their studies on the human body as it relates to explaining the circumstances
of an accident or solving a crime – often homicide.
➢ Forensic anthropologists analyze human remains, typically in criminal investigations. Their study of
human remains aids in the detection of crime by working to assess the age, sex, stature, ancestry
and unique features of a skeleton, which may include documenting trauma to the skeleton and its
postmortem interval.
History of Forensic Anthropology (divided into four periods)

➢ Formative Period (1849-1938)
• 1849 Boston, Dr. John Webster murdered Dr. George Parkman because he owed Parkman
quite a bit of money. However, two
anatomists (Drs. Oliver Wendell Holmes
and Jeffries Wyman) successfully
reassembled the skeletal remains and
determined that they matched the stature,
ancestry (Caucasian), and approximate
age of Dr. Parkman.
• 1894, Thomas Dwight - gave his Shattuck Lecture

about the analysis of human skeletal remains in a legal
setting. He was rightfully hailed as the "Father of
Forensic Anthropology."
• He was the first to write articles and essays and give lectures on human skeletal identification, the
original designation of forensic anthropology. He researched methods determining age, height, and
sex from the sternum, establishing stature without using bones of the arms and legs, using the
closure of joints between the bones of the skull to determine age at death. Sex determined from
joints of long bones.
➢ Consolidation Period (1939-1971):

• Anthropologist Wilton Krogman - published his book, “The Human Skeleton in Forensic
Medicine”, in 1962. Forensic anthropologists use this text even today.
• 1954 by Tom McKern and T. Dale Stewart- published

skeletal age changes in young American males.
Established skeletal aging techniques based on data
from skeletal remains of Korean War soldiers.
➢ Modern Period (1972-1999)

• The American Academy of Forensic Sciences (AAFS)
- established a section for forensic anthropology called the Physical Anthropology Section.
• 1977 - The American Board of Forensic Anthropology (ABFA) was created to certify
professional forensic anthropologists and to set
professional standards.
• 1980 - Dr. William Bass set up the "Body Farm" at the

University of Tennessee, Knoxville to research human
decomposition and taphonomy.
• 1986, Dr. Richard Jantz and Dr. Stephen Ousley -

developed FORDISC, a computer
program that enables forensic anthropologists to perform metric analyses
on skeletal remains based on data from contemporary populations. The
goal is to determine sex, ancestry, and height from the measurements.
• Rd. Clyde Snow- began

training forensic anthropologists to work on human
rights and genocide cases. The first such team
was the Argentine Forensic Anthropology Team
(EAAF).
• Rd. William R. Maples - founded the C.A. Pound Human
Identification Laboratory (CAPHIL), the first private forensic
anthropology lab, at the University of Florida.
➢ Fourth Era (2000 – present)

• The Ellis Kerley Foundation - was established as the first funding
source solely for forensic anthropological research in 2000.
• 2003- JPAC was the first skeletal identification lab to obtain ASCLD-
LAB (American Society of Crime Laboratory Directors-Laboratory
Accreditation Board) accreditation. CAPHIL followed soon after.
• 13th century, medical examiners have sought to determine the causes of deaths and to solve
crimes. Given that a death can be natural, accidental, homicide, suicide, or undetermined,
forensic science has been greatly aided by developments in modern chemistry, toxicology,
and photography.
• Johann Friedrich Blumenbach - German anthropologist in

comparative human morphology, early forensic
anthropologists relied upon anthropometry (the science of
recording measurements of various parts of the human
body).
• Hans Gross - The publication of Austrian criminologist

“Handbuch für Untersuchungsrichter” (1893; Criminal Investigation)
helped to establish the science of forensics, especially in terms of a
cross-transfer of evidence, such as dirt, fingerprints, carpet fibers or hair,
from the criminal to the victim. Early in the 20th century, serological
research led to the discovery of the A, B, AB, and O blood groups, thus
increasing the value of blood as evidence at a crime scene.
• Mid-20th century- advances in biochemistry and technology

resulted in the discovery of unique gene markers in each person; these genetic differences
allow for the DNA fingerprinting of hair, blood, semen and tissue. Thus, DNA testing was a
major contribution to modern forensic science, though forensic anthropologists generally do
not conduct such DNA analyses and often only supply samples to be tested. The 20th and
21st centuries have also seen substantial growth in public and private forensic laboratories,
enabling the collection and study of empirical evidence.
Applications of Forensic Anthropology
➢ Forensic anthropology, application of physical anthropology to legal cases, usually with a focus on
the human skeleton.
➢ Forensic anthropology uses the techniques of

physical anthropology to analyse skeletal, badly
decomposed, or otherwise unidentified human
remains to solve crimes.
➢ Forensic anthropologists can assess the age, sex,

and unique features of a decedent and are
invaluable in documenting trauma to the body and
estimating how long a corpse has been
decomposing.
➢ Forensic anthropologists work closely with

individuals in law enforcement and medical science
and especially with specialists in ballistics,
explosives, pathology, serology (the study of blood and bodily fluids) and toxicology and are often
expert witnesses in murder trials.
➢ Although physical anthropology is concerned with human evolution, human variation, and the
biological bases of human behaviour, many of its excavation and reconstruction techniques can be
applied to forensic anthropology.
➢ Both disciplines use empirical evidence, genetic

information, and computer technology to determine
the physical characteristics of human specimens.
Indeed, a forensic anthropologist can reconstruct the
face of a murder victim in much the same way a
physical anthropologist can reconstruct the face of a
100,000-year-old Neanderthal skull.
➢ Forensic anthropology involves applying

anthropological research and techniques to medico
legal issues. There are three subsections within the
field of forensic anthropology, including: a) Forensic Osteology - the study of the skeleton; b)Forensic
Archeology - involves the controlled collection of human remains; c) Forensic Taphonomy- involves
the study of changes to the body after death, including decomposition and environmental
modification).
Techniques of Forensic Anthropology
Forensic anthropologists use a number of techniques when studying skeletal remains, including:
➢ Clay or graphic facial reproduction- This is used to

recreate a face from skull with the use of soft tissue depth
estimates. In manual methods, is done by using clay, plastic
and wax directly on the victim’s skull.
➢ Scanning electron microscopy- scanning electron

microscope (SEM) is a type of electron
microscope that produces images of a
sample by scanning the surface with a focused beam of electrons. The electrons
interact with atoms in the sample, producing various signals that contain
information about the surface topography and composition of the sample.
➢ Radiographic techniques- Is an
imaging technique using x- rays, gamma rays, or similar ionizing
radiation and non- ionizing radiation to view the internal form of an
object.
➢ Photo or video superimposition techniques- The term of photographic superimposition

has been applied for a number of techniques in
forensic medicine and dentistry. The comparison of
an ante mortem photograph to that of a skull is one
such procedure. Technical information and potential
sources of difficulty are discussed. Finally, two
cases illustrate the use and misuse of this technique
in arriving at a positive identification.
➢ The casting of skeletal materials- Skeletal

remains are physical records that can help determine
the adaptations/biological features of a species or an
individual. Casting protects original materials and
makes new material available for people or research.
Casting and molding are processes that duplicate
fossil and also recent skeletal material.
➢ Preservation of skeletal materials using commercial preservatives- compound or
solution is used in the field for consolidation of bone or skeleton in order
to preserve it.
➢ Thin-sectioning techniques of bone histology-

Involving hand grinding technique has been developed to
produce 20-40-un-thick sections of bone-titanium implant
sites.
➢ Rehydration and preservation of mummified or decayed soft tissues- Process and

chemical formula for rehydrating soft tissues of
mummified corpses or under an initial process of
putrefaction. And the chemical formula for the
subsequent preservation thereof. The present
invention is novel since it includes a process and
a chemical formula which are efficient for
rehydrating the whole soft tissues present in a
mummified corps, or in its initial process of
putrefaction, thus reversing the physical changes
that these phenomena had caused thereto.
Additional Information
In many cases after identity of an individual is made, the forensic anthropologist is called to testify in court
regarding the identity of the remains and/or the trauma or wounds present on the remains.
• Forensic Anthropology- is an important part of forensic science because it can help find the
age, sex, lifestyle and diet of the person thousands of years ago. In criminal investigation, it can
show what type of weapon the victim was killed with and other physical injuries inflicted in the past.
• Forensic Anthropologist- they are involved in a wide range of aspects of crimes and
disasters involving human deaths.
-
They study the living, identifying individual perperators from surveillance
tapes, determining the age of individuals to define their culpability for their
crimes, and determining the age sub- adults in confiscated child pornography.
- They are trained to evaluate and recognize how environmental conditions alter
appearance and composition of bone over the span of time since death.
• Forensic Archaeology- it involves the controlled collection of human remains.
• Forensic Osteology- the study of the skeleton.
• Forensic Taphonomy- it involves the study changes to the body after death, including
decomposition and environmental modification.
• Forensic Pathologist- specially trained to perform autopsies to determine the presence or
absence of disease, injury or poisoning: to evaluate historical and law- enforcement investigative
information relating to manner of death; to collect medical evidence such as trace evidence and
secretions.
• Scene of the crime Mapping- sometimes known as Forensic Archaeology, because it
involves using archaeological techniques to recover information at crime scene.
• Search and recovery of remains- fragmented human remains are difficult for non- specialist
to identify in the field.
• Special identification- mass events often include other life forms.
• Post-mortem interval- determining how long ago the death occurred.
• Taphonomy- refers to what kinds of weathering events have affected the remains since the
death
• Trauma analysis- identifying the cause and manner of death.
• Pathologies of the deceased- what kinds of things did the living person
suffered from.
• Positive Identification of Human remains
• Acting as expert witnesses in court cases.
FORENSIC ODONTHOLOGY
A REPORT IN FOREN 2
Submitted to
SUBJECT INSTRUCTOR
Submitted by
Anne Marie Shane Bandiola
Janyl Marie Odiada
John Rex Arzaga
Kent Daryl Jamelarin
Noeme Joy Arnaiz
Shaira Pagayonan
Shannen Cordero
Vince Pactao-in
2nd Year - Alpha
April 21, 2022

FORENSIC ODONTOLOGY
Teeth are the most indestructible part of the human body. They survive not only after death
but remain unchanged for many thousands of years. Also can be used as a weapon of attack or
defense under certain circumstances may leave information as to the identity of the biter. Human
teeth and dental restorations have proven to remain stable
during a long time as well as in extreme situations such as fire.
HISTORY OF ODONTOLOGY
The evolution of forensic odontology started right back
in the Garden of Eden. According to the Old Testament, Eve
convinced Adam to put a bite mark in apple. It was told that “It
is always tempting to suggest that the history of bite mark
evidence (forensic dentistry) began with the eating of
forbidden fruit in the Garden of Eden.” But the dentist or
forensic odontologist were rare at that time. There is no record
of events, comparisons or analysis, and it is in addition there
were a limited number of suspects and the suspects reportedly confessed.
❖ 66 AD- Well-documented evidence to the use of teeth for identification began 66 AD with
Agrippina and Lollia Pauline case. It was the first use of dental identification where there
is a record.
❖ 1193- The first forensic identification in India started in were Jai Chand, a great Indian
monarchy was destroyed by Muhammad’s army and Jai Chand, Raja of Kanauji was
murdered and he was identified by his false teeth.
❖ It was used in the identification of Adolf Hitler and his wife Eva Brawn at the end of World
War II.
❖ 1453- first formally reported case of dental identification was that of the 80 years old
warrior John Talbot, Earl of Shrews bury, who fell in the battle of Castillon.
❖ 1758- Peter Halket was killed in during French and Indian wars in a battle near Fort
Duquesne. Halket son identified his father’s skeleton by an artificial tooth.
❖ 1870, Ansil L Robinson was charged with the murder of his mistress; Mary Lunsford.
Evidence against Robinson included an attempt to match his teeth to the bite marks on the
victim’s arm.
❖ Wayne Clifford Boden was a Canadian serial killer and rapist active from 1969-1971. He
earned the nickname “the Vampire Rapist” because he had the penchant of biting the
breasts of his victims, a method of operation that led to his conviction due to forensic
odontological evidence.
❖ Early in 1775 Revere constructed a silver wire fixed bridge for
his close friend Dr. Joseph Warren, a medical practitioner. At
the outset of the war, Warren refused the appointment of
surgeon-in-chief to the continental army. Instead, he requested
the rank of a line officer; Unfortunately, Warren was killed by a
bullet that pierced his skull in the Battle of Bunker Hill.
❖ 1776- At the battle for Breed’s Hill in Boston, Dr. Joseph Waren was killed in the year
1776. His face was not able to identify as he suffered from a fatal head wound. A dentist,
Paul Revere, identified Dr. Warren, dead body by a small denture that he had fabricated
for him.
❖ In 1897 a paper entitled, “The role of the Dentists in the identification of the victims of the
catastrophe of the Bazar de la Charite, Paris and 4th May, 1897”, was presented by Dr.
Oscar Amoedo (Professor of the dental school in Paris) at the international Medical
Congress of Moscow. The bazar, at which the wealthy women
of Paris annually raised money for projects for the poor, was
destroyed within 10 minutes and 126 persons lost their lives.
❖ Dr. Oscar Amoedo was considered as the father of the forensic

odontologist. The thesis done by him entitled ‘L’ Art Dentaire
en Medicine Leagale’ in 1898 to the faculty of medicine earned
him a doctorate. This book is the first comprehensive text on
forensic odontologist.
❖ The first forensic odontologist in the United States was Dr. Paul
Revere who identified the extreme body of Dr. Joseph Warren
through a bridge of silver and ivory that he had constructed two years previously.
❖ 1937 in Chantilly, a murder was convicted on the evidence of the bite marks that the victim
inflicted during her struggle for life.
❖ The fire on board the “Scandinavian Star” was one of the world’s worst ferry disasters.
Dental identity could be established in 107 cases (68%).
❖ Sager case involved the murder of a 14 year old girl. The state’s evidence included
comparison by forensic odontologists, of bite marks on the victim’s body to the defendant’s
dentition. After a painstaking review of voluminous legal and dental authorities, the
Missouri court determined that the science of positive bite mark identification has reached
the level of scientific reliability and credibility to permit its admission as evidence in
criminal proceedings.
❖ Forensic odontologists successfully identified tsunami victims in South-East Asia in

December 2004; more than 92% of the non-Thai victims have been identified, out of
which about 80% were identified by dental information. This high success rate of dental
identification in Thailand was a matter of surprise for many forensic experts.
❖ The famous Iroquois theatre in Chicago was burned in 1903 and for about 602 of the 1,842
patrons was died in the theatre. But no records of the identification are found today. But,
Dr. Cigrant quoted in his article that hundreds were unmistakably identified from the dental
records.
❖ First work in facial reconstruction was done by Kollman and Buchley. The technique that
is proposed by Kollmen and Buchely is still used with modification today. Although
computerized methods are gaining interest today. Belty Pat Gatliff of Oklahoma has trained
a number of forensic dentists in facial reconstruction techniques
DEFINITION OF FORENSIC ODONTOLOGY

❖ Forensic Odontology, also known as Forensic Dentistry or Bite Mark Evidence
Expertise, is the application of dental knowledge to the understanding of laws. Some of
the work a Forensic Odontology is involved in is: identification of bite marks on the
victims of attack.
❖ Forensic Odontology a branch of science uses the skills of the dentist in personal
identification during mass calamities, sexual assault and child abuse to name a few.
❖ Forensic Odontology is the application of dentistry to the investigation of crime and

medicolegal investigations. It has its main applications in the identification of corpses
and human remains and in bite mark analysis.
SCOPE OF FORENSIC ODONTOLOGY

The major area of activity of forensic odontology is the identification of human beings,
either dead or alive. This is more so in case of mass disaster, where the corpse is usually badly
mutilated. Other areas of application include criminalistics, in cases involving abuse of children
and elderly. Bite marks also help in detection of culprits. It also renders its service in probing of
dental malpractice, archeology etc.
The scope of forensic dentistry is broad & ever-challenging. Each case is different & even the
seemingly routine case may test the dentist’s ingenuity in applying his dental knowledge.
❖ Identifying human unknown remains through dental records and craniofacial bones
❖ Age estimation of both the living and deceased
❖ Recognition and analysis of bite marks found on victims
❖ Determining the unidentified individual
❖ Presenting evidence in court as expert witness
IDENTIFICATION UNKNOWN REMAINS

Dental identification plays an important role when identification of remains of deceased
person is skeletonized, decomposed, burned or dismembered and is invalid by visual or fingerprint
methods. The identification of remains by dental evidence is possible because, the hard tissues are
preserved after death and can even withstand a temperature of 1600 degree C when heated without
appreciable loss of microstructure, and the status of a person’s teeth change throughout the life
and the combination of decay, missing, filling can be obtained from any fixed time.
According to American board of forensic odontology dental identification can be divided
into four types:
❖ Positive identification- The ante-mortem and postmortem data match to establish that
it is from same individual.
❖ Possible identification- The ante-mortem and postmortem data have few consistent
features, but because of quality of the records it is difficulty to establish the identity.
❖ Insufficient evidence- The data is not enough to from the conclusion.
❖ Exclusion- The ante-mortem and postmortem data clearly inconsistent.
Steps in Forensic Odontology

One of the first things they'll do is obtain a saliva sample from the bite. This, of course, can
be done by others, but a forensic dentist can make sure sample extraction doesn't affect quality of
the bite mark. Next, the forensic dentist will take photographs.
This is a technique shared by all experts, and it's fairly important to get the lighting, color,
and camera angle right. A linear scale should be placed somewhere in the photograph. A camera
angle of 90 degrees is best for a flat surface, while a 40 degree angle causes 25% distortion of a
bite mark.
Next, the forensic dentist makes multiple impressions, casts, or molds of the bite mark, and
has access to a variety of materials in which to choose the right gum, rubber, plastic, or powder to
make a cast. Some forensic dentists used the so-called Dorion method, which advocates the
removal of bitten tissue for microscopic examination.
Others use advanced techniques such as scanning electron microscopy, computer-enhanced
digitization, and xeroradiology. Computerized bite analysis software also exists. Once a suspect is
apprehended, the forensic dentist makes one or more impressions of the suspect's teeth, comparing
them to the recorded bite marks, and if called to testify, renders an opinion of the probability of a
match.
Courts have upheld the constitutionality of involuntarily taking a dental impression from a
suspect, as they have for most biological specimens from the suspect.
AGE ESTIMATION BASED ON DENTAL DATA

Dental ageing technique can be broken down into two categories.
❖ Developmental changes: Developmental changes that occur to the human dentition
while the teeth are growing and emerging into the oral cavity.
✓ HARD TISSUE FORMATION- In this method, each tooth is scored based on
its developmental stage and scores are compared with values corresponding to
a particular age.
✓ DENTAL ERUPTION- To assess the age of unknown individual, we can
compare the postmortem radiographs of the individual to the eruption
standards produced by the Schour and Massler.
✓ THIRD MOLAR ERUPTION- Third molar emergence tends to be around 17-
19 years of age.
✓ DENTAL MEASUREMENT- This technique was an alternative to the
qualitative assessment where the length of tooth was measured
❖ Degenerative changes: That occur once the teeth have erupted and begin to wear
down. There is an intuitive connection between tooth wear and age, as those with
more wear tend to be older.
Bite Marks Identification, Comparison or Analysis

Bite marks are something else Forensic Odontologist look at. The specific areas of bite
marks would be : the distance from cuspid to cuspid, the shape of the mouth arch, the evidence of
a tooth out of alignment, teeth width and thickness, spacing between teeth, missing teeth, the
curves of biting edges, unique dentistry, and wear patterns such as chips or grinding. The amount
and degree of detail recorded in the bitten surface may
vary from case to case.
Human and animal teeth both leave

conspicuous marks. In the flesh, they leave behind
noticeable bruises or puncture marks and in soft foods,
such as fruit, marks are also preserved. In situations
where sufficient details are available, it may be
possible to identify the biter to the exclusion of all
others.
Perhaps more significantly, it is possible to
exclude suspects that did not leave the bite mark or marks. The skin is elastic, tending to slip along
the upper teeth until it catches hold. Depending upon the type of victim, some bite marks last for
hours and others for days, but almost all bite marks alter themselves as time elapses.
Photographing bite marks at intervals over a set period of hours or days is part of the
standard protocol recommended by the ABFO. Bite marks also change or become distorted when
the posture of the victim changes, so the forensic dentist might be able to assist with determination
of how the perpetrator moved the body
SEX DETERMINATION
Sex determination is very important subdivision of forensic odontology, which plays a
major role in identification of the unknown individuals in natural disasters; chemical and nuclear
bomb explosion scenarios
It can be done by four methods:
❖ Sex difference in tooth dimension: Sex determination by measuring mesiodistal and
buccolingual dimensions is most simple and reliable method for sex determination.
Both the dimensions are more in male than in female.
❖ Tooth morphology: In male, the distal accessory ridge in canines is more prominent
than in female. In female, there is less number of cusps in mandibular first molar
(distobuccal or distal). These features can be because of evolutionary reduction in the
female lower jaw size.
❖ Bite marks may be found on the flesh of victims of a violent attack, particularly on the
stomach, breast or buttocks. Alternatively they may be found on the suspect, left by
victim during self-defense. If a bite mark is only represented as a bruise, it is often
extremely difficult to detect any individual characteristics.
❖ The bite mark is defined as the physical alteration in or on a medium caused by the
contact of teeth. In few of criminal cases it is seen that suspect or victim has left his
or her teeth marks on another person or inanimate object. The concept of bite mark
evidence is interesting and is there from Roman times.
• In more aggressive bites -The assailant may suck the soft tissues into the mouth so
that images of palatal and incisal surfaces of teeth may appear. Bites show
laceration of tissue and petechial hemorrhage’s in the center of the wound.
• In less aggressive bites -the skin may not be completely penetrated so there can be
oval mark mostly of anterior teeth.
❖ Bite marks change over a time on living as well as dead. If the bite is on living person
there will be post injury changes in the tissue, where bleeding, swelling and
discoloration can be seen. If the bite is on dead Person, then photographs of marks are
taken with standardized technique.
Lip Prints Analysis, Identification or Comparison

Study of lip prints is termed as “cheiloscopy.” Lip prints are said to be permanent and
unchangeable. Identification of pattern is possible from 6th week of intrauterine life. These can
serve as important evidence left at crime scene.
Disadvantages are major trauma to lips result in scarring. Surgical treatment also affects
the size and shape of lips. Prints may differ in appearance depending on pressure applied or
direction.
Forensic dentists use several different terms to describe the type of bite mark:
❖ Abrasion - a scrape on the skin
❖ Artifact - when a piece of the body, such as an ear lobe, is removed through biting
❖ Avulsion - a bite resulting in the removal of skin
❖ Contusion - a bruise
❖ Hemorrhage - a profusely bleeding bit
❖ Incision - a clean, neat wound
❖ Laceration - a puncture wound
In addition, there are several different types of impressions that can be left by teeth,
depending on the pressure applied by the biter. A clear impression means that there was significant
pressure; an obvious bite signifies medium pressure; and a noticeable impression means that the
biter used violent pressure to bite down.
❖ Forensic dentistry or forensic odontology is the handling, examination and evaluation of
dental evidence in criminal justice cases. Forensic dentists are involved in assisting
investigative agencies to identify recovered human remains in addition to the identification
of whole or fragmented bodies.
❖ Forensic Odontology is the application of dental evidence to both criminal and civil law.
This can include identifying sexual abuse; personal identification of the deceased,
especially in cases of mass disaster or when facial recognition is inconclusive; or in
determining ages of unidentified victims.
DNA PROFILING
A REPORT IN FOREN 2
Submitted to
MRS. SHARON P CORDERO
SUBJECT INSTRUCTOR
Submitted by
Allan David Naranjo
Gerard Cabrejas
Joshua Guanzon
Rommel Magsipoc
Marie Mar Cogtas
Devi Jean Narciso
Frank Ian Casiano
Nhora Mae Berdin
2-Alpha
April 19, 2022
DNA Profiling
Objectives;
✓Know the value of DNA fingerprinting as means of personal identification.
✓Trace the historical events in DNA Profiling
✓Understand the procedure to create DNA Fingerprinting, the Profiling Process, and the DNA Profiling
Applications
Introduction
DNA, or deoxyribonucleic acid, is a complex molecule that contains all the information necessary
to build and maintain an organism. It is the hereditary material. Every cell in the human body has the
same DNA. The information of DNA is stored as a code constituted by four
nitrogenous bases: Adenine (A), Thymine (T), Cytosine (C) and Guanine (G). The
order or sequence of these bases determines the information available for
building and maintaining an organism. The human genome size is about 3,107
mega bases (Mb) but only about 1.2 percent of the total genome encodes for
proteins, this is around 20,000 genes, while 98.8 percent is noncoding DNA2,3,
which means that do not encode proteins. Within this group we have, for example,
a variable number of tandem repeats (VNTR), which are repeated sequences of
9 to 100 base pairs that play a key role in the elaboration of DNA fingerprinting.
Knowing the main DNA characteristics, specificity is the key to the emergence of DNA analysis.
Numerous other techniques used to determine biological markers, such as HLA and blood group
substances, have been successfully applied for identification purposes. All are based on exclusion, where
markers are tested until a difference is found. Other factors favoring DNA analysis include the small
sample requirement, the ability to rapidly replicate a sequence a million fold or more in vitro, and the
relative stability of DNA. The point is that DNA analysis alone can be a definitive test.
Once the technique becomes routine, there is little doubt that, provided a suitable specimen can
be obtained, DNA fingerprinting will be the single best test for excluding a falsely associated individual.
DNA Profiling is also called DNA fingerprinting which is the process of determining an individual’s
DNA characteristics. DNA analysis intended to identify a species, rather than an individual, is called DNA
barcoding. DNA profiling is a forensic technique in criminal investigation, comparing criminal suspects’
profiles to DNA evidence so as to assess the likelihood of their involvement in the crime.
It is also used in parentage testing, to establish immigration eligibility, and in genealogical and
medical research. DNA profiling has also been used in the study of animal and plant populations in the
fields of zoology, botany, and agriculture. DNA profiling is the process where a specific DNA pattern,
called a profile, is obtained from a person or sample of bodily tissue. Even though we are all unique, most
of our DNA is actually identical to other people’s DNA.
However, specific regions vary highly between people. These regions are called polymorphic.
Differences in these variable regions between people are known as polymorphism. Each of us inherits a
unique combination of polymorphism from our mother. DNA polymorphism can be analyzed to give DNA
profile. Human DNA profiles can be used to identify the origin of a DNA sample at a crime scene or test
for parentage.
DNA profiling is used to:
Identify the probable origin of a body fluid sample associated with a crime or crime scene
Revel family relationships
Identify disaster victims, for example, ESR scientists travelled to Thailand to help identify victims of the
00 Boxing Day Tsunami.
History of DNA Fingerprinting

DNA profiling first started out in the80s, and it has
been extremely successful for testing in crime scene,
paternity testing, and predisposition to disease. The
polymerase chain reaction or PCR, was invented by Kary
Mullins in the United Kingdom, and in 1986, Dr. Alec Jeffreys
made genetic fingerprinting available to the public. In 1986
was when DNA was first used in a criminal investigation by
Dr. Jeffreys.
The investigation used genetic fingerprinting in a case

of two rapes and murders that had happened in 1983 and
1986. These crimes happened in a small town called Leicestershire, which is located in the United
Kingdom. They collected fingerprints and connected them with semen stains collected from where the
raping and murders were located. Then in 1987, DNA evidence was first used in the United States on
Florida, rapist man, Tommie Lee Andrews. After using DNA evidence in his case, he was then sentenced
to 22 years in prisons for the rapes that he had committed.
Dr. Jeffreys also made it available for people to preform identity tests. Since the 1980s, DNA testing
had just become a popular way of finding out things through people’s DNA. However, the FBI did not start
using DNA testing until 1998, but it can become very helpful to those who need to find out something in
that area. Thousands of different cases have been cracked and many innocent people have been freed
jail or prison because of the use of DNA provided by family.
Although 99.9%of human DNA sequences are the same in every person, enough of the DNA is
different that it is possible to distinguish one individual from another, unless they are monozygotic
(identical) twins. DNA profiling uses repetitive sequences that are highly variable, called variable tandem
repeats (VNTRs), in particular short tandem repeats (STRs), also known as microsatellites, and
minisatellites. VNTR loci are similar between closely related individuals, but are so variable that individuals
are unlikely to have the same VNTRs.
In India DNA fingerprinting was started by Dr. VK Kashyap and Dr.

Lalji Singh was an Indian scientist who worked in the field of DNA
fingerprinting technology in Indian, where he was popularly known as the
“Father of Indian Fingerprinting”.
1980, Wyman and White laid the foundations for the concept based on the
observation of a polymorphic DNA locus characterized by a number of variable-length restriction
fragments called restriction fragment length polymorphisms (RFLPs), which are specific sequences where
restriction enzymes cleave the DNA.
1985 with the paper “Hypervariable Minisatellite Regions in Human DNA” written by Alec Jeffreys. Jeffreys
and his coworkers were analyzing the human myoglobin gene when they discovered a region consisting
of a 33-base-pair sequence repeated four times. This tandem repeat was referred to as a minisatellite
and similar regions as hypervariable because the number of tandem repeats is variable both within a
locus and between loci.
1987, Nakamura coined the term variable number of tandem repeats (VNTR) to describe individual loci
where alleles are composed of tandem repeats that vary in the number of core units. When DNA is
isolated, cleaved with a specific enzyme, and hybridized under low-stringency conditions with a probe
consisting of the core repeat, a complex ladder of DNA fragments is detected. This profile appears to be
unique to each individual. Different core repeats were later isolated and used to produce a number of
different probes useful for fingerprinting. For that time, this technique was unknown but its potential was
evident.
DNA fingerprinting had its first application in 1985 in a case of parentage testing, actually a maternity test,
with paternal DNA unavailable.
In this unusual case, a mother with her little 13 years old son were arrested in the airport when they arrived
in England from Ghana because the authorities thought that he was not her son. A DNA fingerprinting
applied to both demonstrated that, effectively, they told the truth.
The first application of DNA fingerprinting in forensic identification happened later that same year, in a
case that beautifully exemplifies the power of DNA evidence to link crime-scenes, to exclude suspects,
and to support convictions. A suspect was arrested for allegedly committing a double rape and suicide to
2 minors. A DNA fingerprinting using a sample of semen left in the crime scene demonstrated that a man
had been responsible for both crimes but it was not the arrested suspect. He was released and the real
culprit was arrested. Nowadays, this technique is still used to create DNA profile of each individual in
order to clarify some crimes or parentage testing.
What is DNA fingerprinting?

DNA Fingerprinting is the technology which is used to identify individuals on the basis of the
molecular characteristics of the DNA. More specific, this method uses VNRT because the number of
bases and repeats within a locus is unique to each individual. For example, an individual can have in his
genome the sequence gatagata and this repeats 10 times and another can have the same sequence but
only repeats 5 times.
The technique is used, as we have seen before, in parentage testing and forensic cases but it can
be used for anthropological genetics, zoology, and botany among others disciplines. Importantly, the
technique of DNA Fingerprinting is very sensitive, which means that it can also generate data even from
half (partially) decomposed biological material.
Procedure to create a DNA fingerprinting.

The steps involve others techniques used in Molecular
Biology, such as polymerase chain reaction (PCR) and
electrophoresis among others. The following are the steps to
generate a DNA fingerprinting;
The DNA is extracted from the nuclei of any cell in the body.
The DNA molecules are broken with the help of enzyme
restriction endonuclease (called chemical knife) that cuts
them into fragments. The fragments of DNA also contain the
VNTRs.
The fragments are separated according to size by gel electrophoresis in agarose gel.
The separated fragments of single-stranded DNA are transferred onto a nylon membrane. Radioactive
DNA probes having repeated base sequences complementary to possible VNTRs are poured over the
nylon membrane. Some of them will bind to the single-stranded VNTRs. The method of hybridization of
DNA with probes is called Southern Blotting.
The nylon membrane is washed to remove extra probes.
An X-ray film is exposed to the nylon membrane to mark the places where the radioactive DNA probes
have bound to the DNA fragments. These places are marked as dark bands when X-ray film is developed.
This is known as autoradiography.
The dark bands on X-ray film represent the DNA fingerprints (DNA profiles).
PROFILING PROCESS
The process, developed Glassberg and independently by Jeffreys, begins with a sample of an
individual’s DNA (typically called a “reference sample”). Reference samples are usually collected through
the buccal swab. When this is unavailable (for example, when a court order is needed but unobtainable)
other methods may be needed to collect a sample of blood, saliva, semen, vaginal lubrication or other
fluid or tissue from personal use item (for example, a toothbrush, razor) or from stored samples (for
example, banked sperm or biopsy tissue). Samples obtain from blood relatives can indicate an individual’s
profile, as could previous profile human remain.
A reference sample is then analyzed to create the individual’s DNA profile using one of the
techniques discussed below. The DNA profile is then compared against another sample to determine
whether there is a genetic match.
DNA Fingerprinting Applications

Since Alec Jeffreys developed the DNA fingerprinting technique, it has been used in different
scientific fields. In forensic investigations has helped to send to prison criminals, and identify victims of
crimes, natural disaster, wars. Paternity disputes have been resolved thanks to this method.
Moreover, disciplines as anthropological genetics, zoology, and botany among others have driven
profiling research in order to interpret the origin and behavior of some species. In the next lines, we are
going to describes how the technique has been applied and evolved in the areas mentioned above.
DNA EXTRACTION
DNA Extraction is a process of purification of DNA from sample using a combination of physical and
chemical methods?
When a sample such as blood or saliva is obtained, the DNA is only a small
part of what is present in the sample. Before the DNA can be analyzed, it must
be extracted from the cells and purified. These are many ways this can be
accomplished, but all methods follow the same basic procedure. The cell and
nuclear membranes need to be broken up to allow the DNA to be free in solution.
Once the DNA is free, it can be separated from all other cellular
components. After the DNA has been separated in solution, the remaining
cellular debris can then be removes from the solution and discarded, leaving
only DNA.
The most common methods of DNA extraction include organic extraction (also called phenol chloroform
extraction), Chelex extraction, and solid phase extraction. Differential extraction is modified version of
extraction in which DNA from two different types of cells can be separated from each other before being
purified from the solution.
Each method of extraction works well in the laboratory, but analyzed typically selects their preferred
method based on factors such as the cost, the time involved, the quality of DNA yielded, and the quality
of DNA yielded. After the DNA is extracted from the sample, it can be analyzed, whether it is by RFLP
analysis or quantification and PCR analysis.
RFLP (RESTRICTION FRAGMENT LENGTH POLYMORPHISM) ANALYSIS
The first methods for finding out genetics used for DNA
profiling involved RFLOP analysis. DNA is collected from
cells and cut into small pieces using a restriction enzyme
(a restriction digests). This generates DNA fragments of
differing sizes as a consequence of variations between
DNA sequences of different individuals. The fragments are
then separates on the basis of size using gel
electrophoresis.
The separated fragments are then transferred to a
nitrocellulose or nylon filter; this procedure is called a Southern Blot. The DNA fragments within the blot
are permanently fixed to the filter, and the DNA strands are denatured. Radiolabeled probe molecules are
then added that are complementary to sequences in the genome that contain repeat sequences. These
repeat sequences tend to vary in length among different individuals and are called variable number
tandem repeats sequences or VNTRs.
The probe molecules hybridize to DNA fragments containing the repeats sequences and excess
probe molecules are washed away. The blot is then exposed to an X-ray film. Fragments of DNA that
have bound to the probe molecules appear as fluorescent bands on the film.
The Southern blot techniques requires large amounts of non-degraded sample DNA. Also Karl Brown’s
original techniques looked at many minisatellite loci at the same time, increasing the observe variability,
but making it hard to discern individual alleles (and thereby precluding paternity). These early techniques
have been supplanted by PCR-based assays.
POLYMERASE CHAIN REACTION (PCR) ANALYSIS

Develops by Kary Mullins 1983, a process was reported by which specific portions of the sample DNA
can be amplified almost identify (Saiki et al. 1985, 1985). The process polymerase chain reaction PCR,
mimics the biological process of DNA replication, but confines it to specific DNA sequence of interest.
With the invention of the PCR technique, DNA profiling took huge strides
forward in both discriminating power and the ability to recover information
from very small (or degraded) starting samples.
PCR greatly amplifies the amount of a specific regions of DNA. In the PCR
process, the DNA sample is denaturing into the separate individual
polynucleotide strands through heating. Two oligonucleotide DNA primers are
used to hybridize to two corresponding nearby sites on opposite DNA strands,
in such a fashion of the normal enzymatic extension of the active terminal of
each primer (that is, the 3’ end) leads toward the other primer.
PCR uses replication enzymes that are tolerant of high temperatures, such as the thermostable
tag polymerase. In this fashion, two new copies of the sequence of interest are generated. Repeated
denaturation, hybridization, and extension in this fashion produce an exponentially growing number of
copies of the DNA of interest.
Instrument that perform thermal cycling are readily available from commercial sources. This
process can produce a million-fold or greater amplification of the desired region in 2 hours or less.
SHORT TANDEM REPEATS (STR) ANALYSIS

One of the current techniques for DNA profiling uses polymorphism called short tandem repeats. Short
tandem repeats or STR are regions of non-coding DNA that contain repeats
of the same nucleotide sequence. For example,
GATAGATAGATAGATAGATAGATA is an STR where the nucleotide
sequence GATA is repeated six times.
STRs are found at different places or genetic loci in a person’s DNA.
AMPLIFIED FRAGMENT LENGTH POLYMORPHISM (AFLP)

Another technique, AFLP or amplified fragment length polymorphism was also put into practice during
the early 1990s. This technique was also faster than RFLP analysis and use PCR to amplify DNA samples.
It relied on variable number tandem repeat (VNTR) polymorphisms to distinguish various alleles, which
were separated on a polyacrylamide gel using allelic ladder (as opposed to a molecular weight ladder).
Bands could be visualized by silver staining the gel. One popular
focus for fingerprinting was the D1S80 lucos. As with all PCR based
methods, highly degrade DNA or very small amounts of DNA may
cause allelic dropout (causing a mistake in thinking a heterozygote is a
homozygote) or other stochastic effects.
In addition, because the analysis is done on a gel, very high

repeats may bunch together at the top of the gel, making it difficult to
resolve. AmpFLP analysis can be highly automated, and allows for easy
creation of phylogenetic trees based on comparing individual sample of
DNA. Due to its relatively low cost and ease of set-up and operation.
AmpFLP remains popular in lower income countries.
Forensic Investigations
Famous Crime T.V shows as CSI, Bones and others have popularized this technology. To
summarize the methodology, genetic material like blood, semen, saliva, hair and skin found at the crime
scene are processed, and afterward the samples are compared with the DNA of the suspects, in order to
determine guilt or innocence of the accused.
DNA fingerprinting markers have evolved since 1984. In the beginning, sets of minisatellites or
oligonucleotides stretches were used, also called multi-locus probes (MLP) which detected sets of 15 to
20 variable fragments per individual ranging from 3.5 to 20 kb in size. Minisatellites were replaced
because they needed a large amount of molecular weight of DNA, usually not found at the crime scene
and errors in the linkage between loci.
For this reason, was changed by single locus probe (SLP) which recognized single hypervariable
locus, using high stringency hybridization and just 10 ng of DNA8. Multilocus and Single Locus probes
were part of the so called restriction fragment length polymorphism (RFLP) - based methods were still
limited by the available quality and quantity of the DNA. Those procedures were replaced by PCR based
methods because they improved sensitivity, speed, and genotyping precision.
PCR-based methods use microsatellites as markers instead of minisatellites; microsatellites as

short tandem repeats (STRs) are more sensitive and less prone to allelic dropout than VNTR (variable
number of tandem repeat) systems8.
In cases, when there exist a low proportion of nuclear DNA samples, lineage marker is used which
are obtained from mitochondrial and Y DNA, and they are very useful to reconstruct the paternal and
maternal relationship and historical reconstruction in unidentified remains typically skeletonized, hair
shafts without roots, or very old specimens where only heavily degraded DNA is available likewise
samples of sexual assault without ejaculation, sexual assault by a vasectomized male, male DNA under
the fingernails of a victim, male ‘touch’ DNA on the skin.
Parentage Testing
DNA fingerprinting is an advantageous technique in cases, such as, of establishing the paternity
of disputed offspring or cases of baby swapping. This method replaced ABO blood antigen systems which
cannot establish paternity but can conclusively exclude an alleged father from being a candidate.
Disputed paternity originates because of affiliation orders, divorce proceedings and questioned the
legitimacy, also is used to discover paternity in cases of inheritance, guardianship, maintenance,
legitimacy, adultery or fornications.
In Parentage testing, a DNA comparison is performed between progeny against potential parents.
Children inherit half of their alleles from each parent and thus should possess an alleles combination of
their parents.
Anthropological Genetics
In Anthropological Genetics, markers have been used as ancestry informative markers to
reconstruct the human diaspora and to interpret the evolutionary history of human populations to inquire
population origins, migration, admixture and adaptation to different environments, as well as susceptibility
and resistance to disease.
The main markers used by anthropological genetic are variable number tandem repeats (VNTRs),
short tandem repeats (STRs), mitochondrial DNA hallo groups, Y-specific non-recombining region (NRY)
haplotypes, and single nucleotide polymorphisms (SNPs).
In the medical field, researchers have made possible the mapping quantitative trait loci involved in
biological pathways of diseases such as diabetes mellitus, cancers, obesity, osteoporosis, and coronary
heart disease. In the studies of population, markers allow identifying the presence, absence, or high
frequency in some populations and low frequencies in others, of certain genetic traits that characterize
some specific population11.
Botany
DNA fingerprinting is an essential tool for genotype identification in both wild plant and cultivated
species. DNA profiling is used for protection of biodiversity, identifying markers for traits, identification of
gene diversity and variation. Identification in plants always been an issue for botanists because of the
large variability of the composition and relative amount of chemicals in particular species of the plant
varies with growing condition, harvesting period, post-harvesting period and storage conditions.
Due to large variability, DNA fingerprinting technique uses several types of markers for example,
Inter Simple Sequence Repeat (ISSR), Random Amplification Polymorphic DNA (RAPD)/Arbitrary Primed
PCR, Amplified Fragment Length Polymorphism (AFLP), DNA Amplification Fingerprinting (DAF), Simple
Sequence Repeats (SSR), Sequence Characterized Amplified Region (SCAR), Cleaved Amplified
Polymorphic Sequence (CAPS) and Single Nucleotide
Polymorphism (SNP).
DNA markers help to study fundamental evolutionary

influences of natural selection, mutation, gene flow and
genetic drift on wild plant populations and identify groups are
characterized by highly variable ploidy levels, often even
within the same species. Moreover, the method detects both
ancient and ongoing hybridization between crops and wild
species.
Zoology
In Zoology, DNA fingerprinting determine the genetic
identity of individuals and measure genetic variation in
natural populations, allowing true genetic relationships
among individuals to be determined, rather than them being inferred from field observations. Furthermore,
it helps to test predictions of kin selection models in a realistically way, and detect hybrids species.
The DNA marker clarified mating system in reproductive ecology for example in vertebrates that
give birth to more than one offspring has revealed concurrent multiple paternities. This kind of behavior
has been observed in a wide range of organisms, particularly in reptiles.
DNA microsatellites have been useful tools describing population connectivity, isolation, and the
particulars of inter-population gene flow, also now they are being used to document levels of genetic
variation in rare and endangered species and thus better inform conservation management actions.
What is a DNA profile?

One way to produce a DNA profile, is for scientists to examine STRs at 10 or more genetic loci. These genetic loci are usually
on different chromosomes.
A DNA profile can tell the scientist if the DNA is from a man or woman, and if the sample being tested belongs to a
particular person.
How do you create a DNA profile using STR?
1. Get a sample of DNA
DNA is found in most cells of the body, including white blood cells, semen, hair roots and body tissue. Traces of DNA can
also be detected in body fluids, such as saliva and perspiration because they also contain epithelial cells. Forensic scientists
and Police officers collect samples of DNA from crime scenes. DNA can also be collected directly from a person using a
mouth swab (which collects inner cheek cells).
2. Extract the DNA
DNA is contained within the nucleus of cells. Chemicals are added to break open the cells, extract the DNA and isolate it
from other cell components.
3. Copy the DNA
Often only small amounts of DNA are available for forensic

analysis so the STRs at each genetic locus are copied many
times using the polymerase chain reaction (PCR) to get enough
DNA to make a profile.
Specific primers are used during PCR that attach a fluorescent

tag to the copied STRs.
4. Determine the size of the STRs
The size of the STRs at each genetic locus is determined using a genetic analyser. The genetic analyser separates the copied
DNA by gel electrophoresis and can detect the fluorescent dye on each STR. This is the same piece of equipment used in
the lab for DNA sequencing.
5. Is there a match?
The number of times a nucleotide sequence is repeated in each STR can be calculated from the size of the STRs. A forensic
scientist can use this information to determine if a body fluid sample comes from a particular person.
If two DNA profiles from different samples are the same, the chance that the samples came from different people is low.
This provides strong evidence that the samples have a common source.
To produce a DNA profile, scientists examine STRs at ten, or more, genetic loci. These genetic loci are usually on different
chromosomes.
A REPORT IN FOREN 2
Submitted to
SUBJECT INSTRUCTOR
Submitted by:
SANCADA, REYNIE
ABEJO, JEREMY
BARAYOGA, JOHN ELVIN
MAAMBONG, MARK STEVEN
CADUNGON, CLAUDE VAN
JOMADIAO, JOHN MARK
CATIDAS, JAY ALDRIN
GRUY, LEONY
DULALIA, BRITNEY JANE
April 21, 2022
Learning Objectives:
At the end of the lesson, the students should be able to understand;
✓Forensic anthropology as means of identification for deceased individuals.
✓Trace the history of Forensic Anthropology according to their eras.
✓Get to know the personalities involved in the evolution of Forensic Anthropology.
✓Understand the application of Forensic Anthropology in helping solve crimes.
✓ Discover the various techniques in studying skeletal remains.
Introduction
Forensic anthropology is the application of the anatomical science of anthropology and its
various subfields, including forensic archaeology and forensic taphonomy in a legal setting. A
forensic anthropologist can assist in the identification of deceased individuals whose remains are
decomposed, burned, mutilated or otherwise unrecognizable, as might happen in a plane crash.
Forensic anthropologists are also instrumental in the investigation and documentation
of genocide and mass graves.
homicide investigators, forensic anthropologists commonly
testify in court as expert witnesses. Using physical markers
present on a skeleton, a forensic anthropologist can
potentially determine a person's age, sex, stature, and race.
This is useful in identifying living individuals for legal
purposes such as illegal immigrants. This is extremely
important in legal cases where the court needs to decide if
they will judge an individual as an adult or a minor. In addition
to identifying physical characteristics of the individual,
forensic anthropologists can use skeletal abnormalities to
potentially determine cause of death, past trauma such as
broken bones or medical procedures, as well as diseases such
as bone cancer.
The methods used to identify a person from a skeleton relies on the past contributions of
various anthropologists and the study of human skeletal differences. Through the collection of
thousands of specimens and the analysis of differences within a population, estimations can be
made based on physical characteristics. Through these, a set of remains can potentially be
identified. The field of forensic anthropology grew during the twentieth century into a fully
recognized forensic specialty involving trained anthropologists as well as numerous research
institutions gathering data on decomposition and the effects it can have on the skeleton.
Forensis (Latin- pertaining to the forum)
Anthropos (Greek- human or man)
Logia (Greek- study)

➢ Forensic anthropology applies the science of physical or biological anthropology to the
legal process. Anthropology is the study of humans, and in this forensic discipline
physical or biological anthropologists focus their studies on the human body as it relates
to explaining the circumstances of an accident or solving a crime – often homicide.
➢ Forensic anthropologists analyze human remains, typically in criminal investigations.
Their study of human remains aids in the detection of crime by working to assess the
age, sex, stature, ancestry and unique features of a skeleton, which may include
documenting trauma to the skeleton and its postmortem interval.

• 1849 Boston, Dr. John Webster murdered Dr. George Parkman because he owed
Parkman quite a bit of money. However, two
anatomists (Drs. Oliver Wendell Holmes and Jeffries
Wyman) successfully reassembled the skeletal
remains and determined that they matched the
stature, ancestry (Caucasian), and approximate age
of Dr. Parkman.
• 1894, Thomas Dwight - gave his Shattuck Lecture

about the analysis of human skeletal remains in a
legal setting. He was rightfully hailed as the "Father
of Forensic
Anthropology."

• Anthropologist Wilton Krogman - published his
book, “The Human Skeleton in Forensic Medicine”, in
1962. Forensic anthropologists use this text even today.
• 1954 by Tom McKern and T. Dale Stewart- published skeletal age changes in young
American males. Established skeletal aging techniques based on data from skeletal
remains of Korean War soldiers.

• The American Academy of Forensic Sciences (AAFS) -
established a section for forensic anthropology called the Physical Anthropology Section.
• 1980 - Dr. William Bass set up the "Body Farm" at

the University of Tennessee, Knoxville to research
human decomposition and taphonomy.
• 1986, Dr. Richard Jantz and Dr. Stephen

Ousley - developed FORDISC, a computer program
that enables forensic anthropologists to perform
metric analyses on skeletal remains based on data
from contemporary populations. The goal is to
determine sex, ancestry, and height from the
measurements.
• Dr. Clyde Snow- began training forensic

anthropologists to work on human rights
and genocide cases. The first such team was the
Argentine Forensic Anthropology Team
(EAAF).
• Dr. William R. Maples - founded the C.A. Pound Human

Fourth Era (2000 – present)

• The Ellis Kerley Foundation - was established as the first funding source solely fo
forensic anthropological research in 2000.
• 2003- JPAC was the first skeletal identification lab to obtain ASCLD-LAB (American
Society of Crime Laboratory Directors-Laboratory Accreditation Board) accreditation.
CAPHIL followed soon after.
• 13th century, medical examiners have sought to determine the causes of deaths and
to solve crimes. Given that a death can be natural, accidental, homicide, suicide, or
undetermined, forensic science has been greatly aided by developments in modern
chemistry, toxicology, and photography.
• Johann Friedrich Blumenbach - German anthropologist

in comparative human morphology, early forensic
anthropologists relied upon anthropometry (the
science of recording measurements of various parts of
the human body).

“Handbuch für Untersuchungsrichter” (1893; Criminal
Investigation) helped to establish the science of
forensics, especially in terms of a cross-transfer of evidence, such as dirt, fingerprints,
carpet fibers or hair, from the criminal to the
victim. Early in the 20th century, serological
research led to the discovery of the A, B, AB,
and O blood groups, thus increasing the
value of blood as evidence at a crime scene.
• Mid-20th century- advances in

biochemistry and technology resulted in the
discovery of unique gene markers in each person; these genetic differences allow for
the DNA fingerprinting of hair, blood, semen and tissue. Thus, DNA testing was a
major contribution to modern forensic science, though forensic anthropologists
generally do not conduct such DNA analyses and often only supply samples to be
tested. The 20th and 21st centuries have also seen substantial growth in public and
private forensic laboratories, enabling the collection and study of empirical evidence.

the human skeleton.
➢ Forensic anthropology uses the techniques of physical

anthropology to analyse skeletal, badly decomposed,
or otherwise unidentified human remains to solve
crimes.
➢ Forensic anthropologists can assess the age, sex, and

unique features of a decedent and are invaluable in
documenting trauma to the body and estimating how
long a corpse has been decomposing.
➢ Forensic anthropologists work closely with individuals

in law enforcement and medical science and especially
with specialists in ballistics, explosives, pathology, serology (the study of blood and bodily fluids) and
toxicology and are often expert witnesses in murder trials.


legal issues. There are three subsections within the field of forensic anthropology, including:
➢ a) Forensic Osteology - the study of the skeleton; b)Forensic Archeology - involves the controlled
collection of human remains; c) Forensic Taphonomy- involves the study of changes to the body
after death, including decomposition and environmental modification)

➢ Clay or graphic facial reproduction- This is
used to recreate a face from skull with the use
of soft tissue depth estimates. In manual
methods, is done by using clay, plastic and wax
directly on the victim’s skull.
➢ Scanning electron microscopy- scanning electron microscope (SEM) is a type of electron

microscope that produces images of a sample by scanning the surface with a focused
beam of electrons. The electrons interact with atoms in the sample, producing various
signals that contain information about the surface topography and composition of the
sample.
➢ Radiographic techniques- Is an imaging technique using x- rays, gamma rays, or similar

ionizing radiation and non- ionizing
radiation to view the internal form of an
object.
➢ Photo or video
superimposition techniques- The
term of photographic superimposition has been applied for a number of techniques in
forensic medicine and dentistry. The
comparison of an ante mortem photograph to
that of a skull is one such procedure. Technical
information and potential sources of difficulty
are discussed. Finally, two cases illustrate the
use and misuse of this technique in arriving at
a positive identification.
➢ The casting of skeletal materials- Skeletal remains are physical records that can help
determine the adaptations/biological features of a species or an individual. Casting
protects original materials and makes new material available for people or research.
Casting and molding are processes that duplicate fossil and also recent skeletal material.
➢ Preservation of skeletal materials using commercial preservatives- compound or

solution is used in the field for
consolidation of bone or skeleton in
order to preserve it.
➢ Thin-sectioning techniques of bone

histology- Involving hand grinding technique
has been developed to produce 20-40-un-
thick sections of bone-titanium implant sites.
➢ Rehydration and preservation of mummified or decayed soft tissues- Process and
chemical formula for rehydrating soft
tissues of mummified corpses or under an
initial process of putrefaction. And the
chemical formula for the subsequent
preservation thereof. The present
invention is novel since it includes a
process and a chemical formula which are
efficient for rehydrating the whole soft tissues present in a mummified corps, or in its
initial process of putrefaction, thus reversing the physical changes that these
phenomena had caused thereto.
Various processes used by Forensic Anthropologists:
Gas chromatography- separates chemical substances in the
body, and when used in conjunction with mass
spectrometry, which measures the mass of molecules in a
substance, can help toxicologists identify the amount of
poison in a body.
Popularized in crime television shows, forensic radiology uses x-rays, computer tomography and
MRIs to identify severely destroyed bodies and point to potential causes of death.
Ground-penetrating radar and a proton magnetometer can help

identify mass graves. Ground-penetrating radar sends radar
waves into the ground to sense the edges of graves as well as the
presence of bodies and other evidence. A proton magnetometer
can be used to detect small
changes in the Earth's magenetic field, which is particularly
useful for finding grave pits as the act of digging a grave
greatly disturbs the electromagnetic properties of the soil.
Flotation is a
process that can be
used to recover
small artifacts from
soil. The soil is
placed on a screen that water can bubble through. The soil then gets separated from other matter
like stones or bones.
GIS or (geographic information systems) is lastly used to store the

coordinates and data of excavation sites.
In addition to using common tools and equipment such as shovels,
trowels, knives and excavators to investigate sites, many teams will
also use:
Anthropometers- to measure and establish human stature
with found bones.
Boley guages- to measure teeth.
Spreading calipers to measure head length and

breadth.
Heat-sensitive infrared cameras to locate new

graves, as it can reveal images in the ground that are not
immediately visible above ground.
What Bones Can Tell Us:

Recovery
Because forensic anthropologists are familiar with the human
skeleton, their assistance is invaluable in the recovery of skeletal
remains. The most common situation where skeletal remains are
found is the surface scatter, which occurs when a body is dumped on
the ground and the remains are scattered by animals over
a wide area. The forensic anthropologist can determine at
the scene which remains are nonhuman and which are
human, saving investigators' time. If the remains are
buried, archaeological methods are used to ensure that
the amount and quality of remains recovered are of the
highest standard.
Analysis
After the remains have been recovered in the field, they usually are transported to a medical
examiner's office or other laboratory facility for examination. The remains are described as
found, and if necessary, cleaned and prepared before examination. For each set of human
remains, forensic anthropologists attempt to provide a general physical description of the
following factors:
• Gender
• Age at death
• Race
• Height
They also try to determine whether the bones provide evidence of the cause of death, to identify
any individualistic features in the skeleton, and to estimate the time since death.
Determining Sex
The human pelvis provides the most reliable means for determining the sex of skeletal remains.
The female pelvis is designed to offer optimal space for the birth canal, which is reflected in its
morphology and the relationship of its parts to each other. Although measurements may be
taken to determine the gender of the remains, an experienced anthropologist often can tell
simply by visual inspection. The skull also can be used to determine the sex of an individual. As
the female progresses from puberty to
adulthood, her skull retains many of the
prepubertal traits, such as smoothness and
gracility. The male skull, on the other hand,
exhibits more robustness and larger muscle
attachment areas, more pronounced brow
ridges, squared lower jaw, etc. If the skull
and pelvis are missing, determining the sex
may be difficult. While various
measurements and calculations are
available to estimate sex from long bones
and other parts of the skeleton,
morphology seems a more accurate feature
than size in determining sex.
Age at Death
The criteria used to estimate age at death depend on whether the individual is an infant,
subadult, or adult. In fetal and infant remains, age can be estimated based on the length of
certain bones. The most reliable means to estimate age in children is the development and
eruption of the teeth. We know the developmental pattern and mean age of eruption for each
tooth. The subadult skeleton also can provide information about the age at death. To allow for
growth, the ends and shafts of long bones are separated by cartilage plates (epiphyses). The
cartilage plates disappear and the
extremities of the various long bones
fuse at different ages. Similar
processes take place in other bones,
such as the clavicle and pelvis. By
knowing the sequence of this
epiphyseal union, we can estimate the
age of an individual. In younger adults,
I have found the degree of fusion of
the first and second sacral bodies (S1-
S2) to be useful, and the medial
clavicular epiphysis in the early
twenties. In later adulthood, one can
use changes in the pubic symphysis as
an indicator of age at death. A series of
casts is available to compare with the
unknown symphysis to estimate age.
In older adults, degenerative changes
in the spine and joints associated with
the aging process. Other methods
include microscopic aging of bone
tissue and age-related changes to the ventral ribs.
Race
The word race is an unfortunate label for the population-

based physical diversity we see in the human species
around the world. The term is widely used among the lay
public, however. Methods used to determine the race of
skeletal remains include measurements and observations
of both the skull and the postcranial skeleton. The skull,
especially the facial region, is the most diagnostic for racial
attribution. Nonmetric racial features of the skull have been
outlined by Rhine and include such features as overall
shape of the skull, shape of the nasal region, shape of the
orbits, degree of protrusion of the jaw or prognathism,
shape of the lower jaw, and certain features of the teeth,
to name a few. Cranial and facial measurements diagnostic
for race have been reported in a volume on assessing race
from the skeleton, as have postcranial methods for determining race.
Stature
The most common method to estimate living height from skeletal remains is to use equations
originally developed for this purpose by measuring the lengths of long bones of American
casualties from World War II and the Korean War. We usually measure a leg bone, such as the
femur or tibia, and use the length in the equation listed for males or females of a particular race.
The result is an estimated living stature, reported as a range, such as 66 to 68 inches. Another
method to estimate living stature is known as the anatomical method. The height of the skull is
measured, along with components of the spine, and the lengths of the leg bones, including the
ankle. To this "skeletal height" is added a correction factor for the soft tissues at the joints, scalp,
and soles of the feet. A major drawback of this method is that it requires a fairly complete
skeleton. Methods for estimating height from the spine have been reported, as have methods
for estimating stature from incomplete long bones. While these methods can be fairly accurate,
they rely on antemortem records of height for comparison. Military data indicate that men tend
to overestimate their height more than women do, and a study of heights reported on driver's
licenses also showed overestimation. We must remember that the statures we calculate from
skeletal remains are estimates.
Trauma
Trauma seen in skeletal remains falls into three categories:
1. Antemortem
2. Perimortem
3. Postmortem
Antemortem trauma includes injuries sustained during life, and evidence of healing usually exists
(Fig 2). Perimortem trauma are injuries sustained at or about the time of death, and often
contribute to the cause of death (Figs 3 and 4).
Postmortem trauma is that which is sustained after
death, usually by environmental or animal action.
Antemortem injuries, such as healed broken bones or
surgical implants may assist in identifying an individual
or may provide evidence of a long-term
pattern of injuries in child abuse. For a general
discussion of trauma, the reader should
consult a forensic pathology text such as the
one by DiMaio and DiMaio. Trauma in skeletal
remains is addressed by Merbs, and
postmortem damage and influences are
detailed in a text edited by Haglund and Sorg.
Time Since Death

Estimating how long skeletal remains have been at the location where they are found is one of
the most difficult questions for forensic anthropologists to answer. An estimate of the time since
death can narrow the number of missing persons we compare with the unknown victim.
However, bones of a person who died 10 years ago may differ little from those that are from a
person who has been dead only 5 years. Prompted by a case involving a Civil War grave
mistakenly estimated to be about a year old, one of the best studies to obtain data on
postmortem decomposition and changes has been undertaken by Professor Bill Bass at the
University of Tennessee. Ubelaker discusses current research on estimating time since death,
including the use of insects (forensic entomology).
Establishing Individual Identity
The preferred method for establishing the identity of skeletal remains is by dental identification.
If the anthropologist's general description of the deceased matches the description of a missing
person, we then ask the missing person's dentist to provide dental charts and radiographs for
comparison. A forensic odontologist (dentist) then compares the data to either rule out that the
remains belonged to the missing person or confirm that the unknown and the records represent
the same individual. In some cases, the teeth or skull may be missing, requiring alternatives to a
dental identification. Postmortem radiographs can be compared with antemortem radiographs,
if available. Cranial anatomy, especially the sinus form can be compared. Chest radiographs often
show some of the vertebral detail. Evidence of healed fractures or medical implants may be used
to confirm identity. Photographic or video superimposition can be used to superimpose the
unknown skull and a portrait of an individual to see if they "fit" anatomically. Advances in DNA
technology are making it possible to extract DNA from human bones. This will allow us to
compare the DNA from skeletal remains with the DNA of family members when we have an idea
who the victim is, but more traditional methods of identification are not available due to
incomplete remains, etc. The military is using DNA to assist in the identification of MIA/POW
remains from the Vietnam War.
Confirmation of Personal Identity
It is an important point to remember when considering the relative weighting attached to
identification characteristics that while the fundamental fourosteobiographical parameters of
age, sex, stature, and ancestral origin allow a reduction in potential matches, additional
corroborative factors are only of value when preexisting comparative information is available. As
such, it may not always be possible to achieve a confirmed identity given insufficient presumptive
matches. To this end, we can define three categories of identity depending on the quality of the
identification criteria utilized.
1. Positive or confirmed identity
This occurs when two sets of data are compared and enough specific markers found to conclude
that the two sets of records were, in all probability, derived from the same individual. No
irreconcilable differences should be noted. Unique markers may include DNA, fingerprints,
dentition, and highly individualizing skeletal traits such as numbered surgical implants or
radiographic superimposition of frontal sinus morphology.
2. Possible or presumptive identity
This occurs when several individual factors are considered, and although no single factor justifies
the establishment of identity, the loadings or weightings attributed to the factors available are
sufficient for a possible or presumptive ID. Such factors may include identifiable personal effects,
visual recognition based on surviving soft tissues (facial form, body modifications, etc.),
confirming osteobiographical data, skeletal pathologies, or other individualizing skeletal traits. In
cases of BTB (believed to be), the principle of parsimony is invoked.
3. Exclusion
This arises when all the deceased in an identifiable category such as male or female have been
identified, all surviving victims have been accounted for, and BTB have all been confirmed; those
individuals who are unable to be matched to a list of presumptive identities are excluded from
the identification. It is also possible to exclude with “absolute” certainty in certain cases,
particularly where the remains of an unknown individual can be categorically excluded on the
basis of an invariant or highly individualizing characteristic; for example, a set of unknown
remains determined to be female and 18–25 years of age will clearly not be those of a missing
70-year-old male. It is clear, therefore, that to limit the definition of forensic anthropology to the
process of identification from the skeleton is outdated and inappropriate. The modern forensic
anthropologist must be as comfortable working with the living as they are with the dead, and as
familiar with the soft tissues as they are with the hard tissues of bones and teeth. It is a highly
specialized area of expertise that requires thorough professional education and training.
A REPORT IN FOREN 2
Submitted TO
SUBJECT INSTRUCTOR
Submitted by
ADAYA, JEMALYN
CABILDO, CHRISTOPHER
CALAWOD, JEAN LORRAINE
CHIVA, LEIANNE JEAN
ESPARAGOZA, JOHN GREG
JAMELARIN, LOBELYN
LEGADA, JC
NIÑORA, JOHN PAUL
2-BRAVO
April __21__, 2022
FORENSIC ODONTOLOGY
Learning objectives:
At the end of this lesson, the students should be able to:
1. Know the history of forensic odontology;
2. Define the meaning of forensic odontology;
3. Analyze, compare and determine the dental identification.
Introduction
Teeth are the most indestructible part of the human body. They survive not
only after death but remain unchanged for many thousands of years. Also can be used
as a weapon of attack or defense under certain circumstances may leave information as
to the identity of the biter. Human teeth and dental
restorations have proven to remain stable during a long
time as well as in extreme situations such as fire.
The evolution of forensic odontology started right
back in the Garden of Eden. According to the Old
Testament, Eve convinced Adam to put a bite mark in
apple. It was told that “It is always tempting to suggest
that the history of bite mark evidence (forensic dentistry)
began with the eating of forbidden fruit in the Garden of
Eden.” But the dentist or forensic odontologist were rare at that time. There is no record
of events, comparisons or analysis, and it is in addition there were a limited number of
suspects and the suspects reportedly confessed.
❖ 66 AD- Well-documented evidence to the use of teeth for identification began 66

AD with Agrippina and Lollia Pauline case. It was the first use of dental
identification where there is a record.
❖ 1193- The first forensic identification in India started in were Jai Chand, a great
Indian monarchy was destroyed by Muhammad’s army and Jai Chand, Raja of
Kanauji was murdered and he was identified by his false teeth.
❖ It was used in the identification of Adolf Hitler and his wife Eva Brawn at the end
of World War II.
❖ 1453- first formally reported case of dental identification was that of the 80 years
old warrior John Talbot, Earl of Shrews bury, who fell in the battle of Castillon.
❖ 1758- Peter Halket was killed in during French and Indian wars in a battle near
Fort Duquesne. Halket son identified his father’s skeleton by an artificial tooth.
❖ 1870, Ansil L Robinson was charged with the murder of his mistress; Mary
Lunsford. Evidence against Robinson included an attempt to match his teeth to the
bite marks on the victim’s arm.
❖ Wayne Clifford Boden was a Canadian serial killer and rapist active from 1969-
1971. He earned the nickname “the Vampire Rapist” because he had the penchant
of biting the breasts of his victims, a method of operation that led to his conviction
due to forensic odontological evidence.
❖ Early in 1775 Revere constructed a silver wire fixed bridge

for his close friend Dr. Joseph Warren, a medical
practitioner. At the outset of the war, Warren refused the
appointment of surgeon-in-chief to the continental army.
Instead, he requested the rank of a line officer;
Unfortunately, Warren was killed by a bullet that pierced
his skull in the Battle of Bunker Hill.
❖ 1776- At the battle for Breed’s Hill in Boston, Dr. Joseph Waren was killed in the
year 1776. His face was not able to identify as he suffered from a fatal head wound.
A dentist, Paul Revere, identified Dr. Warren, dead body by a small denture that
he had fabricated for him.
❖ In 1897 a paper entitled, “The role of the Dentists in the identification of the victims
of the catastrophe of the Bazar de la Charite, Paris and 4th May, 1897”, was
presented by Dr. Oscar Amoedo (Professor of the dental school in Paris) at the
international Medical Congress of Moscow. The bazar, at
which the wealthy women of Paris annually raised money
for projects for the poor, was destroyed within 10 minutes
and 126 persons lost their lives.
❖ Dr. Oscar Amoedo was considered as the father of the

forensic odontologist. The thesis done by him entitled ‘L’
Art Dentaire en Medicine Leagale’ in 1898 to the faculty of
medicine earned him a doctorate. This book is the first
comprehensive text on forensic odontologist.
❖ The first forensic odontologist in the United States was Dr.

Paul Revere who identified the extreme body of Dr. Joseph Warren through a
bridge of silver and ivory that he had constructed two years previously.
❖ 1937 in Chantilly, a murder was convicted on the evidence of the bite marks that
the victim inflicted during her struggle for life.
❖ The fire on board the “Scandinavian Star” was one of the world’s worst ferry
disasters. Dental identity could be established in 107 cases (68%).
comparison by forensic odontologists, of bite marks on the victim’s body to the
defendant’s dentition. After a painstaking review of voluminous legal and dental
authorities, the Missouri court determined that the science of positive bite mark
identification has reached the level of scientific reliability and credibility to permit
its admission as evidence in criminal proceedings.
❖ Forensic odontologists successfully identified tsunami victims in South-East Asia

in December 2004; more than 92% of the non-Thai victims have been identified,
out of which about 80% were identified by dental information. This high success
rate of dental identification in Thailand was a matter of surprise for many forensic
experts.
❖ The famous Iroquois theatre in Chicago was burned in 1903 and for about 602 of
the 1,842 patrons was died in the theatre. But no records of the identification are
found today. But, Dr. Cigrant quoted in his article that hundreds were unmistakably
identified from the dental records.
❖ First work in facial reconstruction was done by Kollman and Buchley. The
technique that is proposed by Kollmen and Buchely is still used with modification
today. Although computerized methods are gaining interest today. Belty Pat Gatliff
of Oklahoma has trained a number of forensic dentists in facial reconstruction
techniques.

Expertise, is the application of dental knowledge to the understanding of laws.
Some of the work a Forensic Odontology is involved in is: identification of bite
marks on the victims of attack.
identification during mass calamities, sexual assault and child abuse to name a
few.
❖ Forensic odontology is the application of dentistry to the investigation of crime

and medicolegal investigations. It has its main applications in the identification
of corpses and human remains and in bite mark analysis.

The major area of activity of forensic odontology is the identification of human
beings, either dead or alive. This is more so in case of mass disaster, where the corpse
is usually badly mutilated. Other areas of application include criminalistics, in cases
involving abuse of children and elderly. Bite marks also help in detection of culprits. It also
renders its service in probing of dental malpractice, archeology etc.
The scope of forensic dentistry is broad & ever-challenging. Each case is different &
even the seemingly routine case may test the dentist’s ingenuity in applying his dental
knowledge.
❖ Identifying human unknown remains through dental records and craniofacial

bones

Dental identification plays an important role when identification of remains of
deceased person is skeletonized, decomposed, burned or dismembered and is invalid by
visual or fingerprint methods. The identification of remains by dental evidence is possible
because, the hard tissues are preserved after death and can even withstand a
temperature of 1600 degree C when heated without appreciable loss of microstructure,
and the status of a person’s teeth change throughout the life and the combination of
decay, missing, filling can be obtained from any fixed time.
According to American board of forensic odontology dental identification can be
divided into four types:
❖ Positive identification- The ante-mortem and postmortem data match to
establish that it is from same individual.
❖ Possible identification- The ante-mortem and postmortem data have few
consistent features, but because of quality of the records it is difficulty to
establish the identity.

One of the first things they'll do is obtain a saliva sample from the bite. This, of
course, can be done by others, but a forensic dentist can make sure sample extraction
doesn't affect quality of the bite mark. Next, the forensic dentist will take photographs.
This is a technique shared by all experts, and it's fairly important to get the lighting,
color, and camera angle right. A linear scale should be placed somewhere in the
photograph. A camera angle of 90 degrees is best for a flat surface, while a 40 degree
angle causes 25% distortion of a bite mark.
Next, the forensic dentist makes multiple impressions, casts, or molds of the bite
mark, and has access to a variety of materials in which to choose the right gum, rubber,
plastic, or powder to make a cast. Some forensic dentists used the so-called Dorion
method, which advocates the removal of bitten tissue for microscopic examination.
Others use advanced techniques such as scanning electron microscopy,
computer-enhanced digitization, and xeroradiology. Computerized bite analysis software
also exists. Once a suspect is apprehended, the forensic dentist makes one or more
impressions of the suspect's teeth, comparing them to the recorded bite marks, and if
called to testify, renders an opinion of the probability of a match.
Courts have upheld the constitutionality of involuntarily taking a dental impression

from a suspect, as they have for most biological specimens from the suspect.

❖ Developmental changes: Developmental changes that occur to the human
dentition while the teeth are growing and emerging into the oral cavity.
✓ HARD TISSUE FORMATION- In this method, each tooth is scored
based on its developmental stage and scores are compared with
values corresponding to a particular age.
✓ DENTAL ERUPTION- To assess the age of unknown individual, we
can compare the postmortem radiographs of the individual to the
eruption standards produced by the Schour and Massler.
✓ THIRD MOLAR ERUPTION- Third molar emergence tends to be
around 17-19 years of age.
❖ Degenerative changes: That occur once the teeth have erupted and begin to
wear down. There is an intuitive connection between tooth wear and age, as
those with more wear tend to be older.

Bite marks are something else Forensic Odontologist look at. The specific areas
of bite marks would be : the distance from cuspid to cuspid, the shape of the mouth arch,
the evidence of a tooth out of alignment, teeth width and thickness, spacing between
teeth, missing teeth, the curves of biting edges, unique dentistry, and wear patterns such
as chips or grinding. The amount and degree of
detail recorded in the bitten surface may vary from
case to case.

conspicuous marks. In the flesh, they leave
behind noticeable bruises or puncture marks and
in soft foods, such as fruit, marks are also
preserved. In situations where sufficient details
are available, it may be possible to identify the
biter to the exclusion of all others.
Perhaps more significantly, it is possible to exclude suspects that did not leave the
bite mark or marks. The skin is elastic, tending to slip along the upper teeth until it catches
hold. Depending upon the type of victim, some bite marks last for hours and others for
days, but almost all bite marks alter themselves as time elapses.
Photographing bite marks at intervals over a set period of hours or days is part of
the standard protocol recommended by the ABFO. Bite marks also change or become
distorted when the posture of the victim changes, so the forensic dentist might be able to
assist with determination of how the perpetrator moved the body
SEX DETERMINATION
Sex determination is very important subdivision of forensic odontology, which plays
a major role in identification of the unknown individuals in natural disasters; chemical and
nuclear bomb explosion scenarios
❖ Sex difference in tooth dimension: Sex determination by measuring mesiodistal
and buccolingual dimensions is most simple and reliable method for sex
determination. Both the dimensions are more in male than in female.
❖ Tooth morphology: In male, the distal accessory ridge in canines is more

prominent than in female. In female, there is less number of cusps in
mandibular first molar (distobuccal or distal). These features can be because
of evolutionary reduction in the female lower jaw size.
❖ Bite marks may be found on the flesh of victims of a violent attack, particularly
on the stomach, breast or buttocks. Alternatively they may be found on the
suspect, left by victim during self-defense. If a bite mark is only represented as
a bruise, it is often extremely difficult to detect any individual characteristics.
❖ The bite mark is defined as the physical alteration in or on a medium caused
by the contact of teeth. In few of criminal cases it is seen that suspect or
victim has left his or her teeth marks on another person or inanimate object.
The concept of bite mark evidence is interesting and is there from Roman
times.
• In more aggressive bites -The assailant may suck the soft tissues into the
mouth so that images of palatal and incisal surfaces of teeth may appear.
Bites show laceration of tissue and petechial hemorrhage’s in the center of
the wound.
• In less aggressive bites -the skin may not be completely penetrated so
there can be oval mark mostly of anterior teeth.
❖ Bite marks change over a time on living as well as dead. If the bite is on living
person there will be post injury changes in the tissue, where bleeding,
swelling and discoloration can be seen. If the bite is on dead Person, then
photographs of marks are taken with standardized technique.

Study of lip prints is termed as “cheiloscopy.” Lip prints are said to be permanent
and unchangeable. Identification of pattern is possible from 6th week of intrauterine life.
These can serve as important evidence left at crime scene.
Disadvantages are major trauma to lips result in scarring. Surgical treatment also
affects the size and shape of lips. Prints may differ in appearance depending on pressure
applied or direction.
Forensic dentists use several different terms to describe the type of

bite mark:
❖ Artifact - when a piece of the body, such as an ear lobe, is removed through
biting
depending on the pressure applied by the biter. A clear impression means that there was
significant pressure; an obvious bite signifies medium pressure; and a noticeable
impression means that the biter used violent pressure to bite down.
Forensic dentistry or forensic odontology is the handling, examination and

evaluation of dental evidence in criminal justice cases. Forensic dentists are involved in
assisting investigative agencies to identify recovered human remains in addition to the
identification of fragmented bodies.
Forensic Odontologists
The forensic odontologists on these teams are dentists who have such special
skills in the areas of forensic dental science, including criminal investigation and
identification. They analyze any dental evidence, make forensic conclusions, and testify
in court to support their conclusions. Forensic odontologists often play an essential role
in identifying either victims of disasters or victims and suspects of individual crimes. They
thereby assist the legal authorities in solving crimes and bringing criminals to justice.
Forensic odontologists have other roles as well.
Odontologists need a unique skillset to excel in this field, including:
Attention to detail: Odontologists find evidence in small details, including fragments

of teeth or partial bite marks. Attention to detail helps them perform exact work.
Communication skills: Odontologists need to explain how they reached their
conclusions when testifying in court. They express their procedures and findings in non-
technical terms so everyone can understand.
Objectivity: Forensic odontologists need to be objective to make scientifically-
based conclusions using physical evidence.
Fine motor skills. Odontology requires precision and accuracy. The identification
process may require the use of microscopes or more complex technologies and the
manipulation of small items.
Knowledge of the legal system. Good knowledge of the legal system is useful as
they work closely with the judicial system. Odontologists must understand the impact of
their testimony and evidence they bring to court.
Dental evidence may include such diverse items as a bite mark impression, the
entire dentition of a victim, or just a single fragment of a tooth found at a crime scene.
Dental evidence also includes the premortem, or historical evidence of dental treatment,
such as textual records, diagrams, and X-rays.
Because teeth are the hardest materials of the human body and strongly resist
postmortem changes and adverse environmental conditions such as fire, water
immersion, or explosion, dental evidence is often available in crime cases.
DNA PROFILING
A REPORT IN FOREN 2
Submitted to:
MRS SHARON CORDERO
SUBJECT INSTRUCTOR
Submitted by
MARY ROSE ASONG
JOANNA MONTERO
JOHN MARK CABUTAN
ANGEL LOURAINE LAUD
GREACEY CANDELARIO
KEVIN GUANZON
BENEDICT DIONELA
ANNE KYLIE ESBIETO
BSCRIM 2-B
APRIL 21, 2022
DNA PROFILING
OBJECTIVE:
1. To identify the importance of DNA Profiling in the Personal Identification
Techniques.
2. To understand the process and techniques used in the DNA Profiling.
3. Students will learn what DNA Profiling is, and how it is applicable in
determining someone’s personal identification.
INTRODUCTION:
- DNA, or deoxyribonucleic acid, is a complex molecule that contains all the
information necessary to build and maintain an organism. It is the heredity
material. Every cell in the human body has the same DNA. The information of
DNA is stored as a code constituted by four nitrogenous bases: Adenine (A),
Thymine (T), Cytosine (C), and Guanine (G).
- Knowing the main DNA characteristics, specificity in the key to the emergence of
DNA analysis. Numerous other techniques used to determine biological markers,
such as HLA and blood group substances, have been successfully applied for
identification purpose.
What is DNA Profiling?

- DNA Profiling is also called DNA fingerprinting which is the process of
determining an individual’s DNA characteristics. DNA analysis intended to
identify a species, rather than an individual, is called DNA barcoding.
- DNA profiling is a forensic technique in criminal investigation, comparing criminal
suspects’ profiles to DNA evidence so as to assess the likelihood of their
involvement in the crime.
DNA Profiling is used to:

• Identify the probable origin of a body fluid sample associated with a crime or
crime scene.
• Revel Family relationships.
• Identify disaster victims, for example, ESR scientists travelled to Thailand to
help identify victims of the 00 Boxing Day Tsunami.
HISTORY OF DNA FINGERPRINTING

- DNA profiling first started out in the 80’s and it has been extremely successful for
testing in crime scene, paternity testing and predisposition to disease.
- Kary Mullins – in the United Kingdom invented the polymerase chain reaction or
PCR.
- Dr. Alec Jeffrey’s (1986)- made genetic fingerprinting available to the public. In
1986 was when DNA was first used in a criminal investigation.
- The investigation used genetic fingerprinting in a case of two rapes and murders
that had happened in 1983 and 1986. These crimes happened in a small town
called Leicestershire, which is located in the United Kingdom. They collected
fingerprints and connected them with semen stains collected from where the
raping and murders located. Then in 1987, DNA evidence was first used in the
United States on Florida, rapist man, Tommie Lee Andrews. After using DNA
evidence in his he was then sentenced to 22 years in prisons for the rapes that
he had committed.
- Dr. Jeffrey made it available for people to perform identity tests. Since the
1980’s, DNA testing had just become a popular way of finding out things through
people’s DNA.
- DNA profiling uses repetitive sequences that are highly variable, called variable
tandem repeats (VNTRs), in particular short tandem repeats (STRs), also known
as microsatellites and minisatellites.
- VNTR loci are similar between closely related individuals, but are so variable that
individuals are unlikely to have the same VNTRs.
• Dr. VK Kashyap & Dr. Lalji Singh- an Indian scientist who started the
fingerprints in India and worked in the field of DNA fingerprinting technology
where he was popularly known as the “father of Indian Fingerprinting”.
• Wyman And White (1980)- laid the foundations for the concept based on the
observation of a polymorphic DNA locus characterized by a number of
variable length restriction fragments called restriction fragment length
polymorphisms (RFLPs) which are specific sequences where restriction
enzymes cleave the DNA.
• 1985- “Hypervariable Minisatellite Regions In Human DNA” written by

Alec Jeffreys. Jeffreys and his co workers were analyzing the human
myoglobingene when they discovered a region consisting of a 33-base-pair
sequence repeated 4 times.
• 1987- Nakamura coined the term variable the number of tandem repeats
(VNTR) to describe the individual loci where alleles are composed of tandem
repeats that vary in the number of core units.
• DNA fingerprinting had its first application in 1985 in a case of parentage
testing, actually a maternity test, with paternal DNA unavailable
What is DNA Fingerprinting?

- it is the technology which is used to identify individuals on the basis of the
molecular characteristics of the DNA. The technique is used, in parentage testing
and forensic cases but it can be used for anthropological genetics, zoology and
botany among others discipline.
Why is DNA fingerprinting important?

- it helps to solve crimes and to determine paternity. It is also used to identify
inherited genetic diseases and can be used to identify genetic matches between
tissue donor and recipients.
Procedure to Create a DNA Fingerprinting:

1. The DNA is extracted from the nuclei of any cell in the body.
2. The DNA molecules are broken with the help of enzyme restriction endunucleas
(called chemical knife) that cuts them into fragments. The fragment of DNA also
contains the VNTRs.
3. The fragments are separated according to size by gel electrophoresis agarose
gel.
4. The separated fragments of single stranded DNA are transferred onto nylon
membrane. Radioactive DNA probes having repeated based sequences
complementary to possible the VNTRs are poured over a nylon membrane.
Some of them will bind to the single- stranded VNTRs. The method of
hybridization of DNA with probes is called Southern Blotting.
5. The nylon membrane is washed to remove extra probes.
6. An x-ray film is exposed to the nylon membrane to mark the places where the
radioactive DNA probes have bound to the DNA fragments. These places are
marked as dark bands when x-ray film is developed. This is known as
autoradiography.
7. The dark bands on x-ray film represent the DNA Fingerprints (DNA profiles).
PROFILING PROCESS
- The process developed Glassberg and independently by Jeffreys, begin with a
sample of an individual’s DNA (typically called a “reference sample).
- Reference sample- are usually collected through buccal swab.
- The DNA profile is then compared against another sample to determine whether
there is a genetic match.
DNA FINGERPRINTING APPLICATIONS

- Since Alex Jeffrey developed the DNA fingerprinting technique, it has been used
in different scientific fields.
- In forensic investigation has helped to send to prison criminals, and identify
victims of crimes, natural disaster, wars as well as paternity disputes.
DNA EXTRACTION
- It is a process of purification of DNA from sample using a combination of physical
and chemical methods.
RFLP (RESTRICTION FRAGMENT LENGTH POLYMORPHISM) ANALYSIS

❖ The first methods for finding out genetics used for DNA profiling involved
RFLOP analysis. DNA is collected from cells and cut into small pieces
using a restriction enzyme (a restriction digests).
❖ The fragments are then separates on the basis of size using gel
electrophoresis.
- The separated fragments are then transferred to a nitrocellulose or nylon filter;
this procedure is called a Southern Blot.
- Karl Brown’s original techniques looked at many minisatellite loci at the same
time, increasing the observe variability, but making it hard to discern individual
alleles (and thereby precluding paternity).
- These early techniques have been supplanted by PCR-based assays.

- Kary Mullins (1983)- a process was reported by which specific portions of the
sample DNA can be amplified almost identify (Saiki et al. 1985, 1985).
- PCR greatly amplifies the amount of a specific regions of DNA. In the PCR
process, the DNA sample is denaturing into the separate individual polynucleotide
strands through heating.
- PCR uses replication enzymes that are tolerant of high temperatures, such as the
thermostable tag polymerase. In this fashion, two new copies of the sequence of
interest are generated.
- This process can produce a million-fold or greater amplification of the desired
region in 2 hours or less.

- Short tandem repeats or STR are regions of non-coding DNA that contain repeats
of the same nucleotide sequence. For example,
GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence
GATA is repeated six times.

- was also put into practice during the early 1990s.
- It relied on variable number tandem repeat (VNTR) polymorphisms to distinguish
various alleles, which were separated on a polyacrylamide gel using allelic ladder
(as opposed to a molecular weight ladder).
- Bands could be visualized by silver staining the gel. One popular focus for
fingerprinting was the D1S80 lucos.
- AmpFLP analysis can be highly automated, and allows for easy creation of
phylogenetic trees based on comparing individual sample of DNA. Due to its
relatively low cost and ease of set-up and operation.
- genetic material like blood, semen, saliva, hair and skin found at the crime scene
are processed, and afterward the samples are compared with the DNA of the
suspects, in order to determine guilt or innocence of the accused.
Parentage Testing
- DNA fingerprinting is an advantageous technique in cases, such as, of establishing
the paternity of disputed offspring or cases of baby swapping.
- In Parentage testing, a DNA comparison is performed between progeny against
potential parents.
❖ markers have been used as ancestry informative markers to reconstruct the
human diaspora and to interpret the evolutionary history of human
populations to inquire population origins, migration, admixture and
adaptation to different environments, as well as susceptibility and
resistance to disease.
Botany
- DNA fingerprinting is an essential tool for genotype identification in both wild
plant and cultivated species.
- DNA markers help to study fundamental evolutionary influences of natural
selection, mutation, gene flow and genetic drift on wild plant populations and
identify groups are characterized by highly variable ploidy levels, often even
within the same species.
Zoology
- In Zoology, DNA fingerprinting determine the genetic identity of individuals and
measure genetic variation in natural populations, allowing true genetic
relationships among individuals to be determined, rather than them being inferred
from field observations.
In genetic testing, any of a group of procedures used to identify gene variations,

associated with health, disease, and ancestry and to diagnosed inherited diseases and
disorders.
A REPORT IN FOREN 2
Submitted TO
SUBJECT INSTRUCTOR
Submitted by
Name of reporters
Bahia, Zenaido
Bernesto, Mary Christine
Iballa, Zaera Marie
Quintayo, Karla
Sarino, Harold
Puno, Mark Jumpet
April 22, 2022

Forensic anthropology is the application of the

anatomical science of anthropology and its various subfields,
including forensic archaeology and forensic taphonomy in a
legal setting. A forensic anthropologist can assist in the
identification of deceased individuals whose remains are
decomposed, burned, mutilated or otherwise unrecognizable,
as might happen in a plane crash. Forensic anthropologists are
also instrumental in the investigation and documentation

homicide investigators, forensic anthropologists commonly
testify in court as expert witnesses. Using physical markers
present on a skeleton, a forensic anthropologist can potentially
determine a person's age, sex, stature, and race.
This is useful in identifying living individuals for legal purposes such as illegal
immigrants. This is extremely important in legal cases where the court needs to decide if they
will judge an individual as an adult or a minor. In addition to identifying physical characteristics
of the individual, forensic anthropologists can use skeletal abnormalities to potentially
determine cause of death, past trauma such as broken bones or medical procedures, as well
as diseases such as bone cancer.
The methods used to identify a person from a skeleton relies on the past contributions
of various anthropologists and the study of human skeletal differences. Through the collection
of thousands of specimens and the analysis of differences within a population, estimations
can be made based on physical characteristics. Through these, a set of remains can
potentially be identified. The field of forensic anthropology grew during the twentieth century
into a fully recognized forensic specialty involving trained anthropologists as well as numerous
research institutions gathering data on decomposition and the effects it can have on the
skeleton.
Objectives: In the end of the lesson you will able to;

❑ Discuss the Forensic Anthropology and its history
❑ Establish an identification for deceased person
❑ Use systematic techniques to recover physical remains and associated materials and;
❑ Identification of causative agents of death
Additional Infromation
Forensic Anthropology became established in the 1940s, when law enforcement agencies
began to call upon physical athropologists to assist with their cases that required identification of
skeletal remains.

➢ Forensic anthropology applies the science of physical or biological anthropology to the legal process.
➢ Forensic anthropologists analyze human remains, typically in criminal investigations. Their study of

quite a bit of money. However, two
anatomists (Drs. Oliver Wendell Holmes
and Jeffries Wyman) successfully
age of Dr. Parkman.
• 1894, Thomas Dwight - gave his Shattuck Lecture about the analysis of human skeletal
remains in a legal setting. He was rightfully hailed
as the "Father of Forensic Anthropology."


Established skeletal aging techniques based on data
from skeletal remains of Korean War soldiers.

• The American Academy of Forensic Sciences (AAFS)
- established a section for forensic anthropology called
the Physical Anthropology Section.
• 1980 - Dr. William Bass set up the "Body Farm" at the

University of Tennessee, Knoxville to research human
decomposition and taphonomy.

program that enables forensic anthropologists to perform metric analyses
on skeletal remains based on data from contemporary populations. The
goal is to determine sex, ancestry, and height from the measurements.
anthropologists to work on human rights and
genocide cases. The first such team was the
Argentine Forensic Anthropology Team (EAAF).
• Dr. William R. Maples - founded the C.A. Pound

Human Identification Laboratory (CAPHIL), the first private
forensic anthropology lab, at the University of Florida.

• 2003- JPAC was the first skeletal identification lab to obtain

ASCLD-LAB (American Society of Crime Laboratory Directors-
Laboratory Accreditation Board) accreditation. CAPHIL followed
soon after.
and photography.
• Johann Friedrich Blumenbach - German anthropologist in

comparative human morphology, early forensic
anthropologists relied upon anthropometry (the science of
recording measurements of various parts of the human
body).

“Handbuch für Untersuchungsrichter” (1893; Criminal Investigation)
helped to establish the science of forensics, especially in terms of a
cross-transfer of evidence, such as dirt, fingerprints, carpet fibers or hair,
from the criminal to the victim. Early in the 20th century, serological
research led to the discovery of the A, B, AB, and O blood groups, thus
increasing the value of blood as evidence at a crime scene.
• Mid-20th century- advances in biochemistry and technology resulted in the discovery of
unique gene markers in each person; these genetic differences allow for the DNA
fingerprinting of hair, blood, semen and tissue. Thus, DNA testing was a major contribution
to modern forensic science, though forensic anthropologists generally do not conduct such
DNA analyses and often only supply samples to be tested. The 20th and 21st centuries have
also seen substantial growth in public and private forensic laboratories, enabling the
collection and study of empirical evidence.

the human skeleton.

➢ Forensic anthropologists can assess the age, sex,

and unique features of a decedent and are
invaluable in documenting trauma to the body and
estimating how long a corpse has been
decomposing.

individuals in law enforcement and medical science
and especially with specialists in ballistics,
explosives, pathology, serology (the study of blood and bodily fluids) and toxicology and are often
expert witnesses in murder trials.


legal issues. There are three subsections within the
field of forensic anthropology, including: a) Forensic Osteology - the study of the skeleton; b)Forensic
Archeology - involves the controlled collection of human remains; c) Forensic Taphonomy- involves
the study of changes to the body after death, including decomposition and environmental
modification)
Additonal Information
Forensic Anthropology is usually defined as the application of the science of physical anthropology
to the legal process. The routine scope of the discipline is the identification of skeletonized, badly
decomposed, or otherwise unidentified human remains.

➢ Clay or graphic facial reproduction- This is used to
recreate a face from skull with the use of soft tissue depth
estimates. In manual methods, is done by using clay, plastic
and wax directly on the victim’s skull.

microscope (SEM) is a type of electron
microscope that produces images of a
sample by scanning the surface with a
focused beam of electrons. The electrons interact with atoms in the sample,
producing various signals that contain information about the surface topography
and composition of the sample.
➢ Radiographic techniques- Is an imaging technique using x- rays,

gamma rays, or similar ionizing radiation and non- ionizing radiation
to view the internal form of an object.
➢ Photo or video superimposition techniques- The term of photographic superimposition has been
applied for a number of techniques in forensic
medicine and dentistry. The comparison of an ante
mortem photograph to that of a skull is one such
procedure. Technical information and potential
sources of difficulty are discussed. Finally, two
cases illustrate the use and misuse of this technique
➢ The casting of skeletal materials- Skeletal remains are physical records that can help determine
the adaptations/biological features of a species or an
individual. Casting protects original materials and
makes new material available for people or research.
Casting and molding are processes that duplicate
fossil and also recent skeletal material.
➢ Preservation of skeletal materials using

commercial preservatives- compound or solution is used in the field
for consolidation of bone or skeleton in order to preserve it.
➢ Thin-sectioning techniques of bone histology- Involving

hand grinding technique has been developed to produce 20-
40-un-thick sections of bone-titanium implant sites.
➢ Rehydration and preservation of mummified or decayed

soft tissues- Process and chemical formula for
rehydrating soft tissues of mummified corpses or
under an initial process of putrefaction. And the
chemical formula for the subsequent preservation
thereof. The present invention is novel since it
includes a process and a chemical formula which
are efficient for rehydrating the whole soft tissues
present in a mummified corps, or in its initial
process of putrefaction, thus reversing the
physical changes that these phenomena had
caused thereto.
Additional Information:
Classification
1. Caucasoid (white or of European descent)
-Caucasoid traits were recognized as: thin nasal aperture (“nose narrow”), a small mouth, facial angle of
100-90 degree and orthognathism, exemplified by what Blumenbach saw in most ancient Greek crania and
statues.
2. Negroid (black or of African descent)
- Negroid is a term that is used by some forensic and physical anthropologists to refer to individuals and
populations that shares certain morphological a skeletal traits that are generally associated with Black
African ancestry.
3. Mongoloid (Asian and Native American descent)

- In 2004, British anthropologist Caroline Wilkinson gave a description of “Mongoloid” skulls in her
book on forensic facial reconstruction: “The Mongoloid skull shows around head shape with a
medium-width nasal aperture, rounded orbital margins, massive cheekbones, weak or absent
canine fossae, moderate prognathism.
FORENSIC ODONTOLOGY
A REPORT IN FOREN 2
Submitted TO
SUBJECT INSTRUCTOR
Submitted by
Jemer Janiel Bandiola
Jessmatt Delos Santos
Justiene Jaudines
Ma. Ifa Jenina Rosit
Maribel Vicencio
2-CHARLIE
FORENSIC ODONTOLOGY
defense under certain circumstances may leave information as to the identity of the biter.
Human teeth and dental restorations have proven to remain stable during a long time as well as
in extreme situations such as fire.
Dentistry has much to offer law enforcement in the detection and solution of crime or in civil
proceedings. Forensic dental fieldwork requires an interdisciplinary knowledge of dental
science. Most often the role of the forensic odontologist is to establish a person's identity.
Teeth, with their physiologic variations, pathoses and effects of therapy, record information
that remains throughout life and beyond. The teeth may also be used as weapons and, under
certain circumstances, may leave information about the identity of the biter.
Objectives: In the end you will able to;

❑ Discuss forensic odontology history and historical evidences
❑ Identifying human unknown remains through dental records and craniofacial bones
❑ Recognition and analysis of bite marks found on victims
THE HISTORY
The evolution of forensic odontology started right back in the Garden of Eden. According to the
Old Testament, Eve convinced Adam to put a bite mark in apple. It was told that “It is always
tempting to suggest that the history of bite mark evidence (forensic dentistry) began with the
eating of forbidden fruit in the Garden of Eden.” But the dentist or forensic odontologist were
rare at that time. There is no record of events, comparisons or analysis, and it is in addition
there were a limited number of suspects and the suspects reportedly confessed.
• 66 AD- Well-documented evidence to the use of teeth for identification began 66 AD
with Agrippina and Lollia Pauline case. It was the first use of dental identification where
there is a record.
• 1193- The first forensic identification in India started in were Jai Chand, a great Indian
• It was used in the identification of Adolf Hitler and his wife Eva Brawn at the end of
World War II.
• 1453- First formally reported case of dental identification was that of the 80 years old
• 1758- Peter Halket was killed in during French and Indian wars in a battle near Fort
• 1870, Ansil L Robinson was charged with the murder of his mistress; Mary Lunsford.
Evidence against Robinson included an attempt to match his teeth to the bite marks on
the victim’s arm.
• Wayne Clifford Boden was a Canadian serial killer and rapist active from 1969-1971. He
• 1776- At the battle for Breed’s Hill in Boston, Dr. Joseph Waren was killed in the year
1776. His face was not able to identify as he suffered from a fatal head wound. A
dentist, Paul Revere, identified Dr. Warren, dead body by a small denture that he had
fabricated for him.
• In 1897 a paper entitled, “The role of the Dentists in the identification of the victims of
the catastrophe of the Bazar de la Charite, Paris and 4th May, 1897”, was presented by
Dr. Oscar Amoedo (Professor of the dental school in Paris) at the international Medical
Congress of Moscow. The bazar, at which the wealthy women of Paris annually raised
money for projects for the poor, was destroyed within 10 minutes and 126 persons lost
their lives.
• Dr. Oscar Amoedo was considered as the father of the forensic odontologist. The thesis
done by him entitled ‘L’ Art Dentaire en Medicine Leagale’ in 1898 to the faculty of
medicine earned him a doctorate. This book is the first comprehensive text on forensic
odontologist.
• The first forensic odontologist in the United States was Dr. Paul Revere who identified
the extreme body of Dr. Joseph Warren through a bridge of silver and ivory that he had
constructed two years previously.
• 1937 in Chantilly, a murder was convicted on the evidence of the bite marks that the
victim inflicted during her struggle for life.
• The fire on board the “Scandinavian Star” was one of the world’s worst ferry disasters.
• Sager case involved the murder of a 14 year old girl. The state’s evidence included
identification has reached the level of scientific reliability and credibility to permit its
admission as evidence in criminal proceedings
• Forensic odontologists successfully identified tsunami victims in South-East Asia in
which about 80% were identified by dental information.
• The famous Iroquois theatre in Chicago was burned in 1903 and for about 602 of the
1,842 patrons was died in the theatre. But no records of the identification are found
today.
• First work in facial reconstruction was done by Kollman and Buchley. The technique
that is proposed by Kollmen and Buchely is still used with modification today
What is odontology?
Odontology is the study of teeth. Odontologists study their development and diseases and
analyze their structure. It is a specialty of dentist that helps to identify unknown remains
and connect bite marks to a specific individual
What is forensic Odontology?

▪ Forensic Odontology, also known as Forensic Dentistry or Bite Mark Evidence Expertise,
is the application of dental knowledge to the understanding of laws. Some of the work a
Forensic Odontology is involved in is: identification of bite marks on the victims of
attack.
▪ A branch of science uses the skills of the dentist in personal identification during mass
calamities, sexual assault and child abuse to name a few.
▪ Forensic odontology is the application of dentistry to the investigation of crime and

Dental identification plays an important role when identification of remains of deceased person
is skeletonized, decomposed, burned or dismembered and is invalid by visual or fingerprint
methods. The identification of remains by dental evidence is possible because, the hard tissues
are preserved after death and can even withstand a temperature of 1600 degree C when
heated without appreciable loss of microstructure, and the status of a person’s teeth change
throughout the life and the combination of decay, missing, filling can be obtained from any
fixed time.
According to American board of forensic odontology dental identification can be divided into
four types:
• Positive identification- The ante-mortem and postmortem data match to establish that
• Possible identification- The ante-mortem and postmortem data have few consistent
• Insufficient evidence- The data is not enough to from the conclusion.
• Exclusion- The ante-mortem and postmortem data clearly inconsistent.

➢ One of the first things they'll do is obtain a saliva sample from the bite. This, of course,
can be done by others, but a forensic dentist can make sure sample extraction doesn't
affect quality of the bite mark.
➢ Next, the forensic dentist will take photographs. This is a technique shared by all
experts, and it's fairly important to get the lighting, color, and camera angle right. A
linear scale should be placed somewhere in the photograph. A camera angle of 90
degrees is best for a flat surface, while a 40 degree angle causes 25% distortion of a bite
mark.
➢ Next, the forensic dentist makes multiple impressions, casts, or molds of the bite mark,
and has access to a variety of materials in which to choose the right gum, rubber,
➢ Others use advanced techniques such as scanning electron microscopy, computer-
enhanced digitization, and xeroradiology. Computerized bite analysis software also
exists.
➢ Once a suspect is apprehended, the forensic dentist makes one or more impressions of
the suspect's teeth, comparing them to the recorded bite marks, and if called to testify,
renders an opinion of the probability of a match. Courts have upheld the
constitutionality of involuntarily taking a dental impression from a suspect, as they have
for most biological specimens from the suspect.
The need for age estimation has increased in recent years because there is increase in numbers
of unidentified cadavers and human remain especially in metropolitan cities and age estimation
for living individuals who do not have valid proof of date of birth with them.
Dental ageing technique can be broken down into two categories:
1. DEVELOPMENTAL CHANGES
• Developmental changes that occur to the human dentition while the teeth are growing
and emerging into the oral cavity.
• HARD TISSUE FORMATION- In this method, each tooth is scored based on its
developmental stage and scores are compared with values corresponding to a particular
age.
• DENTAL ERUPTION- To assess the age of unknown individual, we can compare the
postmortem radiographs of the individual to the eruption standards produced by the
Schour and Massler.
• THIRD MOLAR ERUPTION- Third molar emergence tends to be around 17-19 years of
age.
• DENTAL MEASUREMENT- This technique was an alternative to the qualitative
assessment where the length of tooth was measured
2. DEGENERATIVE CHANGES
• That occurs once the teeth have erupted and begin to wear down. There is an intuitive
connection between tooth wear and age, as those with more wear tend to be older.
BITE MARKS IDENTIFICATION, COMPARISON OR ANALYSIS

The amount and degree of detail recorded in the bitten surface may vary from case to case.
Human and animal teeth both leave conspicuous marks. In the flesh, they leave behind
noticeable bruises or puncture marks and in soft foods, such as fruit, marks are also preserved.
In situations where sufficient details are available, it may be possible to identify the biter to the
exclusion of all others.
Perhaps more significantly, it is possible to exclude suspects that did not leave the bite mark or
marks. The skin is elastic, tending to slip along the upper teeth until it catches hold. Depending
upon the type of victim, some bite marks last for hours and others for days, but almost all bite
marks alter themselves as time elapses.
Bite marks also change or become distorted when the posture of the victim changes, so the
forensic dentist might be able to assist with determination of how the perpetrator moved the
body.
Bite marks are something else Forensic Odontologist look at. The specific areas of bite marks
would be:
• the distance from cuspid to cuspid,
• the shape of the mouth arch,
• the evidence of a tooth out of alignment,
• teeth width and thickness,
• spacing between teeth,
• missing teeth,
• the curves of biting edges,
• unique dentistry, and
• wear patterns such as chips or grinding.
Bite Mark
The bite mark is defined as the physical alteration in or on a medium caused by the contact of
teeth. In few of criminal cases it is seen that suspect or victim has left his or her teeth marks on
another person or inanimate object.
The concept of bite mark evidence is interesting and is there from Roman times
▪ In More Aggressive Bites
-The assailant may suck the soft tissues into the mouth so that images of palatal and incisal
surfaces of teeth may appear. Bites show laceration of tissue and petechial hemorrhage’s in the
center of the wound.
▪ In Less Aggressive Bites
-The skin may not be completely penetrated so there can be oval mark mostly of anterior
teeth.
Note!!
Bite marks change over a time on living as well as dead. If the bite is on living person there will
be post injury changes in the tissue, where bleeding, swelling and discoloration can be seen. If
the bite is on dead Person, then photographs of marks are taken with standardized technique
Types of bite mark:
• Abrasion - a scrape on the skin
• Artifact - when a piece of the body, such as an ear lobe, is removed through biting
• Avulsion - a bite resulting in the removal of skin
• Contusion - a bruise
• Hemorrhage - a profusely bleeding bit
• Incision - a clean, neat wound
• Laceration - a puncture wound
There are several different types of impressions that can be left by teeth, depending on the
pressure applied by the biter. A clear impression means that there was significant pressure; an
obvious bite signifies medium pressure; and a noticeable impression means that the biter used
violent pressure to bite down
SEX DETERMINATION
Sex determination is very important subdivision of forensic odontology, which plays a major
role in identification of the unknown individuals in natural disasters; chemical and nuclear
➢ Craniofacial morphology and dimension:
The morphology of the skull and mandible, pattern formed by six traits those are mastoid,
supraorbital ridge, size and architecture of the skull, zygomatic extensions, nasal aperture, and
mandible gonial angle and Frontal sinus dimension are taken into consideration.
• Sex difference in tooth dimension:
Sex determination by measuring mesiodistal and buccolingual dimensions is most simple and
reliable method for sex determination. Both the dimensions are more in male than in female.
▪ Tooth morphology:
In male, the distal accessory ridge in canines is more prominent than in female. In female, there
is less number of cusps in mandibular first molar (distobuccal or distal). These features can be
because of evolutionary reduction in the female lower jaw size.
▪ Sex determination by DNA analysis:
The study by Das and his associates stated that the sex determination could be obtained from
the studying the X and Y-chromosomes upto four weeks of the death.
Lip Print
➢ Study of lip prints is termed as “CHEILOSCOPY”
➢ Cheiloscopy is a forensic investigation that deals with identification of human based on
lip traces. Lip print wrinkle pattern has individual characteristics same as finger prints.
The wrinkles and grooves on the labial mucosa form a characteristic pattern called lip
prints.
➢ Lip prints are said to be permanent and unchangeable. Identification of pattern is
possible from 6th week of intrauterine life. These can serve as important evidence left
ADDITIONAL INFORMATION
Basis for Dental Identification

• Human dentition is never the same in any two individuals
• The morphology and arrangement of teeth vary from person to person

• Dental identity- total of all characteristics of the teeth and their associated structures
which, while no individually unique, when considered together provide a unique totality
• Teeth are relatively resistant to environment insults after death.
Reasons for Identification of Human Remains

Criminal - Investigation in criminal death cannot begin until the victim has been positively
identified.
Marriage - Individuals from many religious backgrounds cannot remarry unless their partners
are confirmed deceased.
Monetary - Payment of pensions, life insurance and other benefits relies upon positive
confirmation of death.
Burial - Many religions require that positive identification be made prior to burial in
geographical sites.
Closure - Identification of individuals missing for prolong time can bring peace and closure to
family members.
➢ The evidence that can be derived from teeth is the age estimation (i.e., children,
adolescents, adults) and identification of the person to whom the teeth belong.
➢ This is done using ante-mortem (prior to death) dental records, radiographs13 and
photographs and by comparing them to post-mortem records.
➢ A person’s teeth change throughout life and the combination of decayed, missing and
filled teeth is measurable and comparable at any fixed point in time.
➢ Teeth have the ability to survive decomposition and withstand extreme temperature
changes, which is why dental evidence comparison is one of the most dependable and
reliable methods of identification.
Ante-mortem and Post-mortem

▪ Post-mortem refers to a forensic investigation of the cause of death, and it is done after
the occurrence of the death. Ideally, post-mortem examination results are based on the
form of injuries detected.
▪ In practice, there are two types of injuries involved in forensic pathology; ante-mortem
injuries and post-mortem injuries. Ante-mortem injuries occur before death whereas
post-mortem injuries occur after death.
▪ Therefore, ante-mortem refers to events occurring prior to death.
Types of Odontology
• General Dentists
- provide regular teeth cleanings and routine dental exams. Your general dentist will also refer
you to other types of dentists if you need services and procedures that they’re not qualified to
provide. General dentistry is one of the most common types of dentistry.
• Pedodontists or Pediatric Dentists

- specialize in dental care and treatments for children and youth.
• Orthodontists
- specialize in teeth and jaw alignment, using wires, braces, retainers, and other devices.
• Periodontists
- help treat and repair diseases and problems of the gums. While a general dentist will support
gum disease prevention, a periodontist will provide treatment for tissue damaged by
progressive gum disease.
• Endodontists
- deal specifically with issues troubling the nerve of a tooth.They are qualified to perform root
canals that are necessary when there is decay around the tooth’s nerve.
• Oral pathologists and oral

- surgeons specialize in the treatment of oral diseases of the teeth and jaw. They are trained to
perform surgery and may work closely with ear, nose, and throat specialists (ENTs).
• Prosthodontists
- repair teeth and jaw bones. They provide cosmetic dentistry, or treatments to improve the
appearance of teeth, such as teeth whitening and veneers. They also fit people with dentures,
crowns and bridges.
DNA PROFILING
A REPORT IN FOREN 2
Submitted to:
MRS. SHARON P CORDERO
SUBJECT INSTRUCTOR
Submitted by:
Belo, Geralden A.
Diata, Anna Marie
Petinglay, Irishlie A.
Samillano, Christine Joy E.
Yongque, Lee Harry L.
BSCRIM 2-C
April 21, 2022
DNA PROFILING
Objectives:
At the end of the lesson, the students will be able to
1. Understand the history of DNA Profiling,
2. familiarize the important terms and definitions involved herein, and
3. know the importance of DNA Profiling in relation to solving crimes.
Introduction
DNA, or deoxyribonucleic acid, is a complex molecule that contains all the
information necessary to build and maintain an organism. It is the hereditary material.
Every cell in the human body has the same DNA. The
information of DNA is stored as a code constituted by four
nitrogenous bases: Adenine (A), Thymine (T), Cytosine (C) and
Guanine (G). The order or sequence of these bases determines
the information available for building and maintaining an
organism. The human genome size is about 3,107 megabases
(Mb) but only about 1.2 percent of the total genome encodes for
proteins, this is around 20,000 genes, while 98.8 percent is
noncoding DNA2,3, which means that do not encode proteins.
Within this group we have, for example, a variable number of
tandem repeats (VNTR), which are repeated sequences of 9 to
100 base pairs that play a key role in the elaboration of DNA fingerprinting.
Knowing the main DNA characteristics, specificity is the key to the emergence of
DNA analysis. Numerous other techniques used to determine biological markers, such as
HLA and blood group substances, have been successfully applied for identification
purposes. All are based on exclusion, where markers are tested until a difference is found.
Other factors favoring DNA analysis include the small sample requirement, the ability to
rapidly replicate a sequence a million fold or more in vitro, and the relative stability of
DNA. The point is that DNA analysis alone can be a definitive test.
Once the technique becomes routine, there is little doubt that, provided a suitable
specimen can be obtained, DNA fingerprinting will be the single best test for excluding a
falsely associated individual.
DNA Profiling is also called DNA fingerprinting which is the process of determining
an individual’s DNA characteristics. DNA analysis intended to identify a species, rather
than an individual, is called DNA barcoding. DNA profiling is a forensic technique in
criminal investigation, comparing criminal suspects’ profiles to DNA evidence so as to
assess the likelihood of their involvement in the crime.
It is also used in parentage testing, to establish immigration eligibility, and in

genealogical and medical research. DNA profiling has also been used in the study of
animal and plant populations in the fields of zoology, botany, and agriculture. DNA
profiling is the process where a specific DNA pattern, called a profile, is obtained from a
person or sample of bodily tissue. Even though we are all unique, most of our DNA is
actually identical to other people’s DNA.
However, specific regions vary highly between people. These regions are called
polymorphic. Differences in these variable regions between people are known as
polymorphism. Each of us inherits a unique combination of polymorphism from our
mother. DNA polymorphism can be analyzed to give DNA profile. Human DNA profiles
can be used to identify the origin of a DNA sample at a crime scene or test for parentage.

• Identify the probable origin of a body fluid sample associated with a crime
or crime scene
• Revel family relationships
• Identify disaster victims, for example, ESR scientists travelled to Thailand
to help identify victims of the 00 Boxing Day Tsunami.

DNA profiling first started out in the80s, and it has been extremely successful for
testing in crime scene, paternity testing, and predisposition to disease. The polymerase
chain reaction or PCR, was invented by Kary Mullins in the United Kingdom, and in 1986,
Dr. Alec Jeffreys made genetic fingerprinting available
to the public. In 1986 was when DNA was first used in
a criminal investigation by Dr. Jeffreys.
The investigation used genetic fingerprinting in

a case of two rapes and murders that had happened
in 1983 and 1986. These crimes happened in a small
town called Leicestershire, which is located in the
United Kingdom. They collected fingerprints and
connected them with semen stains collected from
where the raping and murders were located. Then in
1987, DNA evidence was first used in the United
States on Florida, rapist man, Tommie Lee Andrews. After using DNA evidence in his
case, he was then sentenced to 22 years in prisons for the rapes that he had committed.
Dr. Jeffreys also made it available for people to preform identity tests. Since the
1980s, DNA testing had just become a popular way of finding out things through people’s
DNA. However, the FBI did not start using DNA testing until 1998, but it can become very
helpful to those who need to find out something in that area. Thousands of different cases
have been cracked and many innocent people have been freed jail or prison because of
the use of DNA provided by family.
Although 99.9%of human DNA sequences are

the same in every person, enough of the DNA is different
that it is possible to distinguish one individual from
another, unless they are monozygotic (identical) twins.
DNA profiling uses repetitive sequences that are highly
variable, called variable tandem repeats (VNTRs), in
particular short tandem repeats (STRs), also known as microsatellites, and minisatellites.
VNTR loci are similar between closely related individuals, but are so variable that
In India DNA fingerprinting was started by Dr. VK Kashyap

and Dr. Lalji Singh was an Indian scientist who worked in the field of
DNA fingerprinting technology in Indian,
where he was popularly known as the
• 1980, Wyman and White laid the foundations for the concept based on the
observation of a polymorphic DNA locus characterized by a number of variable-
length restriction fragments called restriction fragment length polymorphisms
(RFLPs), which are specific sequences where restriction enzymes cleave the DNA.
• 1985 with the paper “Hypervariable Minisatellite Regions in Human DNA” written
by Alec Jeffreys. Jeffreys and his coworkers were analyzing the human myoglobin
gene when they discovered a region consisting of a 33-base-pair sequence
repeated four times. This tandem repeat was referred to as a minisatellite and
similar regions as hypervariable because the number of tandem repeats is variable
both within a locus and between loci.
• 1987, Nakamura coined the term variable number of tandem repeats (VNTR) to
describe individual loci where alleles are composed of tandem repeats that vary in
the number of core units. When DNA is isolated, cleaved with a specific enzyme,
and hybridized under low-stringency conditions with a probe consisting of the core
repeat, a complex ladder of DNA fragments is detected. This profile appears to be
unique to each individual. Different core repeats were later isolated and used to
produce a number of different probes useful for fingerprinting. For that time, this
technique was unknown but its potential was evident.
• DNA fingerprinting had its first application in 1985 in a case of parentage testing,
actually a maternity test, with paternal DNA unavailable.
• In this unusual case, a mother with her little 13 years old son were arrested in the
airport when they arrived in England from Ghana because the authorities thought
that he was not her son. A DNA fingerprinting applied to both demonstrated that,
effectively, they told the truth.
• The first application of DNA fingerprinting in forensic identification happened later

that same year, in a case that beautifully exemplifies the power of DNA evidence
to link crime-scenes, to exclude suspects, and to support convictions. A suspect
was arrested for allegedly committing a double rape and suicide to 2 minors. A
DNA fingerprinting using a sample of semen left in the crime scene demonstrated
that a man had been responsible for both crimes but it was not the arrested
suspect. He was released and the real culprit was arrested. Nowadays, this
technique is still used to create DNA profile of each individual in order to clarify
some crimes or parentage testing.
DNA Fingerprinting is the technology which is used to identify individuals on the

basis of the molecular characteristics of the DNA. More specific, this method uses VNRT
because the number of bases and repeats within a locus is unique to each individual. For
example, an individual can have in his genome the sequence gatagata and this repeats
10 times and another can have the same sequence but only repeats 5 times.
The technique is used, as we have seen before, in parentage testing and forensic
cases but it can be used for anthropological genetics, zoology, and botany among others
disciplines. Importantly, the technique of DNA Fingerprinting is very sensitive, which
means that it can also generate data even from half (partially) decomposed biological
material.
The steps involve others techniques used in

Molecular Biology, such as polymerase chain
reaction (PCR) and electrophoresis among others.
The following are the steps to generate a DNA
fingerprinting;
• The DNA is extracted from the nuclei of
any cell in the body.
• The DNA molecules are broken with the
help of enzyme restriction endonuclease
(called chemical knife) that cuts them into fragments. The fragments of DNA
also contain the VNTRs.
• The fragments are separated according to size by gel electrophoresis in
agarose gel.
• The separated fragments of single-stranded DNA are transferred onto a nylon
membrane. Radioactive DNA probes having repeated base sequences
complementary to possible VNTRs are poured over the nylon membrane.
Some of them will bind to the single-stranded VNTRs. The method of
• The nylon membrane is washed to remove extra probes.
• An X-ray film is exposed to the nylon membrane to mark the places where the
marked as dark bands when X-ray film is developed. This is known as
autoradiography.
• The dark bands on X-ray film represent the DNA fingerprints (DNA profiles).
PROFILING PROCESS
The process, developed Glassberg and independently by Jeffreys, begins with a
sample of an individual’s DNA (typically called a “reference sample”). Reference samples
are usually collected through the buccal swab. When this is unavailable (for example,
when a court order is needed but unobtainable) other methods may be needed to collect
a sample of blood, saliva, semen, vaginal lubrication or other fluid or tissue from personal
use item (for example, a toothbrush, razor) or from stored samples (for example, banked
sperm or biopsy tissue). Samples obtain from blood relatives can indicate an individual’s
profile, as could previous profile human remains.
A reference sample is then analyzed to create the individual’s DNA profile using
one of the techniques discussed below. The DNA profile is then compared against
another sample to determine whether there is a genetic match.

Since Alec Jeffreys developed the DNA fingerprinting technique, it has been used
in different scientific fields. In forensic investigations has helped to send to prison
criminals, and identify victims of crimes, natural disaster, wars. Paternity disputes have
been resolved thanks to this method.
Moreover, disciplines as anthropological genetics, zoology, and botany among

others have driven profiling research in order to interpret the origin and behavior of some
species. In the next lines, we are going to describes how the technique has been applied
and evolved in the areas mentioned above.
DNA EXTRACTION
DNA Extraction is a process of purification of DNA from sample using a
combination of physical and chemical methods?
When a sample such as blood or saliva is obtained, the DNA is only a small part
of what is present in the sample. Before the DNA can be analyzed, it must be extracted
from the cells and purified. These are many ways this can be accomplished, but all
methods follow the same basic procedure. The cell and nuclear
membranes need to be broken up to allow the DNA to be free in
solution.
Once the DNA is free, it can be separated from all other
cellular components. After the DNA has been separated in solution,
the remaining cellular debris can then be removes from the solution
and discarded, leaving only DNA.
The most common methods of DNA extraction include organic
extraction (also called phenol chloroform extraction), Chelex
extraction, and solid phase extraction. Differential extraction is modified version of
extraction in which DNA from two different types of cells can be separated from each
other before being purified from the solution.
Each method of extraction works well in the laboratory, but analyzed typically
selects their preferred method based on factors such as the cost, the time involved, the
quality of DNA yielded, and the quality of DNA yielded. After the DNA is extracted from
the sample, it can be analyzed, whether it is by RFLP analysis or quantification and PCR
analysis.
RFLP (RESTRICTION FRAGMENT LENGTH POLYMORPHISM)

ANALYSIS
The first methods for finding out genetics used for DNA profiling involved RFLOP
analysis. DNA is collected from cells and cut into small pieces using a restriction enzyme
(a restriction digests). This generates DNA
fragments of differing sizes as a consequence
of variations between DNA sequences of
different individuals. The fragments are then
separates on the basis of size using gel
electrophoresis.
The separated fragments are then
transferred to a nitrocellulose or nylon filter; this
procedure is called a Southern Blot. The DNA
fragments within the blot are permanently fixed
to the filter, and the DNA strands are denatured.
Radiolabeled probe molecules are then added that are complementary to sequences in
the genome that contain repeat sequences. These repeat sequences tend to vary in
length among different individuals and are called variable number tandem repeats
sequences or VNTRs.
The probe molecules hybridize to DNA fragments containing the repeats
sequences and excess probe molecules are washed away. The blot is then exposed to
an X-ray film. Fragments of DNA that have bound to the probe molecules appear as
fluorescent bands on the film.
The Southern blot techniques requires large amounts of non-degraded sample
DNA. Also Karl Brown’s original techniques looked at many minisatellite loci at the same
time, increasing the observe variability, but making it hard to discern individual alleles
(and thereby precluding paternity). These early techniques have been supplanted by
PCR-based assays.

Develops by Kary Mullins 1983, a process was
reported by which specific portions of the sample DNA can
be amplified almost identify (Saiki et al. 1985, 1985). The
process polymerase chain reaction PCR, mimics the
biological process of DNA replication, but confines it to
specific DNA sequence of interest. With the invention of the
PCR technique, DNA profiling took huge strides forward in
both discriminating power and the ability to recover
information from very small (or degraded) starting samples.
PCR greatly amplifies the amount of a specific
regions of DNA. In the PCR process, the DNA sample is denaturing into the separate
individual polynucleotide strands through heating. Two oligonucleotide DNA primers are
used to hybridize to two corresponding nearby sites on opposite DNA strands, in such a
fashion of the normal enzymatic extension of the active terminal of each primer (that is,
the 3’ end) leads toward the other primer.
PCR uses replication enzymes that are tolerant of high temperatures, such as the
thermostable tag polymerase. In this fashion, two new copies of the sequence of interest
are generated. Repeated denaturation, hybridization, and extension in this fashion
produce an exponentially growing number of copies of the DNA of interest.
Instrument that perform thermal cycling are readily available from commercial
sources. This process can produce a million-fold or greater amplification of the desired
region in 2 hours or less.

One of the current techniques for DNA profiling uses polymorphism called short
tandem repeats. Short tandem repeats or STR are regions of non-coding DNA that
contain repeats of the same nucleotide sequence. For
example, GATAGATAGATAGATAGATAGATA is an STR
where the nucleotide sequence GATA is repeated six times.
STRs are found at different places or genetic loci in a
person’s DNA.
Another technique, AFLP or amplified fragment length polymorphism was also put
into practice during the early 1990s. This technique was also faster than RFLP analysis
and use PCR to amplify DNA samples. It relied on
variable number tandem repeat (VNTR)
polymorphisms to distinguish various alleles, which
were separated on a polyacrylamide gel using allelic
ladder (as opposed to a molecular weight ladder).
Bands could be visualized by silver staining the
gel. One popular focus for fingerprinting was the
D1S80 lucos. As with all PCR based methods, highly
degrade DNA or very small amounts of DNA may
cause allelic dropout (causing a mistake in thinking a
heterozygote is a homozygote) or other stochastic
effects.
In addition, because the analysis is done on a

gel, very high repeats may bunch together at the top of the gel, making it difficult to
resolve. AmpFLP analysis can be highly automated, and allows for easy creation of
phylogenetic trees based on comparing individual sample of DNA. Due to its relatively
low cost and ease of set-up and operation. AmpFLP remains popular in lower income
countries.
Famous Crime T.V shows as CSI, Bones and others have popularized this
technology. To summarize the methodology, genetic material like blood, semen, saliva,
hair and skin found at the crime scene are processed, and afterward the samples are
compared with the DNA of the suspects, in order to determine guilt or innocence of the
accused.
DNA fingerprinting markers have evolved since 1984. In the beginning, sets of
minisatellites or oligonucleotides stretches were used, also called multi-locus probes
(MLP) which detected sets of 15 to 20 variable fragments per individual ranging from 3.5
to 20 kb in size. Minisatellites were replaced because they needed a large amount of
molecular weight of DNA, usually not found at the crime scene and errors in the linkage
between loci.
For this reason, was changed by single locus probe (SLP) which recognized single
hypervariable locus, using high stringency hybridization and just 10 ng of DNA8.
Multilocus and Single Locus probes were part of the so called restriction fragment length
polymorphism (RFLP) - based methods were still limited by the available quality and
quantity of the DNA. Those procedures were replaced by PCR based methods because
they improved sensitivity, speed, and genotyping precision.
PCR-based methods use microsatellites as markers instead of minisatellites;
microsatellites as short tandem repeats (STRs) are more sensitive and less prone to
allelic dropout than VNTR (variable number of tandem repeat) systems8.
In cases, when there exist a low proportion of nuclear DNA samples, lineage
marker is used which are obtained from mitochondrial and Y DNA, and they are very
useful to reconstruct the paternal and maternal relationship and historical reconstruction
in unidentified remains typically skeletonized, hair shafts without roots, or very old
specimens where only heavily degraded DNA is available likewise samples of sexual
assault without ejaculation, sexual assault by a vasectomized male, male DNA under the
fingernails of a victim, male ‘touch’ DNA on the skin.
Parentage Testing
DNA fingerprinting is an advantageous technique in cases, such as, of establishing
the paternity of disputed offspring or cases of baby swapping. This method replaced ABO
blood antigen systems which cannot establish paternity but can conclusively exclude an
alleged father from being a candidate.
Disputed paternity originates because of affiliation orders, divorce proceedings

and questioned the legitimacy, also is used to discover paternity in cases of inheritance,
guardianship, maintenance, legitimacy, adultery or fornications.
In Parentage testing, a DNA comparison is performed between progeny against

potential parents. Children inherit half of their alleles from each parent and thus should
possess an alleles combination of their parents.
In Anthropological Genetics, markers have been used as ancestry informative
markers to reconstruct the human diaspora and to interpret the evolutionary history of
human populations to inquire population origins, migration, admixture and adaptation to
different environments, as well as susceptibility and resistance to disease.
The main markers used by anthropological genetic are variable number tandem
repeats (VNTRs), short tandem repeats (STRs), mitochondrial DNA hallo groups, Y-
specific non-recombining region (NRY) haplotypes, and single nucleotide polymorphisms
(SNPs).
In the medical field, researchers have made possible the mapping quantitative trait
loci involved in biological pathways of diseases such as diabetes mellitus, cancers,
obesity, osteoporosis, and coronary heart disease. In the studies of population, markers
allow identifying the presence, absence, or high frequency in some populations and low
frequencies in others, of certain genetic traits that characterize some specific
population11.
Botany
DNA fingerprinting is an essential tool for genotype identification in both wild plant
and cultivated species. DNA profiling is used for protection of biodiversity, identifying
markers for traits, identification of gene diversity and variation. Identification in plants
always been an issue for botanists because of the large variability of the composition and
relative amount of chemicals in particular species of the plant varies with growing
condition, harvesting period, post-harvesting period and storage conditions.
Due to large variability, DNA fingerprinting technique uses several types of

markers for example, Inter Simple Sequence Repeat (ISSR), Random Amplification
Polymorphic DNA (RAPD)/Arbitrary Primed PCR, Amplified Fragment Length
Polymorphism (AFLP), DNA Amplification Fingerprinting (DAF), Simple Sequence
Repeats (SSR), Sequence Characterized Amplified Region (SCAR), Cleaved Amplified
Polymorphic Sequence (CAPS) and Single Nucleotide Polymorphism (SNP).
DNA markers help to study fundamental evolutionary influences of natural

selection, mutation, gene flow and genetic drift on wild plant populations and identify
groups are characterized by highly variable ploidy levels, often even within the same
species. Moreover, the method detects both ancient and ongoing hybridization between
crops and wild species.
Zoology
In Zoology, DNA fingerprinting determine the genetic identity of individuals and
measure genetic variation in natural populations, allowing true genetic relationships
among individuals to be determined, rather than them being inferred from field
observations. Furthermore, it helps to test predictions of kin selection models in a
realistically way, and detect hybrids species.
The DNA marker clarified mating system in reproductive ecology for example in
vertebrates that give birth to more than one offspring has revealed concurrent multiple
paternities. This kind of behavior has been observed in a wide range of organisms,
particularly in reptiles.
DNA microsatellites have been useful tools describing population connectivity,

isolation, and the particulars of inter-population gene flow, also now they are being used
to document levels of genetic variation in rare and endangered species and thus better
inform conservation management actions.
Deoxyribonucleic acid (DNA) is the cell’s hereditary material and contains
instructions for development, growth and reproduction. DNA is passed from generation
to generation in humans and many other organisms. The same DNA is located in nearly
every cell of the human body. DNA is mostly located within chromosomes in the nucleus,
but some DNA is also found in the mitochondria. Chromosomes consist of DNA coiled
around histones (alkaline proteins).
DNA is contained in blood, semen, skin cells, tissue, organs, muscle, brain cells,
bone, teeth, hair, saliva, mucus, perspiration, fingernails, urine, feces, etc.
Because a person's DNA must be exactly the same across all the body's cells,
DNA has the fascinating ability to make copies of itself. This is how it stores genetic
information and ensures that when a cell divides, the new cells contain exact replicas of
the DNA from the original cell.
What things can change your DNA?
-Environmental factors such as food, drugs, or exposure to toxins can cause
epigenetic changes by altering the way molecules bind to DNA or changing the structure
of proteins that DNA wraps around.
Three major forms of DNA are double stranded and connected by interactions between
complementary base pairs. These are terms A-form, B-form,and Z-form DNA.
*A-form DNA is a right-handed double helix made up of deoxyribonucleotides. It appears

when the relative humidity of the environment is less than 75%, which means that it is
rarely present in normal physiological condition. The two strands of A-DNA are anti-
parallel with each other and not symmetrical. The molecule is asymmetrical is because
the glycosidic bonds of a base pair are not diametrically opposite to each other. Therefore,
major grooves and minor grooves can be observed in each turn.
*B-form DNA is a right-handed double helix, which was discovered by Watson and Crick
based on the X-ray diffraction patterns. It is the common form of DNA exists under normal
physiological condition. The double strands of B-DNA run in opposite directions. The
structure is asymmetrical with major grooves and minor grooves present alternatively.
*Z-form DNA is a left-handed double helix. It has a very different structure when
compared with A-DNA and B-DNA. The zigzag appearance of backbone allows it to be
distinguished from other forms of DNA.
What is a DNA profile?

One way to produce a DNA profile, is for scientists to examine STRs at 10 or more genetic
loci. These genetic loci are usually on different chromosomes.
A DNA profile can tell the scientist if the DNA is from a man or woman, and if the sample
being tested belongs to a particular person.
How do you create a DNA profile using STR?

1. Get a sample of DNA
DNA is found in most cells of the body, including white blood cells, semen, hair roots and
body tissue. Traces of DNA can also be detected in body fluids, such as saliva and
perspiration because they also contain epithelial cells. Forensic scientists and Police
officers collect samples of DNA from crime scenes. DNA can also be collected directly
from a person using a mouth swab (which collects inner cheek cells). Find out more in
the articles Forensics and DNA and Crime scene evidence.
2. Extract the DNA

DNA is contained within the nucleus of cells. Chemicals are added to break open the
cells, extract the DNA and isolate it from other cell components.
3. Copy the DNA

Often only small amounts of DNA are available for forensic analysis so the STRs at each
genetic locus are copied many times using the polymerase chain reaction (PCR) to get
enough DNA to make a profile.
Specific primers are used during PCR that attach a fluorescent tag to the copied STRs.
4. Determine the size of the STRs

The size of the STRs at each genetic locus is determined using a genetic analyser. The
genetic analyser separates the copied DNA by gel electrophoresis and can detect the
fluorescent dye on each STR. This is the same piece of equipment used in the lab for
DNA sequencing.
5. Is there a match?
The number of times a nucleotide sequence is repeated in each STR can be calculated
from the size of the STRs. A forensic scientist can use this information to determine if a
body fluid sample comes from a particular person.
If two DNA profiles from different samples are the same, the chance that the samples
came from different people is low. This provides strong evidence that the samples have
a common source.
To produce a DNA profile, scientists examine STRs at ten, or more, genetic loci. These
genetic loci are usually on different chromosomes.
Objectives:
After successfully completing this report, the students will be able to:
✓ Understanding Anthropology and its value

✓ Apply Forensic Anthropology in the field/case
✓ Analyze the Techniques of Forensic Anthropology and how it’s done
Introduction
Forensic anthropology is the application of the anatomical science of anthropology and its
various subfields, including forensic archaeology and forensic taphonomy in a legal setting. A
forensic anthropologist can assist in the identification of deceased individuals whose remains are
decomposed, burned, mutilated or otherwise unrecognizable, as might happen in a plane crash.
Forensic anthropologists are also instrumental in the investigation and documentation
Along with forensic pathologists, forensic dentists, and homicide investigators, forensic
anthropologists commonly testify in court as expert witnesses. Using physical markers present on
a skeleton, a forensic anthropologist can potentially determine a person's age, sex, stature,
and race.
This is useful in identifying living individuals for legal purposes such as illegal immigrants.
This is extremely important in legal cases where the court needs to decide if they will judge an
individual as an adult or a minor. In addition to identifying physical characteristics of the
individual, forensic anthropologists can use skeletal abnormalities to potentially determine cause
of death, past trauma such as broken bones or medical procedures, as well as diseases such as bone
cancer.
The methods used to identify a person from a skeleton relies on the past contributions of
various anthropologists and the study of human skeletal differences. Through the collection of
thousands of specimens and the analysis of differences within a population, estimations can be
made based on physical characteristics. Through these, a set of remains can potentially be
identified. The field of forensic anthropology grew during the twentieth century into a fully
recognized forensic specialty involving trained anthropologists as well as numerous research
institutions gathering data on decomposition and the effects it can have on the skeleton.
➢ Forensic anthropology applies the science of physical or biological anthropology to the
legal process. Anthropology is the study of humans, and in this forensic discipline physical
or biological anthropologists focus their studies on the human body as it relates to
explaining the circumstances of an accident or solving a crime – often homicide.
➢ Forensic anthropologists analyze human remains, typically in criminal investigations.
Their study of human remains aids in the detection of crime by working to assess the age,
sex, stature, ancestry and unique features of a skeleton, which may include documenting
trauma to the skeleton and its postmortem interval.

• 1849 Boston, Dr. John Webster murdered Dr. George Parkman because he owed
Parkman quite a bit of money.
However, two anatomists (Drs. Oliver
Wendell Holmes and Jeffries Wyman)
successfully reassembled the skeletal
remains and determined that they
matched the stature, ancestry
(Caucasian), and approximate age of
Dr. Parkman.
• 1894, Thomas Dwight - gave his Shattuck Lecture about the analysis of human
skeletal remains in a legal setting. He was
rightfully hailed as the "Father of Forensic
Anthropology."
• Anthropologist Wilton Krogman - published his book, “The Human Skeleton in
Forensic Medicine”, in 1962. Forensic anthropologists use this text even today.
• 1954 by Tom McKern and T. Dale Stewart-

published skeletal age changes in young
American males. Established skeletal aging
techniques based on data from skeletal remains
of Korean War soldiers.

• The American Academy of Forensic Sciences
(AAFS) - established a section for forensic anthropology called the Physical
Anthropology Section.
• 1977 - The American Board of Forensic Anthropology (ABFA) was created to

certify professional forensic anthropologists and to
set professional standards.
• 1980 - Dr. William Bass set up the "Body Farm" at

the University of Tennessee, Knoxville to research
human decomposition and taphonomy.

program that enables forensic anthropologists to perform metric
analyses on skeletal remains based on data from contemporary
populations. The goal is to determine sex, ancestry, and height
from the measurements.

anthropologists to work on human rights and
genocide cases. The first such team was the
Argentine Forensic Anthropology Team
(EAAF).
Identification Laboratory (CAPHIL), the first private

• The Ellis Kerley Foundation - was established as the first
funding source solely for forensic anthropological
research in 2000.
• 2003- JPAC was the first skeletal identification lab to

obtain ASCLD-LAB (American Society of Crime
Laboratory Directors-Laboratory Accreditation Board)
accreditation. CAPHIL followed soon after.
• 13th century, medical examiners have sought to determine the causes of deaths and
to solve crimes. Given that a death can be natural, accidental, homicide, suicide, or
undetermined, forensic science has been greatly aided by developments in modern
chemistry, toxicology, and photography.
• Johann Friedrich Blumenbach - German

anthropologist in comparative human morphology,
early forensic anthropologists relied upon
anthropometry (the science of recording
measurements of various parts of the human body).
• Hans Gross - The publication of Austrian

criminologist “Handbuch für Untersuchungsrichter” (1893;
Criminal Investigation) helped to establish the science of
forensics, especially in terms of a cross-transfer of evidence, such
as dirt, fingerprints, carpet fibers or hair, from the criminal to the
victim. Early in the 20th century, serological research led to the
discovery of the A, B, AB, and O blood groups, thus increasing
the value of blood as evidence at a crime scene.
• Mid-20th century- advances in biochemistry and technology resulted in the

discovery of unique gene markers in each person; these genetic differences allow
for the DNA fingerprinting of hair, blood, semen and tissue. Thus, DNA testing
was a major contribution to modern forensic science, though forensic
anthropologists generally do not conduct such DNA analyses and often only supply
samples to be tested. The 20th and 21st centuries have also seen substantial growth
in public and private forensic laboratories, enabling the collection and study of
empirical evidence.

➢ Forensic anthropology, application of physical anthropology to legal cases, usually with a
focus on the human skeleton.

physical anthropology to analyse skeletal,
badly decomposed, or otherwise unidentified
human remains to solve crimes.
➢ Forensic anthropologists can assess the age,

sex, and unique features of a decedent and are
invaluable in documenting trauma to the body
and estimating how long a corpse has been
decomposing.

individuals in law enforcement and medical
science and especially with specialists in
ballistics, explosives, pathology, serology (the study of blood and bodily fluids) and
toxicology and are often expert witnesses in murder trials.
➢ Although physical anthropology is concerned with human evolution, human variation, and
the biological bases of human behaviour, many of its excavation and reconstruction
techniques can be applied to forensic anthropology.
➢ Both disciplines use empirical evidence,

genetic information, and computer technology
to determine the physical characteristics of
human specimens. Indeed, a forensic
anthropologist can reconstruct the face of a
murder victim in much the same way a physical
anthropologist can reconstruct the face of a

anthropological research and techniques to
medico legal issues. There are three subsections within the field of forensic anthropology,
including: a) Forensic Osteology - the study of the skeleton; b)Forensic Archeology -
involves the controlled collection of human remains; c) Forensic Taphonomy- involves the
study of changes to the body after death, including decomposition and environmental
modification)
Forensic anthropologists use a number of techniques when studying skeletal remains,
including:
Clay or graphic facial reproduction

✓ This is used to recreate a face from skull with the use of
soft tissue depth estimates. In manual methods, is done by
using clay, plastic and wax directly on the victim’s skull.
Scanning electron microscopy
✓ Scanning electron microscope (SEM) is a type of electron

microscope that produces images of a sample by scanning the surface
with a focused beam of electrons. The electrons interact with atoms in
the sample, producing various signals that contain information about the
surface topography and composition of the sample.
Radiographic techniques
✓ Is an imaging technique using x- rays, gamma rays, or similar
ionizing radiation and non- ionizing radiation to view the
internal form of an object.
Photo or video superimposition techniques

✓ The term of photographic superimposition has
been applied for a number of techniques in
forensic medicine and dentistry. The comparison
of an ante mortem photograph to that of a skull is
one such procedure. Technical information and
potential sources of difficulty are discussed.
Finally, two cases illustrate the use and misuse of
this technique in arriving at a positive
identification.
✓
The casting of skeletal materials
✓ Skeletal remains are physical records that can help
determine the adaptations/biological features of a
species or an individual. Casting protects original
materials and makes new material available for
people or research. Casting and molding are
processes that duplicate fossil and also recent
skeletal material.
Preservation of skeletal materials using commercial preservatives

✓ Compound or solution is used in the field for consolidation
of bone or skeleton in order to preserve it.
Thin-sectioning techniques of bone histology

✓ Involving hand grinding technique has been developed to
produce 20-40-un-thick sections of bone-titanium implant
sites.
Rehydration and preservation of mummified or decayed soft tissues

✓ Process and chemical formula for rehydrating
soft tissues of mummified corpses or under an
initial process of putrefaction. And the chemical
formula for the subsequent preservation thereof.
The present invention is novel since it includes
a process and a chemical formula which are
efficient for rehydrating the whole soft tissues
present in a mummified corps, or in its initial
process of putrefaction, thus reversing the
physical changes that these phenomena had caused thereto.
Forensic anthropology is a special sub-field of physical anthropology (the study of human

remains) that involves applying skeletal analysis and techniques in archaeology to solving
criminal cases. When human remains or a suspected burial are found, forensic anthropologists
are called upon to gather information from the bones and their recovery context to determine
who died, how they died, and how long ago they died. Forensic anthropologists specialize in
analyzing hard tissues such as bones. With their training in archaeology, they are also
knowledgeable about excavating buried remains and meticulously recording the evidence.
History of Anthropology
The profession of the forensic anthropologist is a relatively recent outgrowth from the broader
field of forensic sciences in general. Forensic science is a field which has its roots at the end of
the 19th century, but it didn't become a widely practiced professional endeavor until the 1950s.
Early anthropologically-minded practitioners such as Wilton Marion Krogman, T.D. Steward, J.
Lawrence Angel, and A.M. Brues were pioneers in the field. Sections of the field dedicated to
anthropology — the study of human skeletal remains — began in the United States in the 1970s,
with the efforts of pioneer forensic anthropologist Clyde Snow.
Forensic anthropology began with scientists dedicated to determining the "big four" of any one
set of skeletal remains: age at death, sex, ancestry or ethnicity, and stature. Forensic
anthropology is an outgrowth of physical anthropology because the first people who attempted to
determine the big four from skeletal remains were primarily interested in the growth, nutrition,
and demography of past civilizations.
Since those days, and largely due to an enormous number and variety of scientific advances,
forensic anthropology now includes the study of both the living and the dead. In addition,
scholars strive to collect information in the form of databases and human remains repositories,
that allow continuing research in the scientific repeatability of forensic anthropological studies.
Wilton Krogman - He was an American Anthropologists. A leader in the development of the

field of physical anthropology, with an early and lasting interest in dental anthropology.
"The Human Skeleton in Forensic Medicine" - The book contains numerous updates as a result
of the changes that have occured in the field of forensic sciences and forensic anthropology
American Academy of Forensic Sciences (AAFS) - aims to promote integrity, competency,

education, foster research, improve practice, and encourage collaboration in the forensic
sciences.
Dr. William Bass - An American Forensic Anthropolist, best known for his research on human
osteology and human decomposition. He has also assisted federal, local and non-U.S. authorities
in the identification of human remains. In addition to his research, Bass has also assisted law
enforcement in forensic investigations...
"Body Farm" - is the Anthropological Research Facility - the pathology school, at the University
of Tennesse started by Dr. William Bass in 1971. It was the first research facility of its kind
where students could scientifically study the decomposition of the human body.
Dr. William R. maples

a leading forensic anthropologist who sought to identify the skeletal remains of prominent
figures dating back as far as the 1500's
a pioneer in the relatively young field of forensic anthropology, Dr. Maples traveled the world to
examine and identify skeletons, including those of President Zachary Taylor, Czar Nicholas II of
Russia
The Ellis Kerley foundation
Kerley (1924 to 1998) represents an important figure in the history of American forensic
anthropology. In research, he is best known for pioneering the microscopic approach to the
estimation of age at death from human bone.
Johann Friedrich blumenbach
was a German physician, naturalist, physiologist, and anthropologist. He is considered to be a
main founder of zoology and anthropology as comparative, scientific disciplines. He was also
important as a race theorist.
Blumenbach was the first to show the value of comparative anatomy in the study of man's
history. His research in the measurement of craniums led him to divide mankind into five great
families—Caucasian, Mongolian, Malayan, Ethiopian, and American.
Hans gross
Hans Gustav Adolf Gross or Groß was an Austrian criminal jurist and criminologist, the
"Founding Father" of criminal profiling. A criminal jurist, Gross made a mark as the creator of
the field of criminality. Throughout his life, Hans Gross made significant contributions to the
realm of scientific criminology.
Clyde Snow, one of the nation's foremost forensic anthropologists who discovered the hidden
stories told by skeletal remains and helped identify Nazi war criminal Josef Mengele and
countless victims of accidents, crimes and state-sanctioned abuses of human rights.
The Argentine Forensic Anthropology Team (Spanish: Equipo Argentino de Antropología

Forense, EAAF) is an Argentine not-for-profit scientific non-governmental organisation. It was
created in 1986 at the initiative of various human rights organisations with the aim of developing
forensic anthropology techniques to help locate and identify the Argentines who had disappeared
during the "Dirty War" period of the 1976–1983 military dictatorship.
Clay or graphic facial reproduction
➢ Forensic facial reconstruction can be used to identify unknown human remains when other
techniques fail. There are several techniques of doing facial reconstruction, which vary
from two dimensional drawings to three dimensional clay models.
➢ The skull provides clues to personal appearance. The brow ridge, the distance between the
eye orbits, the shape of the nasal chamber, the shape and projection of the nasal bones, the
chin's form, and the overall profile of the facial bones all determine facial features in life.
➢ In facial reconstruction, a sculptor, such as Amy Danning pictured at left, familiar with
facial anatomy works with a forensic anthropologist, to interpret skeletal features that
reveal the subject's age, sex, and ancestry, and anatomical features like facial asymmetry,
evidence of injuries (like a broken nose), or loss of teeth before death.
➢ Markers indicate the depths of tissue to be added to the skull (a cast in this case). Studies
over the past century of males and females of different ancestral groups determine the
measures of these depths.
➢ Applying strips of clay, the artist begins to rebuild the face by filing in around the markers.
➢ The artist begins to refine features around the artificial eyes.
➢ The lips take shape
➢ Facial contours have been smoothed and subtle details added to accurately personalize the
reconstruction.
Scanning electron microscopy- scanning electron microscope (SEM) is a type of electron

microscope that produces images of a sample by scanning the surface with a focused beam of
electrons. The electrons interact with atoms in the sample, producing various signals that
contain information about the surface topography and composition of the sample.
Due to its superior performance the SEM is used in an increasing number of various applications
and provides valuable results for instance in the following applications:
• Gunshot residue analysis

• Firearms identification (bullet markings comparison)
• Investigation of gemstones and jewellery
• Examination of paint particles and fibres
• Filament bulb investigations at traffic accidents
• Handwriting and print examination / forgery
• Counterfeit bank notes
• Trace comparison
• Examination of non-conducting materials
• High resolution surface imaging
Bullet Comparison
Bullets fired from the same weapon carry distinct markings which are related to the shape of the
barrel of the gun. Furthermore, it is possible, by matching the characteristic markings on bullets,
to conclude whether they were fired by the same gun. Similar markings are made by the firing
pin on the cartridge case of the bullets, permitting another method of relating a bullet to a
particular gun. Bullets may sometimes be matched using optical techniques. However, optical
microscopy lacks the ability to reveal fine detail seen at higher magnifications, and the depth of
focus to show it clearly.
➢
➢ Low magnification, image of a .45 cartridge. Image courtesy of Terry McAdam Washington
State Patrol Crime Laboratory Seattle USA
➢
➢ Firing pin impression in centre of a .45 cartridge.
➢ Radiographic techniques- Is an imaging technique using x- rays, gamma rays, or similar

ionizing radiation and non- ionizing radiation to view the internal form of an object.
➢ Radiography is an imaging technique using X-rays, gamma rays, or similar ionizing
radiation and non-ionizing radiation to view the internal form of an object. Applications of
radiography include medical radiography ("diagnostic" and "therapeutic") and industrial
radiography.
➢ Radiography can play an important part in forensic odontology, mainly to establish
identification. This may take the precise form of comparison between antemortem and
postmortem radiographs. Radiographs may also be taken to determine the age of a minor
victim and even help in the assessment of the sex and ethnic group. Comparable
radiographs are an essential factor to confirm identification in a mass disaster.
➢ Radiographs are helpful to determine the age of an individual by assessing the stage of
eruption of teeth. Skull radiographs can be used in the identification by superimposing on
antemortem radiograph or photograph. Since frontal sinuses are known for greatest normal
variations among individuals, they are used for this purpose. Radiographs may provide
evidence of bullets or foreign bodies in the soft tissues following firearm incidence and
explosion.
Photo or video superimposition techniques-
The term of photographic superimposition has been applied for a number of techniques in
forensic medicine and dentistry. The comparison of an ante mortem photograph to that of a skull
is one such procedure. Technical information and potential sources of difficulty are discussed.
Finally, two cases
In graphics, superimposition is the placement of an image or video on top of an already-existing
image or video, usually to add to the overall image effect, but also sometimes to conceal
something (such as when a different face is superimposed over the original face in a photograph).
Craniofacial superimposition is a technique used in the field of forensic anthropology to assist in
the analysis of an unknown skull. The process involves superimposing an image of the recovered
skull over an ante mortem image of the suspected individual.
The method of craniofacial superimposition involves comparison of features of a skull with
antemortem photographs of a head and/or face. In the forensic context, photographic
superimposition focuses on a recovered skull that likely is of sufficiently recent origin to be of
medico-legal interest. Forensic scientists employ the technique when positive identification has
not been accomplished but authorities suspect the recovered skull relates to a particular missing
person. Analysis goals focus on determining if (1) the skull could not represent the person
(exclusion), (2) the skull definitely represents the person (positive identification) or (3) the skull
could represent the person. An exclusion indicates that features of the skull are inconsistent with
features of the antemortem photographs to the extent that they could not represent the same
person. Positive identification suggests that the skull and photograph share so many important
features that they represent the same person to the exclusion of all others.
Nostalgia for the Light: The Tools of Forensic Anthropology
Nostalgia for the Light hints at the intersection of forensic anthropology with contemporary
Latin American social movements. These movements aim to find the bodies of persons that had
gone missing under various military regimes in the 1970s and 1980s.
Forensic anthropologists use a variety of processes to determine the fates of their victims:
*Gas chromatography separates chemical substances in the body, and when used in conjunction
with mass spectrometry, which measures the mass of molecules in a substance, can help
toxicologists identify the amount of poison in a body.
*Popularized in crime television shows, forensic radiology uses x-rays, computer tomography
and MRIs to identify severely destroyed bodies and point to potential causes of death.
*Flotation is a process that can be used to recover small artifacts from soil. The soil is placed on
a screen that water can bubble through. The soil then gets separated from other matter like stones
or bones.
*GIS or (geographic information systems) is lastly used to store the coordinates and data of
excavation sites.
In addition to using common tools and equipment such as shovels, trowels, knives and
excavators to investigate sites, many teams will also use:
*anthropometers to measure and establish human stature with found bones
*boley guages to measure teeth
*spreading calipers to measure head length and breadth
*and heat-sensitive infrared cameras to locate new graves, as it can reveal images in the ground
that are not immediately visible above ground.
Forensic investigation
Forensic anthropologists may work with bodies in a variety of conditions, including

as mummies, piles of bones, decomposed bodies, charred remains, and the victims of aircraft
crashes or natural catastrophes. Investigations often begin with a ground search team using
cadaver dogs or a low-flying plane to locate a missing body or skeleton. As
a meticulous examination of any death scene is imperative, forensic anthropologists are
frequently involved at the earliest stages of investigating a human skeleton. After mapping,
photographing, and labeling relevant items at the scene, the osteological evidence is examined at
a forensic laboratory. Bone fragments are sorted according to size and shape and fitted together
when possible.
As experts in osteology, forensic anthropologists focus on human skeletal traits, such

as skull features, dental characteristics, and subcranial bone sizes and shapes, that
vary from individual to individual and from population to population. When compared
with medical and dental records, the presence of bone anomalies, metal plates or pins,
or specific dental characteristics can help to make a positive identification. In addition
to revealing the age, sex, size, stature, health, and ethnic population of the decedent,
an examination of the skeleton may reveal evidence concerning pathology and any
antemortem (before death), perimortem (at the time of death), or postmortem (after
death) trauma. Often the time elapsed since death can be determined by
using forensic entomology, which studies the relationship between insects and
decomposition.
In the case of victims with gunshot wounds to the head, a forensic study of bullet
holes and fractures in a skull can determine the trajectory of bullets through the
cranium. An entrance wound is generally smaller and rounder, whereas the usually
larger exit wound is more ragged and shows external beveling. Markings on a shell or
bullet are photographed through a microscope and compared with information in a
national database for definite identification. If a bullet is not found, then X-rays of the
skull may reveal bullet fragments.
AUTOPSY
Autopsy, also called necropsy, postmortem, or postmortem examination, dissection and
examination of a dead body and its organs and structures. An autopsy may be performed to
determine the cause of death, to observe the effects of disease, and to establish the evolution and
mechanisms of disease processes. The word autopsy is derived from the Greek autopsia,
meaning “the act of seeing for oneself.”
Forensic autopsy
The forensic pathologist goes beyond the mere cause of death; he must establish all the facts,
both lethal and nonlethal, with any potential bearing whatsoever on the criminal or civil
litigation. The cause of death is not automatically revealed when the body is opened; it is not an
isolated tangible and delimited entity; it is a concept—an opinion—as to mechanism or
happening and as such is subject occasionally to differences in interpretation. The legal autopsy
requires meticulous detailed descriptions, measurements, and documentation.
The goal of forensic autopsies is to determine whether or not death was due to natural causes.
Experience in the investigation of the scene of a death in medicolegal cases is important, for the
evaluation of circumstances of death may be critical in establishing the mode of death—
e.g., suicide. The autopsy may not be able, of itself, to determine intent, whereas the scene and
the circumstances may provide unmistakable evidence. Photographic documentation is important
in the medicolegal autopsy.
Purposes
The autopsy deals with the particular illness as evidenced in one individual and is more than
simply a statistical average. Every autopsy is important to expose mistakes, to delimit new
diseases and new patterns of disease, and to guide future
studies. Morbidity and mortality statistics acquire accuracy and significance when based on
careful autopsies; they also often give the first indication of contagion and epidemics. Nor can
the role of the autopsy in medical education be understated. It is the focal point at which the
profession learns to assess and to apply medical knowledge. Thus, the autopsy does more than
merely determine the cause of death. While the medicolegal autopsy in particular has this
important primary objective, most autopsies have a larger purpose.
A REPORT IN FOREN 2
Submitted TO
SUBJECT INSTRUCTOR
Submitted by
Name of reporters
BLANCO, MARIA ANA

EIMAR, DANIELLE
JAVIER, GIAN CARLO
MONTERO, REX JOHN
ROBEJES, JOVAN
VICENTE, JOHN ARNOLD
DELA ROSA, LOVELY JETH
VILLALUZ, ANGELENE Q.
April 20, 2022

FORENSIC ODONTOLOGY
A REPORT IN FOREN 2
SUBMITTED TO;
MRS. SHARON P. CORDERO
SUBJECT INSTRUCTOR
SUBMITTED BY;
REX S. TIAMSON 2A
RON KAYRAN S. PABALINAS 2D
ANTONETTE WAYNE S. CABRILLOS 2D
ELMER P. CANJA 2D
JEANELYN L. SANTIAGO 2D
ZEAN E. ESCALONA 2D
RANIL P. LUMAMPAO 2D
JOHN ROWIE M. SALVACION 2A
APRIL 22, 2022

FORENSIC ODONTOLOGY
OBJECTIVES:
The reporters should be able to;
1. Discuss precisely the history of forensic odontology.
2. Explain the importance of Forensic Odontology when comes to mass disasters and
solving crimes.
3. Recognize and describe identification methods utilized in forensic odontology.
4. Determine and differentiate the significance of forensic odontology among other
personal identification techniques.
INTRODUCTION TO FORENSIC ODONTOLOGY

Forensic odontologists often play an essential role in identifying either victims of disasters or
victims and suspects of individual crimes. They thereby assist the legal authorities in solving
crimes and bringing criminals to justice. Forensic odontologists have other roles as well. For
example, their activities may range from assisting in archaeological expeditions to assessing bite
marks and injuries to the teeth and facial structures for plaintiffs in civil and criminal cases.
defense under certain circumstances may leave information as to the identity of the biter.
Human teeth and dental restorations have proven to remain stable during a long time as well as
in extreme situations such as fire.
HISTORY
• The evolution of forensic odontology started right back in the Garden of Eden.
According to the Old Testament, Eve convinced Adam to put a bite mark in apple. It was
told that “It is always tempting to suggest that the history of bite mark evidence
(forensic dentistry) began with the eating of forbidden fruit in the Garden of Eden.”
• 66 A.D. Nero, the Roman Emperor. Nero’s mother Agrippina had her soldiers kill Lollia
Paulina, with instructions to bring back her head as proof that she was dead. Agrippina,
unable to positively identify the head, examined the front teeth and on finding the
discolored front tooth confirmed the identity of the victim.
• 1193- The first forensic identification in India started in were Jai Chand, a great Indian
• It was used in the identification of Adolf Hitler and his wife Eva Brawn at the end of
World War II.
• 1453- first formally reported case of dental identification was that of the 80 years old
• 1758- Peter Halket was killed in during French and Indian wars in a battle near Fort
• 1870, Ansil L Robinson was charged with the murder of his mistress; Mary Lunsford.
Evidence against Robinson included an attempt to match his teeth to the bite marks on
the victim’s arm.
• Wayne Clifford Boden was a Canadian serial killer and rapist active from 1969-1971. He
• Early in 1775 Revere constructed a silver wire fixed bridge for his close friend Dr. Joseph
Warren, a medical practitioner. At the outset of the war, Warren refused the
appointment of surgeon-in-chief to the continental army. Instead, he requested the
rank of a line officer; Unfortunately, Warren was killed by a bullet that pierced his skull
in the Battle of Bunker Hill.
• 1776- At the battle for Breed’s Hill in Boston, Dr. Joseph Waren was killed in the year
1776. His face was not able to identify as he suffered from a fatal head wound. A
dentist, Paul Revere, identified Dr. Warren, dead body by a small denture that he had
fabricated for him.
• The first forensic odontologist in the United States was Dr. Paul Revere who identified
the extreme body of Dr. Joseph Warren through a bridge of silver and ivory that he had
constructed two years previously.
• In 1897 a paper entitled, “The role of the Dentists in the identification of the victims of
the catastrophe of the Bazar de la Charite, Paris and 4th May, 1897”, was presented by
Dr. Oscar Amoedo (Professor of the dental school in Paris) at the international Medical
Congress of Moscow. The bazar, at which the wealthy women of Paris annually raised
money for projects for the poor, was destroyed within 10 minutes and 126 persons lost
their lives.
• Dr. Oscar Amoedo was considered as the father of the forensic odontologist. The thesis
done by him entitled ‘L’ Art Dentaire en Medicine Leagale’ in 1898 to the faculty of
medicine earned him a doctorate. This book is the first comprehensive text on forensic
odontologist.
• The fire on board the “Scandinavian Star” was one of the world’s worst ferry disasters.
• Sager case involved the murder of a 14 year old girl. The state’s evidence included
identification has reached the level of scientific reliability and credibility to permit its
admission as evidence in criminal proceedings.
• Forensic odontologists successfully identified tsunami victims in South-East Asia in
which about 80% were identified by dental information. This high success rate of dental
identification in Thailand was a matter of surprise for many forensic experts.
• The famous Iroquois theatre in Chicago was burned in 1903 and for about 602 of the
1,842 patrons was died in the theatre. But no records of the identification are found
today. But, Dr. Cigrant quoted in his article that hundreds were unmistakably identified
from the dental records.
• First work in facial reconstruction was done by Kollman and Buchley. The technique that
is proposed by Kollmen and Buchely is still used with modification today. Although
computerized methods are gaining interest today. Belty Pat Gatliff of Oklahoma has
trained a number of forensic dentists in facial reconstruction techniques.
LANDMARK CASES:
• Salem Witch Trial
• 1954, Texas burglary scene with bite mark in cheese (Doyle v. State)
• 1975, California sexual assault with bites to victim’s nose (People v. Marx)
WHAT IS FORENSIC ODONTOLOGY?

• This is the application of dental knowledge to criminal and civil cases.
• Forensic odontology is the application of dentistry to the investigation of crime and
• Forensic Odontology is a branch of science uses the skills of the dentist in personal

The major area of activity of forensic odontology is the identification of human beings, either
dead or alive. This is more so in case of mass disaster, where the corpse is usually badly
mutilated. Other areas of application include criminalistics, in cases involving abuse of children
and elderly. Bite marks also help in detection of culprits. It also renders its service in probing of
dental malpractice, archeology etc.The scope of forensic dentistry is broad & ever-challenging.
Each case is different & even the seemingly routine case may test the dentist’s ingenuity in
applying his dental knowledge.
Functions of Forensic Odontology

• Id unknown human remains through dental records and craniofacial bones.
• Assist at the scene of a mass disaster.
• Age estimations of both living and deceased persons.
• Analysis of bite marks found on victims of attack.
• ID of bite marks in other substances e.g. wood, duct tape, pencils, leather and
foodstuffs.
• Analysis of weapon marks using the principles of bite mark analysis.
• Presentation of bite and weapon mark evidence in court.
• Building a picture of lifestyle and diet at an archaeological site.
Identification of Unknown Remains

Dental identification plays an important role when identification of remains of deceased person
is skeletonized, decomposed, burned or dismembered and is invalid by visual or fingerprint
methods. The identification of remains by dental evidence is possible because, the hard tissues
are preserved after death and can even withstand a temperature of 1600 degree C when
heated without appreciable loss of microstructure, and the status of a person’s teeth change
throughout the life and the combination of decay, missing, filling can be obtained from any
fixed time.
According to American board of forensic odontology dental identification can be divided into
four types:
• Positive identification- The ante-mortem and postmortem data match to establish that
• Possible identification- The ante-mortem and postmortem data have few consistent
• Insufficient evidence- The data is not enough to from the conclusion.
• Exclusion- The ante-mortem and postmortem data clearly inconsistent.
Identification of Human Remains
• Post-Mortem resection of non-viewable remains

• Radiography of intact or fragmented jaws
• Charting of post-mortem examination
• Obtaining and charting of ante-mortem records
• Comparison of data
Postmortem- After death. Latin post = after, mortem = death
Antemortem- Before death. Latin ante = before, mortem = death.
Details for Comparison
• Fillings
• Extractions
• Surface structure/root configuration
• Adjacent teeth
• Twisted/tilted teeth
Steps In Forensic Odontology

• One of the first things they’ll do is obtain a saliva sample from the bite. This, of course,
can be done by others, but a forensic dentist can make sure sample extraction doesn’t
affect quality of the bite mark.
• Next, the forensic dentist will take photographs. This is a technique shared by all
experts, and it’s fairly important to get the lighting, color, and camera angle right. A
linear scale should be placed somewhere in the photograph. A camera angle of 90
degrees is best for a flat surface, while a 40 degree angle causes 25% distortion of a bite
mark.
• Next, the forensic dentist makes multiple impressions, casts, or molds of the bite mark,
and has access to a variety of materials in which to choose the right gum, rubber,
Others use advanced techniques such as scanning electron microscopy, computer-
enhanced digitization, and xeroradiology. Computerized bite analysis software also
exists. Once a suspect is apprehended, the forensic dentist makes one or more
impressions of the suspect’s teeth, comparing them to the recorded bite marks, and if
Dental ageing technique can be broken down into two categories:
• Developmental changes: Developmental changes that occur to the human dentition
while the teeth are growing and emerging into the oral cavity.
1. HARD TISSUE FORMATION- In this method, each tooth is scored based on its
developmental stage and scores are compared with values corresponding to a
particular age.
2. DENTAL ERUPTION- To assess the age of unknown individual, we can compare
the postmortem radiographs of the individual to the eruption standards
produced by the Schour and Massler.
3. THIRD MOLAR ERUPTION- Third molar emergence tends to be around 17-19
years of age.
4. DENTAL MEASUREMENT- This technique was an alternative to the qualitative
assessment where the length of tooth was measured.
• Degenerative changes: That occur once the teeth have erupted and begin to wear down.
There is an intuitive connection between tooth wear and age, as those with more wear
tend to be older.

Bite marks are something else Forensic Odontologist look at. The specific areas of bite
marks would be: the distance from cuspid to cuspid, the shape of the mouth arch, the
evidence of a tooth out of alignment, teeth width and thickness, spacing between teeth,
missing teeth, the curves of biting edges, unique dentistry, and wear patterns such as chips
or grinding. The amount and degree of detail recorded in the bitten surface may vary from
case to case.
Human and animal teeth both leave conspicuous marks. In the flesh, they leave behind
noticeable bruises or puncture marks and in soft foods, such as fruit, marks are also
preserved. In situations where sufficient details are available, it may be possible to identify
the biter to the exclusion of all others. Perhaps more significantly, it is possible to exclude
suspects that did not leave the bite mark or marks. The skin is elastic, tending to slip along
the upper teeth until it catches hold. Depending upon the type of victim, some bite marks
last for hours and others for days, but almost all bite marks alter themselves as time
elapses.
Bite Mark Analysis
• Scaled photography of bite mark evidence

• Scaled photography of dental casts
• Clinical comparisons
• Computer comparisons
Sex Determination
Sex determination is very important subdivision of forensic odontology, which plays a major
role in identification of the unknown individuals in natural disasters; chemical and nuclear
It can be done by this methods:
• Sex difference in tooth dimension: Sex determination by measuring mesiodistal and

buccolingual dimensions is most simple and reliable method for sex determination. Both
the dimensions are more in male than in female.
• Tooth morphology: In male, the distal accessory ridge in canines is more prominent than
in female. In female, there is less number of cusps in mandibular first molar (distobuccal
or distal). These features can be because of evolutionary reduction in the female lower
jaw size.
Bite Marks
• Bite marks may be found on the flesh of victims of a violent attack, particularly on the
stomach, breast or buttocks. Alternatively they may be found on the suspect, left by
victim during self-defense. If a bite mark is only represented as a bruise, it is often
extremely difficult to detect any individual characteristics.
• The bite mark is defined as the physical alteration in or on a medium caused by the
contact of teeth. In few of criminal cases it is seen that suspect or victim has left his or
her teeth marks on another person or inanimate object. The concept of bite mark
evidence is interesting and is there from Roman times.
1. In more aggressive bites –The assailant may suck the soft tissues into the mouth
so that images of palatal and incisal surfaces of teeth may appear. Bites show
laceration of tissue and petechial hemorrhage’s in the center of the wound.
2. In less aggressive bites -the skin may not be completely penetrated so there
can be oval mark mostly of anterior teeth.
• Bite marks change over a time on living as well as dead. If the bite is on living person
there will be post injury changes in the tissue, where bleeding, swelling and
discoloration can be seen. If the bite is on dead Person, then photographs of marks are
taken with standardized technique.

• Study of lip prints is termed as “cheiloscopy.” Lip prints are said to be permanent and
unchangeable. Identification of pattern is possible from 6 th week of intrauterine life.
• Disadvantages are major trauma to lips result in scarring. Surgical treatment also affects
the size and shape of lips. Prints may differ in appearance depending on pressure
DEGREE OF BITE
Forensic dentists use several different terms to describe the type of bite mark:
Hemorrhage – small bleeding spot
Abrasion – undamaging mark on skin
Contusion – ruptured blood vessel, bruise (*most common)
Laceration – punctured or torn skin
Incision – neat puncture of skin
Avulsion – removal of skin
Artifact – bitten-off piece of body
(ADDITIONAL INFORMATION)
TEETH IMPRESSIONS
• Can be left in food, gum and skin

• Connect suspect to bite mark
Why do people bite?
• A sign of perp seeking to degrade the victim while also achieving complete domination.
• Can be found on a suspect when a victim attempts to defend him/herself.
TEETH DIAGRAM AND CHART
• CANINE– (also called cuspid) the pointy tooth located between the incisors and the
premolars. A canine tooth has 1 root. Adults have 4 canine teeth (2 in the top jaw and 2
in the bottom jaw)
• PREMOLARS– (also called bicuspids) the teeth located between the canine and the
molars.The premolar tooth has 1 root. Bicuspids have 2 points (cusps) at the top. Adults
have 8 premolars (4 in the top jaw and 4 in the bottom jaw.
• INCISORS– the front teeth, used for cutting food. An incisor has 1 root. Adults have 8
incisors (4 in the top jaw and 4 in the bottom jaw.
• MOLARS- The relatively flat teeth located towards the back of the mouth, used for
grinding food. Molars in top jaw have 3 roots and 2 roots in the lower jaw. Adults have
12 molars (6 in the top jaw and 6 in the lower jaw.
A Little About Teeth
• 28 adult teeth are usually in by age of 13 (except wisdom, which makes 32, between the
ages of 17 and 25)
• Outside enamel is the hardest substance in body, but can breakdown over time-
grinding cavities.
• Enamel is the thin outer covering of the tooth. This tough shell is the hardest tissue in
the human body. Enamel covers the crown which is the part of the tooth that’s visible
outside of the gums.
How helpful are teeth in identifying human remains?

Answer: EXCELLENT!!!
Teeth remain very intact even through violent crimes, fires, accidents, and advanced
decomposition. DNA is also preserved very well in the pulp of the tooth.
Mass Disasters
• SEPTEMBER 11, 2001 ATTACKS
• SCANDINAVIAN STAR FERRY FIRE
Role in Mass Disaster Management
• Establish hierarchy of leadership

• Procure and implement computer data base
• Establish ante-mortem team
• Establish post-mortem team
• Determine protocol
Importance of Forensic Odontology

“When other means of personal identification techniques can no longer be performed. Forensic
Odontology becomes Significant”
“Forensic Odontology is the last resort of establishing IDENTITY”
DNA PROFILING
A REPORT IN FOREN 2
Submitted to
MRS SHARON P. CORDERO

DNA PROFILING
OBJECTIVES:
After the lesson the students should be able or expected to;

❖ Understand the uses and importance of DNA Profiling.
❖ Determine the relevance and contribution of DNA Profiling in criminal
investigation; and,
❖ Familiarize the different methods used in DNA Profiling
INTRODUCTION
information necessary to build and maintain an organism. It is the hereditary
material. Every cell in the human body has the same DNA. The information of DNA
is stored as a code constituted by four nitrogenous bases: Adenine (A), Thymine
(T), Cytosine (C) and Guanine (G). The order or sequence of these bases determines
the information available for building and maintaining an organism. The human
genome size is about 3,107 megabases (Mb) but only about 1.2 percent of the total
genome encodes for proteins, this is around 20,000 genes, while 98.8 percent is
noncoding DNA2,3, which means that do not encode proteins. Within this group we
have, for example, a variable number of tandem repeats (VNTR), which are
repeated sequences of 9 to 100 base pairs that play a key role in the elaboration of
DNA fingerprinting.
Knowing the main DNA characteristics, specificity is the key to the

emergence of DNA analysis. Numerous other techniques used to determine
biological markers, such as HLA and blood group substances, have been successfully
applied for identification purposes. All are based on exclusion, where markers are
tested until a difference is found. Other factors favoring DNA analysis include the
small sample requirement, the ability to rapidly replicate a sequence a million fold
or more in vitro, and the relative stability of DNA. The point is that DNA analysis
alone can be a definitive test.
Once the technique becomes routine, there is little doubt that, provided a
suitable specimen can be obtained, DNA fingerprinting will be the single best test
for excluding a falsely associated individual.
an individual’s DNA characteristics. DNA analysis intended to identify a species,
rather than an individual, is called DNA barcoding. DNA profiling is a forensic
technique in criminal investigation, comparing criminal suspects’ profiles to DNA
evidence so as to assess the likelihood of their involvement in the crime.

genealogical and medical research. DNA profiling has also been used in the study of
animal and plant populations in the fields of zoology, botany, and agriculture. DNA
profiling is the process where a specific DNA pattern, called a profile, is obtained
from a person or sample of bodily tissue. Even though we are all unique, most of our
DNA is actually identical to other people’s DNA.
polymorphism. Each of us inherits a unique combination of polymorphism from our
mother. DNA polymorphism can be analyzed to give DNA profile. Human DNA
profiles can be used to identify the origin of a DNA sample at a crime scene or
test for parentage.
HISTORY OF DNA FINGERPRINTING

DNA profiling first started out in the80s, and it has been extremely
successful for testing in crime scene,
paternity testing, and predisposition to
disease. The polymerase chain reaction or
PCR, was invented by Kary Mullins in the
United Kingdom, and in 1986, Dr. Alec
Jeffreys made genetic fingerprinting
available to the public. In 1986 was when
DNA was first used in a criminal
investigation by Dr. Jeffreys.
The investigation used genetic fingerprinting in a case of two rapes and

murders that had happened in 1983 and 1986. These crimes happened in a small town
called Leicestershire, which is located in the United Kingdom. They collected
fingerprints and connected them with semen stains collected from where the raping
and murders were located. Then in 1987, DNA evidence was first used in the United
States on Florida, rapist man, Tommie Lee Andrews. After using DNA evidence in his
case, he was then sentenced to 22 years in prisons for the rapes that he had
committed.
Dr. Jeffreys also made it available for people to preform identity tests. Since
the 1980s, DNA testing had just become a popular way of finding out things through
people’s DNA. However, the FBI did not start using DNA testing until 1998, but it
can become very helpful to those who need to find out something in that area.
Thousands of different cases have been cracked and many innocent people have been
freed jail or prison because of the use of DNA provided by family.
Although 99.9%of human DNA sequences are the same in every person, enough
of the DNA is different that it is possible to distinguish one individual from another,
unless they are monozygotic (identical) twins. DNA
profiling uses repetitive sequences that are highly
variable, called variable tandem repeats (VNTRs),
in particular short tandem repeats (STRs), also
known as microsatellites, and minisatellites. VNTR
loci are similar between closely related individuals,
but are so variable that individuals are unlikely to
have the same VNTRs.
In India DNA fingerprinting was
started by Dr. VK Kashyap and Dr. Lalji Singh
was an Indian scientist who worked in the
field of DNA fingerprinting technology in
Indian, where he was popularly known as the
• 1980, Wyman and White laid the foundations

for the concept based on the observation of a
polymorphic DNA locus characterized by a number
of variable-length restriction fragments called
restriction fragment length polymorphisms
(RFLPs), which are specific sequences where
restriction enzymes cleave the DNA.
• 1985 with the paper “Hypervariable

Minisatellite Regions in Human DNA” written by Alec Jeffreys. Jeffreys and
his coworkers were analyzing the human myoglobin gene when they discovered
a region consisting of a 33-base-pair sequence repeated four times. This
tandem repeat was referred to as a minisatellite and similar regions as
hypervariable because the number of tandem repeats is variable both within
a locus and between loci.
• 1987, Nakamura coined the term variable number of tandem repeats (VNTR)
to describe individual loci where alleles are composed of tandem repeats that
vary in the number of core units. When DNA is isolated, cleaved with a specific
enzyme, and hybridized under low-stringency conditions with a probe
consisting of the core repeat, a complex ladder of DNA fragments is
detected. This profile appears to be unique to each individual. Different core
repeats were later isolated and used to produce a number of different probes
useful for fingerprinting. For that time, this technique was unknown but its
potential was evident.
testing, actually a maternity test, with paternal DNA unavailable.
• In this unusual case, a mother with her little 13 years old son were arrested
in the airport when they arrived in England from Ghana because the
authorities thought that he was not her son. A DNA fingerprinting applied to
both demonstrated that, effectively, they told the truth.
• The first application of DNA fingerprinting in forensic identification

happened later that same year, in a case that beautifully exemplifies the
power of DNA evidence to link crime-scenes, to exclude suspects, and to
support convictions. A suspect was arrested for allegedly committing a double
rape and suicide to 2 minors. A DNA fingerprinting using a sample of semen
left in the crime scene demonstrated that a man had been responsible for
both crimes but it was not the arrested suspect. He was released and the real
culprit was arrested. Nowadays, this technique is still used to create DNA
profile of each individual in order to clarify some crimes or parentage testing.

DNA Fingerprinting is the technology which is used to identify individuals on
the basis of the molecular characteristics of the DNA. More specific, this method
uses VNRT because the number of bases and repeats within a locus is unique to each
individual. For example, an individual can have in his genome the sequence gatagata
and this repeats 10 times and another can have the same sequence but only repeats
5 times.
The technique is used, as we have seen before, in parentage testing and
forensic cases but it can be used for anthropological genetics, zoology, and botany
among others disciplines. Importantly, the technique of DNA Fingerprinting is very
sensitive, which means that it can also generate data even from half (partially)
decomposed biological material.

The steps involve others techniques used in Molecular Biology, such as
polymerase chain reaction (PCR) and electrophoresis among others. The following are
the steps to generate a DNA
fingerprinting;
• The DNA is extracted from the
nuclei of any cell in the body.
• The DNA molecules are
broken with the help of
enzyme restriction
endonuclease (called
chemical knife) that cuts
them into fragments. The fragments of DNA also contain the VNTRs.
• The fragments are separated according to size by gel electrophoresis in
agarose gel.
• The separated fragments of single-stranded DNA are transferred onto a
nylon membrane. Radioactive DNA probes having repeated base sequences
complementary to possible VNTRs are poured over the nylon membrane.
Some of them will bind to the single-stranded VNTRs. The method of
• The nylon membrane is washed to remove extra probes.
• An X-ray film is exposed to the nylon membrane to mark the places where
the radioactive DNA probes have bound to the DNA fragments. These
places are marked as dark bands when X-ray film is developed. This is
known as autoradiography.
• The dark bands on X-ray film represent the DNA fingerprints (DNA
profiles).
PROFILING PROCESS
The process, developed Glassberg and independently by Jeffreys, begins with
a sample of an individual’s DNA (typically called a “reference sample”). Reference
samples are usually collected through the buccal swab. When this is unavailable (for
example, when a court order is needed but unobtainable) other methods may be
needed to collect a sample of blood, saliva, semen, vaginal lubrication or other fluid
or tissue from personal use item (for example, a toothbrush, razor) or from stored
samples (for example, banked sperm or biopsy tissue). Samples obtain from blood
relatives can indicate an individual’s profile, as could previous profile human remains.
A reference sample is then analyzed to create the individual’s DNA profile
using one of the techniques discussed below. The DNA profile is then compared
against another sample to determine whether there is a genetic match.
DNA FINGERPRINTING APPLICATIONS

Since Alec Jeffreys developed the DNA fingerprinting technique, it has been
used in different scientific fields. In forensic investigations has helped to send to
prison criminals, and identify victims of crimes, natural disaster, wars. Paternity
disputes have been resolved thanks to this method.

others have driven profiling research in order to interpret the origin and behavior
of some species. In the next lines, we are going to describes how the technique has
been applied and evolved in the areas mentioned above.
DNA EXTRACTION
When a sample such as blood or saliva is obtained, the DNA is only a small part
of what is present in the sample. Before the DNA can be
analyzed, it must be extracted from the cells and purified.
These are many ways this can be accomplished, but all methods
follow the same basic procedure. The cell and nuclear
membranes need to be broken up to allow the DNA to be free
in solution.
Once the DNA is free, it can be separated from all
other cellular components. After the DNA has been separated
in solution, the remaining cellular debris can then be removes
from the solution and discarded, leaving only DNA.
The most common methods of DNA extraction include organic extraction (also called
phenol chloroform extraction), Chelex extraction, and solid phase extraction.
Differential extraction is modified version of extraction in which DNA from two
different types of cells can be separated from each other before being purified
from the solution.
Each method of extraction works well in the laboratory, but analyzed typically
selects their preferred method based on factors such as the cost, the time involved,
the quality of DNA yielded, and the quality of DNA yielded. After the DNA is
extracted from the sample, it can be analyzed, whether it is by RFLP analysis or
quantification and PCR analysis.
RFLP (RESTRICTION FRAGMENT LENGTH POLYMORPHISM)

ANALYSIS
The first methods for finding out genetics used for DNA profiling involved
RFLOP analysis. DNA is collected from cells and cut into small pieces using a
restriction enzyme (a restriction digests).
This generates DNA fragments of
differing sizes as a consequence of
variations between DNA sequences of
different individuals. The fragments are
then separating on the basis of size using
gel electrophoresis.
The separated fragments are then
transferred to a nitrocellulose or nylon
filter; this procedure is called a Southern
Blot. The DNA fragments within the blot are permanently fixed to the filter, and
the DNA strands are denatured. Radiolabeled probe molecules are then added that
are complementary to sequences in the genome that contain repeat sequences. These
repeat sequences tend to vary in length among different individuals and are called
variable number tandem repeats sequences or VNTRs.
The probe molecules hybridize to DNA fragments containing the repeats
sequences and excess probe molecules are washed away. The blot is then exposed to
an X-ray film. Fragments of DNA that have bound to the probe molecules appear as
fluorescent bands on the film.
The Southern blot techniques requires large amounts of non-degraded sample
DNA. Also Karl Brown’s original techniques looked at many minisatellite loci at the
same time, increasing the observe variability, but making it hard to discern individual
alleles (and thereby precluding paternity). These early techniques have been
supplanted by PCR-based assays.

Develops by Kary Mullins 1983, a process was reported by which specific
portions of the sample DNA can be amplified
almost identify (Saiki et al. 1985, 1985). The
process polymerase chain reaction PCR,
mimics the biological process of DNA
replication, but confines it to specific DNA
sequence of interest. With the invention of
the PCR technique, DNA profiling took huge
strides forward in both discriminating power
and the ability to recover information from
very small (or degraded) starting samples.
PCR greatly amplifies the amount of a specific regions of DNA. In the PCR
process, the DNA sample is denaturing into the separate individual polynucleotide
strands through heating. Two oligonucleotide DNA primers are used to hybridize to
two corresponding nearby sites on opposite DNA strands, in such a fashion of the
normal enzymatic extension of the active terminal of each primer (that is, the 3’
end) leads toward the other primer.
PCR uses replication enzymes that are tolerant of high temperatures, such as
the thermostable tag polymerase. In this fashion, two new copies of the sequence
of interest are generated. Repeated denaturation, hybridization, and extension in
this fashion produce an exponentially growing number of copies of the DNA of
interest.
Instrument that perform thermal cycling are readily available from
commercial sources. This process can produce a million-fold or greater amplification
of the desired region in 2 hours or less.

One of the current techniques for DNA profiling
uses polymorphism called short tandem repeats. Short
tandem repeats or STR are regions of non-coding DNA
that contain repeats of the same nucleotide sequence.
For example, GATAGATAGATAGATAGATAGATA is an
STR where the nucleotide sequence GATA is repeated
six times.
STRs are found at different places or genetic loci in a
person’s DNA.

Another technique, AFLP or amplified
fragment length polymorphism was also put into
practice during the early 1990s. This technique
was also faster than RFLP analysis and use PCR to
amplify DNA samples. It relied on variable
number tandem repeat (VNTR) polymorphisms to
distinguish various alleles, which were separated
on a polyacrylamide gel using allelic ladder (as
opposed to a molecular weight ladder).
Bands could be visualized by silver staining
the gel. One popular focus for fingerprinting was
the D1S80 lucos. As with all PCR based methods,
highly degrade DNA or very small amounts of DNA may cause allelic dropout (causing
a mistake in thinking a heterozygote is a homozygote) or other stochastic effects.
In addition, because the analysis is done on a gel, very high repeats may bunch
together at the top of the gel, making it difficult to resolve. AmpFLP analysis can be
highly automated, and allows for easy creation of phylogenetic trees based on
comparing individual sample of DNA. Due to its relatively low cost and ease of set-
up and operation. AmpFLP remains popular in lower income countries.
FORENSIC INVESTIGATIONS
technology. To summarize the methodology, genetic material like blood, semen,
saliva, hair and skin found at the crime scene are processed, and afterward the
samples are compared with the DNA of the suspects, in order to determine guilt or
innocence of the accused.
DNA fingerprinting markers have evolved since 1984. In the beginning, sets
of minisatellites or oligonucleotides stretches were used, also called multi-locus
probes (MLP) which detected sets of 15 to 20 variable fragments per individual
ranging from 3.5 to 20 kb in size. Minisatellites were replaced because they needed
a large amount of molecular weight of DNA, usually not found at the crime scene and
errors in the linkage between loci.
For this reason, was changed by single locus probe (SLP) which recognized
single hypervariable locus, using high stringency hybridization and just 10 ng of
DNA8. Multilocus and Single Locus probes were part of the so called restriction
fragment length polymorphism (RFLP) - based methods were still limited by the
available quality and quantity of the DNA. Those procedures were replaced by PCR
based methods because they improved sensitivity, speed, and genotyping precision.
PCR-based methods use microsatellites as markers instead of minisatellites;

microsatellites as short tandem repeats (STRs) are more sensitive and less prone to
allelic dropout than VNTR (variable number of tandem repeat) systems8.
In cases, when there exist a low proportion of nuclear DNA samples, lineage
marker is used which are obtained from mitochondrial and Y DNA, and they are very
useful to reconstruct the paternal and maternal relationship and historical
reconstruction in unidentified remains typically skeletonized, hair shafts without
roots, or very old specimens where only heavily degraded DNA is available likewise
samples of sexual assault without ejaculation, sexual assault by a vasectomized male,
male DNA under the fingernails of a victim, male ‘touch’ DNA on the skin.
PARENTAGE TESTING
DNA fingerprinting is an advantageous technique in cases, such as, of
establishing the paternity of disputed offspring or cases of baby swapping. This
method replaced ABO blood antigen systems which cannot establish paternity but
can conclusively exclude an alleged father from being a candidate.
Disputed paternity originates because of affiliation orders, divorce proceedings
and questioned the legitimacy, also is used to discover paternity in cases of
inheritance, guardianship, maintenance, legitimacy, adultery or fornications.
In Parentage testing, a DNA comparison is performed between progeny

against potential parents. Children inherit half of their alleles from each parent and
thus should possess an alleles combination of their parents.
ANTHROPOLOGICAL GENETICS
markers to reconstruct the human diaspora and to interpret the evolutionary history
of human populations to inquire population origins, migration, admixture and
adaptation to different environments, as well as susceptibility and resistance to
disease.
specific non-recombining region (NRY) haplotypes, and single nucleotide
polymorphisms (SNPs).
In the medical field, researchers have made possible the mapping quantitative
trait loci involved in biological pathways of diseases such as diabetes mellitus,
cancers, obesity, osteoporosis, and coronary heart disease. In the studies of
population, markers allow identifying the presence, absence, or high frequency in
some populations and low frequencies in others, of certain genetic traits that
characterize some specific population11.
BOTANY
DNA fingerprinting is an essential tool for genotype identification in both wild
plant and cultivated species. DNA profiling is used for protection of biodiversity,
identifying markers for traits, identification of gene diversity and variation.
Identification in plants always been an issue for botanists because of the large
variability of the composition and relative amount of chemicals in particular species
of the plant varies with growing condition, harvesting period, post-harvesting period
and storage conditions.
Repeats (SSR), Sequence Characterized Amplified Region (SCAR), Cleaved Amplified
Polymorphic Sequence (CAPS) and Single Nucleotide Polymorphism (SNP).
DNA markers help to study fundamental evolutionary influences of natural

selection, mutation, gene flow and genetic drift on wild plant populations and identify
groups are characterized by highly variable ploidy levels, often even within the same
species. Moreover, the method detects both ancient and ongoing hybridization
between crops and wild species.
ZOOLOGY
In Zoology, DNA fingerprinting determine the genetic identity of individuals
and measure genetic variation in natural populations, allowing true genetic
from field observations. Furthermore, it helps to test predictions of kin selection
models in a realistically way, and detect hybrids species.
The DNA marker clarified mating system in reproductive ecology for example
in vertebrates that give birth to more than one offspring has revealed concurrent
multiple paternities. This kind of behavior has been observed in a wide range of
organisms, particularly in reptiles.

isolation, and the particulars of inter-population gene flow, also now they are being
used to document levels of genetic variation in rare and endangered species and thus
better inform conservation management actions.
DNA PROFILING IN FORENSIC SCIENCE

DNA- was first described by Watson and crick in 1953, as double-stranded
molecule that adopts a helical arrangement. Each individual’s genome contains a
large amount of DNA that is a potential target for DNA profiling.
-it is often described as the “blue print of the life”, because it contains all
the information that an organism requires in function and reproduction.
Sources of biological evidence

Human body is composed of trillions of cells and most of them are
nucleated cells, except for the red blood cells. Each nucleated cell contains
two copies of individual’s genome and can be used to generate a DNA profile.
Usually, samples show some level of degradation but when the level is high,
more cellular material is needed to produce a DNA profile.
Biological samples with nucleated cells are essential for forensic

genetic profiling, such as:
• Liquid blood or dry deposits

• Liquid saliva ,semen or dry deposits
• Hard tissues like bone and teeth
• Hair with follicles
Collection and handling of material at the crime scenes

Whole blood is considered as one of the widely used source of DNA .It is
preserved in an anticoagulant (Ethylenediamine tetra acetic acid) and conserved at
4 degrees Celsius for 5 to 7 days initially. After this period, DNA samples are kept
at -20 degrees Celsius for few weeks or at 80 degrees Celsius for longer periods
of time. Epithelial cells collected from crime scenes are harvested with sterile
brush or bud. After harvesting, they are wrapped in plastic envelope or paper
envelope and kept in a dry environment at room temperature. It is essential that
proper care is taken, such as maintaining integrity of the crime scene, wearing face
masks and full protective suits during the investigation of scene, as inappropriate
handling of the evidence can lead to serious consequences. In worst cases, cross-
contamination leads to high level of sample degradation; this can confuse or avert
the final result of evidence.
Characterization of DNA Analysis: Basic Steps
Analysis of DNA involves four basic steps, which are as follows;
1. DNA extraction.
2. DNA quantification.
3. DNA amplification.
4. Detection of the DNA-amplified products.
DNA Extraction
The first DNA extraction was performed by Friedrich Miescher in 1869. Since
then, scientists have made progress in designing various extraction methods that
are easier, cost-effective, reliable, faster to perform, and producing a higher
yield. With the advent of gene-editing and personalized medicine, there has been
an increase in the demand for reliable and efficient DNA isolation methods that
can yield adequate quantities of high-quality DNA with minimal impurities. There
are various methods of extraction as mentioned below, though commonly used are
Chelex-100 method, silica-based DNA extraction, and phenol–chloroform method.
1. Chromatography-based DNA extraction method.

2. Ethidium bromide–cesium chloride (EtBr-CsCl) gradient centrifugation method.
3. Alkaline extraction method.
4. Silica matrices method.
5. Salting-out method.
6. Cetyltrimethylammonium bromide (CTAB) extraction method.
7. Phenol–chloroform method.
8. Sodium dodecyl sulfate (SDS)-proteinase K method.

9. Silica column-based DNA extraction method.
10. Magnetic beads method.
11. Cellulose-based paper method.
12. Chelex-100 extraction method.
13. Filter paper-based DNA extraction method.
Chromatography-Based DNA Extraction Method

Chromatography-based DNA extraction method is used to isolate DNA from any
kind of biological material. This method is divided into three different types:
1. Size-inclusion chromatography: In this method, molecules are separated

according to their molecular sizes and shape.
2. Ion-exchange chromatography (IEC): In this method, solution containing DNA
anion-exchange resin selectively binds to DNA with its positively charged
diethylaminoethyl cellulose group. This method is simple to perform when compared
with other DNA extraction methods.
3. Affinity chromatography: Protocol is similar to IEC; however it uses oligo that
forms specific interaction with nucleic acid resulting in separation from the cell
lysate.
• This procedure is used for isolation of messenger ribonucleic acid (m-RNA).
• It is time-efficient.
• It yields a very good quality of nucleic acids.
EtBr-CsCl Gradient Centrifugation Method

In 1957, Meselson et al developed this method.22 DNA is mixed with CsCl solution,
which is then ultra-centrifuged at high speed (10,000–12,000 rpm) for 10 hours,
resulting in separation of DNA from remaining substances based on its density.
EtBr is incorporated more into nonsupercoiled DNA than supercoiled DNA
molecules resulting in accumulation of supercoiled DNA at lower density, and
location of DNA is visualized under ultraviolet (UV) light.
Advantage:
• This method is used to extract DNA from bacteria.
Limitations:
• Greater amount of material source is needed.
• Time-consuming.
• Costly procedure due to long duration of high-speed ultracentrifugation.
• Complicated method.
Alkaline Extraction Method
First introduced by Birnboim and Doly in 1979, this method is used to extract
plasmid DNA from cells. Sample is suspended in NaOH solution and SDS detergent
for lysis of cell membrane and protein denaturation. Potassium acetate is then
added to neutralize the alkaline solution, which results in formation of precipitate.
Plasmid DNA in the supernatant is recovered after centrifugation.
Limitation:
• Contamination of plasmid DNA with fragmented chromosomal DNA.
Silica Matrices Method

The affinity between DNA and silicates was described by Vogelstein and Gillespie
in 1979.
Principle:
Selective binding of negatively charged DNAwith silica surface is covered with

positively charged ions. DNA tightly binds to silica matrix, and other cellular
contaminants can be washed using distilled water or Tris-EDTA.27
Advantages:
• Simple.
• Fast to perform.
• Cost-efficient.
Limitation:
• Silica matrices cannot be reused.
Salting-Out Method
Introduced by Miller et al55 in 1988, this method is a nontoxic DNA extraction
method.
Procedure:
Sample is added to 3 mL of lysis buffer, SDS, and proteinase K, and incubated at

55 to 65°C overnight. Next, 6 mL of saturated NaCl is added and centrifuged at
2,500 rpm for 15 minutes. DNA containing supernatant is transferred into fresh
tube and precipitated using ethanol.28
Advantages:
• This method is used to extract DNA from blood, tissue homogenate, or
suspension culture. • High-quality DNA is obtained.
• Cost-efficient.
• Reagents are nontoxic.
Cetyltrimethylammonium Bromide (CTAB) Extraction Method
This method was introduced by Doyle et al in 1990. Samples are added to 2% CTAB
at alkaline pH. In a solution of low ionic strength, buffer precipitates DNA and
acidic polysaccharides from remaining cellular components. Solutions with high salt
concentrations are then added to remove DNA from acidic polysaccharides; later,
DNA is purified using organic solvents, alcohols, phenols, and chloroform.
Limitations:
• Time-consuming method.
• Toxic reagents like phenol and chloroform are used.
Phenol–Chloroform Method
This method was introduced by Barker et al in 1998.31 Lysis containing SDS is
added to cells to dissolve the cell membrane and nuclear envelope; phenol–
chloroform–isoamyl alcohol reagent is added in the ratio 25:24:1. Both SDS and
phenol cause protein denaturation, while isoamyl alcohol prevents emulsification and
hence facilitates DNA precipitation. The contents are then mixed to form biphasic
emulsion that is later subjected to vortexing. This emulsion separates into two
phases upon centrifugation, upper aqueous phase, composed of DNA, and the lower
organic phase, composed of proteins. Upper aqueous phase is transferred to fresh
tube and the lower organic phase is discarded. These steps are further repeated
until the interface between the organic and aqueous phase is free from protein.
Later, sodium acetate solution and ethanol are added in 2:1 or 1:1 ratio, followed by
centrifugation for separation of DNA from the solution. The pellet is washed with
70% ethanol to remove excess salt from the DNA and subjected to centrifugation
for removal of ethanol. The pellet is dried and suspended in an aqueous buffer or
sterile distilled water.
Advantages:
• Used to extract DNA from blood, tissue homogenate, and suspension culture.
• Inexpensive.
• Gold standard method.
Limitation:
• Toxic nature of phenol and chloroform.
SDS-Proteinase K Method
It was first introduced by Ebeling et al in 1974.32 For extraction of DNA, 20 to

50 µL of 10 to 20 mg/mL proteinase (K) is added. SDS is added to dissolve the cell
membrane, nuclear envelope, and also to denature proteins. The solution is
incubated for 1 to 18 hours at 50 to 60°C and then DNA can be extracted using
the salting-out method or phenol–chloroform method.
Silica Column-Based DNA Extraction Method
In this method, 1% SDS, lysis buffer (3 mL of 0.2 M tris and 0.05 M EDTA), and
100 mg of proteinase K are added to sample and incubated at 60°C for 1 hour, and
this mixture is added in a tube containing silica gel. To this, phenol–chloroform is
added in the ratio of 1:1 and centrifuged for 5 minutes. This separates the organic
phase containing proteins beneath the silica column while aqueous phase containing
DNA above the gel polymerase, and then aqueous layer is transferred to the tube
and dissolved in TE buffer.
Advantages:
• Increase in purity of extracted DNA.
• Silica gel prevents physical contact with toxic reagents.
• DNA yield is 40% higher than organic solvent-based DNA extraction method.34
Magnetic Beads Method
Trevor Hawkins filed a patent “DNA purification and isolation using magnetic
particles” in 1998.35 Magnetic nanoparticles are coated with DNA-binding antibody
or polymer that has specific affinity to bind to its surface.36 In this method, a
magnetic field is created at the bottom of the tube using an external magnet that
causes separation of DNA-bound magnetic beads from cell lysate. The supernatant
formed is rinsed, and beads aggregated at the bottom can be eluted with ethanol
precipitation method; and the magnetic pellet is incubated at 65°C to elute the
magnetic particles from the DNA.28
Advantages:
• Time taken is less than 15 minutes.
• Faster compared with other conventional methods.
• Little equipment is required.
• Less cost.19,37
Cellulose-Based Paper
It was first introduced by Whatman in 2000, who filed a patent titled “FTA-
coated media for use as a molecular diagnostic tool.” Cellulose is a hydroxylated
polymer with high binding affinity for DNA. Whatman FTA cards are commercially
available as cellulose-based paper that is widely used for extraction of DNA.38
They are impregnated with detergents, buffers, and chelating agents that
facilitate DNA extraction. About 1 to 2 mm of sample area is removed with micro
punch and further processed for downstream applications.19,39
Advantages:
• Extraction of DNA using cellulose-based paper is fast.
• Highly convenient.
• Does not require laboratory expertise.
• Easy storage of sample.40
Chelex-100 Extraction Method

In 2011, Xlonghui et al40 patented a DNA extraction method using Chelex-
100. Chelex resin is used to chelate metal ions acting as cofactors for DNases.
After incubating overnight, 5%
Chelex solution and proteinase K are used to degrade the added DNases, which
are later boiled in 5% Chelex solution to lyse the remaining cell membranes, and to
denature both proteins and DNA. Also, 5% Chelex solution prevents DNA from
being digested by DNases that remain after boiling, hence stabilizing the
preparation. The resulting DNA can then be concentrated from the supernatant
after centrifugation.
Advantages:
• Reduced risk of contamination.
• Use of single test tube.
Limitation:
• Isolated DNA can be unstable.
Filter Paper-Based DNA Extraction Method
This method was described by Ruishi and Dilippanthe in 2017. DNA extraction
method using filter paper can be used to isolate DNA from plant sources. A spin
plate composed of 96-well plate is used, with a hole 1 mm in diameter drilled into
bottom of each well used, and each well containing a disk of 8 mm diameter
Whatman FTA filter paper. Samples subjected to lysis buffer are filtered with
centrifugation.
Advantage:
• Less cost.
DNA Quantification
After DNA extraction, an accurate measurement of the amount and quality of
DNA extract is desirable. When the correct amount of DNA is added to PCR, it
results in best quality within short duration of time. Adding less or more amount of
DNA will results in a profile that is difficult or impossible to interpret. Quantity
of DNA that can be extracted from a sample depends on the type of model.
Quantity of DNA in different biological samples is shown in ►Table 1.
Table 1 Various sources of biological evidence
Type of sample Amount of DNA
Liquid blood 30,000 ng/mL
Stain of blood 200 ng/cm2
Liquid saliva 5,000 ng/mL
Hair (with root) shed 1–12 ng/root
Hair (with root) plucked 1–750 ng/root
Liquid semen 250,000 ng/mL

Postcoital vaginal swab 0–3,000 ng/swab
Oral swab 100–1,500 ng/swab
Urine 1–20 ng/mL
Bone 3–10 ng/mg
Tissue 50–500 ng/mg
Classification of Quantification
DNA quantification can be classified as follows:
1. Nonnucleic acid-based quantification methods.

• Microscopic and macroscopic examination.
• Chemical and immunological methods.
2. DNA-based total genomic methods.

• Intact and degraded DNA–UV spectrometry.
*PicoGreen homogenous microtiter plate assays.

• Intact vs degraded DNA–agarose gel electrophoresis.
3. Real-time PCR, DNA-based target specific methods.

• Human total autosomal DNA.
• Y chromosome DNA, mitochondrial DNA (mt-DNA), Alu repeat real-time PCR.
• Multiplex real-time PCR.
4. End-point PCR DNA quantification and alternative DNA detection methods.

5. RNA-based quantification.
Visualization on agarose gels

Advantages:
• It is relatively easy and quick method for assessing both quality and quantity of
extracted DNA.
• Gives indication of size of extracted DNA molecules.
Disadvantages:
• Quantification is subjective.
• Total DNA obtained can be mixture of human DNA and microbial DNA and this
can lead to overestimation of DNA concentration.
Ultraviolet Spectrometry
Spectrometry is commonly used for quantification of DNA in molecular biology but
has not been widely adopted by the forensic community. Usually, DNA absorbs light
maximally at 260 nm; this feature is used to estimate the amount of DNA
extraction by measuring wavelengths ranging from 220 nm to 300 nm. With this
method, it is possible to assess the amount of protein (maximum absorbance is 280
nm) and carbohydrate (maximum absorbance is 230 nm). If the DNA extract is
clean, the ratio of absorbance should be between 1.8 and 2.0.
Disadvantages:
• Difficult to quantify small amounts of DNA.

• It is not human specific.
Fluorescence Spectrometry
EtBr or 4,6 diamidino-2-phenylindole can be used to visualize DNA in agarose gels.
In addition to staining agarose gels, fluorescent dyes can be used as an alternative
to UV spectrometry for DNA quantification. PicoGreen dye is commonly used
because it is specific for double-stranded DNA as it has the ability to detect little
amount of DNA as 25 pg/mL.
Disadvantage:
• Nonhuman specific.
DNA Amplification
There are eight DNA- and RNA-based techniques, but PCR and reverse
transcription-PCR have been the predominant techniques. PCR is the commonly used
method of amplification of DNA. PCR amplifies specific regions of DNA template;
even a single molecule can be amplified to 1 billion fold by 30 cycles of
amplification. DNA amplification occurs in cycling phase, which consists of three
stages.
1. Denaturation.
2. Annealing.
3. Extraction.
Normal range of PCR cycle is between 28 and 32; when DNA is very low, then
cycles can be increased to 34 cycles.
Other methods are as follows:

• Nucleic acid sequence-based amplification method.
• Strand displacement amplification.
• Recombinase polymerase amplification.
• Strand invasion-based amplification.
• Multiple displacement amplification.
• Hybridization chain reaction.
After the amplification of DNA, the final step is detection of the DNA-amplified
products.
Detection of the DNA-Amplified Products
The following methods are used in forensic human identification:

1. Autosomal short-tandem repeat (STR) profiling
2. Analysis of the Y chromosome
3. Analysis of mt-DNA.
4. Autosomal single-nucleotide polymorphism (SNP) typing.
Autosomal STR Profiling

STRs were discovered in 1980. Since then, they are considered as gold standard in
human identification in forensics. STR or microsatellites are the most frequently
genotyped to distinguish between individuals. STR consists of mononucleotide,
dinucleotide, trinucleotide, tetranucleotide, pentanucleotide, and hexanucleotide
repeats of which tetranucleotide repeats are used for genotyping. STR profiling is
used in paternity/maternity testing, rape perpetrators’ identification, kinship
testing, and disaster victim identification. STR-based DNA analysis in forensic has
been well accepted by professionals and population as an important tool in criminal
justice and in human identification.
Advantages:
• The test is simple
• Can be done rapidly.49
Analysis of the Y Chromosome
Typically, biologically a male individual has 1 Y chromosome and contains 55 genes.

Because of this unique feature, analysis of Y chromosome is done in crime cases.
Application of Y chromosome in forensic medicine:
It is present only in males. Thus, in crime cases, the investigators expect to find
Y chromosome at the crime scene. Also, when talking about male–female ratio in
body fluid mixtures, such as sexual assault or rapes, by analyzing the Y-STR
component, the investigators can obtain more information regarding the male
component. It is well known that azoospermic or vasectomized rapists do not leave
semen traces, and it is impossible to find spermatozoa on the microscopic
examination. In such cases, the Y-STR profiling is very useful, offering information
regarding the identity of the accused person.
Analysis of Mitochondrial DNA (mt-DNA)
mt-DNA is inherited from mother; thus all the members of a matrilineal family
share the identical haplotype.
Advantages:
• mt-DNA has 200 to 1,700 copies per cell.
• Increased probability of survival when compared to nuclear DNA.
Applications:
• Analysis of biologic samples that are severely degraded or old.
• Samples with low amount of DNA (e.g., hair shafts).
Autosomal Single-Nucleotide Polymorphism Typing
SNP has a lower heterozygosity when compared with STRs. Advantage of SNP
typing over STR is that the DNA template size can be as large as 50 BPs, compared
with STRs that need a size of 300 BPs to obtain good STR profiling. Due to this
reason, SNP has become an important tool in analyzing degraded samples. Thus in
the 2001 World Trade Center disaster, victims were identified using SNP typing.
Impact of Genetic Identification in Justice

Genetic testing using DNA has been widely applicable to the field of justice. This
method is being used for the following:
• Identification of accused and confirmation of guilt.
• Exculpation of innocent ones.
• Identification of persons who commit crimes or serial killers.
• Identification of victims in disasters.
• Establishing consanguinity in complex cases.
Conclusion
Currently, the DNA genotyping of all types of microtraces or biological traces
containing nucleated cells is possible if they are not entirely demolished, either
chemically or by bacteria. The DNA analysis is an important tool in solving
caseworks in forensic medicine, such as establishing the custody of a child through
paternity or maternity tests, identifying victims from crimes or disasters, or
exonerating innocent people convicted to prison.
DNA PROFILING
A REPORT IN FOREN 2
Submitted to
SUBJECT INSTRUCTOR
Submitted by
Anjo Karl Sapul
Wilsid Bench Tabalanza
April Joy Meanagua
Jirah Jane Cabrillos
Ryan Dave Tuyo
Mel Anthony Pamisaran
Reymund Castillon
Aj Gicaraya
2nd year Alpha-Delta

April 21, 2022
A REPORT IN FOREN 2
Submitted to:
SUBJECT INSTRUCTOR
Submitted by:
CABRELA, EDA-JANE V.
HUERA, BOBB BENEDICT
MASANIT, RIXCY
VILLASIS, JOHN KARL
JOSE,
April 20, 2022
OBJECTIVES
- Assist law enforcement with the location and recovering of human remains at crime scene.
- Cleans the bones so that they may be examined.
- Analyze skeletal remains to establish the biological profile of the individual.

Forensic anthropology is the application of the anatomical science of anthropology and its various
subfields, including forensic archaeology and forensic taphonomy in a legal setting. A forensic anthropologist
can assist in the identification of deceased individuals whose remains are decomposed, burned, mutilated or
otherwise unrecognizable, as might happen in a plane crash. Forensic anthropologists are also instrumental
in the investigation and documentation of genocide and mass graves.
Along with forensic pathologists, forensic dentists, and homicide investigators, forensic
anthropologists commonly testify in court as expert witnesses. Using physical markers present on a skeleton,
a forensic anthropologist can potentially determine a person's age, sex, stature, and race.
This is useful in identifying living individuals for legal purposes such as illegal immigrants. This is
extremely important in legal cases where the court needs to decide if they will judge an individual as an adult
or a minor. In addition to identifying physical characteristics of the individual, forensic anthropologists can
use skeletal abnormalities to potentially determine cause of death, past trauma such as broken bones or
medical procedures, as well as diseases such as bone cancer.
The methods used to identify a person from a skeleton relies on the past contributions of various
anthropologists and the study of human skeletal differences. Through the collection of thousands of
specimens and the analysis of differences within a population, estimations can be made based on physical
characteristics. Through these, a set of remains can potentially be identified. The field of forensic
anthropology grew during the twentieth century into a fully recognized forensic specialty involving trained
anthropologists as well as numerous research institutions gathering data on decomposition and the effects it
can have on the skeleton.
• Forensis (Latin- pertaining to the forum)
• Anthropos (Greek- human or man)
• Logia (Greek- study)

• Establishing the identity of the deceased that involves skeletal remains.
• Forensic anthropology applies the science of physical or biological anthropology to the legal process.
• Forensic anthropologists analyze human remains, typically in criminal investigations. Their study of
• Formative Period (1849-1938)
quite a bit of money. However, two anatomists (Drs. Oliver Wendell Holmes and Jeffries
Wyman) successfully reassembled the skeletal remains and determined that they matched
the stature, ancestry (Caucasian), and approximate age of Dr. Parkman.
• 1894, Thomas Dwight - gave his Shattuck Lecture about the analysis of human skeletal
remains in a legal setting. He was rightfully hailed as the "Father of Forensic Anthropology."
• Consolidation Period (1939-1971):

• 1954 by Tom McKern and T. Dale Stewart- published skeletal age changes in young
American males. Established skeletal aging techniques based on data from skeletal remains
of Korean War soldiers.
• Modern Period (1972-1999)

• The American Academy of Forensic Sciences (AAFS) - established a section for forensic
anthropology called the Physical Anthropology Section.
professional forensic anthropologists and to set professional standards.
• 1980 - Dr. William Bass set up the "Body Farm" at the University of Tennessee, Knoxville to
research human decomposition and taphonomy.
• 1986, Dr. Richard Jantz and Dr. Stephen Ousley - developed FORDISC, a computer
program that enables forensic anthropologists to perform metric analyses on skeletal
remains based on data from contemporary populations. The goal is to determine sex,
ancestry, and height from the measurements.
• Dr. Clyde Snow- began training forensic anthropologists to work on human rights and
genocide cases. The first such team was the Argentine Forensic Anthropology Team
(EAAF).
• Dr. William R. Maples - founded the C.A. Pound Human Identification Laboratory (CAPHIL),
the first private forensic anthropology lab, at the University of Florida.
• Fourth Era (2000 – present)

• The Ellis Kerley Foundation - was established as the first funding source solely for forensic
anthropological research in 2000.
• 2003- JPAC was the first skeletal identification lab to obtain ASCLD-LAB (American Society
of Crime Laboratory Directors-Laboratory Accreditation Board) accreditation. CAPHIL
followed soon after.
and photography.
• Johann Friedrich Blumenbach - German anthropologist in comparative human morphology,

early forensic anthropologists relied upon anthropometry (the science of recording
measurements of various parts of the human body).
• Hans Gross - The publication of Austrian criminologist “Handbuch für Untersuchungsrichter”

(1893; Criminal Investigation) helped to establish the science of forensics, especially in
terms of a cross-transfer of evidence, such as dirt, fingerprints, carpet fibers or hair, from the
criminal to the victim. Early in the 20th century, serological research led to the discovery of
the A, B, AB, and O blood groups, thus increasing the value of blood as evidence at a crime
scene.
• Mid-20th century- advances in biochemistry and technology resulted in the discovery of

unique gene markers in each person; these genetic differences allow for the DNA
fingerprinting of hair, blood, semen and tissue. Thus, DNA testing was a major contribution
to modern forensic science, though forensic anthropologists generally do not conduct such
DNA analyses and often only supply samples to be tested. The 20th and 21st centuries have
also seen substantial growth in public and private forensic laboratories, enabling the

• Forensic anthropology, application of physical anthropology to legal cases, usually with a focus on
the human skeleton.
• Forensic anthropology uses the techniques of physical anthropology to analyse skeletal, badly
decomposed, or otherwise unidentified human remains to solve crimes.
• Forensic anthropologists can assess the age, sex, and unique features of a decedent and are
invaluable in documenting trauma to the body and estimating how long a corpse has been
decomposing.
• Forensic anthropologists work closely with individuals in law enforcement and medical science and
especially with specialists in ballistics, explosives, pathology, serology (the study of blood and bodily
fluids) and toxicology and are often expert witnesses in murder trials.
• Although physical anthropology is concerned with human evolution, human variation, and the
• Both disciplines use empirical evidence, genetic information, and computer technology to determine
the physical characteristics of human specimens. Indeed, a forensic anthropologist can reconstruct
the face of a murder victim in much the same way a physical anthropologist can reconstruct the face
of a 100,000-year-old Neanderthal skull.
• Forensic anthropology involves applying anthropological research and techniques to medico legal
issues. There are three subsections within the field of forensic anthropology, including: a) Forensic
Osteology - the study of the skeleton; b)Forensic Archeology - involves the controlled collection of
human remains; c) Forensic Taphonomy- involves the study of changes to the body after death,
including decomposition and environmental modification)

• Clay or graphic facial reproduction- This is used to recreate a face from skull with the use of soft
tissue depth estimates. In manual methods, is done by using clay, plastic and wax directly on the
victim’s skull.
• Scanning electron microscopy- scanning electron microscope (SEM) is a type of electron

microscope that produces images of a sample by scanning the surface with a focused beam of
electrons. The electrons interact with atoms in the sample, producing various signals that contain
• Radiographic techniques- Is an imaging technique using x- rays, gamma rays, or similar ionizing
radiation and non- ionizing radiation to view the internal form of an object.
• Photo or video superimposition techniques- The term of photographic superimposition has been
applied for a number of techniques in forensic medicine and dentistry. The comparison of an ante
mortem photograph to that of a skull is one such procedure. Technical information and potential
sources of difficulty are discussed. Finally, two cases illustrate the use and misuse of this technique
• The casting of skeletal materials- Skeletal remains are physical records that can help determine
the adaptations/biological features of a species or an individual. Casting protects original materials
and makes new material available for people or research. Casting and molding are processes that
duplicate fossil and also recent skeletal material.
• Preservation of skeletal materials using commercial preservatives- compound or solution is

used in the field for consolidation of bone or skeleton in order to preserve it.
• Thin-sectioning techniques of bone histology- Involving hand grinding technique has been
developed to produce 20-40-un-thick sections of bone-titanium implant sites.
• Rehydration and preservation of mummified or decayed soft tissues- Process and chemical
formula for rehydrating soft tissues of mummified corpses or under an initial process of putrefaction.
And the chemical formula for the subsequent preservation thereof. The present invention is novel
since it includes a process and a chemical formula which are efficient for rehydrating the whole soft
tissues present in a mummified corps, or in its initial process of putrefaction, thus reversing the
physical changes that these phenomena had caused thereto.
A REPORT IN FOREN 2
Submitted TO
SUBJECT INSTRUCTOR
Submitted by
Joyce Ann A. Magbanua
John Lorens A. Dipalan
John leo S. Raymundo
James Tiao
BSCRIM 2-F
FORENSIC ODONTOLOGY
Objectives:
1.Discuss the forensic odontology and its history

2.To identify the types of bite mark
3. Recognize the importance of odontology in forensic investigation.
Introduction
only after death but remain unchanged for many thousands of years. Also
can be used as a weapon of attack or defense under certain circumstances
may leave information as to the identity of the biter. Human teeth
and dental restorations have proven to remain stable during a long time as
well as in extreme situations such as fire.
History of Odontology
The evolution of forensic odontology started right back in the Garden of
Eden. According to the Old Testament, Eve convinced Adam to put a bite
mark in apple. It was told that “It is always tempting to suggest that the
history of bite mark evidence (forensic dentistry) began with the eating of
forbidden fruit in the Garden of Eden.” But the dentist or forensic
odontologist were rare at that time. There is no record of events,
comparisons or analysis, and it is in addition there were a limited number of
66 AD- Well-documented evidence to the use of teeth for identification

began 66 AD with Agrippina and Lollia Pauline case. It was the first use of
dental identification where there is a record.
1193- The first forensic identification in India started in were Jai Chand, a
great Indian monarchy was destroyed by Muhammad’s army and Jai
Chand, Raja of Kanauji was murdered and he was identified by his false
teeth.
1453- first formally reported case of dental identification was that of the
80 years old warrior John Talbot, Earl of Shrews bury, who fell in the battle
of Castillon.
In 1897 a paper entitled, “The role of the Dentists in the identification of the
victims of the catastrophe of the Bazar de la Charite, Paris and 4th May,
1897”, was presented by Dr. Oscar Amoedo (Professor of the dental school
in ParOscar Amoedo was considered as the father of the forensic is) at the
international Medical Congress of Moscow. The bazar, at which the wealthy
women of Paris annually raised money for projects for the poor, was
destroyed within 10 minutes and 126 persons lost their lives.
Dr. odontologist. The thesis done by him entitled ‘L’ Art Dentaire en
Medicine Leagale’ in 1898 to the faculty of medicine earned him a
doctorate. This book is the first comprehensive text on forensic
odontologist.
The first forensic odontologist in the United States was Dr. Paul Revere
who identified the extreme body of Dr. Joseph Warren through a bridge of
silver and ivory that he had constructed two years previously.
First work in facial reconstruction was done by Kollman and Buchley. The
technique that is proposed by Kollmen and Buchely is still used with
modification today. Although computerized methods are gaining interest
today. Belty Pat Gatliff of Oklahoma has trained a number of forensic
dentists in facial reconstruction techniques

Forensic Odontology, also known as Forensic Dentistry or Bite Mark
Evidence Expertise, is the application of dental knowledge to the
understanding of laws. Some of the work a Forensic Odontology is involved
in is: identification of bite marks on the victims of attack.
Forensic Odontology a branch of science uses the skills of the dentist in

personal identification during mass calamities, sexual assault and child
abuse to name a few.
Forensic odontology is the application of dentistry to the investigation of

crime and medicolegal investigations. It has its main applications in the
identification of corpses and human remains and in bite mark analysis.

The major area of activity of forensic odontology is the identification of
human beings, either dead or alive. This is more so in case of mass
disaster, where the corpse is usually badly mutilated. Other areas of
application include criminalistics, in cases involving abuse of children and
elderly. Bite marks also help in detection of culprits. It also renders its
service in probing of dental malpractice, archeology etc.
The scope of forensic dentistry is broad & ever-challenging. Each case is
different & even the seemingly routine case may test the dentist’s ingenuity
in applying his dental knowledge.
Identifying human unknown remains through dental records and

craniofacial bones
Age estimation of both the living and deceased
Recognition and analysis of bite marks found on victims
Determining the unidentified individual
Presenting evidence in court as expert witness

Dental identification plays an important role when identification of remains
of deceased person is skeletonized, decomposed, burned or dismembered
and is invalid by visual or fingerprint methods. The identification of remains
by dental evidence is possible because, the hard tissues are preserved
after death and can even withstand a temperature of 1600 degree C when
heated without appreciable loss of microstructure, and the status of a
person’s teeth change throughout the life and the combination of decay,
missing, filling can be obtained from any fixed time.
According to American board of forensic odontology dental identification
can be divided into four types:
According to American board of forensic odontology dental identification

can be divided into four types:
Positive identification- The ante-mortem and postmortem data match to
Possible identification- The ante-mortem and postmortem data have few
Insufficient evidence- The data is not enough to from the conclusion.
Exclusion- The ante-mortem and postmortem data clearly inconsistent.

One of the first things they'll do is obtain a saliva sample from the bite.
This, of course, can be done by others, but a forensic dentist can make
sure sample extraction doesn't affect quality of the bite mark. Next, the
forensic dentist will take photographs.
This is a technique shared by all experts, and it's fairly important to get the
lighting, color, and camera angle right. A linear scale should be placed
somewhere in the photograph. A camera angle of 90 degrees is best for a
flat surface, while a 40 degree angle causes 25% distortion of a bite mark.
Next, the forensic dentist makes multiple impressions, casts, or molds of
the bite mark, and has access to a variety of materials in which to choose
the right gum, rubber, plastic, or powder to make a cast. Some forensic
dentists used the so-called Dorion method, which advocates the removal of
bitten tissue for microscopic examination.
computer-enhanced digitization, and xeroradiology. Computerized bite
analysis software also exists. Once a suspect is apprehended, the forensic
dentist makes one or more impressions of the suspect's teeth, comparing
them to the recorded bite marks, and if called to testify, renders an opinion
of the probability of a match.
Courts have upheld the constitutionality of involuntarily taking a dental

impression from a suspect, as they have for most biological specimens
from the suspect.

Developmental changes: Developmental changes that occur to the human
HARD TISSUE FORMATION- In this method, each tooth is scored based
on its developmental stage and scores are compared with values
corresponding to a particular age.
DENTAL ERUPTION- To assess the age of unknown individual, we can
compare the postmortem radiographs of the individual to the eruption
standards produced by the Schour and Massler.
THIRD MOLAR ERUPTION- Third molar emergence tends to be around
17-19 years of age.
DENTAL MEASUREMENT- This technique was an alternative to the
Degenerative changes: That occur once the teeth have erupted and begin
to wear down. There is an intuitive connection between tooth wear and
age, as those with more wear tend to be older.
Bite marks are something else Forensic Odontologist look at. The specific
areas of bite marks would be : the distance from cuspid to cuspid, the
shape of the mouth arch, the evidence of a tooth out of alignment, teeth
width and thickness, spacing between teeth, missing teeth, the curves of
biting edges, unique dentistry, and wear patterns such as chips or grinding.
The amount and degree of detail recorded in the bitten surface may vary
from case to case.
Human and animal teeth both leave conspicuous marks. In the flesh, they
leave behind noticeable bruises or puncture marks and in soft foods, such
as fruit, marks are also preserved. In situations where sufficient details are
available, it may be possible to identify the biter to the exclusion of all
others.
Perhaps more significantly, it is possible to exclude suspects that did not
leave the bite mark or marks. The skin is elastic, tending to slip along the
upper teeth until it catches hold. Depending upon the type of victim, some
bite marks last for hours and others for days, but almost all bite marks alter
themselves as time elapses.
Photographing bite marks at intervals over a set period of hours or days is

part of the standard protocol recommended by the ABFO. Bite marks also
change or become distorted when the posture of the victim changes, so the
forensic dentist might be able to assist with determination of how the
perpetrator moved the body
SEX DETERMINATION
Sex determination is very important subdivision of forensic odontology,
which plays a major role in identification of the unknown individuals in
natural disasters; chemical and nuclear bomb explosion scenarios
Sex difference in tooth dimension: Sex determination by measuring
mesiodistal and buccolingual dimensions is most simple and reliable
method for sex determination. Both the dimensions are more in male than
in female.
Tooth morphology: In male, the distal accessory ridge in canines is more
mandibular first molar (distobuccal or distal). These features can be
because of evolutionary reduction in the female lower jaw size.
Bite marks may be found on the flesh of victims of a violent attack,

particularly on the stomach, breast or buttocks. Alternatively they may be
found on the suspect, left by victim during self-defense. If a bite mark is
only represented as a bruise, it is often extremely difficult to detect any
individual characteristics.
The bite mark is defined as the physical alteration in or on a medium

caused by the contact of teeth. In few of criminal cases it is seen that
suspect or victim has left his or her teeth marks on another person or
inanimate object. The concept of bite mark evidence is interesting and is
there from Roman times.
In more aggressive bites -The assailant may suck the soft tissues into the
the wound.
In less aggressive bites -the skin may not be completely penetrated so


Study of lip prints is termed as “cheiloscopy.” Lip prints are said to be
permanent and unchangeable. Identification of pattern is possible from
6th week of intrauterine life. These can serve as important evidence left at
crime scene.
Disadvantages are major trauma to lips result in scarring. Surgical

treatment also affects the size and shape of lips. Prints may differ in
appearance depending on pressure applied or direction.
Forensic dentists use several different terms to describe the type of bite
mark:
Abrasion - a scrape on the skin
Artifact - when a piece of the body, such as an ear lobe, is removed
through biting
Avulsion - a bite resulting in the removal of skin
Contusion - a bruise
Hemorrhage – a profusely bleeding bit
Incision – a clean, neat wound
Laceration – a puncture wound
What is a forensic odontologist?

A forensic odontologist must be a qualified dentist and complete additional
training and certification requirments to use dental information to identify
victims or develop evidence for criminal investigations. A forensic
commonly participates in autopsies by photographing dental evidence,
presenting evidence in court, retrieving DNA evidence and analyzing bite
marks.
Role and importance of forensic odontology
The forensic play a very important role in assisting the forensic team and
investigating team in identification of corpuses found in natural disasters
and homicides where fragmentation and thermal injuries are common.
Since tooth is a calcified structure and is resistant to high or low
temperatures and is adequately strong to resist trauma, the teeth maybe
the only structures left behind intact in most of the cases.
DNA PROFILING
A REPORT IN FOREN 2
Submitted to:
SUBJECT INSTRUCTOR
Submitted by:
Name of reporters
LIAN ROSE A. ERISPE
RAYMUND T. MALUNES
ROGER SASI
JAN MARK S. DEOCAMPO
Year & Section

BSCRIM 2-FOXTROT
April 18 , 2022
DNA PROFILING
Objectives
➢ Recognize the significance of DNA fingerprinting in crime investigation.
➢ Identify the DNA fingerprinting
➢ Determine the application, methods, and techniques used in DNA
fingerprinting.
Introduction
material. Every cell in the human body has the same DNA. The information of DNA
is stored as a code constituted by four nitrogenous bases: Adenine (A), Thymine (T),
Cytosine (C) and Guanine (G). The order or sequence of these bases determines the
information available for building and maintaining an organism.
an individual’s DNA characteristics. DNA analysis intended to identify a species,
rather than an individual, is called DNA barcoding. DNA profiling is a forensic
technique in criminal investigation, comparing criminal suspects’ profiles to DNA
evidence so as to assess the likelihood of their involvement in the crime.
genealogical and medical research. DNA profiling has also been used in the study
of animal and plant populations in the fields of zoology, botany, and agriculture.
DNA profiling is the process where a specific DNA pattern, called a profile, is
obtained from a person or sample of bodily tissue. Even though we are all unique,
most of our DNA is actually identical to other people’s DNA.
Specific regions vary highly between people. These regions are called
polymorphism. Each of us inherits a unique combination of polymorphism from
our mother. DNA polymorphism can be analyzed to give DNA profile. Human DNA
profiles can be used to identify the origin of a DNA sample at a crime scene or test
for parentage.
➢ Identify the probable origin of a body fluid sample associated with a crime
or crime scene
➢ Revel family relationships
➢ Identify disaster victims, for example, ESR scientists travelled to Thailand to

DNA profiling first started out in the80s, and it has been extremely successful
for testing in crime scene, paternity testing, and predisposition to disease.
• Kary Mullins invented the Polymerase Chain Reaction or PCR, in the united
Kingdom
• In 1986, Dr. Alec Jeffreys made genetic fingerprinting available to the public.
In the same year when DNA was first used in a criminal investigation by Dr.
Jeffreys.
Genetic Fingerprinting was used in the investigation in a case of two rapes and
murders that had happened in 1983 and 1986. These crimes happened in a small
town called Leicestershire, which is located in the United Kingdom. They collected
fingerprints and connected them with semen stains collected from where the
raping and murders were located.
• In 1987, DNA evidence was first used in the United States on Florida, rapist
man, Tommie Lee Andrews. After using DNA evidence in his case, he was
then sentenced to 22 years in prisons for the rapes that he had committed
Since the 1980s, DNA testing had just become a popular way of finding out things
through people’s DNA. However, the FBI did not start using DNA testing until 1998,
but it can become very helpful to those who need to find out something in that
area. Thousands of different cases have been cracked and many innocent people
have been freed jail or prison because of the use of DNA provided by family.
99.9%of human DNA sequences are the same in every person, enough of the DNA is
different that it is possible to distinguish one individual from another, unless they
are monozygotic (identical) twins. DNA profiling uses repetitive sequences that are
highly variable, called variable tandem repeats (VNTRs), in particular short
tandem repeats (STRs), also known as microsatellites, and minisatellites. VNTR loci
are similar between closely related individuals, but are so variable that
• In India, DNA fingerprinting was started by Dr. VK Kashyap and Dr. Lalji
Singh, an Indian scientist who worked in the field of DNA fingerprinting
technology in India.
• Dr. Lalji Singh was popularly known as the “Father of Indian
Fingerprinting”.
• (1980) Wyman and White laid the foundations for the concept based on the
variable-length restriction fragments called restriction fragment length
polymorphisms (RFLPs), which are specific sequences where restriction
• (1985) with the paper “Hypervariable Minisatellite Regions in Human DNA”
written by Alec Jeffreys. Jeffreys and his co-workers were analyzing the
human myoglobin gene when they discovered a region consisting of a 33-
base-pair sequence repeated four times.
• (1987) Nakamura coined the term variable number of tandem repeats
(VNTR) to describe individual loci where alleles are composed of tandem
repeats that vary in the number of core units. When DNA is isolated,
cleaved with a specific enzyme, and hybridized under low-stringency
conditions with a probe consisting of the core repeat, a complex ladder of
DNA fragments is detected.
In (1985) , DNA fingerprinting had its first application in a case of parentage testing,
actually a maternity test, with paternal DNA unavailable.
authorities thought that he was not her son.
A DNA fingerprinting applied to both demonstrated that, effectively, they told the
truth. The first application of DNA fingerprinting in forensic identification
happened later that same year, in a case that beautifully exemplifies the power of
DNA evidence to link crime-scenes, to exclude suspects, and to support convictions.
• A suspect was arrested for allegedly committing a double rape and suicide
to 2 minors. A DNA fingerprinting using a sample of semen left in the crime
scene demonstrated that a man had been responsible for both crimes but it
was not the arrested suspect. He was released and the real culprit was
arrested.
What is DNA Fingerprinting?
DNA Fingerprinting is the technology which is used to identify individuals on
the basis of the molecular characteristics of the DNA. More specific, this method
uses VNRT because the number of bases and repeats within a locus is unique to
each individual.
cases but it can be used for anthropological genetics, zoology, and botany among
others disciplines. Importantly, the technique of DNA Fingerprinting is very
Procedures to create DNA Fingerprinting:
The steps involve others techniques used in Molecular Biology, such as
polymerase chain reaction (PCR) and electrophoresis among others. The following
are the steps to generate a DNA fingerprinting;
➢ The DNA is extracted from the nuclei of any cell in the body.
➢ The DNA molecules are broken with the help of enzyme restriction
endonuclease (called chemical knife) that cuts them into fragments. The
fragments of DNA also contain the VNTRs.
➢ The fragments are separated according to size by gel electrophoresis in
agarose gel.
➢ The separated fragments of single-stranded DNA are transferred onto a
nylon membrane. Radioactive DNA probes having repeated base
sequences complementary to possible VNTRs are poured over the nylon
membrane. Some of them will bind to the single-stranded VNTRs. The
method of hybridization of DNA with probes is called Southern Blotting.
➢ The nylon membrane is washed to remove extra probes.
➢ An X-ray film is exposed to the nylon membrane to mark the places
where the radioactive DNA probes have bound to the DNA fragments.
These places are marked as dark bands when X-ray film is developed.
This is known as autoradiography.
➢ The dark bands on X-ray film represent the DNA fingerprints (DNA
profiles).
Profiling Process
The process, developed Glassberg and independently by Jeffreys, begins
with a sample of an individual’s DNA (typically called a “reference sample”).
Reference samples are usually collected through the buccal swab. When this is
unavailable (for example, when a court order is needed but unobtainable) other
methods may be needed to collect a sample of blood, saliva, semen, vaginal
lubrication or other fluid or tissue from personal use item (for example, a
toothbrush, razor) or from stored samples (for example, banked sperm or biopsy
tissue). Samples obtain from blood relatives can indicate an individual’s profile, as
could previous profile human remains.
A reference sample is then analyzed to create the individual’s DNA profile using
one of the techniques discussed below. The DNA profile is then compared against
another sample to determine whether there is a genetic match.
Alec Jeffreys developed the DNA fingerprinting technique, that has been
used in different scientific fields. In forensic investigations has helped to send to
prison criminals, and identify victims of crimes, natural disaster, wars. Paternity
disputes have been resolved thanks to this method.
DNA EXTRACTION
combination of physical and chemical methods. When a sample such as blood or
saliva is obtained, the DNA is only a small part of what is present in the sample.
Before the DNA can be analyzed, it must be extracted from the cells and purified.
These are many ways this can be accomplished, but all methods follow the same
basic procedure. The cell and nuclear membranes need to be broken up to allow
the DNA to be free in solution.
The most common methods of DNA extraction include organic extraction (also
called phenol chloroform extraction), Chelex extraction, and solid phase
extraction. Differential extraction is modified version of extraction in which DNA
from two different types of cells can be separated from each other before being
purified from the solution.
Methods of DNA Fingerprinting
• RFLP (RESTRICTION FRAGMENT LENGTH POLYMORPHISM) ANALYSIS
restriction enzyme (a restriction digests). This generates DNA fragments of
differing sizes as a consequence of variations between DNA sequences of
different individuals. The fragments are then separates on the basis of size using
gel electrophoresis.
• The separated fragments are then transferred to a nitrocellulose or nylon
filter; this procedure is called a Southern Blot.
• The DNA fragments within the blot are permanently fixed to the filter, and
the DNA strands are denatured. Radiolabeled probe molecules are then
added that are complementary to sequences in the genome that contain
repeat sequences.
• The Southern blot techniques requires large amounts of non-degraded
sample DNA. Also Karl Brown’s original techniques looked at many
minisatellite loci at the same time, increasing the observe variability, but
making it hard to discern individual alleles (and thereby precluding
paternity). These early techniques have been supplanted by PCR-based
assays.
• POLYMERASE CHAIN REACTION (PCR) ANALYSIS

portions of the sample DNA can be amplified almost identify (Saiki et al. 1985, 1985)
• The process polymerase chain reaction PCR, mimics the biological process of
DNA replication, but confines it to specific DNA sequence of interest. With
the invention of the PCR technique, DNA profiling took huge strides forward
in both discriminating power and the ability to recover information from
very small (or degraded) starting samples.
• DNA sample is denaturing into the separate individual polynucleotide
strands through heating. Two oligonucleotide DNA primers are used to
hybridize to two corresponding nearby sites on opposite DNA strands, in
such a fashion of the normal enzymatic extension of the active terminal of
each primer (that is, the 3’ end) leads toward the other primer.
• PCR uses replication enzymes that are tolerant of high temperatures, such
as the thermostable tag polymerase.
3. SHORT TANDEM REPEATS (STR) ANALYSIS
DNA profiling uses polymorphism called short tandem repeats. Short
tandem repeats or STR are regions of non-coding DNA that contain repeats of the
same nucleotide sequence. For example, GATAGATAGATAGATAGATAGATA is an
STR where the nucleotide sequence GATA is repeated six times.
• STRs are found at different places or genetic loci in a person’s DNA.
4. AMPLIFIED FRAGMENT LENGTH POLYMORPHISM (AFLP)

AFLP or amplified fragment length polymorphism was also put into practice
during the early 1990s. This technique was also faster than RFLP analysis and use
PCR to amplify DNA samples. It relied on variable number tandem repeat (VNTR)
polymorphisms to distinguish various alleles, which were separated on a
polyacrylamide gel using allelic ladder (as opposed to a molecular weight ladder).
Bands could be visualized by silver staining the gel. One popular focus for
fingerprinting was the D1S80 lucos. As with all PCR based methods, highly degrade
DNA or very small amounts of DNA may cause allelic dropout (causing a mistake
in thinking a heterozygote is a homozygote) or other stochastic effects.
AmpFLP analysis can be highly automated, and allows for easy creation of
phylogenetic trees based on comparing individual sample of DNA. Due to its
relatively low cost and ease of set-up and operation. AmpFLP remains popular in
lower income countries.
Techniques of DNA Fingerprinting
1. FORENSIC INVESTIGATION
Genetic material like blood, semen, saliva, hair and skin found at the crime
scene are processed, and afterward the samples are compared with the DNA of
the suspects, in order to determine guilt or innocence of the accused.
DNA fingerprinting markers have evolved since 1984. In the beginning, sets of
minisatellites or oligonucleotides stretches were used, also called multi-locus
probes (MLP) which detected sets of 15 to 20 variable fragments per individual
ranging from 3.5 to 20 kb in size. Minisatellites were replaced because they needed
a large amount of molecular weight of DNA, usually not found at the crime scene
and errors in the linkage between loci.
• PCR-based methods use microsatellites as markers instead of minisatellites;
microsatellites as short tandem repeats (STRs) are more sensitive and less
prone to allelic dropout than VNTR (variable number of tandem repeat)
systems8
When there exist a low proportion of nuclear DNA samples, lineage marker is
used which are obtained from mitochondrial and Y DNA, and they are very useful
to reconstruct the paternal and maternal relationship and historical reconstruction
in unidentified remains typically skeletonized, hair shafts without roots, or very
old specimens where only heavily degraded DNA is available likewise samples of
sexual assault without ejaculation, sexual assault by a vasectomized male, male
DNA under the fingernails of a victim, male ‘touch’ DNA on the skin.
2. PARENTAGE TESTING
DNA fingerprinting is an advantageous technique in cases, such as, of
establishing the paternity of disputed offspring or cases of baby swapping. This
method replaced ABO blood antigen systems which cannot establish paternity but
can conclusively exclude an alleged father from being a candidate.
In Parentage testing, a DNA comparison is performed between progeny against
potential parents. Children inherit half of their alleles from each parent and thus
should possess an alleles combination of their parents.
3. ANTHROPOLOGICAL GENETICS
Markers have been used as ancestry informative markers to reconstruct the
human diaspora and to interpret the evolutionary history of human populations
to inquire population origins, migration, admixture and adaptation to different
environments, as well as susceptibility and resistance to disease.
specific non-recombining region (NRY) haplotypes, and single nucleotide
polymorphisms (SNPs).
4. BOTANY
DNA fingerprinting is an essential tool for genotype identification in both
wild plant and cultivated species. DNA profiling is used for protection of
biodiversity, identifying markers for traits, identification of gene diversity and
variation. Identification in plants always been an issue for botanists because of
the large variability of the composition and relative amount of chemicals in
particular species of the plant varies with growing condition, harvesting period,
post-harvesting period and storage conditions.
Repeats (SSR), Sequence Characterized Amplified Region (SCAR), Cleaved
Amplified Polymorphic Sequence (CAPS) and Single Nucleotide Polymorphism
(SNP).
5. ZOOLOGY
DNA fingerprinting determine the genetic identity of individuals and
from field observations. Furthermore, it helps to test predictions of kin selection
models in a realistically way, and detect hybrids species.
The DNA marker clarified mating system in reproductive ecology for example in
vertebrates that give birth to more than one offspring has revealed concurrent
multiple paternities. This kind of behavior has been observed in a wide range of
organisms, particularly in reptiles.
isolation, and the particulars of inter-population gene flow, also now they are
being used to document levels of genetic variation in rare and endangered
species and thus better inform conservation management actions.
A REPORT IN FOREN 2
Submitted to:
SUBJECT INSTRUCTOR
Submitted by:
EGIELYN DE TOMAS
ARGELYN TALIDONG
JANINE MAGUAD
IRENE MARIANO
AQUINO JOMAR
ARGIE RUBINO
April 19, 2022

OBJECTIVES
➢ To discuss and understand the meaning of Anthropology
➢ To learn the History, Applications and Techniques on Anthropology
➢ To evaluate an assessment if the students have learned something from the
topic
Forensic anthropology is the application of the anatomical science

of anthropology and its various subfields, including forensic archaeology and
forensic taphonomy in a legal setting. A forensic anthropologist can assist in the
identification of deceased individuals whose remains are decomposed, burned, mutilated
or otherwise unrecognizable, as might happen in a plane crash. Forensic anthropologists
are also instrumental in the investigation and documentation of genocide and mass
graves.
Along with forensic pathologists, forensic

dentists, and homicide investigators, forensic
anthropologists commonly testify in court as expert
witnesses. Using physical markers present on a
skeleton, a forensic anthropologist can potentially
determine a person's age, sex, stature, and race.
This is useful in identifying living individuals for

legal purposes such as illegal immigrants. This is
extremely important in legal cases where the court
needs to decide if they will judge an individual as an
adult or a minor. In addition to identifying physical
characteristics of the individual, forensic
anthropologists can use skeletal abnormalities to
potentially determine cause of death, past
trauma such as broken bones or medical procedures,
as well as diseases such as bone cancer.
The methods used to identify a person from a skeleton relies on the past
contributions of various anthropologists and the study of human skeletal differences.
Through the collection of thousands of specimens and the analysis of differences within
a population, estimations can be made based on physical characteristics. Through these,
a set of remains can potentially be identified. The field of forensic anthropology grew
during the twentieth century into a fully recognized forensic specialty involving trained
anthropologists as well as numerous research institutions gathering data on
decomposition and the effects it can have on the skeleton.

➢ Forensic anthropology applies the science of physical or biological anthropology
to the legal process. Anthropology is the study of humans, and in this forensic
discipline physical or biological anthropologists focus their studies on the human
body as it relates to explaining the circumstances of an accident or solving a crime
– often homicide.
➢ Forensic anthropologists analyze human remains, typically in criminal
investigations. Their study of human remains aids in the detection of crime by
working to assess the age, sex, stature, ancestry and unique features of a
skeleton, which may include documenting trauma to the skeleton and its
History of Forensic Anthropology (divided

into four periods)
• 1849 Boston, Dr. John Webster murdered
Dr. George Parkman because he owed
Parkman quite a bit of money. However,
two anatomists (Drs. Oliver Wendell
Holmes and Jeffries Wyman) successfully
age of Dr. Parkman.
• 1894, Thomas Dwight - gave his Shattuck
Lecture about the analysis of human
skeletal remains in a legal setting. He was
rightfully hailed as the "Father of Forensic
Anthropology."

• Anthropologist Wilton Krogman - published his book, “The Human Skeleton
in Forensic Medicine”, in 1962. Forensic anthropologists
use this text even today.

Established skeletal aging techniques based on data from
skeletal remains of Korean War soldiers.

• The American Academy of Forensic Sciences (AAFS) - established a
section for forensic anthropology called the Physical Anthropology Section.
• 1977 - The American Board of Forensic Anthropology (ABFA) was created

to certify professional forensic anthropologists
and to set professional standards.
• 1980 - Dr. William Bass set up the "Body Farm"

at the University of Tennessee, Knoxville to
research human decomposition and
taphonomy.
• 1986, Dr. Richard Jantz and Dr. Stephen
Ousley - developed FORDISC, a computer
program that enables forensic anthropologists
to perform metric analyses on skeletal remains
based on data from contemporary populations.
The goal is to determine sex, ancestry, and
height from the measurements.
• Dr. Clyde Snow- began training forensic anthropologists

to work on human rights and genocide cases. The first
such team was the Argentine Forensic Anthropology
Team (EAAF).


• 2003- JPAC was the first skeletal identification lab to obtain ASCLD-LAB
(American Society of Crime Laboratory Directors-Laboratory Accreditation
Board) accreditation. CAPHIL followed soon after.
• 13th century, medical examiners have sought to determine the causes of

deaths and to solve crimes. Given that a death can be natural, accidental,
homicide, suicide, or undetermined, forensic science has been greatly
aided by developments in modern chemistry,
toxicology, and photography.
• Johann Friedrich Blumenbach - German

anthropologist in comparative human
morphology, early forensic anthropologists relied
upon anthropometry (the science of recording
measurements of various parts of the human
body).
• Hans Gross - The publication of Austrian criminologist “Handbuch für
Untersuchungsrichter” (1893; Criminal Investigation) helped to establish the
science of forensics, especially in terms of a
cross-transfer of evidence, such as dirt,
fingerprints, carpet fibers or hair, from the
criminal to the victim. Early in the 20th century,
serological research led to the discovery of the
A, B, AB, and O blood groups, thus increasing
the value of blood as evidence at a crime
scene.
• Mid-20th century- advances in biochemistry and technology resulted in the

discovery of unique gene markers in each person; these genetic differences
allow for the DNA fingerprinting of hair, blood, semen and tissue. Thus, DNA
testing was a major contribution to modern forensic science, though forensic
anthropologists generally do not conduct such DNA analyses and often only
supply samples to be tested. The 20th and 21st centuries have also seen
substantial growth in public and private forensic laboratories, enabling the

➢ Forensic anthropology, application of physical
anthropology to legal cases, usually with a focus
on the human skeleton.

➢ Forensic anthropologists can assess the age,

sex, and unique features of a decedent and are
invaluable in documenting trauma to the body
and estimating how long a corpse has been decomposing.
➢ Forensic anthropologists work closely with individuals in law enforcement and

medical science and especially with specialists in ballistics, explosives, pathology,
serology (the study of blood and bodily fluids) and toxicology and are often expert
witnesses in murder trials.
➢ Although physical anthropology is concerned with human evolution, human

variation, and the biological bases of human behaviour, many of its excavation and
reconstruction techniques can be applied to forensic anthropology.
information, and computer technology to determine the
physical characteristics of human specimens. Indeed, a
forensic anthropologist can reconstruct the face of a murder
victim in much the same way a physical anthropologist can
reconstruct the face of a 100,000-year-old Neanderthal
skull.
➢ Forensic anthropology involves applying anthropological

research and techniques to medico legal issues. There are
three subsections within the field of forensic anthropology, including: a) Forensic
Osteology - the study of the skeleton; b)Forensic Archeology - involves the
controlled collection of human remains; c) Forensic Taphonomy- involves the study
of changes to the body after death, including decomposition and environmental
modification)
Forensic anthropologists use a number of techniques when studying
skeletal remains, including:
➢ Clay or graphic facial reproduction- This is used to recreate a
face from skull with the use of soft tissue depth estimates. In manual
methods, is done by using clay, plastic and wax directly on the
victim’s skull.

microscope (SEM) is a type of electron microscope
that produces images of a sample by scanning the
surface with a focused beam of electrons. The
electrons interact with atoms in the sample, producing
various signals that contain information about the
surface topography and composition of the sample.
➢ Radiographic techniques- Is an imaging technique using x- rays,

gamma rays, or similar ionizing radiation and non- ionizing radiation
to view the internal form of an object.
➢ Photo or video superimposition techniques- The term of
photographic superimposition has been applied for a number of
techniques in forensic medicine and dentistry. The comparison
of an ante mortem photograph to that of a skull is one such
procedure. Technical information and potential sources of
difficulty are discussed. Finally, two cases illustrate the use and
misuse of this technique in arriving at a positive identification.
➢ The casting of skeletal materials- Skeletal remains are

physical records that can help determine the
adaptations/biological features of a species or an individual.
Casting protects original materials and makes new material
available for people or research. Casting and molding are
processes that duplicate fossil and also recent skeletal
material.
➢ Preservation of skeletal materials using commercial

preservatives- compound or solution is used in the field for
consolidation of bone or skeleton in order to preserve it.
➢ Thin-sectioning techniques of bone

histology- Involving hand grinding technique has
been developed to produce 20-40-un-thick
sections of bone-titanium implant sites.
➢ Rehydration and preservation of mummified or decayed soft tissues- Process

and chemical formula for rehydrating soft tissues of
mummified corpses or under an initial process of putrefaction.
And the chemical formula for the subsequent preservation
thereof. The present invention is novel since it includes a
process and a chemical formula which are efficient for
rehydrating the whole soft tissues present in a mummified
corps, or in its initial process of putrefaction, thus reversing
the physical changes that these phenomena had caused
thereto.
ADDITIONAL NOTE:
Identification of the Deceased By Trauma Analysis

Trauma analysis focuses on the examination of skeletal injuries, such as fractures,
projectile entry and exit points and tool marks. It is an essential part of forensic
anthropology training; therefore, all forensic anthropologists should be able to provide a
general opinion, for instance, on the timing (ante-, peri- or post-mortem) or type (sharp,
blunt or ballistic force) of injury. Trauma analysis furthermore requires concomitant
knowledge of the surrounding soft tissues such as skin and muscles and is often done
in close collaboration with a forensic pathologist.
Types of Trauma
Ballistic trauma - is a high-speed injury caused by a projectile. The most obvious
example is a gunshot injury, but any fast-moving, relatively small object might serve as
a projectile. In ballistic trauma, the high velocity of the projectile causes penetration
and/or shattering of the bone tissue. The remaining defect, especially when in flat bones
such as the skull or the pelvis, allows for a reconstruction of the direction of the
projectile. This is because an entrance wound will almost invariably be smaller than an
exit wound. The outward tapering of the skeletal defect, also called ‘bevelling’, shows
the direction of the projectile. However, one cannot determine the calibre of a projectile
based on the skeletal analysis.
Blunt force trauma - Blunt force trauma generally constitutes the most frequent group
of traumatic injuries, as it relates to all mechanical forces inflicted with a relatively large
blunt object or surface. Injuries from falls, impacts, traffic accidents, etc are included in
this group. Study of the extent and patterning of the skeletal injury(s) can allow for
reconstruction of the direction of a force. Some fracture patterns may suggest a specific
traumatic event. An example would be the typical fracture patterns seen in a fall from a
height and landing in a standing position. Ordinarily, this results in fractures of the
calcanei (heel bones), tibial plateaus (upper parts of the shin bones), acetabulae (hip
sockets) and lumbar vertebrae (spine of the lower back).
Sharp force trauma- Sharp force trauma is skeletal damage inflicted at a relatively low
velocity (compared with ballistic trauma) by an edged, pointed or bevelled tool.
Examples are knife cuts or saw marks. In these types of trauma, it is usually possible to
ascertain the class of implement used (eg knives, hatchets, saws). A more detailed
identification of the implement (eg an electric versus a hand saw) is more difficult.
Linkage of a mark on the bone to an individual tool is in all but very rare cases not
possible for a forensic anthropologist. It is possible to clarify the directionality of force
and type of movement (eg cutting, hacking, sawing) that occurred. In cases of
dismemberment this may give information on the placement of the victim relative to the
perpetrator at the time of the event(s).
A REPORT IN FOREN 2
Submitted TO
SUBJECT INSTRUCTOR
Submitted by
CEEJAY O. VEGAFRIA
CEZAR FRANCISCO
GALE ASMOD
RENE MARAŇO
VAN ALVER RENDON
BSCRIM 2-GOLF
April 20, 2022

FORENSIC ODONTOLOGY
Teeth are the most indestructible part of the human

body. They survive not only after death but remain
unchanged for many thousands of years. Also can be used
as a weapon of attack or defense under certain
circumstances may leave information as to the identity of
the biter. Human teeth and dental restorations have proven
to remain stable during a long time as well as in extreme
situations such as fire.
The evolution of forensic odontology started right back in the Garden of Eden.
According to the Old Testament, Eve convinced Adam to put a bite mark in apple. It was
told that “It is always tempting to suggest that the history of bite mark evidence (forensic
dentistry) began with the eating of forbidden fruit in the Garden of Eden.” But the dentist
or forensic odontologist were rare at that time. There is no record of events, comparisons
or analysis, and it is in addition there were a limited number of suspects and the suspects
reportedly confessed.
✓ 66 AD- Well-documented evidence to the use of teeth for identification began 66

✓ 1193- The first forensic identification in India started in were Jai Chand, a great
✓ It was used in the identification of Adolf Hitler and his wife Eva Brawn at the end
of World War II.
✓ 1453- first formally reported case of dental identification was that of the 80 years
✓ 1758- Peter Halket was killed in during French and Indian wars in a battle near
✓ 1870, Ansil L Robinson was charged with the murder of his mistress; Mary
✓ Wayne Clifford Boden was a Canadian serial killer and rapist active from 1969-
✓ Early in 1775 Revere constructed a silver wire fixed bridge for his close friend Dr.
Joseph Warren, a medical practitioner. At the outset of the war, Warren refused
the appointment of surgeon-in-chief to the continental army. Instead, he requested
the rank of a line officer; Unfortunately, Warren was killed by a bullet that pierced
✓ 1776- At the battle for Breed’s Hill in Boston, Dr. Joseph Waren was killed in the
✓ In 1897 a paper entitled, “The role of the Dentists in the identification of the victims
international Medical Congress of Moscow. The bazar, at which the wealthy
women of Paris annually raised money for projects for the poor, was destroyed
within 10 minutes and 126 persons lost their lives.
✓ Dr. Oscar Amoedo was considered as the father of the forensic odontologist. The
thesis done by him entitled ‘L’ Art Dentaireen Medicine Leagale’ in 1898 to the
faculty of medicine earned him a doctorate. This book is the first comprehensive
text on forensic odontologist.
✓ The first forensic odontologist in the United States was Dr. Paul Revere who
identified the extreme body of Dr. Joseph Warren through a bridge of silver and
ivory that he had constructed two years previously.
✓ 1937 in Chantilly, a murder was convicted on the evidence of the bite marks that
✓ The fire on board the “Scandinavian Star” was one of the world’s worst ferry
✓ Sager case involved the murder of a 14 year old girl. The state’s evidence included
✓ Forensic odontologists successfully identified tsunami victims in South-East Asia
experts.
✓ The famous Iroquois theatre in Chicago was burned in 1903 and for about 602 of
✓ First work in facial reconstruction was done by Kollman and Buchley. The
techniques
Forensic Odontology, also known as Forensic Dentistry or Bite Mark Evidence

Expertise, is the application of dental knowledge to the understanding of laws. Some
of the work a Forensic Odontology is involved in is: identification of bite marks on the
victims of attack.
Forensic Odontology a branch of science uses the skills of the dentist in personal
Forensic odontology is the application of dentistry to the investigation of crime and

medicolegal investigations. It has its main applications in the identification of
corpses and human remains and in bite mark analysis.

knowledge.
▪ Identifying human unknown remains through dental records and craniofacial

bones
▪ Age estimation of both the living and deceased
▪ Recognition and analysis of bite marks found on victims
▪ Determining the unidentified individual
▪ Presenting evidence in court as expert witness

STEPS IN FORENSIC ODONTOLOGY



teeth, missing teeth, the curves of biting edges, unique dentistry, and wear patterns such
as chips or grinding. The amount and degree of
detail recorded in the bitten surface may vary from
case to case.

preserved. In situations where sufficient details
are available, it may be possible to identify the
biter to the exclusion of all others.
SEX DETERMINATION

➢ Sex difference in tooth dimension: Sex determination by measuring mesiodistal
➢ Tooth morphology: In male, the distal accessory ridge in canines is more

➢ Bite marks may be found on the flesh of victims of a violent attack, particularly
➢ The bite mark is defined as the physical alteration in or on a medium caused

times.
the wound.
Bite marks change over a time on living as well as dead. If the bite is on living
LIP PRINTS ANALYSIS, IDENTIFICATION OR COMPARISON
FORENSIC DENTISTS USE SEVERAL DIFFERENT TERMS TO

DESCRIBE THE TYPE OF BITE MARK:
▪ Abrasion - a scrape on the skin
▪ Artifact - when a piece of the body, such as an ear lobe, is removed through
biting
▪ Avulsion - a bite resulting in the removal of skin
▪ Contusion - a bruise
▪ Hemorrhage - a profusely bleeding bit
▪ Incision - a clean, neat wound
▪ Laceration - a puncture wound
DNA PROFILING
A REPORT IN FOREN 2
Personal Identification Techniques
Submitted to:
Mrs. SHARON P. CORDERO
SUBJECT INSTRUCTOR
Submitted by:
JAKE LOUIE MARCELO
JOHN ERIC SAMILLANO
ARMANDO VIRAYON BSCRIM 2-

GOLF
THEA JUPERLY JUAREZ
ZEDFFREY CASTILLON
OBJECTIVES
or crime scene.
• Identify disaster victims, for example, ESR scientist travelled to Thailand to
help identify victims of the 00 boxing Day tsunami.
Introduction
material. Every cell in the human body has the same DNA. The information of
DNA is stored as a code constituted by four nitrogenous bases: Adenine (A),
Thymine (T), Cytosine (C) and Guanine (G). The order or sequence of these bases
determines the information available for building and maintaining an organism.
The human genome size is about 3,107 mega bases (Mb) but only about 1.2
percent of the total genome encodes for proteins, this is around 20,000 genes,
while 98.8 percent is noncoding DNA2,3, which means that do not encode
proteins. Within this group we have, for example, a variable number of tandem
repeats (VNTR), which are repeated sequences of 9 to 100 base pairs that play a
key role in the elaboration of DNA fingerprinting.
Knowing the main DNA characteristics, specificity is the key to the emergence of
DNA analysis. Numerous other techniques used to determine biological markers,
such as HLA and blood group substances, have been successfully applied for
identification purposes. All are based on exclusion, where markers are tested until
a difference is found. Other factors favoring DNA analysis include the small
sample requirement, the ability to rapidly replicate a sequence a million fold or
more in vitro, and the relative stability of DNA. The point is that DNA analysis
alone can be a definitive test.
polymorphism. Each of us inherits a unique combination of polymorphism from
our mother. DNA polymorphism can be analyzed to give DNA profile. Human DNA
profiles can be used to identify the origin of a DNA sample at a crime scene or test
for parentage.
or crime scene
• Identify disaster victims, for example, ESR scientists travelled to Thailand to
History
DNA profiling first started out in the80s, and it has been extremely successful for
testing in crime scene, paternity testing, and predisposition to disease. The
polymerase chain reaction or PCR, was invented by Kary Mullins in the United
Kingdom, and in 1986, Dr. Alec Jeffreys made genetic fingerprinting available to
the public. In 1986 was when DNA was first used in a
criminal investigation by Dr. Jeffreys.
Dr. Jeffreys also made it available for people to preform
identity tests. Since the 1980s, DNA testing had just become
a popular way of finding out things through people’s DNA.
However, the FBI did not start using DNA testing until 1998,
but it can become very helpful to those who need to find
out something in that area. Thousands of different cases
have been cracked and many innocent people have been freed jail or prison
because of the use of DNA provided by family.
Although 99.9%of human DNA sequences are the same in every person, enough
of the DNA is different that it is possible to distinguish one individual from
another, unless they are monozygotic (identical) twins.
DNA profiling uses repetitive sequences that are highly variable, called variable
tandem repeats (VNTRs), in particular short tandem repeats (STRs), also known as
microsatellites, and minisatellites. VNTR loci are similar between closely related
individuals, but are so variable that individuals are unlikely to have the same
VNTRs.
In India DNA fingerprinting was started by Dr. VK Kashyap and Dr. Lalji Singh was
an Indian scientist who worked in the field of DNA fingerprinting technology in
Indian, where he was popularly known as the “Father of Indian Fingerprinting.
• 1980, Wyman and White laid the foundations for the concept based on the
variable-length restriction fragments called restriction fragment length
polymorphisms (RFLPs), which are specific sequences where restriction
• 1985 with the paper “Hypervariable Minisatellite Regions in Human DNA”

written by Alec Jeffreys. Jeffreys and his coworkers were analyzing the
human myoglobin gene when they discovered a region consisting of a 33-
base-pair sequence repeated four times.
• 1987, Nakamura coined the term variable number of tandem repeats

(VNTR) to describe individual loci where alleles are composed of tandem
repeats that vary in the number of core units.
testing, actually a maternity test, with paternal DNA unavailable.
authorities thought that he was not her son.
• The first application of DNA fingerprinting in forensic identification
happened later that same year, in a case that beautifully exemplifies the
power of DNA evidence to link crime-scenes, to exclude suspects, and to
support convictions. A suspect was arrested for allegedly committing a
double rape and suicide to 2 minors.
DNA Fingerprinting is the technology which is used to identify individuals on the
basis of the molecular characteristics of the DNA. More specific, this method uses
VNRT because the number of bases and repeats within a locus is unique to each
individual. For example, an individual can have in his genome the sequence
gatagata and this repeats 10 times and another can have the same sequence but
only repeats 5 times.
cases but it can be used for anthropological genetics, zoology, and botany among
others disciplines. Importantly, the technique of DNA Fingerprinting is very
1.The DNA is extracted from the nuclei of any cell in the body.
2.The DNA molecules are broken with the help of enzyme restriction
endonuclease (called chemical knife) that cuts them into fragments. The
fragments of DNA also contain the VNTRs.
3.The fragments are separated according to size by gel electrophoresis in agarose
gel.
4.The separated fragments of single-stranded DNA are transferred onto a nylon
membrane. Radioactive DNA probes having repeated base sequences
complementary to possible VNTRs are poured over the nylon membrane. Some of
them will bind to the single-stranded VNTRs. The method of hybridization of DNA
with probes is called Southern Blotting.
5.The nylon membrane is washed to remove extra probes.
6.An X-ray film is exposed to the nylon membrane to mark the places where the
marked as dark bands when X-ray film is developed. This is known as
autoradiography.
7.The dark bands on X-ray film represent the DNA fingerprints (DNA profiles).
PROFILING PROCESS
The process, developed Glassberg and independently by Jeffreys, begins
with a sample of an individual’s DNA (typically called a “reference sample”).
Reference samples are usually collected through the buccal swab. When this is
unavailable (for example, when a court order is needed but unobtainable) other
methods may be needed to collect a sample of blood, saliva, semen, vaginal
lubrication or other fluid or tissue from personal use item (for example, a
toothbrush, razor) or from stored samples (for example, banked sperm or biopsy
tissue). Samples obtain from blood relatives can indicate an individual’s profile, as
could previous profile human remain.

Since Alec Jeffreys developed the DNA fingerprinting technique, it has been used
in different scientific fields. In forensic investigations has helped to send to prison
criminals, and identify victims of crimes, natural disaster, wars. Paternity disputes
have been resolved thanks to this method.
others have driven profiling research in order to interpret the origin and behavior
of some species. In the next lines, we are going to describes how the technique
has been applied and evolved in the areas mentioned above.
DNA EXTRACTION
When a sample such as blood or saliva is obtained, the DNA is only a small
part of what is present in the sample. Before the DNA can be analyzed, it must be
extracted from the cells and purified. These are many ways this can be
accomplished, but all methods follow the same basic procedure. The cell and
nuclear membranes need to be broken up to allow the DNA to be free in solution.
RFLP (RESTRICTION FRAGMENT LENGTH

POLYMORPHISM) ANALYSIS
restriction enzyme (a restriction digests). This generates DNA fragments of
differing sizes as a consequence of variations between DNA sequences of
different individuals. The fragments are then separates on the basis of size using
gel electrophoresis. Also Karl Brown’s original techniques looked at many
minisatellite loci at the same time, increasing the observe variability, but making
it hard to discern individual alleles (and thereby precluding paternity). These early
techniques have been supplanted by PCR¬-based assays.
POLYMERASE CHAIN REACTION (PCR)
ANALYSIS
portions of the sample DNA can be amplified almost identify (Saiki et al. 1985,
1985). The process polymerase chain reaction PCR, mimics the biological process
of DNA replication, but confines it to specific DNA sequence of interest. With the
invention of the PCR technique, DNA profiling took huge strides forward in both
discriminating power and the ability to recover information from very small (or
degraded) starting samples.

One of the current techniques for DNA profiling uses polymorphism called
short tandem repeats. Short tandem repeats or STR are regions of non-coding
DNA that contain repeats of the same nucleotide sequence. For example,
GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA
is repeated six times.
AMPLIFIED FRAGMENT LENGTH

POLYMORPHISM (AFLP)
Another technique, AFLP or amplified fragment length polymorphism was
also put into practice during the early 1990s. This technique was also faster than
RFLP analysis and use PCR to amplify DNA samples. It relied on variable number
tandem repeat (VNTR) polymorphisms to distinguish various alleles, which were
separated on a polyacrylamide gel using allelic ladder (as opposed to a molecular
weight ladder).
In addition, because the analysis is done on a gel, very high repeats may bunch
together at the top of the gel, making it difficult to resolve.
technology. To summarize the methodology, genetic material like blood, semen,
saliva, hair and skin found at the crime scene are processed, and afterward the
samples are compared with the DNA of the suspects, in order to determine guilt
or innocence of the accused.
Parentage Testing
DNA fingerprinting is an advantageous technique in cases, such as, of establishing
the paternity of disputed offspring or cases of baby swapping. This method
replaced ABO blood antigen systems which cannot establish paternity but can
conclusively exclude an alleged father from being a candidate. In Parentage
testing, a DNA comparison is performed between progeny against potential
parents. Children inherit half of their alleles from each parent and thus should
possess an alleles combination of their parents.
markers to reconstruct the human diaspora and to interpret the evolutionary
history of human populations to inquire population origins, migration, admixture
and adaptation to different environments, as well as susceptibility and resistance
to disease. In the medical field, researchers have made possible the mapping
quantitative trait loci involved in biological pathways of diseases such as diabetes
mellitus, cancers, obesity, osteoporosis, and coronary heart disease.
Botany
DNA fingerprinting is an essential tool for genotype identification in both wild
plant and cultivated species. DNA profiling is used for protection of biodiversity,
identifying markers for traits, identification of gene diversity and variation.
Identification in plants always been an issue for botanists because of the large
variability of the composition and relative amount of chemicals in particular
species of the plant varies with growing condition, harvesting period, post-
harvesting period and storage conditions.
Zoology
In Zoology, DNA fingerprinting determine the genetic identity of individuals and
relationships among individuals to be determined, rather than them being
inferred from field observations. Furthermore, it helps to test predictions of kin
selection models in a realistically way, and detect hybrids species.
ADDITIONAL INFORMATION ABOUT DNA PROFILING
DNA PROFILING BIASES
Bias occurs when extraneous context or prejudice influence decisions. With DNA
mixtures, bias shifts genotype probability away from the data-derived
distribution toward a more preconceived outcome. This can happen in at
least three ways.
List of pros of DNA fingerprinting

1.It is simple, less intrusive testing.
As mentioned before, a DNA sample is needed for mapping and matching. Since a
mere sample of saliva is sufficient for the DNA fingerprinting process, it is less
intrusive to the subject.
2. It can reduce innocent convictions.
DNA fingerprinting, when used properly and along with other forensic tools and
evidence, can greatly reduce the number of innocent convictions.
3. It can help solve crimes and identity issues.
Even after decades have passed, DNA samples with forensic value can still be
available and collected as evidence.
A REPORT IN FOREN 2
Submitted To
SUBJECT INSTRUCTOR
Submitted by
AGAPAY, JAN LYSTER
CERVANTES, VIA MAE
JALIPA, MARY ROSE
LUSTESTICA, ALVIE
MEJARES, ROSHAN JANE
SAMPOLLO, NEREA
APRIL 19, 2022

Objective:
At the end of this lesson, you should be able to:
1. Identify what are the importance of Forensic Anthropology.

2. Know the importance and lesson of Forensic Anthropology.
3. Differentiate what is Forensic Anthropology does and what its relationship with
other crime scene investigators.
Introduction
In these cases, the medical examiner often examines the body if there is sufficient soft
tissue remaining, However, if the death was suspicious and the human remains are
more skeleton than flesh, forensic anthropologists become the primary examiners,
because they specialize in osteology, the study of bones and their diseases.
But forensic anthropologists don't study the structure and function of bones, at least not
in the way non-forensic osteologists do. Forensic anthropologists must be able to
identify each bone in the body, whole or fragmented, determine which side of the body
it's from, and discern if it shows signs of disease, trauma, or taphonomy (anything
affecting bodies and bones after death, such as carnivore scavenging, tampering, and
water damage).
❖ Forensic anthropology
• Forensics (Latin- pertaining to the forum)
• Anthropos (Greek- human or man)
• Logia (Greek- study)
The study of man for the purposes of the court.
➢ Forensic anthropology applies the science of physical or biological anthropology

to the legal
process. Anthropology is the study of humans, and in this forensic discipline physical or
biological anthropologists focus their studies on the human body as it relates to

explaining the
circumstances of an accident or solving a crime-often homicide
➢ Forensic anthropologists analyze human remains, typically in criminal

investigations.
Their study of human remains aids in the detection of crime by working to assess the
age, sex,
stature, ancestry and unique features of a skeleton, which may include documenting
trauma to the skeleton and its postmortem interval.
History of Forensic Anthropology
(Divided into four periods)
1. Formative Period (1849-1938)

1849 Boston, Dr. John Webster murdered Dr. George Parkman because he owed
Parkman quite a bit of money. However, two anatomists (Drs. Oliver Wendell Holmes
and Jefries Wyman) successfully reassembled the skeletal remains and determined that
they matched the stature, ancestry (Caucasian), and approximate age of Dr. Parkman.
1894, Thomas Dwight
-gave his Shattuck Lecture about the analysis of human skeletal remains in a legal
setting.
- he was rightfully hailed as the "Father of Forensic Anthropology.
- Forensic anthropology's origin in the United States can be traced to the Parkman
murder of 1849. Two anatomists first demonstrated the effectiveness of methods
regularly used in forensic anthropology today.
Oliver Wendell Holmes the First and Jeffries Wyman
-were professors of anatomy at Harvard University in 1849 when they were asked to
investigate a mysterious death. A dismembered body was found in an anatomy lab and
privy (septic tank) as well as a burnt head in a furnace. Holmes and Wyman got the help
of their anatomy colleagues reassembled the body and determine that it was a 5-foot
101/2-inch white male who was between 50 and 60 years old when the victim died.
- Another famous formative period crime was the leutgert case of

1897- it was a highly publicized murder; Adolph leutgert was accused of killing his wife
Louisa and placing her body in a vat of potash at his sausage factory. The body
dissolved leaving only a greasy jelly, four small pieces of bone and a ring belonging to
Mrs. Leutgert. The bones fragments were so small they could fit on a present-day
quarter but the prosecution called anthropologist George A. Dorsey (1868-1931) who
appeared to been aware of Dwight's work to determine if the bones could be identified.
- Books were published by Harris H. Wilder (1864-1928) and Bert Wentworth outlining
the aspect of human identification from work on dermatoglyphics (configuration of
fingerprints) and reproduction of the face from the skull, methods still used by forensic
anthropologist today. Paul Stevenson (1890-1971) put out a couple of articles on human
skeletal identification; one on determining age from the epiphyseal union of the long
bones and the other on the stature of Chinese from long bone measurements.
- Two physicians who played prominent, albeit unwitting roles in the development of
forensic anthropology.
- T. Wingate Todd, a physician in Cleveland, Ohio started what was to become the
Hamann-Todd collection of human skeletal remains (it also contains a large number of
nonhuman primate skeletons). 1912 and 1938 he was able to acquire the bones of
approximately 2600 persons. Many of these, the demographics are known
unequivocally making this collection heavily used for developing standards for
determining ancestry, sex, age and stature from various aspects of the human skeleton.
- Robert J. Terry and his successor Mildred Trotter performed a similar task in St. Louis,
Missouri. Between 1914 and 1965 the Terry collection of 1636 human skeletons was
compiled from dissecting-room cadavers, many of known age, sex and ancestry. The
collection that bears his name is now housed in the Smithsonian institution where it is
used regularly for human skeletal research.
- A book was published in 1937 by John Glaister and J.C Brash (the investigators of this
case) called Medico-Legal Aspects of the Ruxton Case, which has the facts of this case.
2. Consolidation Period (1939-1971):
Anthropologist Wilton Krogman

-published his book, "The Human Skeleton in Forensic Medicine", in 1962. Forensic
anthropologists use this text even today.
1954 by Tom McKern and T. Dale Stewart

- published Skeletal age changes in young American males.
-established skeletal aging techniques based on data from skeletal remains of Korean
War soldiers.
Guide to the Identification of Human Skeletal Material
by Wilton Marion Krogman (1903-1987) in 1939 seems to end the formative period. This
was written as a pamphlet for the FBI and it summarized what was known about the
human skeleton up to that time
Several events that took place in the 1940s and 1950s that were to have a great
impact on forensic anthropology
- One during World War ll, the bodies of skilled service men often could not be
recovered from the battlefield fast enough (and so came badly decomposed) or were so
severely disfigured that identification was difficult. U.S. Army Office of the
Quartermaster established the Central Identification Laboratory in Hawaii (CILHI for
short) with Charles E. Snow (1910-1967) as it's first director. Mildred Trotter (1899-
1991) took over the lab when snow returned to teaching on the mainland in 1948. She
began working on improving ways of determining stature from the lengths of long
bones, using the skeletons of killed servicemen and records of their heights. The result
of her work at CILHI and as professor of anatomy at Washington University in St. Louis
Missouri over the next quarter century is a standard set of formulas used for decades
for determining stature from skeletonized remains.
-Second event of this period that increased our knowledge base of skeletal identification
was the Korean War. Again faced with the problem of identifying servicemen killed in
action, the U.S. Army established and identification laboratory in Japan with T. Dale
Stewart (1901-1997) as it's director. Under Stewart's guidance, Thomas Mckern
undertook a definitive study for determining age from aspects of the skeletal remains
odlf deceased soldiers. The ensuing publication Skeletal Age Changes in Young
American Males (Mckern and Stewart, 1957) still provides the standards for determining
age at death from osteological remains.
3. Modern Period (1972-1999)

The American Academy of Forensic Sciences (AAFS)
-established a section for forensic anthropology called the Physical Anthropology

Section.
1977
-the American Board of Forensic Anthropology (ABFA) was created to certify

professional forensic anthropologists and to set professional standards.
1980
- Dr. William Bass set up the "Body Farm" at the University of Tennessee, Knoxville to
research human decomposition and taphonomy.
1986, Drs. Richard Jantz and Stephen Ousley
-developed FORDISC, a computer program that enables forensic anthropologists to

perform metric
analyses on skeletal remains based on data from contemporary populations. The goal is
to determine sex, ancestry, and height from the measurements.
Dr. Clyde Snow
- began training forensic anthropologists to work on human rights and genocide cases.
The first such team was the Argentine Forensic Anthropology Team (EAAF).
Dr. William R. Maples
-founded the C.A. Pound Human identification Laboratory (CAPHIL), the first private
The most influential book in this field was written by T. Dale Stewart; Essentials of
Forensic Anthropology in 1979. The period is considered to have begun when the
Physical Anthropology Section in the American Academy of Forensic sciences (AAF)
met tor the first time in 19/2. Ells R. Kerley (1924-1998) and Clyde Collins Snow (1928-
presentg are the founders often Sector,
4. Fourth era (2000-present)

The Ellis Kerley Foundation
-was established as the first funding source solely for forensic anthropological research
in 2000.
2003
-JPAC was the first skeletal identification lab to obtain ASCLD-LAB (American Society
of Crime Laboratory DirectorsS-Laboratory Accreditation Board) accreditation. CAPHIL
followed soon after.
Since the 13th century, medical examiners have sought to determine the causes of
deaths and to solve crimes. Given that a death can be natural, accidental, homicide,
suicide, or undetermined, forensic science has been greatly aided by developments in
modern chemistry, toxicology, and photography.
Johann Friedrich Blumenbach
-German anthropologist in comparative human morphology, early forensic

anthropologists relied upon anthropometry (the science of recording measurements of
various parts of the human body).
Hans Gross
-The publication of Austrian criminologist "Handbuch für Untersuchungsrichter " (1893;

Criminal Investigation) helped to establish the science of forensics, especially in terms
of a cross-transfer of evidence, such as dirt, fingerprints, carpet fibers or hair, from the
criminal to the victim. Early in the 20th century, serological research led to the discovery
of the A, B, AB, and O blood groups, thus increasing the value of blood as evidence at a
crime scene.
Mid-20th century
-advances in biochemistry and technology resulted in the discovery of unique gene

markers in each person; these genetic differences allow for the DNA fingerprinting of
hair, blood, semen and tissue.
Thus, DNA testing was a major contribution to modern forensic science, though forensic
anthropologists generally, do not conduct such DNA analyses and often only supply
samples to be tested. The 20th and
21st centuries have also seen substantial growth in public and private forensic
laboratories, enabling the collection and study of empirical evidence.
Forensic anthropologists use a number of techniques when studying skeletal remains,

including
• Clay or graphic facial reproduction.

This is used to recreate a face from skull with the use of soft tissue depth estimates in
manual methods, is done by using clay, plastic and wax directly on the victim's skull.
• Scanning electron microscopy
Scanning electron microscope (SEM) Is a type or electron microscope that produces

images of a sample by scanning the surface with a focused beam of electrons. The
electrons interact with atoms in the sample, producing various signals that contain
• Radiographic techniques
Is an imaging technique using X- rays, gamma rays, or similar ionizing radiation and
non-ionizing radiation to view the internal form of an object.
• Photo or video superimposition techniques
The term of photographic superimposition has been applied for a number of techniques
in forensic medicine and dentistry. The comparison of an antemortem photograph to
that of a skull is one such procedure. Technical information and potential sources of
difficulty are discussed finally two cases illustrate the use and misuse of this technique
• The casting of skeletal materials
Skeletal remains are physical records that can help determine the adaptations/biological
features of a species or an individual. Casting protects original materials and makes
new material available for people or research. Casting and molding are processes that
duplicate fossil and also recent skeletal material.
• Preservation of skeletal materials using commercial preservatives
A compound or solution is used in the field for consolidation of bone or skeleton in order
to preserve it.
Thin-sectioning techniques of bone histology involving hand grinding technique has

been developed to produce 20-40-un-thick sections of bone-titanium implant sites.
• Rehydration and preservation of mummified or decayed soft tissues.
Process and chemical formula for rehydrating soft tissues of mummified corpses or
under an initial process of putrefaction. And the chemical formula for the subsequent
preservation thereof. The present invention is novel since it includes a process and a
chemical formula which are efficient for rehydrating the whole soft tissues present in a
mummified corps, or in its initial process of putrefaction, thus reversing the physical
changes that these phenomena had caused there to.

-Forensic anthropology, application of physical anthropology to legal cases, usually with
a focus on the human skeleton.
-Forensic anthropology uses the techniques of physical anthropology to analyse

skeletal, badly decomposed, or otherwise unidentified human remains to solve crimes.
-Forensic anthropologists can assess the age, sex, and unique features of a decedent
and are invaluable in documenting trauma to the body and estimating how long a
corpse has been decomposing.
-Forensic anthropologists work closely with individuals in law enforcement and medical
science and especially with specialists in ballistics, explosives, pathology, serology (the
study of blood and bodily fluids) and toxicology and are often expert witnesses in
murder trials.
-Although physical anthropology is concerned with human evolution, human variation,

and the biological bases of human behaviour, many of its excavation and reconstruction
-Both disciplines use empirical evidence, genetic information, and computer technology
to determine the physical characteristics of human specimens. Indeed, a forensic
anthropologist can reconstruct the face of a murder victim in much the same way a
physical anthropologist can reconstruct the face of a 100,000-year-old Neanderthal
skull.
-Forensic anthropology involves applying anthropological research and techniques to

medico legal issues. There are three subsections within the field of forensic
anthropology, including: a) Forensic Osteology - the study of the skeleton; b)Forensic
Archeology - involves the controlled collection of human remains; c) Forensic
Taphonomy- involves the study of changes to the body after death, including
decomposition and environmental modification).
-It applies the science of physical or biological anthropology to the legal process.
anthropologists focused their studies on the human body as it relates to explaining the
circumstances of an accident or solving a crime-often homicide.
-It involves applying anthropological research and techniques to medicolegal issues.
-It includes the identification of Skeletal, decompose or unidentified human remains.
-Forensic anthropologists may team up with forensic pathologists, forensic dentist and
homicide detectives to identity a dead on and the time and manner of their death. DNA
forensics, blood groups, and fingerprints are all tools of the trade in forensic
anthropology today.
-Forensic anthropologists analyze human remains, typically in criminal investigations.

Their study of human remains aids in the detection or crime by working to assess the
age, sex, stature, ancestry and unique features of a skeleton, which may include
documenting trauma to the Skeleton and its postmortem interval.
Forensic Anthropology Concept
✓ Age determination
✓ Sex determination
✓ No. of individuals
✓ Cause of death
✓ Individual identification
✓ Disease processes
What can be identified?
✓ Human or not
✓ Minimum number of individuals
✓ Sex
✓ Approximate age
✓ Race
✓ Approximate stature
✓ Commingling
✓ Skeletal injury
✓ Cause of death
✓ Time Since death
3 Subsections of Forensic Anthropology

1. Forensic Osteology (the study of the skeleton)
Is that the application of the study of bones (osteology) to the field of forensic science.
Whereas a Medical Examiner (aka- Me, and usually a trained forensic pathologist) is
experienced in dealing with bodies that still retain soft issues, the field of forensic
osteology deals almost exclusively with skeletal material and the manner in which the
skeletonization occurred.
2.Forensic Archeology (involves the controlled collection of human remains)
-is a field of forensic science which involves application of archaeological methods in

investigation of a crime scene in order to identity evidence and reconstruct crime scene,
usually a murder Forensic archaeologist are employed to excavate and recover human
remains, personal items, weapons, etc. 25 well as eliminate non related objects.
3. Forensic Taphonomy ( involves the study of changes to the body after death,
including the decomposition of environmental modification)
• Forensic Taphonomy is a new, emerging field, which originated as a subfield of

forensic anthropology. The word taphonomy derives from Asian Greek, were
“tapho” is “burial” and “nomos” is “laws” so it is the study of the laws of burial.
❖ Anthropology
-Forensic anthropology, application of physical anthropology to legal cases, usually with

a focus on the human skeleton.
-Forensic anthropology uses the techniques of physical anthropology to analyze -

skeletal, badly decomposed, or otherwise unidentified human remains to solve crimes.
-Forensic anthropologists can assess the age, sex, and unique features of a decedent
and are invaluable in documenting trauma to the body and estimating how long a
corpse has been decomposing.
-Forensic anthropologists work closely with individuals in law enforcement and medical
science and especially with specialists in ballistics, explosives, pathology, serology (the
study of blood and bodily fluids) and toxicology and are often expert witnesses in
murder trials.
-Although physical anthropology is concerned with human evolution, human variation, -

and the biological bases of human behavior, many of its excavation and reconstruction
-Both disciplines use empirical evidence, genetic information, and computer technology
to determine the physical characteristics of human specimens. Indeed, a forensic
anthropologist can reconstruct the face of a murder victim in much the same way a
physical anthropologist can reconstruct the face of a 100,000-year-old Neanderthal
skull.
-Forensic anthropology involves applying anthropological research and techniques to

medico legal issues.
There are three subsections within the field of forensic anthropology, including:
• Forensic Osteology (the study of the skeleton)
• Forensic Archeology (involves the controlled collection of human remains)
• Forensic Taphonomy (involves the study of changes to the body after death,
including decomposition and environmental modification)
References
https://www.britannica.com/science/forensic-anthropologyynaturalhistory.si.edu
https://sites.google.com/site/holforensicanthro/home/lesson-1-introduction-and-histosy
https://www.swganth.org.historicalbackground
http://www.crimesceneinvestigatoredu.org/forensic-anthropologist/
A REPORT IN FOREN 2
Submitted TO
SUBJECT INSTRUCTOR
Submitted by
ADAYA, JEMALYN
CABILDO, CHRISTOPHER
CALAWOD, JEAN LORRAINE
CHIVA, LEIANNE JEAN
ESPARAGOZA, JOHN GREG
JAMELARIN, LOBELYN
LEGADA, JC
NIÑORA, JOHN PAUL
3-BRAVO
April __21__, 2022
FORENSIC ODONTOLOGY
Learning objectives:
At the end of this lesson, the students should be able to:
4. Know the history of forensic odontology;
5. Define the meaning of forensic odontology;
6. Analyze, compare and determine the dental identification.
Introduction
only after death but remain unchanged for many thousands of years. Also can be used
as a weapon of attack or defense under certain circumstances may leave information as
to the identity of the biter. Human teeth and dental
restorations have proven to remain stable during a long
time as well as in extreme situations such as fire.
The evolution of forensic odontology started right
back in the Garden of Eden. According to the Old
Testament, Eve convinced Adam to put a bite mark in
apple. It was told that “It is always tempting to suggest
that the history of bite mark evidence (forensic dentistry)
began with the eating of forbidden fruit in the Garden of
Eden.” But the dentist or forensic odontologist were rare at that time. There is no record
of events, comparisons or analysis, and it is in addition there were a limited number of
❖ 66 AD- Well-documented evidence to the use of teeth for identification began 66

❖ 1193- The first forensic identification in India started in were Jai Chand, a great
❖ It was used in the identification of Adolf Hitler and his wife Eva Brawn at the end
of World War II.
❖ 1453- first formally reported case of dental identification was that of the 80 years
❖ 1758- Peter Halket was killed in during French and Indian wars in a battle near
❖ 1870, Ansil L Robinson was charged with the murder of his mistress; Mary
❖ Wayne Clifford Boden was a Canadian serial killer and rapist active from 1969-
❖ Early in 1775 Revere constructed a silver wire fixed bridge

for his close friend Dr. Joseph Warren, a medical
practitioner. At the outset of the war, Warren refused the
appointment of surgeon-in-chief to the continental army.
Instead, he requested the rank of a line officer;
Unfortunately, Warren was killed by a bullet that pierced
❖ 1776- At the battle for Breed’s Hill in Boston, Dr. Joseph Waren was killed in the
❖ In 1897 a paper entitled, “The role of the Dentists in the identification of the victims
international Medical Congress of Moscow. The bazar, at
which the wealthy women of Paris annually raised money
for projects for the poor, was destroyed within 10 minutes
and 126 persons lost their lives.
❖ Dr. Oscar Amoedo was considered as the father of the

forensic odontologist. The thesis done by him entitled ‘L’
Art Dentaire en Medicine Leagale’ in 1898 to the faculty of
medicine earned him a doctorate. This book is the first
comprehensive text on forensic odontologist.
❖ The first forensic odontologist in the United States was Dr.

Paul Revere who identified the extreme body of Dr. Joseph Warren through a
bridge of silver and ivory that he had constructed two years previously.
❖ 1937 in Chantilly, a murder was convicted on the evidence of the bite marks that
❖ The fire on board the “Scandinavian Star” was one of the world’s worst ferry
❖ Forensic odontologists successfully identified tsunami victims in South-East Asia

experts.
❖ The famous Iroquois theatre in Chicago was burned in 1903 and for about 602 of
❖ First work in facial reconstruction was done by Kollman and Buchley. The
techniques.

Expertise, is the application of dental knowledge to the understanding of laws.
Some of the work a Forensic Odontology is involved in is: identification of bite
marks on the victims of attack.
identification during mass calamities, sexual assault and child abuse to name a
few.
❖ Forensic odontology is the application of dentistry to the investigation of crime

and medicolegal investigations. It has its main applications in the identification
of corpses and human remains and in bite mark analysis.

knowledge.
❖ Identifying human unknown remains through dental records and craniofacial

bones





teeth, missing teeth, the curves of biting edges,
unique dentistry, and wear patterns such as chips
or grinding. The amount and degree of detail
recorded in the bitten surface may vary from case
to case.

preserved. In situations where sufficient details are available, it may be possible to identify
the biter to the exclusion of all others.
SEX DETERMINATION
❖ Sex difference in tooth dimension: Sex determination by measuring mesiodistal
❖ Tooth morphology: In male, the distal accessory ridge in canines is more

❖ Bite marks may be found on the flesh of victims of a violent attack, particularly
❖ The bite mark is defined as the physical alteration in or on a medium caused

times.
the wound.
❖ Bite marks change over a time on living as well as dead. If the bite is on living

Forensic dentists use several different terms to describe the type of

bite mark:
❖ Artifact - when a piece of the body, such as an ear lobe, is removed through
biting
Forensic dentistry or forensic odontology is the handling, examination and

evaluation of dental evidence in criminal justice cases. Forensic dentists are involved in
assisting investigative agencies to identify recovered human remains in addition to the
identification of fragmented bodies.
Forensic Odontologists
The forensic odontologists on these teams are dentists who have such special
skills in the areas of forensic dental science, including criminal investigation and
identification. They analyze any dental evidence, make forensic conclusions, and testify
in court to support their conclusions. Forensic odontologists often play an essential role
in identifying either victims of disasters or victims and suspects of individual crimes. They
thereby assist the legal authorities in solving crimes and bringing criminals to justice.
Forensic odontologists have other roles as well.
Odontologists need a unique skillset to excel in this field, including:
Attention to detail: Odontologists find evidence in small details, including fragments

of teeth or partial bite marks. Attention to detail helps them perform exact work.
Communication skills: Odontologists need to explain how they reached their
conclusions when testifying in court. They express their procedures and findings in non-
technical terms so everyone can understand.
Objectivity: Forensic odontologists need to be objective to make scientifically-
based conclusions using physical evidence.
Fine motor skills. Odontology requires precision and accuracy. The identification
process may require the use of microscopes or more complex technologies and the
manipulation of small items.
Knowledge of the legal system. Good knowledge of the legal system is useful as
they work closely with the judicial system. Odontologists must understand the impact of
their testimony and evidence they bring to court.
Dental evidence may include such diverse items as a bite mark impression, the
entire dentition of a victim, or just a single fragment of a tooth found at a crime scene.
Dental evidence also includes the premortem, or historical evidence of dental treatment,
such as textual records, diagrams, and X-rays.
Because teeth are the hardest materials of the human body and strongly resist
postmortem changes and adverse environmental conditions such as fire, water
immersion, or explosion, dental evidence is often available in crime cases.
DNA PROFILING
A REPORT IN FOREN2
SUBMITTED TO:
MRS SHARON CORDERO
SUBJECT INSTRUCTOR
SUBMITTED BY:
VILLALUZ, APRIL MAE
MANALO, ANGELIZER
CABRILLOS, MARK ANTHONY
RUIZ, JOHN REZ
GASPAR, ROBERT STEVE
BSCRIM 2- HOTEL
APRIL 21,2022
Introduction
Deoxyribonucleic acid (DNA) is the fundamental building block of all living cells. The
characteristics, traits, and physical features of an organism are determined by the
specific arrangement of DNA base-pair in the cell. DNA is a polymer consisting of a
large repetition of monomer sequences. The monomer units of DNA are nucleotides.
Each nucleotide consists of three components: (1) deoxyribose (a 5-carbon sugar), (2)
a nitrogen-containing base attached to the sugar, and (3) a phosphate group.
Deoxyribose and phosphate components are common (repeat) for all nucleotides,
and the nitrogen containing bases may vary, being of four types. The nucleotides are
given one-letter abbreviations (shorthand for the four bases): A for adenine; G for
guanine; C for cytosine; and T for thymine. These bases belong to two main classes:
purinic (A and G) and pyrimidinic (C and T). Their number is equal. It is this distinct
arrangement of adenine, guanine, thymine, and cytosine that regulates the
production of specific proteins and enzymes in a cell. Thus, DNA is the basic
genotype (genetic identity) of an organism, which in turn determines the phenotype
(physical features). Subsequently, particular DNA profiles can be ascribed to
particular organisms. The DNA profile thus constitutes a unique fingerprint, specific
to each individual .
DNA is a molecule that contains the instructions needed for an organism to develop
and function. These instructions are stored as a code made up of four chemical
bases: adenine (A), guanine (G), cytosine (C) and thymine (T).
A specific pattern of DNA attributes that is obtained in the laboratory and can be
used to identify an individual. The order, or sequence, of these bases form the
instructions in the genome. DNA is a two-stranded molecule. DNA has a unique
‘double helix’ shape, like a twisted ladder.
Each strand is composed of long sequences of the four bases, A, C, G and T.

The bases on one strand of the DNA molecule pair together with complementary
bases on the opposite strand of DNA to form the ‘rungs’ of the DNA ‘ladder’.
The bases always pair together in the same way, A with T, C with G.
Each base pair is joined together by hydrogen bonds.
Each strand of DNA has a beginning and an end, called 5’ five prime and 3’ three
prime respectively.
The two strands run in the opposite direction (antiparallel) to each other so that one
runs 5’ to 3’ and one runs 3’ to 5’, they are called the sense strand and the antisense
strand, respectively.
The strands are separated during DNA replication.
This double helix structure was first discovered by Francis Crick and James Watson
with the help of Rosalind Franklin and Maurice Wilkins.
The human genome is made of 3.2 billion bases of DNA but other organisms have
different genome sizes.
Chromosomes are DNA wrapped around proteins to form an X-shaped structure.
A chromosome actually looks something like this:

Here is another depiction of a chromosome, which shows the familiar DNA double
helix design.
Since it was invented in 1984, DNA fingerprinting most often has been used in court
cases and legal matters. It can:
• Physically connect a piece of evidence to a person or rule out someone as a

suspect.
• Show who your parents, siblings, and other relatives may be.
• Identify a dead body that’s too old or damaged to be recognizable.
History of DNA fingerprinting

DNA fingerprinting was invented in 1984 by Professor Sir Alec Jeffreys after he
realized you could detect
variations in human DNA, in the form of these minisatellites.
DNA fingerprinting is a technique that simultaneously detects lots of minisatellites in
the genome to produce a pattern unique to an individual.
It was not until 20 years ago that Sir Alec Jeffreys, professor and geneticist at the
University of Leicester inthe United Kingdom (UK), pioneered DNA-based identity
testing .Professor Jeffreys was interested in studying the genetic variation between
individuals and had done some of the early work to detect genetic differences in
humans. However, the answer did not come to him on the initial project he was
interested in but rather on an unrelated project: analysis of the myoglobin gene in
seal meat at the headquarters of the British Antarctic Survey. When he and his
colleagues compared the myoglobin gene in seals with the human counterpart, they
found that some short repeating sequences were homologous between seals and
humans. When they compared those sequences with the published sequences of
tandem repeats called minisatellites, they found that they were the same . Professor
Jeffreys recognized that the repeating sequences “could be highly variable,
informative genetic markers” . His group developed a radioactive probe, made up of
short sequences, that could latch onto those repeating sequences and ultimately
reveal patterns that were unique to each individual: a DNA “fingerprint” .
The steps involved in DNA fingerprinting are as follows. First, the DNA is extracted
from the specimen (i.e., blood, semen, skin, hair). After DNA extraction, restriction
enzymes are added, which work like scissors to cut the DNA into the smaller
segments that are different between individuals. The DNA seg-ments are sorted by
agarose gel electrophoresis and visualized by staining with ethidium bromide. A
Southern blot is performed to transfer the DNA onto a membrane. A radioactive
probe is applied to the membrane, and the pattern of DNA is detected by exposing
the membrane to x-ray film. The result is a pattern of DNA bands that looks like a
supermarket bar code. Each individual has a signature fingerprint .
Professor Jeffreys looked at a DNA fingerprint of a human family; he also looked at

the fingerprint of a cow, a baboon, a mouse, and a tobacco plant. The pattern of DNA
segments, composed of perhaps 15 to 20 bands, was different for each one.
However, closer inspection of the patterns of the human family revealed that the
mother and the father each had their own pattern and that the child had a
composite of both, having inherited an allele from the father and the mother.
In the spring of 1985, Professor Jeffreys and his colleagues published their first article
on DNA fingerprinting and saw the utility of it in the forensic sciences and in
paternity identification . Newspapers publicized the findings, and shortly thereafter a
lawyer became interested in the test and saw its applicability in one of the cases she
was representing.
There are many examples in the media of crimes that have been solved decades after
they were committed because evidentiary material has been re-examined using DNA
profiling for the first time, or more sensitive DNA techniques have become available.
For cold crimes to be solved, there needs to be cooperation between law
enforcement agencies, the forensic laboratory and a centralized DNA database.
Statutes of limitation that were imposed because of the knowledge that with time
witness accounts may no longer be accurate may need to be reassessed because
DNA testing can still provide answers after many decades. A 2002 National Institute
of Justice report provides some practical considerations about DNA profiling to solve
cold cases.
1984 - Alec Jeffreys discovered the technique of genetic fingerprinting in a laboratory

in the Department of Genetics at the University of Leicester.
1986- DNA fingerprinting was first used in a police forensic test.
1987 – The first DNA profile developed, also by Jeffreys.
PROCEDURE IN TO CREATE A DNA PROFILING
EVEN THOUGH 99.9 PERCENT OF HUMAN DNA is exactly the same in all people, a
single droplet of blood or stray eyelash collected at a crime scene still carries all the
genetic information needed to convict a criminal. Back at the lab, forensic scientists
simply probe the remaining 0.1 percent of the genome—3 million nucleotide bases—
for telltale variations. This process, known as DNA profiling or genetic fingerprinting,
reveals a suite of variations in the genetic code that, taken together, constitute an
individual’s unique DNA profile. Here’s how it works:
1. Collect a sample and extract its DNA. Scientists only need a tiny amount of DNA—
around 100 micrograms—to construct a DNA profile from a crime scene sample.
That’s so little, a few cells from saliva on a straw will do.
2. Amplify the telltale regions. Scientists use a powerful technique called Polymerase
Chain Reaction (PCR) to make millions of copies of the sample’s telltale DNA regions.
In particular, they home in on regions known as Short Tandem Repeats, or STRs,
which are composed of short units of DNA—just four or five bases long—that are
repeated numerous times in a row. What makes these regions telltale is that the
number of repeats they contain varies widely from person to person. In criminal
investigations, 13 such STR regions, all located in the non-coding DNA between our
genes, are analyzed for the number of repeated units they contain.
3. Count the repeats. During PCR, fluorescent dyes are attached to all the STR copies
that get made—one type of dye for each STR region—so that all of the DNA copies
from a given region can be distinguished from the others in the mix. Scientists run
the mixture through a capillary electophoresis machine, which separates the various
DNA fragments by size. From there, it’s a fairly easy thing to calculate the length of
each STR region, and, therefore, the number of repetitive units at each site.
4. Look for a match. To convict a suspect, his or her STR repeats must match those in
the crime scene sample—at all 13 STR regions. According to the FBI, when all 13 STR
sites match perfectly, it’s virtually guaranteed you’ve got your culprit; the odds of
fingering the wrong person are about one in 1 billion. A single STR mismatch,
however, is enough to exonerate a suspect and spur investigators to search CODIS,
the nation’s database of DNA profiles, in hopes of solving the crime.
DNA Profiling Processing
Following is a review of the steps involved in processing forensic DNA samples with
STR markers. STRs are a smaller version of the VNTR sequences first described by Dr.
Jeffreys. Samples obtained from crime scenes or paternity investigations are
subjected to defined processes involving biology, technology, and genetics.
Biology
Following collection of biological material from a crime scene or paternity
investigation, the DNA is first extracted from its biological source material and then
measured to evaluate the quantity of DNA recovered. After isolating the DNA from
its cells, specific regions are copied with a technique known as the polymerase chain
reaction, or PCR. PCR produces millions of copies for each DNA segment of interest
and thus permits very minute amounts of DNA to be examined. Multiple STR regions
can be examined simultaneously to increase the informativeness of the DNA test.
Technology
The resulting PCR products are then separated and detected in order to characterize
the STR region being examined. The separation methods used today include slab gel
and capillary electrophoresis (CE). Fluorescence detection methods have greatly
aided the sensitivity and ease of measuring PCR-amplified STR alleles. After detecting
the STR alleles, the number of repeats in a DNA sequence is determined, a process
known as sample genotyping.
Genetics
The resulting DNA profile for a sample, which is a combination of individual STR
genotypes, is compared to other samples. In the case of a forensic investigation,
these other samples would include known reference samples such as the victim or
suspects that are compared to the crime scene evidence. With paternity
investigations, a child's genotype would be compared to his or her mother's and the
alleged father(s) under investigation. If there is not a match between the questioned
sample and the known sample, then the samples may be considered to have
originated from different sources. The term used for failure to match between two
DNA profiles is 'exclusion.'
Applications of DNA Profiling
1. Paternity and Maternity

Because a person inherits his or her VNTRs from his or her parents, VNTR patterns
can be used to establish paternity and maternity. The patterns are so specific that a
parental VNTR pattern can be reconstructed even if only the children's VNTR patterns
are known (the more children produced, the more reliable the reconstruction).
Parent-child VNTR pattern analysis has been used to solve standard father-
identification cases as well as more complicated cases of confirming legal nationality
and, in instances of adoption, biological parenthood.
2. Criminal Identification and Forensics

DNA isolated from blood, hair, skin cells, or other genetic evidence left at the scene
of a crime can be compared, through VNTR patterns, with the DNA of a criminal
suspect to determine guilt or innocence. VNTR patterns are also useful in establishing
the identity of a homicide victim, either from DNA found as evidence or from the
body itself.
3. Personal Identification
The notion of using DNA fingerprints as a sort of genetic bar code to identify
individuals has been discussed, but this is not likely to happen anytime in the
foreseeable future. The technology required to isolate, keep on file, and then analyze
millions of very specified VNTR patterns is both expensive and impractical. Social
security numbers, picture ID, and other more mundane methods are much more
likely to remain the prevalent ways to establish personal identification.
DNA FINGERPRINTING PRINCIPLES AND FORENSIC APPLICATIONS

The first technique of this type was developed in England by the geneticist Alec
Jeffreys in the mid-1980s, who was looking at techniques to screen for hereditary
diseases and genetic defects. However, when asked by the local constabulary to
investigate a rape case, he successfully identified the rapist from his DNA profile.
Within a few years, DNA profiling-based techniques were used by forensic scientists
around the world.
Unique DNA sequences are present in all species and are used as biomarkers for the
detection of cells from that species. These DNA sequences can most easily be
detected using the polymerase chain reaction (PCR) -based DNA fingerprinting
methods. All DNA fingerprinting techniques produce a pattern or profile of nucleic
acids amplified (by PCR) from a sample and that pattern reflects the microbial
community structure from an environment (Kitts, 2001). DNA fingerprinting or
profiling comprises any DNA-based techniques that identifies the DNA from a certain
individual or group of individuals within a community of organisms. The DNA
fingerprints may be used as a tool for determining the identity of a specific DNA
sample, or to assess the relatedness between samples. Most DNA fingerprinting
methods are highly specific, highly sensitive, and largely independent on the
physiological or growth state of the organisms, which make them of particular
interest for forensic investigations.
The principle of these techniques consists of screening for certain DNA sequences
that are found in some individuals, but not in others, thus visualizing DNA
polymorphisms between samples and producing specific DNA fingerprints. Each
individual has a DNA profile as unique as a fingerprint. In the case of humans, for
instance, over 99% of all nucleotides are identical among all individuals. However,
for every 1000 nucleotides inherited there is one site of variation, called
polymorphism, in the population. These DNA polymorphisms induce the change in
the length of the DNA fragments produced by digestion with restriction enzymes in
the course of a fingerprinting technique. So, DNA polymorphism determines the
resulting fragments to be of different length and/or sequence. Gel electrophoresis is
used to separate and determine the size of the resulted fragments. This is because
DNA is a charged molecule, so in an applied electric field it moves toward an
electrode. The exact number and size of fragments produced by a specific restriction
enzyme digestion varies between individuals. The fragments are arranged in order of
length and tagged with radioactive probes emitting x-rays, so when the sample is
photographed they show up. This produces the fingerprint represented by a series of
black lines corresponding to the DNA sequences present.
Many DNA fingerprinting methods are available. DNA fingerprinting techniques with
potential applicability in environmental forensics are listed in Table 15.2. They differ
methodologically using various techniques to look into the polymorphism of certain
genes. All these techniques function based on the same principle described earlier,
and they all result in producing specific patterns (fingerprints) of microbial
communities in the environment.
DNA PROFILING TO SOLVE CASES

DNA profiling can be used in old or unsolved crimes or to identify human remains.
The availability of parental DNA samples might allow identification of a body when
conventional means (physical appearances, dermatoglyphic fingerprints, dental
charts) have been unsuccessful. Dissimilar DNA profiles will exclude a relationship.
Teeth are important evidentiary material in forensic cases, since they are more
resistant to postmortem degradation and extreme environmental conditions. Teeth
are also easy to transport and serve as a good source of DNA. Comparisons of
antemortem dental records with skeletal remains have long provided a useful means
of identifying individuals, even in a mass grave. In affluent societies, dental records
may be decisive in determining the identity of individual victims. However, in less
affluent communities, which are more likely to be involved in human rights abuses
associated with mass murder, dental records are unlikely to be available. In this
situation, the only option for identification might be DNA analysis.
There are many examples in the media of crimes that have been solved decades
after they were committed because evidentiary material has been re-examined using
DNA profiling for the first time, or more sensitive DNA techniques have become
available. For cold crimes to be solved, there needs to be cooperation between law
enforcement agencies, the forensic laboratory and a centralized DNA database.
Statutes of limitation that were imposed because of the knowledge that with time
witness accounts may no longer be accurate may need to be reassessed because
DNA testing can still provide answers after many decades. A 2002 National Institute
of Justice report provides some practical considerations about DNA profiling to solve
cold cases.
DNA TESTING
The DNA of all human beings is nearly identical. Approximately 99.9% of the
sequence of DNA is in the exact same order. This determines common human
features such as two eyes, ears on both sides of the head, and long bonesin forearms
and calves. Although looking at these parts of the DNA
molecule might help us determine it is human DNA — rather than, say, banana DNA
— it isn’t helpful in distinguishing one human from another. There are, however,
places on the human DNA molecule that are different. Ofthe approximately 3.2
billion base pairs in the human genome, some 3 million base pairs of DNA (about
0.10 percent of your entire genome) vary from person to person. These variations
are at the core of DNA testing.
The DNA sections looked at in forensic science is not currently known to have any
function (such
as coding for eye color or the potential predisposition toward a genetically inherited
disease) — 4
except for amelogenin , which is used in forensic analysis for gender differentiation.
The areas at
which forensic analysts look are always found in the same spots on the same
chromosomes. Each specific location is called a locus (pronounced “LOW-cuss”).
The forensic science community typically uses a minimum of 13 genetic loci (plural
for locus , pronounced “LOW-sigh”), referred
to as the 13 core CODIS (Combined DNA Index System) loci. This enables laboratories
to search
profiles against other profiles already in the CODIS databank (although some
laboratoriestest more than the 13 core CODIS loci. Many labs will examine 15 loci if
they are comparing DNA from anevidentiary sample to DNA collected from a known
suspect.
Several basic steps are performed during DNA testing. The general procedure
includes: 1) The
collection of samples which might contain DNA; 2) The isolation of the DNA from an
evidence sample and the isolation of DNA from a sample from a known individual; 3)
The processing of the
DNA so that test results may be obtained; 4) The determination of the DNA test
results and 5) the
comparison and interpretation of the test resultsfrom the unknown and known
samplesto determine
whether the known individual is not the source of the DNA or is included as a
possible source of the DNA
How and Where DNA Testing is Performed
DNA testing must be conducted in a laboratory with dedicated facilities and

equipment that meet the FBI’s stringent QAS requirements. Most publicly funded
DNA crime laboratories in the United States are part of state, regional or municipal
law enforcement agencies and accept submissions from multiple agencies.
Prior to performing DNA analysis at the laboratory, initial testing is often conducted
at the crime scene to determine the type of biological material in question. Screening
for the presence of biological materials may also be conducted in the laboratory to
determine if a specific biological fluid may be present. Most biological screening tests
are presumptive in nature and do not specifically identify a bodily fluid.
To determine who deposited biological material at a crime scene, unknown samples

are collected and then compared to known samples taken directly from a suspect or
victim.
Most DNA samples submitted to a laboratory undergo the following

process:
1. Extraction is the process of releasing the DNA from the cell.
2. Quantitation is the process of determining how much DNA you have.
3. Amplification is the process of producing multiple copies of the DNA in order to

characterize it.
4. Separation is the process of separating amplified DNA product to permit
subsequent identification.
5. Analysis & Interpretation is the process of quantitatively and qualitatively

comparing DNA evidence samples to known DNA profiles.
6. Quality Assurance is the process of reviewing analyst reports for technical

accuracy.
During extraction, a centrifuge is used to concentrate the sample to the base of the
tube.
HOW DNA PROFILING WORKS

EVEN THOUGH 99.9 PERCENT OF HUMAN DNA is exactly the same in all people, a
single droplet of blood or stray eyelash collected at a crime scene still carries all the
genetic information needed to convict a criminal. Back at the lab, forensic scientists
simply probe the remaining 0.1 percent of the genome—3 million nucleotide
bases—for telltale variations. This process, known as DNA profiling or genetic
fingerprinting, reveals a suite of variations in the genetic code that, taken together,
constitute an individual’s unique DNA profile. Here’s how it works:
1. Collect a sample and extract its DNA. Scientists only need a tiny amount of DNA—
around 100 micrograms—to construct a DNA profile from a crime scene sample.
That’s so little, a few cells from saliva on a straw will do.
2. Amplify the telltale regions. Scientists use a powerful technique called Polymerase
Chain Reaction (PCR) to make millions of copies of the sample’s telltale DNA regions.
In particular, they home in on regions known as Short Tandem Repeats, or STRs,
which are composed of short units of DNA—just four or five bases long—that are
repeated numerous times in a row. What makes these regions telltale is that the
number of repeats they contain varies widely from person to person. In criminal
investigations, 13 such STR regions, all located in the non-coding DNA between our
genes, are analyzed for the number of repeated units they contain.
3. Count the repeats. During PCR, fluorescent dyes are attached to all the STR copies
that get made—one type of dye for each STR region—so that all of the DNA copies
from a given region can be distinguished from the others in the mix. Scientists run
the mixture through a capillary electophoresis machine, which separates the various
DNA fragments by size. From there, it’s a fairly easy thing to calculate the length of
each STR region, and, therefore, the number of repetitive units at each site.
4. Look for a match. To convict a suspect, his or her STR repeats must match those in
the crime scene sample—at all 13 STR regions. According to the FBI, when all 13 STR
sites match perfectly, it’s virtually guaranteed you’ve got your culprit; the odds of
fingering the wrong person are about one in 1 billion. A single STR mismatch,
however, is enough to exonerate a suspect and spur investigators to search CODIS,
the nation’s database of DNA profiles, in hopes of solving the crime

Forensic Anthropology Identification Techniques

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Forensic Anthropology Identification Techniques

Uploaded by

Copyright:

Available Formats

FORENSIC ANTHROPOLOGY

MRS SHARON P CORDERO

April 19, 2022

1. Know what is Forensic Anthropology and its History.

Along with forensic pathologists, forensic dentists, and

This is useful in identifying living individuals for legal

The methods used to identify a person from a skeleton

The study of man for the purposes of the COURT.

History of Forensic Anthropology (divided into four periods)

• 1894, Thomas Dwight - gave his Shattuck Lecture

➢ Consolidation Period (1939-1971):

• 1954 by Tom McKern and T. Dale Stewart- published

➢ Modern Period (1972-1999)

• 1980 - Dr. William Bass set up the "Body Farm" at the

• 1986, Dr. Richard Jantz and Dr. Stephen Ousley -

• Rd. Clyde Snow- began

➢ Fourth Era (2000 – present)

• Johann Friedrich Blumenbach - German anthropologist in

• Hans Gross - The publication of Austrian criminologist

• Mid-20th century- advances in biochemistry and technology

➢ Forensic anthropology uses the techniques of

➢ Forensic anthropologists can assess the age, sex,

➢ Forensic anthropologists work closely with

➢ Both disciplines use empirical evidence, genetic

➢ Forensic anthropology involves applying

➢ Clay or graphic facial reproduction- This is used to

➢ Scanning electron microscopy- scanning electron

➢ Photo or video superimposition techniques- The term of photographic superimposition

➢ The casting of skeletal materials- Skeletal

➢ Thin-sectioning techniques of bone histology-

➢ Rehydration and preservation of mummified or decayed soft tissues- Process and

2nd Year - Alpha

April 21, 2022

❖ Dr. Oscar Amoedo was considered as the father of the forensic

❖ Forensic odontologists successfully identified tsunami victims in South-East Asia in

DEFINITION OF FORENSIC ODONTOLOGY

❖ Forensic Odontology is the application of dentistry to the investigation of crime and

SCOPE OF FORENSIC ODONTOLOGY

IDENTIFICATION UNKNOWN REMAINS

Steps in Forensic Odontology

AGE ESTIMATION BASED ON DENTAL DATA

Bite Marks Identification, Comparison or Analysis

Human and animal teeth both leave

Lip Prints Analysis, Identification or Comparison

✓Know the value of DNA fingerprinting as means of personal identification.

✓Trace the historical events in DNA Profiling

History of DNA Fingerprinting

The investigation used genetic fingerprinting in a case

In India DNA fingerprinting was started by Dr. VK Kashyap and Dr.

What is DNA fingerprinting?

Procedure to create a DNA fingerprinting.

DNA Fingerprinting Applications

POLYMERASE CHAIN REACTION (PCR) ANALYSIS

SHORT TANDEM REPEATS (STR) ANALYSIS

AMPLIFIED FRAGMENT LENGTH POLYMORPHISM (AFLP)

In addition, because the analysis is done on a gel, very high

PCR-based methods use microsatellites as markers instead of minisatellites; microsatellites as

DNA markers help to study fundamental evolutionary

What is a DNA profile?

How do you create a DNA profile using STR?

1. Get a sample of DNA

2. Extract the DNA

3. Copy the DNA

April 21, 2022