R ES E A RC H

◥ immunity against recently encountered invaders.

REVIEW SUMMARY
CRISPR BIOLOGY
CRISPR-Cas: Adapting to change
Simon A. Jackson,* Rebecca E. McKenzie,* Robert D. Fagerlund, Sebastian N. Kieper,
Peter C. Fineran,† Stan J. J. Brouns†
BACKGROUND: The arms race between pro-
karyotes and their perpetually evolving pred-
ators has fueled the evolution of a defense
arsenal. The so-called CRISPR-Cas systems—
clustered regularly interspaced short palindromic
repeats and associated proteins—are adaptive im-
mune defense systems found in bacteria and
The chronological ordering of new spacers has
enabled insights into the temporal dynamics
of interactions between hosts and invaders that
are constantly changing. Some CRISPR-Cas sys-
tems use existing spacers to recognize previously
encountered elements and promote the formation
◥ of new CRISPR memories,
ON OUR WEBSITE a process known as primed
Read the full article CRISPR adaptation. Viruses
at http://dx.doi. and plasmids that have es-
prespacer substrates and captured by the Cas1- org/10.1126/ caped previous CRISPR-Cas
Cas2 complex. After this, Cas1-Cas2 locates the science.aal5056 defenses through genetic
..................................................
genomic CRISPR locus and docks in the appro- mutations trigger primed
priate position for insertion of the new spacer CRISPR adaptation. Several recent studies have
into the CRISPR array, while duplicating a revealed that primed CRISPR adaptation is also
CRISPR repeat. The cues directing the docking strongly promoted by recurrent invaders, even
of substrate-laden Cas1-Cas2 differ between sys- in the absence of escape mutations. This has

Downloaded from http://science.sciencemag.org/ on April 26, 2017

archaea. The recent exponential growth of re- tems, with some relying on intrinsic sequence led to previously separate paradigms of in-
search in the CRISPR field has led to the discov- specificity and others assisted by host proteins. vader destruction and primed CRISPR adapta-
ery of a diverse range of CRISPR-Cas systems Before integration, accurate processing of the tion beginning to converge into a unified model.
and insight into their defense functions. These spacer precursors is required to ensure that the
systems are divided into two major classes and new spacers are compatible with the protein ma-OUTLOOK: CRISPR adaptation is crucial for
six types. Each system consists of two compo- ensuring both population-level protection through
chinery in order to elicit CRISPR-Cas defense. For
nents: a locus for memory storage (the CRISPR spacer diversity and protection of the host through
a given CRISPR-Cas system, spacers must typical-
array) and cas genes that encode the machinery invader clearance. Although many studies have
ly be of a certain length and be inserted into the
driving immunity. Information stored explored CRISPR adaptation in a broad
within CRISPR arrays is used to direct range of host-specific and metagenomic
the sequence-specific destruction of in- contexts, much of the mechanistic detail
vading genetic elements, including viruses has been gleaned from studying a rela-
and plasmids. As such, all CRISPR-Cas tively small subset of systems. Thus, de-
immune systems are reliant on the for- spite the relative wealth of mechanistic
mation of CRISPR memories, known as information about CRISPR adaptation
spacers, to facilitate future defense. To in a few specific types, work in other sys-
form these memories, small fragments of tems continues to reveal distinct modes of
invader nucleic acids are added as spacers operation for spacer acquisition. There-
to the CRISPR memory banks in a process fore, studies of CRISPR adaptation in
termed CRISPR adaptation. The genetic alternative systems are necessary to deter-
basis of immunity means that CRISPR mine which processes are conserved and
adaptation provides heritable benefits, which are system-specific. An important
an attribute that is unparalleled in eu- remaining question is why the enhanced
karyotic immune systems. There is wide- primed CRISPR adaptation commonly
spread evidence of highly active CRISPR found in type I systems has not yet been
adaptation in nature, and it is clear that observed in other types. Do other sys-
these systems play important roles in tems possess analogous mechanisms that
shaping microbial evolution and global have yet to be discovered, or does the ab-
ecological networks. sence of priming in these systems explain
the prevalence of type I systems in nature?
ADVANCES: CRISPR adaptation requires Many hues of the CRISPR-Cas adaptation machinery. The Future expansion of our understanding of
several processes, including selection and complex of the Cas1 and Cas2 proteins, which is the workhorse how CRISPR adaptation is carried out in
processing of spacer precursors and their of CRISPR adaptation in diverse CRISPR-Cas prokaryotic immune the diverse repertoire of CRISPR-Cas sys-
subsequent localization to, and integration systems, is depicted with a DNA substrate. Despite the near- tems is vital for maximizing the potential
into, the CRISPR loci. Although our un- ubiquitous Cas1-Cas2 molecular machinery, type-specific dif- for repurposing the spacer acquisition ma-
derstanding of all facets of the CRISPR ferences in the insertion of new information into CRISPR memory chinery in biotechnological applications.
adaptation pathway is not yet complete, banks are beginning to come to light. Commandeering CRISPR adaptation for
considerable progress has been made in on-demand memory formation will usher
the past few years. At the heart of CRISPR ad- CRISPR in a specific orientation. It is becoming in a new era of biological information storage,
aptation is a protein complex, the Cas1-Cas2
“workhorse,” which catalyzes the addition of new
increasingly apparent that Cas1-Cas2 complexes from
diverse systems are capable of ensuring that these
with many applications that await discovery.
▪
spacers to CRISPR memory banks. A combina- system-specific factors are met with high fidelity. The list of author affiliations is available in the full article online.
tion of functional assays and high-resolution New findings also account for the ordering *These authors contributed equally to this work.
structures of Cas1-Cas2 complexes has recently of stored memories: Typically, the insertion of †Corresponding author. Email: peter.fineran@otago.ac.nz
(P.C.F.); stanbrouns@gmail.com (S.J.J.B.)
led to major advances. There is now a sound un- new spacers is directed to one end of CRISPR Cite this article as S. A. Jackson et al., Science 356,
derstanding of how foreign DNA is converted to arrays, and it has been shown that this enhances eaal5056 (2017). DOI: 10.1126/science.aal5056

Jackson et al., Science 356, 40 (2017) 7 April 2017 1 of 1

R ES E A RC H

◥ consisting of six types and 19 subtypes (Fig. 1)

REVIEW (27, 28). Comparative genomics indicates that all
known CRISPR-Cas systems evolved from a sin-
gle ancestor (27, 28). The more compact class 2
CRISPR BIOLOGY CRISPR-Cas systems likely evolved from class
1 ancestors through the acquisition of genes

CRISPR-Cas: Adapting to change encoding new single-subunit effector proteins

and the loss of additional cas genes (28). How-
ever, despite the divergence of CRISPR-Cas sys-
Simon A. Jackson,1* Rebecca E. McKenzie,2* Robert D. Fagerlund,1 tems into several types, the proteins primarily
Sebastian N. Kieper,2 Peter C. Fineran,1,3† Stan J. J. Brouns2,4† responsible for catalyzing spacer acquisition—
namely, Cas1 and Cas2—remain relatively con-
Bacteria and archaea are engaged in a constant arms race to defend against the ever-present served, and the genes encoding these proteins
threats of viruses and invasion by mobile genetic elements. The most flexible weapons in are associated with nearly all CRISPR-Cas systems
the prokaryotic defense arsenal are the CRISPR-Cas adaptive immune systems. These (27). Indeed, as long as spacers can be acquired
systems are capable of selective identification and neutralization of foreign DNA and/or from MGEs, distinct effector machineries capable
RNA. CRISPR-Cas systems rely on stored genetic memories to facilitate target recognition. of using the information stored in CRISPRs are
Thus, to keep pace with a changing pool of hostile invaders, the CRISPR memory banks likely to arise. Knowledge of the structure and
must be regularly updated with new information through a process termed CRISPR adaptation. function of CRISPR-Cas effector complexes has

Downloaded from http://science.sciencemag.org/ on April 26, 2017

In this Review, we outline the recent advances in our understanding of the molecular advanced rapidly in recent years (6, 28). In ad-
mechanisms governing CRISPR adaptation. Specifically, the conserved protein machinery dition, considerable progress has been made lately
Cas1-Cas2 is the cornerstone of adaptive immunity in a range of diverse CRISPR-Cas systems. toward elucidating the molecular basis of how,
when, and why CRISPR adaptation occurs. Here

B
acteria and archaea are constantly threat-
ened by phage infection and invasion by
mobile genetic elements (MGEs) through
conjugation and transformation. In response,
a defense arsenal has evolved, including
various innate mechanisms and the CRISPR-Cas
(clustered regularly interspaced short palindromic
repeats and associated proteins) adaptive immune
systems (1–3). CRISPR-Cas systems are widely dis-
tributed, occurring in 50 and 87% of complete
bacterial and archaeal genomes, respectively. These
systems function as RNA-guided nucleases that
provide sequence-specific defense against invading
MGEs (4, 5). The repurposing of sequence-specific
Cas nucleases, particularly Cas9, has stimulated a
biotechnological revolution in genome editing
(6). In native hosts, the advantage conferred by
CRISPR-Cas systems over innate defenses lies in
the ability to update the resistance repertoire in
response to infection (a process termed CRISPR
adaptation). CRISPR adaptation is achieved by
incorporating short DNA fragments from MGEs
into CRISPR arrays to form memory units called
spacers. Early bioinformatic studies showed that
many spacers were of foreign origin, hinting that
CRISPR loci may act as a form of memory for a
prokaryotic immune system (7–10). Subsequent
confirmation of the link between spacers and
resistance to phage and MGEs was gained ex-
perimentally (4, 5, 11). An overview of CRISPR-
Cas–mediated defense and CRISPR adaptation
is provided in Box 1.
1
Department of Microbiology and Immunology, University of
Otago, Post Office Box 56, Dunedin 9054, New Zealand.
2
Department of Bionanoscience, Kavli Institute of
Nanoscience, Delft University of Technology, Van der
Maasweg 9, 2629 HZ Delft, Netherlands. 3Bio-Protection
Research Centre, University of Otago, Post Office Box 56,
Dunedin 9054, New Zealand. 4Laboratory of Microbiology,
Wageningen University, Wageningen, Netherlands.
*These authors contributed equally to this work. †Corresponding
author. Email: peter.fineran@otago.ac.nz (P.C.F.); stanbrouns@
gmail.com (S.J.J.B.)
Red Queen CRISPR adaptation
The ability to keep defenses up to date by ac-
quiring new spacers is central to the success of
CRISPR-Cas systems. Typically, new spacers are
inserted at a specific end of the CRISPR array,
adjacent to a “leader” region that contains con-
served sequence motifs (4, 12–14). The leader
usually also contains the promoter driving CRISPR
transcription, and it has been demonstrated that
integration of new spacers at the leader end
enhances defense against phages and MGEs
encountered recently (15). This “polarized” addi-
tion of spacers into CRISPR loci produces a chron-
ological account of the encounters between
phages and bacteria that can provide insights
into phage-host co-occurrences, evolution, and
ecology (16, 17). However, phage and MGE var-
iants with genetic mutations can avoid detection
by existing CRISPR spacers; these evaders are
termed “escape mutants.” Additionally, spacers
can be lost from CRISPR arrays by recombina-
tion between the repeats (16, 18). Thus, main-
tenance of CRISPR-Cas defense is reliant on the
addition of new spacers into CRISPR arrays (19, 20).
The continuous competition between host CRISPR
adaptation and MGE escape, akin to Red Queen
dynamics, has been exposed in several recent meta-
genome studies (21, 22). Individual cells within
a prokaryotic community acquire different, and
often multiple, spacers during CRISPR adapta-
tion (23, 24). The diversity of CRISPR loci within
cell populations optimizes defense by limiting the
reproductive success of mutants that escape the
CRISPR-Cas defenses of individual cells (25). Fur-
thermore, the resulting polymorphisms in CRISPR
loci enable fast and accurate differentiation of spe-
cies subtypes, which may prove to have economic
and clinical benefits—for example, enabling trac-
ing of pathogens during outbreaks (7, 26).
Origins of CRISPR adaptation
According to their constituent Cas proteins, CRISPR-
Cas systems are classified into two major classes
we review these recent findings and highlight the
insights that they offer on the function of different
CRISPR adaptation mechanisms used by diverse
CRISPR-Cas systems.
The molecular basis of
CRISPR adaptation
CRISPR adaptation requires the integration of
new spacers into CRISPR loci and duplication
of the associated repeat sequences. The Cas1 and
Cas2 proteins, which form a Cas14-Cas22 complex
(hereafter, Cas1-Cas2) (29, 30), constitute the “work-
horse” of spacer integration. Spacers added to
CRISPR arrays must be compatible with the
diverse range of type-specific effector complex
machinery (Fig. 1). Thus, despite being near-
ubiquitous among CRISPR-Cas types, Cas1-Cas2
homologs meet the varied requirements for the
acquisition of appropriate spacer sequences in
different systems. For example, the effector com-
plexes of several CRISPR-Cas types only recognize
targets containing a specific sequence adjacent
to where the CRISPR RNA (crRNA) base-pairs
with the target strand of a MGE (Fig. 1) (31). The
crRNA-paired target sequence is termed the pro-
tospacer, and the adjacent target-recognition mo-
tif is called a protospacer-adjacent motif (PAM)
(32). PAM-based target discrimination prevents
the unintentional recognition and self-destruction
of the CRISPR locus by the crRNA-effector com-
plex, yet canonical PAM sequences vary between
and sometimes within systems.
Much of what we know about the Cas1-Cas2
molecular structure and function has been gained
from studies in the Escherichia coli type I-E sys-
tem. Within the Cas14-Cas22 complex, the Cas1
subunits form two dimers that are bridged by a
central Cas2 dimer (Fig. 2A) (29, 33, 34). Cas1-
Cas2–mediated spacer integration prefers double-
stranded DNA (dsDNA) substrates and proceeds
through a mechanism resembling retroviral inte-
gration (35, 36). In addition to Cas1-Cas2, at least
one CRISPR repeat, part of the leader sequence
(12, 13, 15, 37), and several host factors for repair

Jackson et al., Science 2017 356, eaal5056 7 April 2017 1 of 9

R ES E A RC H | R E V IE W

of the insertion sites (e.g., DNA polymerase) are type I systems, the presence of a canonical PAM stranded ends of the prespacer extend into active
required (38). Spacer acquisition involves three within the prespacer substrate increases the af- subunits of each corresponding Cas1 dimer (Fig.
main processes: substrate capture, recognition finity for Cas1-Cas2 binding but is not requisite 2, A to C) (33, 34). The length of new spacers is
of the CRISPR locus, and integration within the (33). Details of how prespacer substrates are pro- governed by the fixed distances between the two
array. duced from foreign DNA are discussed later. For Cas1 wedges and from the branch points to the
the E. coli type I-E Cas1-Cas2–prespacer complex, integrase sites. Many CRISPR-Cas systems have
Cas1-Cas2 substrate capture the ends of the dsDNA prespacer are splayed by highly consistent yet system-specific spacer lengths,
During substrate capture, Cas1-Cas2 is loaded with tyrosine wedges in each Cas1 dimer, which lock and it is likely that analogous wedge-based Cas1-
an integration-compatible prespacer, which is open the DNA branch points while fixing in place Cas2 “molecular rulers” exist in these systems to
thought to be partially duplexed dsDNA (35). For a core 23–base pair dsDNA region. The 3′ single- control prespacer length (33, 34). However, in some
systems, such as type III, the length of spacers
found within CRISPR arrays appears more var-
iable, and studies of Cas1-Cas2 structure and func-
Box 1. A roadmap of CRISPR-Cas adaptation and defense. In the example illustrated,
tion in these systems are lacking.
a bacterial cell is infected by a bacteriophage. The first stage of CRISPR-Cas defense is CRISPR
adaptation. This involves the incorporation of small fragments of DNA from the invader into the Recognition of the CRISPR array
host CRISPR array. This forms a genetic “memory” of the infection. The memories are stored
Before integration, the substrate-bound Cas1-
as spacers (colored squares) between repeat sequences (R), and new spacers are added at
Cas2 complex must locate the CRISPR leader-
the leader-proximal (L) end of the array. The Cas1 and Cas2 proteins, encoded within the cas
repeat sequence. Specific sequences upstream
gene operon, form a Cas1-Cas2 complex (blue)—the “workhorse” of CRISPR adaptation. In

Downloaded from http://science.sciencemag.org/ on April 26, 2017

of CRISPR arrays direct leader-polarized spacer
this example, the Cas1-Cas2 complex catalyzes the addition of a spacer from the phage
integration, both through direct Cas1-Cas2 recog-
genome (purple) into the CRISPR array. The second stage of CRISPR-Cas defense involves
nition and assisted by host proteins. The Cas1-Cas2
transcription of the CRISPR array and subsequent processing of the precursor transcript to
complexes of several systems show intrinsic affinity
generate CRISPR RNAs (crRNAs). Each crRNA contains a single spacer unit that is typically
for the leader-repeat region in vitro (35, 39), yet
flanked by parts of the adjoining repeat sequences (gray). Individual crRNAs assemble with
this is not always wholly sufficient to provide the
Cas effector proteins (light green) to form crRNA-effector complexes. The crRNA-effector
specificity observed in vivo. It was recently dis-
complexes catalyze the sequence-specific recognition and destruction of foreign DNA and/or
covered that for the type I-E system, leader-repeat
RNA elements. This process is known as interference.
recognition is assisted by the integration host fac-
tor (IHF) heterodimer (40). IHF binds the CRISPR
Phage infection leader in a sequence-specific manner and induces
∼120° DNA bending, providing a cue to accurately
localize Cas1-Cas2 to the leader-repeat junction
(40, 41). A conserved sequence motif upstream
of the IHF pivot is proposed to stabilize the Cas1-
Foreign nucleic acid
Cas2–leader-repeat interaction and increase the
efficiency of spacer acquisition, supporting binding
of the adaptation complex to DNA sites on either
Cas1-Cas2 side of the bound IHF (41).
IHF is absent in many prokaryotes, including
CRISPR
archaea, indicating that other leader-proximal
Adaptation
L R R R R integration mechanisms exist. Indeed, type II-A
Cas1-Cas2 from Streptococcus pyogenes catalyzed
CRISPR array cas gene operon leader-proximal integration in vitro at a level of
precision comparable to that of the type I-E sys-
tem with IHF (39, 40). In type II systems, a short
leader-anchoring site (LAS) adjacent to the first
repeat and ≤6 base pairs of this repeat are essen-
Expression Precursor crRNA tial for CRISPR adaptation (15, 37, 39) and are
and conserved in systems with similar repeats. Place-
processing ment of an additional LAS in front of a nonleader
crRNAs Cas proteins
repeat resulted in the integration of spacers at
both sites (37), whereas LAS deletion caused ec-
topic integration at a downstream repeat adjacent
to a spacer containing a LAS-like sequence (15).
Hence, in contrast to type I-E systems, type II-A
systems appear to rely solely on intrinsic sequence
crRNA-effector complex specificity for the leader-repeat junction.

Integration into the CRISPR array

Type-specific targeting For CRISPR-Cas types that are reliant on PAM
of cognate sequences sequences for recognition of targets, the acquisi-
Interference tion of interference-proficient spacers requires
processing of the prespacer substrate at a specific
position relative to the PAM. Each of the four Cas1
monomers in the Cas1-Cas2 complex contains a
Destruction of foreign DNA and/or RNA PAM-sensing domain. The presence of a PAM in
the active site of just one of the Cas1 monomers

Jackson et al., Science 2017 356, eaal5056 7 April 2017 2 of 9

R ES E A RC H | R E V IE W

Class 1 Class 2 CRISPR adaptation (Fig. 3) (51). For naïve CRISPR

adaptation, prespacer substrates are generated
from foreign material and loaded onto Cas1-Cas2.
Type I Type II Type V The main known source of these precursors is
Target strand
crRNA-DNA pairing

the host RecBCD complex (52). Stalled replication

5' 5' 3'
forks that occur during DNA replication can re-
3' 5'
3'
3'
5' 3' 5' 3' 5'
sult in double-strand breaks (DSBs), which are
5' 3' 5' 3' 5' 3' repaired through RecBCD-mediated unwinding
and degradation of the dsDNA ends back to the
PAM Protospacer PAM PAM nearest Chi sites (53). During this repair process,
RecBCD produces single-stranded DNA (ssDNA)
fragments, which have been proposed to subse-
quently anneal to form partially duplexed pre-
Type III Type VI
crRNA-RNA pairing

spacer substrates for Cas1-Cas2 (52). The greater

3' 5' number of active origins of replication and the
5' 3' paucity of Chi sites on MGEs, compared with the
5' 5' 3'
RN

3' 5' host chromosome, bias naïve adaptation toward

A

RNA foreign DNA. Furthermore, RecBCD recognizes

3'
5'
the unprotected dsDNA ends that are commonly

Downloaded from http://science.sciencemag.org/ on April 26, 2017

PFS present in phage genomes upon injection or be-
rPAM
fore packaging, which theoretically provides an
additional phage-specific source of naïve prespacer
Fig. 1. Target interactions and the PAMs of diverse CRISPR-Cas types. Recognition of the invading
substrates (52).
DNA target by the crRNA-Cas effector complexes of types I, II, and V results in the formation of an RNA-
Despite the role of RecBCD in substrate gen-
DNA hybrid in which the nontarget DNA strand is displaced. The target strand contains the protospacer
eration, naïve CRISPR adaptation can occur in
(red), which is complementary to the spacer sequence in the crRNA (orange). The protospacer-adjacent
its absence, albeit with reduced bias toward
motif (PAM, blue) is located at either the 3′ end (types I and V) or the 5′ end (type II) of the protospacer.
foreign DNA (52). Thus, events other than DSBs
Types III and VI recognize RNA targets, with type III exhibiting additional transcription-dependent DNA
might also stimulate naïve CRISPR adaptation,
targeting. Some type III systems require an RNA-based PAM (rPAM). Type VI systems exhibit specificity
such as R-loops that occur during plasmid replica-
for a protospacer-flanking sequence (PFS) motif, which is analogous to a PAM.
tion, lagging ends of incoming conjugative elements
(54), and even CRISPR-Cas–mediated spacer inte-
is sufficient to appropriately position the sub- active site for the second nucleophilic attack at gration events themselves (23, 52). Furthermore, we
strate and PAM relative to the cleavage site (Fig. the repeat-spacer boundary (47). However, in the do not know whether all CRISPR-Cas systems have
2B) (33, 34). Furthermore, the presence of a PAM type I-B system from Haloarcula hispanica, only an intrinsic bias toward production of prespacers
within the prespacer substrate ensures integra- the first IR is essential for integration, and a from foreign DNA. In high-throughput studies of
tion into the CRISPR in the correct orientation single molecular ruler, directed by an anchor native systems, the frequency of acquisition of
(23, 42–44). This directional fidelity is critical between the IRs, has been proposed (48). In the spacers from host genomes is likely to be under-
because otherwise the PAM in the MGE target type II-A systems of Streptococcus thermophilus estimated, because the autoimmunity resulting
would lie at the wrong end of the crRNA target and S. pyogenes, the IRs are located distally from self-targeting spacers means that these geno-
binding site, thus precluding target recognition within the repeats, suggesting that these short types are typically lethal (23, 49, 50, 55). For ex-
(Fig. 1). To avoid premature loss of the PAM di- sequences may directly position the nucleophilic ample, in the S. thermophilus type II-A system,
rectional cue, processing of the prespacer likely attacks without a need for molecular rulers (37, 39). spacer acquisition appears biased toward MGEs,
occurs after Cas1-Cas2 orients and docks at the Although these recent findings suggest that leader- yet nuclease-deficient Cas9 fails to discriminate
leader-proximal repeat (Fig. 2D). Cas1-mediated repeat regions at the beginning of CRISPR arrays between host and foreign DNA (55). It is unknown
processing of the prespacer creates two 3′OH ends contain sequences to ensure appropriate Cas1-Cas2 whether CRISPR adaptation in type II systems
required for nucleophilic attack on each strand of localization, further work is required to determine is reliant on DNA break repair. Further studies
the leader-proximal repeat (35, 36, 45). The initial how the spacer integration events are specif- in a range of host systems are required to clarify
nucleophilic attack most likely occurs at the leader- ically orchestrated in the diverse range of CRISPR- how diverse CRISPR-Cas systems balance the re-
repeat junction and forms a half-site intermediate; Cas types. quirement for naïve production of prespacers from
then, a second attack at the existing repeat-spacer MGEs against the risk of acquiring spacers from
junction generates the full-site integration product Production of prespacers from host DNA.
(Fig. 2D). The precise order of the prespacer pro- foreign DNA
cessing and integration steps remains to be fully Despite the elegance of memory-directed defense, crRNA-directed CRISPR
determined, but considerable progress toward elu- CRISPR adaptation is not without complications. adaptation (priming)
cidating the reaction mechanisms has been made. For example, the inadvertent acquisition of spacers Mutations in the target PAM or protospacer se-
After the first nucleophilic attack, the intrinsic from host DNA must be avoided because this will quences can abrogate immunity, allowing MGEs
sequence specificity of the Cas1-Cas2 complex de- result in cytotoxic self-targeting, akin to autoim- to escape CRISPR-Cas defenses (56–58). Further-
fines the site of the second attack and ensures munity in eukaryotic adaptive immune systems more, the protection conferred by individual spacers
accurate repeat duplication. CRISPR repeats are (49, 50). Therefore, production of prespacer sub- varies: Often, several MGE-specific spacers are
often semi-palindromic, containing two short in- strates from MGEs should outweigh production required to mount an effective defense (24, 59)
verted repeat (IR) elements, but the location of from host DNA. In the following sections, we out- and to prevent proliferation of escape mutants
these can vary (46). In type I-B and I-E systems, line the routes to prespacer generation in different (17, 25). Thus, to maintain effective immunity,
the IRs occur close to the center of the repeat CRISPR-Cas systems. CRISPR-Cas systems need to undergo CRISPR
(Fig. 2E) and are important for spacer acquisi- adaptation faster than MGEs can evade targeting.
tion (47, 48). In the type I-E system, both IRs act Naïve CRISPR adaptation Indeed, type I systems have evolved a mechanism
as anchors for the Cas1-Cas2 complex, which con- Acquisition of spacers from MGEs that are not known as primed CRISPR adaptation (or priming)
tains two molecular rulers to position the Cas1 already cataloged in host CRISPRs is termed naïve to facilitate rapid spacer acquisition (44, 60), even

Jackson et al., Science 2017 356, eaal5056 7 April 2017 3 of 9

R ES E A RC H | R E V IE W

A Prespacer DNA with splayed ends

C Cas1-Cas2 loaded with prespacer

5' 5'

Ruler
Cas1 ‘wedge’

PA
M
Cas2 dimer 3'
3' 180°
PAM sensing site
Cas1 dimers

B Cas1 PAM sensing D

Type I systems Type II systems

Downloaded from http://science.sciencemag.org/ on April 26, 2017

Y165
i
T

PA
3' 5' 3'

PA

M
M
5' 3' 5'
CT
T

C IHF assisted LAS identification

T docking
Y217
K211 R138
H208
Q287*

ii
PAM
PA
M

PAM-distal nucleophilic attack PAM-proximal nucleophilic attack

E Type I-E repeat rulers

16 nt iii
M
GT PA
GT
T CCCCGCGCCAGCGGGGATAAACC
CACAAGGGGCGCGGTCGCCCCTATTTGG PAM-proximal nucleophilic attack PAM-distal nucleophilic attack

8 nt
Anchor sequences 180° 180°

iv

Fig. 2. Cas1-Cas2–mediated spacer acquisition. (A) The Cas1-Cas2 protein
complex loaded with a prespacer substrate (the E. coli type I-E structure is
shown; Protein Data Bank ID, 5DQZ). (B) The Cas1 PAM sensing site, showing
the canonical type I-E PAM (CTT, yellow) residue-specific interactions (a residue
from the noncatalytic Cas1 monomer is annotated with an asterisk) and the site
of PAM processing (scissors). H, histidine; K, lysine; Q, glutamine; R, arginine; Y,
tyrosine. (C) A schematic representation of the substrate-loaded Cas1-Cas2
protein complex with the active PAM-sensing site highlighted (light purple)
and a partially duplexed DNA prespacer substrate (strands are purple and
pink). The ruler mechanism determining spacer length for the E. coli type I-E
system uses two conserved tyrosine residues (the “Cas1 wedge;” gray hexagons).
(D) Spacer integration proceeds as follows: (i) The Cas1-Cas2–prespacer complex
binds to the leader (green) and first repeat (black). For type I and type II systems,
Cas1-Cas2 docking to the leader-proximal repeat is assisted by integration host
factor (IHF) and recognition of the leader-anchoring site (LAS), respectively. (ii)
The first nucleophilic attack most likely occurs at the leader-repeat junction
and gives rise to a half-site intermediate. (iii) The second nucleophilic attack
occurs at the boundary between the repeat and the spacer (orange), re-
sulting in full-site integration. (iv) Host DNA repair enzymes fill the integra-
tion site. (E) The type I-E repeat is magnified to indicate the inverted repeats
within its sequence and highlight the anchoring sites of the molecular rulers
that determine the point of integration. nt, nucleotides.

Jackson et al., Science 2017 356, eaal5056 7 April 2017 4 of 9

R ES E A RC H | R E V IE W

A B C cell exceeds defense capabilities. This can occur

when cells are infected by MGE escape mutants
Stalled replication fork Restriction endonuclease Type I priming Cas9 or when the levels of CRISPR-Cas activity are
insufficient to provide complete immunity using
only the existing spacers, even in the absence of
MGE escape mutations (44, 58, 60–63).
Priming begins with target recognition by
crRNA-effector complexes. Therefore, factors that
DNA breaks Cas1-Cas2 Cas3 Csn2 / Cas4 influence target recognition (i.e., the formation
and stability of the crRNA-DNA hybrid; Fig. 1),
including PAM sensing and crRNA-target comple-
mentarity, affect the efficiency of primed CRISPR
Chi
adaptation (58, 59, 64–69). Furthermore, these
same factors can induce conformational rearrange-
ments in the target-bound crRNA-effector complex
RecBCD that result in favoring of either the interference or
priming pathways (65–67, 70). In type I-E systems,
the Cas8e (Cse1) subunit of Cascade can adopt
one of two conformational modes (67, 70), which

Downloaded from http://science.sciencemag.org/ on April 26, 2017

may promote either direct or Cas1-Cas2–stimulated
Cas1-Cas2 loaded with prespacer
recruitment of the effector Cas3 nuclease (65, 66, 70).
Fig. 3. Cas1-Cas2 substrate production pathways. (A) Naïve generation of substrates by RecBCD Cas3, which is found in all type I systems, ex-
activity on DNA ends due to double-strand breaks that occur as a result of stalled replication forks, hibits 3′ to 5′ helicase and endonuclease activity
innate defenses such as restriction endonuclease activity, or the ends of phage genomes (not shown). that nicks, unwinds, and degrades target DNA
(B) Primed prespacer production in type I systems, which requires Cas3 helicase and nuclease activity. (71–73). In vitro activity of the type I-E Cas3 pro-
(C) Cas9-dependent spacer selection in type II systems, which for some subtypes is dependent on the duces ssDNA fragments of ~30 to 100 nucleo-
activity of accessory proteins, such as Csn2 or Cas4. The PAM specificity of the Cas9 protein determines tides that are enriched for PAMs in their 3′ ends
the selection of PAMs in prespacer substrates. and that anneal to provide partially duplexed
prespacer substrates (64). The spatial position-
ing of Cas1-Cas2 during primed substrate gener-
A Type I-E Type I-F ation has not been clearly established, although
Cas1-Cas2–facilitated recruitment of Cas3 would
L L imply that the CRISPR adaptation machinery is
localized close to the site of prespacer production
(65, 70). In type I-F systems, Cas3 is fused to the
Same strand Opposite strand C terminus of Cas2 (Cas2-3), so these systems form
MGE MGE Cas1–Cas2-3 complexes (30) that couple the CRISPR
* * adaptation machinery directly to the source of
prespacer generation during priming (23, 74).
Despite different target recognition modes fa-
voring distinct Cas3 recruitment routes, primed
Cas1-Cas2 Cas1-Cas2-3 CRISPR adaptation can be provoked by MGE
B
escape mutants and non-escape (interference-
proficient) targets (23, 44, 60, 75). However, when
the intracellular copy number influences of the
MGE are excluded, interference-proficient targets
Same strand promote greater spacer acquisition than escape
mutants (23, 75). This forms a positive feedback
loop, reinforcing immunity against recurrent
* * threats even in the absence of escapees (23, 44).
If the copy number of the MGE within the host
Opposite strand
cell is factored in, then escape mutants actually
Fig. 4. Primed CRISPR adaptation from a multicopy MGE by type I-E and I-F CRISPR-Cas systems. trigger more spacer acquisition. This is because
(A) An existing spacer (brown) with homology to a MGE sequence that has escaped interference interference rapidly clears targeted MGEs from
(the priming protospacer, denoted with an asterisk) directs target recognition. The PAM is shown in the cell, whereas escape mutants that evade im-
black. The crRNA-effector complex recruits Cas3 (or Cas1–Cas2-3 for type I-F), and the 3′ to 5′ helicase mediate clearance by existing CRISPR-Cas immu-
activity (illustrated by the red arrow) results in the acquisition of a new spacer from a site distal to the nity persist for longer. Over time, the prolonged
initial priming location. The new spacer maps to an interference-proficient protospacer (orange). Spacer presence of the escape MGE, combined with the
acquisition in the type I-E system requires the Cas1-Cas2 complex, and spacer acquisition in the type I-F priming-centric CRISPR-Cas target recognition mode,
system uses a Cas1–Cas2-3 complex. (B) The new spacer (orange) perfectly matches the MGE sequence results in higher net production of prespacer sub-
at the orange protospacer location and facilitates targeting of the MGE and recruitment of Cas3. Hence, strates and spacer integration (23, 63, 64, 75).
subsequent spacers (mapping to blue protospacers) typically originate from Cas3 activity (red arrows) Because priming is initiated by site-specific
beginning at this location. target recognition (i.e., targeting a priming proto-
spacer), Cas1-Cas2–compatible prespacers are sub-
against highly divergent invaders (58) (Fig. 3). quisition of additional spacers from previously sequently produced from MGEs with locational
Priming uses MGE target recognition that is fa- encountered elements. Thus, priming is advan- biases (Fig. 4). Mapping the MGE sequence po-
cilitated by preexisting spacers to trigger the ac- tageous when MGE replication within the host sitions and strands targeted by newly acquired

Jackson et al., Science 2017 356, eaal5056 7 April 2017 5 of 9

R ES E A RC H | R E V IE W
spacers (i.e., their corresponding protospacers) has
revealed subtype-specific patterns and has provided
much of our insight into the mechanisms of primed
CRISPR adaptation (23, 43, 44, 60, 74, 76, 77). In
type I-E systems, new protospacers typically map to
the same strand as the priming protospacer (43, 44)
(Fig. 4). For type I-B priming, Cas3 is predicted to
load onto either strand at the priming proto-
spacer, resulting in a bidirectional distribution
of new protospacers (76). For type I-F priming,
the first new protospacer typically maps to the
strand opposite the priming protospacer, in a di-
rection consistent with Cas3 loading and 3′ to 5′
helicase activity on the nontarget strand. Once
the first spacer is acquired, two protospacer tar-
gets in the MGE are recognized, and prespacer
production can be driven from both locations
(23, 74) (Fig. 4). However, priming is stimulated
more strongly from the interference-proficient
protospacer than from the original priming pro-
tospacer. Thus, subsequent spacers (i.e., the sec-
ond and those following) result from targeting
by the first new spacer (23) (Fig. 4). The dom-
inance of the first new spacer also holds true
for type I-E (44, 75) and likely all other systems
that display priming. However, these are gen-
eralized models, and many aspects remain un-
resolved, such as the mechanisms resulting in
strand selection and why some spacer sequences
are more highly acquired from MGEs than others.
Further analyses of priming in different systems,
particularly with respect to the order of new spacers
acquired, will greatly inform our understanding
of primed Cas1-Cas2 substrate production.
Cas protein–assisted production
of spacers
Given the apparent advantages conferred by
priming in type I systems, analogous mechanisms
to stimulate primed-like CRISPR adaptation are
likely to exist in other CRISPR-Cas types. For ex-
ample, DNA breaks induced by interference ac-
tivity of class 2 CRISPR-Cas effector complexes
could trigger host DNA repair mechanisms (e.g.,
RecBCD), thereby providing substrates for Cas1-
Cas2. In agreement with a model for DNA break–
stimulated enhancement of CRISPR adaptation,
restriction enzyme activity can stimulate RecBCD-
facilitated production of prespacer substrates (52).
RecBCD activity may also partially account for the
enhanced CRISPR adaptation observed during
phage infection of a host possessing an innate
restriction-modification defense system (78). Whether
the enhanced CRISPR adaptation was RecBCD-
dependent in this example is unknown. In a CRISPR-
Cas–induced DNA break model, the production
of prespacer substrates is preceded by sequence-
specific target recognition, which could be con-
sidered to be related to priming (79). Although
direct evidence to support this concept is lacking,
CRISPR adaptation in type II-A systems requires
Cas1-Cas2, Cas9, a transactivating crRNA (tracrRNA;
a cofactor for crRNA processing and interference in
type II systems), and Csn2 (55, 79). The PAM-sensing
domain of Cas9 enhances the acquisition of spacers
with interference-proficient PAMs (79). However,
Cas9 nuclease activity is dispensable (55), and
Jackson et al., Science 2017 356, eaal5056 7 April 2017
existing spacers are not strictly necessary (79),
suggesting that the PAM interactions of Cas9
could be sufficient to select appropriate new spac-
ers. Some Cas9 variants can also function with
non-CRISPR RNAs and tracrRNA (80). This raises
the possibility that host or MGE-derived RNAs
might direct promiscuous Cas9 activity, resulting
in DNA breaks or replication fork stalling that
could potentially result in prespacer generation.
Roles of accessory Cas proteins in
CRISPR adaptation
Although Cas1 and Cas2 play a central role in
CRISPR adaptation, type-specific variations in cas
gene clusters occur. In many systems, Cas1-Cas2 is
assisted by accessory Cas proteins, which are often
mutually exclusive and type-specific (27). For ex-
ample, in the S. thermophilus type II-A system,
deletion of csn2 impaired the acquisition of spacers
from invading phages (4). Direct interaction be-
tween Cas1 and Csn2 also suggests a role for
Csn2 in conjunction with the spacer acquisition
machinery (81). Csn2 multimers cooperatively bind
to the free ends of linear dsDNA and can trans-
locate by rotation-coupled movement (82, 83).
Given that substrate-loaded type II-A Cas1-Cas2
is capable of full-site spacer integration in vitro
(39), Csn2 may be required for prespacer sub-
strate production, selection, or processing. Poten-
tially, Csn2 binding to the free ends of dsDNA
provides a cue for nucleases to assist in prespacer
generation (82).
Cas4, another ring-forming accessory protein,
is found in type I, II-B, and V systems (27). Con-
firming its role in CRISPR adaptation, Cas4 is
necessary for type I-B priming in H. hispanica
(76) and interacts with a Cas1-Cas2 fusion protein
in the Thermoproteus tenax type I-A system (84).
Fusions between Cas4 and Cas1 are found in
several systems, which indicates a functional as-
sociation with the spacer acquisition machinery.
Cas4 contains a RecB-like domain and four con-
served cysteine residues, which are presumably
involved in the coordination of an iron-sulfur clus-
ter (85). However, Cas4 proteins appear to be
functionally diverse, with some possessing uni-
or bidirectional exonuclease activity, whereas others
exhibit ssDNA endonuclease activity and unwind-
ing activity on dsDNA (85, 86). Because of its nu-
clease activity, Cas4 is hypothesized to be involved
in prespacer generation.
In type III systems, spacers complementary
to RNA transcribed from MGEs are required for
immunity (Fig. 1) (87, 88). Some bacterial type
III systems contain fusions of Cas1 with reverse
transcriptase domains (RTs) that provide a mech-
anism to integrate spacers from RNA substrates
(89). The RT-Cas1 fusion from M. mediterranea
can integrate RNA precursors into an array, which
are subsequently reverse-transcribed to generate
DNA spacers (89). However, integration of DNA-
derived spacers also occurs, indicating that the
RNA derived–spacer route is not exclusive (89).
Hence, the combined integrase and reverse tran-
scriptase activity of RT-Cas1–Cas2 enhances CRISPR
adaptation against highly transcribed DNA MGEs
and potentially against RNA-based invaders.
Other host proteins may also be necessary for
prespacer substrate production. For example, RecG
is required for efficient primed CRISPR adaptation
in type I-E and I-F systems, but its precise role re-
mains speculative (38, 90). Additionally, it is still
enigmatic why some CRISPR-Cas systems require
accessory proteins, whereas closely related types
do not. For example, type II-C systems lack cas4
and csn2, which assist CRISPR adaptation in type
II-A and II-B systems, respectively. These type-
specific differences exemplify the diversity that has
arisen during the evolution of CRISPR-Cas systems.
The genesis of adaptive
immunity in prokaryotes
Expanding knowledge of the molecular mech-
anisms underlying CRISPR adaptation indicates
the evolutionary origin of CRISPR-Cas systems (91).
Casposons are transposon-like elements typified
Downloaded from http://science.sciencemag.org/ on April 26, 2017
by the presence of Cas1 homologs, or casposases,
which catalyze site-specific DNA integration and
result in the duplication of repeat sites, analo-
gously to spacer acquisition (92, 93). It is possible
that ancestral innate defenses gained DNA inte-
gration functionality from casposases, thus seed-
ing the genesis of prokaryotic adaptive immunity
(94). The innate ancestor remains unidentified
but is likely to be a nuclease-based system. Co-
occurrence of casposon-derived terminal IRs and
casposases in the absence of full casposons might
represent an intermediate of the signature CRISPR
repeat-spacer-repeat structures (95). However, the
evolutionary journey from the innate immunity–
casposase hybrid to full adaptive immunity is
unclear. Evolution of diverse CRISPR-Cas types
would have required stringent coevolution of the
Cas1-Cas2 spacer acquisition machinery, PAM and
leader-repeat sequences, crRNA processing mech-
anisms, and effector complexes.
In some systems, mechanisms to enhance the
production of Cas1-Cas2–compatible prespacers
from MGEs, such as priming, might have arisen
because naïve CRISPR adaptation is an inefficient
process with a high probability of acquiring spac-
ers from host DNA. However, it was recently shown
that promiscuous binding of crRNA-effector com-
plexes to the host genome results in a basal level
of lethal “self-priming” in a type I-F system (23).
Host CRISPR and cas gene regulation mechanisms
might have arisen to balance the likelihood of self-
acquisition events against the requirement to adapt
to new threats—for example, when the risk of
phage infection or horizontal gene transfer is high
(96, 97). Alternatively, it has been proposed that
selective acquisition of self-targeting spacers could
provide benefits, such as invoking altruistic cell
death (98), facilitating rapid genome evolution
(50), regulating host processes (99, 100), or even
preventing the uptake of other CRISPR-Cas
systems (101).
Outlook
Recent years have seen rapid progress in under-
standing the mechanisms of CRISPR adaptation.
Despite this progress, many facets of CRISPR
adaptation need more work. Synergy between
innate defense systems and CRISPR adaptation
6 of 9
R ES E A RC H | R E V IE W
is relatively unexplored, but two aspects may be
interrelated. First, DNA breaks (52) could stimulate
the generation of substrates for spacer acquisition
(Fig. 3), and second, the stalling of infection could
buy time for CRISPR adaptation (78, 102, 103).
Analogously, it remains to be determined whether
interference by CRISPR-Cas systems other than
type I can also stimulate primed CRISPR adapta-
tion. If not, the benefits of priming might provide
an explanation for why type I systems are the
most prevalent and diverse CRISPR-Cas type.
It is also unclear why many CRISPR-Cas sys-
tems have more than one CRISPR array that is
used by a single set of Cas proteins. Given that
Cas1-Cas2 is directed to leader-repeat junctions
during integration, multiple arrays might provide
additional integration sites, increasing CRISPR
adaptation efficiency. In addition, parallel CRISPR
arrays should increase crRNA production from
spacers that were acquired recently (because of
the polarized insertion of new spacers next to the
promoter-containing CRISPR leaders) (15). Whereas
some strains have multiple CRISPR arrays belong-
ing to the same type, other hosts have several
different types of CRISPR-Cas systems simulta-
neously. The benefits of harboring multiple CRISPR-
Cas systems are not entirely clear, but it can result
in CRISPRs being shared by different systems
to extend targeting to both RNA and DNA (104).
From a CRISPR adaptation perspective, multiple
systems might also enable a wider PAM reper-
toire to be sampled during spacer selection. Ad-
ditional systems in a single host could also be a
result of phage- and MGE-encoded anti-CRISPR
proteins, which can inhibit both interference and
primed CRISPR adaptation (105–107). Alternatively,
additional systems may allow some systems to
function in defense, whereas others perform non-
canonical roles (100).
Although Cas effector nucleases, such as Cas9,
have been harnessed for many biotechnological
applications, the use of repurposed CRISPR-Cas
adaptation machinery has yet to be widely ex-
ploited. The sequence-specific integrase activity
of Cas1-Cas2 holds promise in synthetic biology,
such as for the insertion of specific sequences (or
barcodes) to mark and track cells in a population.
In E. coli, the feasibility of such an approach is
evident (42), but translation to eukaryotic sys-
tems, in which lineage and cell fate could be
tracked, will provide the greatest utility. A sim-
ilar approach has been demonstrated by exploit-
ing Cas9 nuclease activity (108). The elements
required for leader-specific integration must be
carefully considered for the introduction of CRISPR-
Cas spacer acquisition machinery into eukaryotic
cells, because unintended ectopic integrations
could be problematic, given the larger eukaryotic
sequence space. Ultimately, our understanding
of CRISPR adaptation in prokaryotes may lead
to applications in which entire CRISPR systems
are transplanted into eukaryotic cells to prevent
viral invaders. As we begin to comprehend CRISPR
adaptation in more detail, the opportunities to
repurpose other parts of these remarkable pro-
karyotic immune systems are increasingly becom-
ing reality.
Jackson et al., Science 2017 356, eaal5056 7 April 2017
RE FERENCES AND NOTES
1. R. L. Dy, C. Richter, G. P. Salmond, P. C. Fineran, Remarkable
mechanisms in microbes to resist phage infections. Annu.
Rev. Virol. 1, 307–331 (2014). doi: 10.1146/annurev-virology-
031413-085500; pmid: 26958724
2. J. E. Samson, A. H. Magadán, M. Sabri, S. Moineau, Revenge
of the phages: Defeating bacterial defences. Nat. Rev.
Microbiol. 11, 675–687 (2013). doi: 10.1038/nrmicro3096;
pmid: 23979432
3. L. A. Marraffini, CRISPR-Cas immunity in prokaryotes. Nature
526, 55–61 (2015). doi: 10.1038/nature15386; pmid: 26432244
4. R. Barrangou et al., CRISPR provides acquired resistance
against viruses in prokaryotes. Science 315, 1709–1712
(2007). doi: 10.1126/science.1138140; pmid: 17379808
5. S. J. Brouns et al., Small CRISPR RNAs guide antiviral
defense in prokaryotes. Science 321, 960–964 (2008).
doi: 10.1126/science.1159689; pmid: 18703739
6. A. V. Wright, J. K. Nuñez, J. A. Doudna, Biology and
applications of CRISPR systems: Harnessing nature’s toolbox
for genome engineering. Cell 164, 29–44 (2016).
doi: 10.1016/j.cell.2015.12.035; pmid: 26771484
7. C. Pourcel, G. Salvignol, G. Vergnaud, CRISPR elements in
Yersinia pestis acquire new repeats by preferential uptake of
bacteriophage DNA, and provide additional tools for
evolutionary studies. Microbiology 151, 653–663 (2005).
doi: 10.1099/mic.0.27437-0
8. F. J. Mojica, C. Díez-Villaseñor, J. García-Martínez, E. Soria,
Intervening sequences of regularly spaced prokaryotic
repeats derive from foreign genetic elements. J. Mol. Evol.
60, 174–182 (2005). doi: 10.1007/s00239-004-0046-3;
pmid: 15791728
9. A. Bolotin, B. Quinquis, A. Sorokin, S. D. Ehrlich, Clustered
regularly interspaced short palindrome repeats (CRISPRs)
have spacers of extrachromosomal origin. Microbiology 151,
2551–2561 (2005). doi: 10.1099/mic.0.28048-0
10. K. S. Makarova, N. V. Grishin, S. A. Shabalina, Y. I. Wolf,
E. V. Koonin, A putative RNA-interference-based immune system
in prokaryotes: Computational analysis of the predicted
enzymatic machinery, functional analogies with eukaryotic RNAi,
and hypothetical mechanisms of action. Biol. Direct 1, 7 (2006).
doi: 10.1186/1745-6150-1-7; pmid: 16545108
11. L. A. Marraffini, E. J. Sontheimer, CRISPR interference limits
horizontal gene transfer in staphylococci by targeting DNA.
Science 322, 1843–1845 (2008). doi: 10.1126/
science.1165771; pmid: 19095942
12. I. Yosef, M. G. Goren, U. Qimron, Proteins and DNA elements
essential for the CRISPR adaptation process in Escherichia
coli. Nucleic Acids Res. 40, 5569–5576 (2012). doi: 10.1093/
nar/gks216; pmid: 22402487
13. C. Díez-Villaseñor, N. M. Guzmán, C. Almendros,
J. García-Martínez, F. J. Mojica, CRISPR-spacer integration
reporter plasmids reveal distinct genuine acquisition
specificities among CRISPR-Cas I-E variants of Escherichia
coli. RNA Biol. 10, 792–802 (2013). doi: 10.4161/rna.24023;
pmid: 23445770
14. S. Erdmann, R. A. Garrett, Selective and hyperactive uptake
of foreign DNA by adaptive immune systems of an archaeon
via two distinct mechanisms. Mol. Microbiol. 85, 1044–1056
(2012). doi: 10.1111/j.1365-2958.2012.08171.x;
pmid: 22834906
15. J. McGinn, L. A. Marraffini, CRISPR-Cas systems optimize
their immune response by specifying the site of spacer
integration. Mol. Cell 64, 616–623 (2016). doi: 10.1016/
j.molcel.2016.08.038; pmid: 27618488
16. M. J. Lopez-Sanchez et al., The highly dynamic
CRISPR1 system of Streptococcus agalactiae controls the
diversity of its mobilome. Mol. Microbiol. 85, 1057–1071
(2012). doi: 10.1111/j.1365-2958.2012.08172.x;
pmid: 22834929
17. A. F. Andersson, J. F. Banfield, Virus population dynamics
and acquired virus resistance in natural microbial
communities. Science 320, 1047–1050 (2008). doi: 10.1126/
science.1157358; pmid: 18497291
18. P. Horvath et al., Diversity, activity, and evolution of CRISPR
loci in Streptococcus thermophilus. J. Bacteriol. 190,
1401–1412 (2008). doi: 10.1128/JB.01415-07;
pmid: 18065539
19. G. Amitai, R. Sorek, CRISPR-Cas adaptation: Insights into the
mechanism of action. Nat. Rev. Microbiol. 14, 67–76 (2016).
doi: 10.1038/nrmicro.2015.14; pmid: 26751509
20. S. H. Sternberg, H. Richter, E. Charpentier, U. Qimron,
Adaptation in CRISPR-Cas systems. Mol. Cell 61, 797–808
(2016). doi: 10.1016/j.molcel.2016.01.030; pmid: 26949040
21. C. L. Sun, B. C. Thomas, R. Barrangou, J. F. Banfield,
Metagenomic reconstructions of bacterial CRISPR loci
constrain population histories. ISME J. 10, 858–870 (2016).
doi: 10.1038/ismej.2015.162; pmid: 26394009
22. D. Paez-Espino et al., Uncovering Earth’s virome. Nature 536,
425–430 (2016). doi: 10.1038/nature19094; pmid: 27533034
23. R. H. Staals et al., Interference-driven spacer acquisition is
dominant over naive and primed adaptation in a native
CRISPR-Cas system. Nat. Commun. 7, 12853 (2016).
doi: 10.1038/ncomms12853; pmid: 27694798
24. D. Paez-Espino et al., Strong bias in the bacterial CRISPR
elements that confer immunity to phage. Nat. Commun. 4, 1430
(2013). doi: 10.1038/ncomms2440; pmid: 23385575
25. S. van Houte et al., The diversity-generating benefits of a
prokaryotic adaptive immune system. Nature 532, 385–388
(2016). doi: 10.1038/nature17436; pmid: 27074511
26. F. Liu et al., Novel virulence gene and clustered regularly
interspaced short palindromic repeat (CRISPR) multilocus
sequence typing scheme for subtyping of the major serovars
of Salmonella enterica subsp. enterica. Appl. Environ.
Microbiol. 77, 1946–1956 (2011). doi: 10.1128/AEM.02625-10;
pmid: 21278266
27. K. S. Makarova et al., An updated evolutionary classification
of CRISPR-Cas systems. Nat. Rev. Microbiol. 13, 722–736
Downloaded from http://science.sciencemag.org/ on April 26, 2017
(2015). doi: 10.1038/nrmicro3569; pmid: 26411297
28. P. Mohanraju et al., Diverse evolutionary roots and
mechanistic variations of the CRISPR-Cas systems. Science
353, aad5147 (2016). doi: 10.1126/science.aad5147;
pmid: 27493190
29. J. K. Nuñez et al., Cas1-Cas2 complex formation mediates
spacer acquisition during CRISPR-Cas adaptive immunity.
Nat. Struct. Mol. Biol. 21, 528–534 (2014). doi: 10.1038/
nsmb.2820; pmid: 24793649
30. C. Richter, T. Gristwood, J. S. Clulow, P. C. Fineran, In vivo
protein interactions and complex formation in the
Pectobacterium atrosepticum subtype I-F CRISPR/Cas
system. PLOS ONE 7, e49549 (2012). doi: 10.1371/journal.
pone.0049549; pmid: 23226499
31. R. T. Leenay, C. L. Beisel, Deciphering, communicating, and
engineering the CRISPR PAM. J. Mol. Biol. 429, 177–191
(2017). doi: 10.1016/j.jmb.2016.11.024; pmid: 27916599
32. F. J. Mojica, C. Díez-Villaseñor, J. García-Martínez,
C. Almendros, Short motif sequences determine the targets
of the prokaryotic CRISPR defence system. Microbiology 155,
733–740 (2009). doi: 10.1099/mic.0.023960-0
33. J. Wang et al., Structural and mechanistic basis of PAM-
dependent spacer acquisition in CRISPR-Cas systems. Cell
163, 840–853 (2015). doi: 10.1016/j.cell.2015.10.008;
pmid: 26478180
34. J. K. Nuñez, L. B. Harrington, P. J. Kranzusch, A. N. Engelman,
J. A. Doudna, Foreign DNA capture during CRISPR-Cas adaptive
immunity. Nature 527, 535–538 (2015). doi: 10.1038/
nature15760; pmid: 26503043
35. J. K. Nuñez, A. S. Lee, A. Engelman, J. A. Doudna, Integrase-
mediated spacer acquisition during CRISPR-Cas adaptive
immunity. Nature 519, 193–198 (2015). doi: 10.1038/
nature14237; pmid: 25707795
36. Z. Arslan, V. Hermanns, R. Wurm, R. Wagner, Ü. Pul,
Detection and characterization of spacer integration
intermediates in type I-E CRISPR-Cas system. Nucleic Acids
Res. 42, 7884–7893 (2014). doi: 10.1093/nar/gku510;
pmid: 24920831
37. Y. Wei, M. T. Chesne, R. M. Terns, M. P. Terns, Sequences
spanning the leader-repeat junction mediate CRISPR
adaptation to phage in Streptococcus thermophilus. Nucleic
Acids Res. 43, 1749–1758 (2015). doi: 10.1093/nar/gku1407;
pmid: 25589547
38. I. Ivančić-Baće, S. D. Cass, S. J. Wearne, E. L. Bolt, Different
genome stability proteins underpin primed and naïve
adaptation in E. coli CRISPR-Cas immunity. Nucleic Acids Res.
43, 10821–10830 (2015). doi: 10.1093/nar/gkv1213;
pmid: 26578567
39. A. V. Wright, J. A. Doudna, Protecting genome integrity
during CRISPR immune adaptation. Nat. Struct. Mol. Biol. 23,
876–883 (2016). doi: 10.1038/nsmb.3289; pmid: 27595346
40. J. K. Nuñez, L. Bai, L. B. Harrington, T. L. Hinder, J. A. Doudna,
CRISPR immunological memory requires a host factor for
specificity. Mol. Cell 62, 824–833 (2016). doi: 10.1016/
j.molcel.2016.04.027; pmid: 27211867
41. K. N. Yoganand, R. Sivathanu, S. Nimkar, B. Anand,
Asymmetric positioning of Cas1-2 complex and Integration
Host Factor induced DNA bending guide the unidirectional
homing of protospacer in CRISPR-Cas type I-E system.
7 of 9
R ES E A RC H | R E V IE W
Nucleic Acids Res. 45, 367–381 (2017). doi: 10.1093/nar/
gkw1151; pmid: 27899566
42. S. L. Shipman, J. Nivala, J. D. Macklis, G. M. Church,
Molecular recordings by directed CRISPR spacer acquisition.
Science 353, aaf1175 (2016). doi: 10.1126/science.aaf1175;
pmid: 27284167
43. S. Shmakov et al., Pervasive generation of oppositely
oriented spacers during CRISPR adaptation. Nucleic Acids
Res. 42, 5907–5916 (2014). doi: 10.1093/nar/gku226;
pmid: 24728991
44. D. C. Swarts, C. Mosterd, M. W. van Passel, S. J. Brouns,
CRISPR interference directs strand specific spacer
acquisition. PLOS ONE 7, e35888 (2012). doi: 10.1371/journal.
pone.0035888; pmid: 22558257
45. C. Rollie, S. Schneider, A. S. Brinkmann, E. L. Bolt, M. F. White,
Intrinsic sequence specificity of the Cas1 integrase directs new
spacer acquisition. eLife 4, 08716 (2015). pmid: 26284603
46. V. Kunin, R. Sorek, P. Hugenholtz, Evolutionary conservation
of sequence and secondary structures in CRISPR repeats.
Genome Biol. 8, R61 (2007). doi: 10.1186/gb-2007-8-4-r61;
pmid: 17442114
47. M. G. Goren et al., Repeat size determination by two
molecular rulers in the type I-E CRISPR array. Cell Rep. 16,
2811–2818 (2016). doi: 10.1016/j.celrep.2016.08.043;
pmid: 27626652
48. R. Wang, M. Li, L. Gong, S. Hu, H. Xiang, DNA motifs
determining the accuracy of repeat duplication during
CRISPR adaptation in Haloarcula hispanica. Nucleic Acids Res.
44, 4266–4277 (2016). doi: 10.1093/nar/gkw260;
pmid: 27085805
49. A. Stern, L. Keren, O. Wurtzel, G. Amitai, R. Sorek, Self-
targeting by CRISPR: Gene regulation or autoimmunity?
Trends Genet. 26, 335–340 (2010). doi: 10.1016/
j.tig.2010.05.008; pmid: 20598393
50. R. B. Vercoe et al., Cytotoxic chromosomal targeting by
CRISPR/Cas systems can reshape bacterial genomes and
expel or remodel pathogenicity islands. PLOS Genet. 9,
e1003454 (2013). doi: 10.1371/journal.pgen.1003454;
pmid: 23637624
51. P. C. Fineran, E. Charpentier, Memory of viral infections by
CRISPR-Cas adaptive immune systems: Acquisition of
new information. Virology 434, 202–209 (2012).
doi: 10.1016/j.virol.2012.10.003; pmid: 23123013
52. A. Levy et al., CRISPR adaptation biases explain preference
for acquisition of foreign DNA. Nature 520, 505–510 (2015).
doi: 10.1038/nature14302; pmid: 25874675
53. D. B. Wigley, Bacterial DNA repair: Recent insights into the
mechanism of RecBCD, AddAB and AdnAB. Nat. Rev.
Microbiol. 11, 9–13 (2013). doi: 10.1038/nrmicro2917;
pmid: 23202527
54. E. R. Westra et al., CRISPR-Cas systems preferentially
target the leading regions of MOBF conjugative plasmids.
RNA Biol. 10, 749–761 (2013). doi: 10.4161/rna.24202;
pmid: 23535265
55. Y. Wei, R. M. Terns, M. P. Terns, Cas9 function and host
genome sampling in Type II-A CRISPR-Cas adaptation. Genes
Dev. 29, 356–361 (2015). doi: 10.1101/gad.257550.114;
pmid: 25691466
56. E. Semenova et al., Interference by clustered regularly
interspaced short palindromic repeat (CRISPR) RNA is
governed by a seed sequence. Proc. Natl. Acad. Sci. U.S.A.
108, 10098–10103 (2011). doi: 10.1073/pnas.1104144108;
pmid: 21646539
57. H. Deveau et al., Phage response to CRISPR-encoded
resistance in Streptococcus thermophilus. J. Bacteriol. 190,
1390–1400 (2008). doi: 10.1128/JB.01412-07;
pmid: 18065545
58. P. C. Fineran et al., Degenerate target sites mediate rapid
primed CRISPR adaptation. Proc. Natl. Acad. Sci. U.S.A. 111,
E1629–E1638 (2014). doi: 10.1073/pnas.1400071111;
pmid: 24711427
59. C. Xue et al., CRISPR interference and priming varies with
individual spacer sequences. Nucleic Acids Res. 43,
10831–10847 (2015). doi: 10.1093/nar/gkv1259;
pmid: 26586800
60. K. A. Datsenko et al., Molecular memory of prior infections
activates the CRISPR/Cas adaptive bacterial immunity
system. Nat. Commun. 3, 945 (2012). doi: 10.1038/
ncomms1937; pmid: 22781758
61. E. Savitskaya, E. Semenova, V. Dedkov, A. Metlitskaya,
K. Severinov, High-throughput analysis of type I-E CRISPR/
Cas spacer acquisition in E. coli. RNA Biol. 10, 716–725
(2013). doi: 10.4161/rna.24325; pmid: 23619643
Jackson et al., Science 2017 356, eaal5056 7 April 2017
62. A. G. Patterson, J. T. Chang, C. Taylor, P. C. Fineran,
Regulation of the Type I-F CRISPR-Cas system by CRP-cAMP
and GalM controls spacer acquisition and interference.
Nucleic Acids Res. 43, 6038–6048 (2015). doi: 10.1093/nar/
gkv517; pmid: 26007654
63. K. Severinov, I. Ispolatov, E. Semenova, The influence of
copy-number of targeted extrachromosomal genetic
elements on the outcome of CRISPR-Cas defense. Front. Mol.
Biosci. 3, 45 (2016). doi: 10.3389/fmolb.2016.00045;
pmid: 27630990
64. T. Künne et al., Cas3-derived target DNA degradation
fragments fuel primed CRISPR adaptation. Mol. Cell 63,
852–864 (2016). doi: 10.1016/j.molcel.2016.07.011;
pmid: 27546790
65. S. Redding et al., Surveillance and processing of foreign DNA
by the Escherichia coli CRISPR-Cas system. Cell 163,
854–865 (2015). doi: 10.1016/j.cell.2015.10.003;
pmid: 26522594
66. T. R. Blosser et al., Two distinct DNA binding modes guide
dual roles of a CRISPR-Cas protein complex. Mol. Cell 58,
60–70 (2015). doi: 10.1016/j.molcel.2015.01.028;
pmid: 25752578
67. R. P. Hayes et al., Structural basis for promiscuous PAM
recognition in type I-E Cascade from E. coli. Nature 530,
499–503 (2016). doi: 10.1038/nature16995; pmid: 26863189
68. P. B. van Erp et al., Mechanism of CRISPR-RNA guided
recognition of DNA targets in Escherichia coli. Nucleic Acids
Res. 43, 8381–8391 (2015). doi: 10.1093/nar/gkv793;
pmid: 26243775
69. M. Li, R. Wang, H. Xiang, Haloarcula hispanica CRISPR
authenticates PAM of a target sequence to prime
discriminative adaptation. Nucleic Acids Res. 42, 7226–7235
(2014). doi: 10.1093/nar/gku389; pmid: 24803673
70. C. Xue, N. R. Whitis, D. G. Sashital, Conformational control of
cascade interference and priming activities in CRISPR
immunity. Mol. Cell 64, 826–834 (2016). doi: 10.1016/
j.molcel.2016.09.033; pmid: 27871367
71. S. Mulepati, S. Bailey, In vitro reconstitution of an Escherichia
coli RNA-guided immune system reveals unidirectional,
ATP-dependent degradation of DNA target. J. Biol. Chem.
288, 22184–22192 (2013). doi: 10.1074/jbc.M113.472233;
pmid: 23760266
72. E. R. Westra et al., CRISPR immunity relies on the
consecutive binding and degradation of negatively
supercoiled invader DNA by Cascade and Cas3. Mol. Cell 46,
595–605 (2012). doi: 10.1016/j.molcel.2012.03.018;
pmid: 22521689
73. Y. Huo et al., Structures of CRISPR Cas3 offer mechanistic
insights into Cascade-activated DNA unwinding and
degradation. Nat. Struct. Mol. Biol. 21, 771–777 (2014).
doi: 10.1038/nsmb.2875; pmid: 25132177
74. C. Richter et al., Priming in the Type I-F CRISPR-Cas system
triggers strand-independent spacer acquisition, bi-
directionally from the primed protospacer. Nucleic Acids Res.
42, 8516–8526 (2014). doi: 10.1093/nar/gku527;
pmid: 24990370
75. E. Semenova et al., Highly efficient primed spacer acquisition
from targets destroyed by the Escherichia coli type I-E
CRISPR-Cas interfering complex. Proc. Natl. Acad. Sci. U.S.A.
113, 7626–7631 (2016). doi: 10.1073/pnas.1602639113;
pmid: 27325762
76. M. Li, R. Wang, D. Zhao, H. Xiang, Adaptation of the
Haloarcula hispanica CRISPR-Cas system to a purified virus
strictly requires a priming process. Nucleic Acids Res. 42,
2483–2492 (2014). doi: 10.1093/nar/gkt1154;
pmid: 24265226
77. C. Rao et al., Active and adaptive Legionella CRISPR-Cas
reveals a recurrent challenge to the pathogen. Cell. Microbiol.
18, 1319–1338 (2016). doi: 10.1111/cmi.12586;
pmid: 26936325
78. A. P. Hynes, M. Villion, S. Moineau, Adaptation in bacterial
CRISPR-Cas immunity can be driven by defective phages.
Nat. Commun. 5, 4399 (2014). doi: 10.1038/ncomms5399;
pmid: 25056268
79. R. Heler et al., Cas9 specifies functional viral targets during
CRISPR-Cas adaptation. Nature 519, 199–202 (2015).
doi: 10.1038/nature14245; pmid: 25707807
80. T. R. Sampson, S. D. Saroj, A. C. Llewellyn, Y. L. Tzeng,
D. S. Weiss, A CRISPR/Cas system mediates bacterial innate
immune evasion and virulence. Nature 497, 254–257 (2013).
doi: 10.1038/nature12048; pmid: 23584588
81. D. Ka et al., Crystal structure of Streptococcus pyogenes Cas1
and its interaction with Csn2 in the type II CRISPR-Cas
system. Structure 24, 70–79 (2016). doi: 10.1016/
j.str.2015.10.019; pmid: 26671707
82. Z. Arslan et al., Double-strand DNA end-binding and sliding of
the toroidal CRISPR-associated protein Csn2. Nucleic Acids
Res. 41, 6347–6359 (2013). doi: 10.1093/nar/gkt315;
pmid: 23625968
83. K. H. Lee et al., Identification, structural, and biochemical
characterization of a group of large Csn2 proteins involved
in CRISPR-mediated bacterial immunity. Proteins 80,
2573–2582 (2012). doi: 10.1002/prot.24138;
pmid: 22753072
84. A. Plagens, B. Tjaden, A. Hagemann, L. Randau, R. Hensel,
Characterization of the CRISPR/Cas subtype I-A system
of the hyperthermophilic crenarchaeon Thermoproteus
tenax. J. Bacteriol. 194, 2491–2500 (2012). doi: 10.1128/
JB.00206-12; pmid: 22408157
85. J. Zhang, T. Kasciukovic, M. F. White, The CRISPR associated
protein Cas4 is a 5′ to 3′ DNA exonuclease with an iron-sulfur
cluster. PLOS ONE 7, e47232 (2012). doi: 10.1371/journal.
pone.0047232; pmid: 23056615
86. S. Lemak et al., Toroidal structure and DNA cleavage by the
CRISPR-associated [4Fe-4S] cluster containing Cas4
nuclease SSO0001 from Sulfolobus solfataricus. J. Am. Chem.
Soc. 135, 17476–17487 (2013). doi: 10.1021/ja408729b;
Downloaded from http://science.sciencemag.org/ on April 26, 2017
pmid: 24171432
87. C. R. Hale et al., RNA-guided RNA cleavage by a
CRISPR RNA-Cas protein complex. Cell 139,
945–956 (2009). doi: 10.1016/j.cell.2009.07.040;
pmid: 19945378
88. G. W. Goldberg, W. Jiang, D. Bikard, L. A. Marraffini,
Conditional tolerance of temperate phages via
transcription-dependent CRISPR-Cas targeting. Nature
514, 633–637 (2014). doi: 10.1038/nature13637;
pmid: 25174707
89. S. Silas et al., Direct CRISPR spacer acquisition from RNA by
a natural reverse transcriptase-Cas1 fusion protein. Science
351, aad4234 (2016). doi: 10.1126/science.aad4234;
pmid: 26917774
90. G. E. Heussler, J. L. Miller, C. E. Price, A. J. Collins,
G. A. O’Toole, Requirements for Pseudomonas
aeruginosa type I-F CRISPR-Cas adaptation determined
using a biofilm enrichment assay. J. Bacteriol. 198,
3080–3090 (2016). doi: 10.1128/JB.00458-16;
pmid: 27573013
91. M. Krupovic, K. S. Makarova, P. Forterre, D. Prangishvili,
E. V. Koonin, Casposons: A new superfamily of self-
synthesizing DNA transposons at the origin of prokaryotic
CRISPR-Cas immunity. BMC Biol. 12, 36 (2014). doi: 10.1186/
1741-7007-12-36; pmid: 24884953
92. A. B. Hickman, F. Dyda, The casposon-encoded Cas1 protein
from Aciduliprofundum boonei is a DNA integrase that
generates target site duplications. Nucleic Acids Res. 43,
10576–10587 (2015). doi: 10.1093/nar/gkv1180;
pmid: 26573596
93. P. Béguin, N. Charpin, E. V. Koonin, P. Forterre, M. Krupovic,
Casposon integration shows strong target site preference
and recapitulates protospacer integration by CRISPR-Cas
systems. Nucleic Acids Res. 44, 10367–10376 (2016).
pmid: 27655632
94. E. V. Koonin, M. Krupovic, Evolution of adaptive immunity
from transposable elements combined with innate immune
systems. Nat. Rev. Genet. 16, 184–192 (2015). doi: 10.1038/
nrg3859; pmid: 25488578
95. M. Krupovic, S. Shmakov, K. S. Makarova, P. Forterre,
E. V. Koonin, Recent mobility of casposons, self-synthesizing
transposons at the origin of the CRISPR-Cas immunity.
Genome Biol. Evol. 8, 375–386 (2016). doi: 10.1093/gbe/
evw006; pmid: 26764427
96. A. G. Patterson et al., Quorum sensing controls adaptive
immunity through the regulation of multiple CRISPR-Cas
systems. Mol. Cell 64, 1102–1108 (2016). doi: 10.1016/
j.molcel.2016.11.012; pmid: 27867010
97. N. M. Høyland-Kroghsbo et al., Quorum sensing
controls the Pseudomonas aeruginosa CRISPR-Cas
adaptive immune system. Proc. Natl. Acad. Sci. U.S.A. 114,
131–135 (2017). doi: 10.1073/pnas.1617415113;
pmid: 27849583
98. E. V. Koonin, F. Zhang, Coupling immunity and programmed
cell suicide in prokaryotes: Life-or-death choices. BioEssays
39, 1600186 (2017). doi: 10.1002/bies.201600186;
pmid: 27896818
99. R. Li et al., Type I CRISPR-Cas targets endogenous genes and
regulates virulence to evade mammalian host immunity. Cell
8 of 9
R ES E A RC H | R E V IE W
Res. 26, 1273–1287 (2016). doi: 10.1038/cr.2016.135;
pmid: 27857054
100. E. R. Westra, A. Buckling, P. C. Fineran, CRISPR-Cas
systems: Beyond adaptive immunity. Nat. Rev. Microbiol.
12, 317–326 (2014). doi: 10.1038/nrmicro3241;
pmid: 24704746
101. C. Almendros, N. M. Guzmán, J. García-Martínez,
F. J. Mojica, Anti-cas spacers in orphan
CRISPR4 arrays prevent uptake of active
CRISPR-Cas I-F systems. Nat. Microbiol. 1,
16081 (2016). doi: 10.1038/nmicrobiol.2016.81;
pmid: 27573106
102. K. S. Makarova, V. Anantharaman, L. Aravind,
E. V. Koonin, Live virus-free or die: Coupling
of antivirus immunity and programmed suicide
or dormancy in prokaryotes. Biol. Direct 7, 40
(2012). doi: 10.1186/1745-6150-7-40; pmid: 23151069
103. M. E. Dupuis, M. Villion, A. H. Magadán, S. Moineau,
CRISPR-Cas and restriction-modification systems are
compatible and increase phage resistance. Nat. Commun.
Jackson et al., Science 2017 356, eaal5056 7 April 2017
4, 2087 (2013). doi: 10.1038/ncomms3087;
pmid: 23820428
104. J. Elmore, T. Deighan, J. Westpheling, R. M. Terns, M. P. Terns,
DNA targeting by the type I-G and type I-A CRISPR-Cas
systems of Pyrococcus furiosus. Nucleic Acids Res.
43, 10353–10363 (2015). pmid: 26519471
105. J. Bondy-Denomy, A. Pawluk, K. L. Maxwell,
A. R. Davidson, Bacteriophage genes that inactivate
the CRISPR/Cas bacterial immune system. Nature 493,
429–432 (2013). doi: 10.1038/nature11723;
pmid: 23242138
106. A. Pawluk et al., Inactivation of CRISPR-Cas systems by anti-
CRISPR proteins in diverse bacterial species. Nat. Microbiol.
1, 16085 (2016). doi: 10.1038/nmicrobiol.2016.85;
pmid: 27573108
107. D. Vorontsova et al., Foreign DNA acquisition by the
I-F CRISPR-Cas system requires all components of the
interference machinery. Nucleic Acids Res. 43,
10848–10860 (2015). doi: 10.1093/nar/gkv1261;
pmid: 26586803
108. S. D. Perli, C. H. Cui, T. K. Lu, Continuous genetic
recording with self-targeting CRISPR-Cas in human cells.
Science 353, aag0511 (2016). doi: 10.1126/science.
aag0511; pmid: 27540006
AC KNOWLED GME NTS
Work in the Fineran laboratory on CRISPR-Cas is supported
by a Rutherford Discovery Fellowship (to P.C.F.) from
the Royal Society of New Zealand (RSNZ), the Marsden Fund
of the RSNZ, the University of Otago, and the Bio-Protection
Research Centre (Tertiary Education Commission). The Brouns
laboratory is funded by a European Research Council
starting grant (639707), a Netherlands Organisation for
Scientific Research (NWO) Vidi grant (864.11.005), and a
Foundation for Fundamental Research on Matter (FOM)
projectruimte grant (15PR3188). We thank members
of the Fineran and Brouns groups for useful feedback on
the manuscript.
10.1126/science.aal5056
Downloaded from http://science.sciencemag.org/ on April 26, 2017
9 of 9
 CRISPR-Cas: Adapting to change
Simon A. Jackson, Rebecca E. McKenzie, Robert D. Fagerlund,
Sebastian N. Kieper, Peter C. Fineran and Stan J. J. Brouns (April 6,
2017)
Science 356 (6333), . [doi: 10.1126/science.aal5056]

Editor's Summary

Variation in prokaryote adaptive immunity

To repel infection by phage and mobile genetic elements, prokaryotes have a form of adaptive
immune response and memory invested in clustered regularly interspaced short palindromic repeats and
associated proteins (CRISPR-Cas). This molecular machinery can recognize and remember foreign
nucleic acids by capturing and retaining small nucleotide sequences. On subsequent encounters, the
cognate CRISPR-Cas marshals enzymatic defenses to destroy infecting elements that contain the same
sequences. Jackson et al. review the molecular mechanisms by which diverse CRISPR-Cas systems

Downloaded from http://science.sciencemag.org/ on April 26, 2017

adapt and anticipate novel threats and evasive countermeasures from mobile genetic elements.
Science, this issue p. eaal5056

This copy is for your personal, non-commercial use only.

Article Tools Visit the online version of this article to access the personalization and
article tools:
http://science.sciencemag.org/content/356/6333/eaal5056

Permissions Obtain information about reproducing this article:

http://www.sciencemag.org/about/permissions.dtl

Science (print ISSN 0036-8075; online ISSN 1095-9203) is published weekly, except the last week
in December, by the American Association for the Advancement of Science, 1200 New York
Avenue NW, Washington, DC 20005. Copyright 2016 by the American Association for the
Advancement of Science; all rights reserved. The title Science is a registered trademark of AAAS.