Journal of

FOOD LEGUMES
An Official Journal of Indian Society of Pulses Research and Development (Registration No. 877)
ISSN: 0970-6380; Online ISSN: 0976-2434

The Indian Society of Pulses Research and Development (ISPRD) was founded in April 1987 with the following
objectives:
• To promote research, development and extension activities in pulses
• To facilitate close association amongst pulse workers nationally and internationally
• To publish “Journal of Food Legumes”, a quality research journal of the Society
Membership: any person interested in pulses research and development is eligible for membership of the Society
by becoming ordinary, life or corporate member by paying respective membership fee as detailed below:
Membership Fee Indian (Rs.) Foreign (US$)
Ordinary (Annual) 500 40
Life member 5000 400
Admission Fee 50 10
Library Institute 5000 400
Corporate Member 7500 –
The contribution to the Journal, except in case of invited articles, is open to the members of the society only.
Any non-member submitting a manuscript will be required to become at least an annual member. Members will be
entitled to receive the Journal and other communications issued by the Society. Renewal of the subscription is due
in January each year. If the subscription is not received by February 15, the membership would stand cancelled.
The membership can be revived by paying readmission fee of Rs. 50/-. The membership fee will be paid through
online bank transfer as per given details:
Account Holder’s name: INDIAN SOCIETY OF PULSES RESEARCH AND DEVELOPMENT
Name of the Bank: Union Bank of India
Address: Kalyanpur-Kanpur 208024
Account No.: 349502010003620
IFSC Code: UBIN0534951
Communication regarding transfer of membership fee alongwith the transfer receipt should be communicated
to Secretary, ISPRD, ICAR-Indian Institute of Pulses Research, Kanpur-0802, India at secretary.isprd@gmail.com.

EXECUTIVE COUNCIL 2020-2023

Chief Patron
Dr Trilochan Mohapatra
Patron Co-Patron
Dr TR Sharma Dr NP Singh
President: IP Singh, ICAR-IIPR, Kanpur
Vice-President: Rajeev Varshney, ICRISAT, Hyderabad
Secretary: Aditya Pratap, ICAR-IIPR, Kanpur
Joint Secretary: CS Praharaj, ICAR-IIPR, Kanpur
Treasurer: DR Mishra, ICAR-IIPR, Kanpur
Councilors
AK Srivastava, ICAR-IIPR, Kanpur; Ravinder Singh, PAU, Ludhiana; C. Bharadwaj, ICAR-IARI, New Delhi;
Mudalgiriyappa, GKVK UAS, Bengaluru; S.S. Punia, CoA, Bharatpur, Rajasthan; RP Singh, RAK College, Sehore
Editor-in-Chief
Meenal Rathore
ICAR-Indian Institute of Pulses Research, Kanpur, India
Editorial Board
SK Sharma, Palampur, India; Pooran Gaur, ICRISAT, Hyderabad, India; Nguyen, Henry T, Columbia, USA; Suk-Ha
Lee, Seoul, Korea; Kadambot Siddique, Perth, Australia; Shiv Kumar, ICARDA, Morocco; Ramakrishnan Madhavan
Nair, WorldVeg, Hyderabad, India; Liao Boshou, China; Sushil Chaturvedi, Jhansi, India; AR Sharma, Jhansi, India;
Jayamani P, Coimbatore, India; PS Basu, Kanpur, India; Jitendra Kumar, Kanpur, India; Dinesh Yadav, Gorakhpur,
India; Harsh Nayyar, Chandigarh, India; Harsh K Dikshit, New Delhi, India; A Amarender Reddy, Hyderabad, India;
Uma Sah, Kanpur, India; Mohd. Akram, Kanpur, India; Gaurav K Taggar, Ludhiana, India; Narendra Kumar,
Kanpur, India; Prasoon Verma, Kanpur, India; Senthil Kumar, Kanpur, India
 Journal of
FOOD LEGUMES
An Official Journal of Indian Society of Pulses Research and Development
ISSN: 0970-6380; Online ISSN: 0976-2434

Vol. 33 (2) April-June, 2020

Contents
CURRENT AFFAIRS
1. Genomics-assisted breeding comes of age in pulses in India! 69
Rajeev K. Varshney

RESEARCH PAPERS
2. Insect pest succession and screening for spotted pod borer tolerance in short
duration pigeonpea 71
Sujayanand GK, Dibendu Datta and Farindra Singh
3. Comparative agroclimatic indices of desi and kabuli chickpea genotypes under
irrigated and rainfed conditions 77
Norah Johal, Jagmeet Kaur, Ashutosh Kushwah and Sarvjeet Singh
4. Understanding molecular divergence and population structure of parental lines
of CMS hybrids in pigeonpea 82
Kishan Patel, Karen P Pachchigar, Rachit K Saxena, Rajeev K Varshney and
Abhishek Bohra
5. Cultural and morphological variability among Trichoderma harzianum and
Trichoderma asperellum collected from chickpea growing areas of Rayalaseema
Region of Andhra Pradesh 93
P Nagamani, Someshwar Bhagat, K Viswanath and MK Biswas
6. Analysis of growth, instability and time series decomposition of price indices
of pulses in India 101
Shripad Bhat, Hemant Kumar, Devraj and Rajesh Kumar
7. Impact of phosphorus, sulphur and seaweed sap on yield and economics of
chickpea (Cicer arietinum L.) 106
SL Yadav, Arvind Verma, V Nepalia, GN Yadav, RK Yadav and Khajan Singh
8. Impact of greengram demonstrations in Jabalpur district of Madhya Pradesh 112
AK Singh, Siddarth Nayak, SRK Singh, YR Khare, Nitin Singhai and DP Sharma
SHORT COMMUNICATION
9. Simultaneous selection index based on yield, stability and resistance to wilt
for desi chickpea in North West Plain Zone of India 118
Hemant Kumar, GP Dixit, AK Srivastava and NP Singh
10. DALHANDERMA (IIPRTh-31): Multi-trait Trichoderma based formulation for
management of wilt diseases of pulse crops 123
RK Mishra, Monika Mishra, Sonika Pandey, Naimuddin, PR Saabale and Bansa Singh
11. Phenology, thermal indices and yield of chickpea (Cicer arietinum L.) varieties
under different sowing dates in New Alluvial Zone of West Bengal 127
Shreyasee Seth, Mrityunjay Ghosh, R Nath, MD Hedyatullah and MK Nanda

COMMENTARY
12. Food legumes to prevent an impeding nutrition famine in India 133
SK Sharma

List of Referees for Vol. 33(2) 135

 Journal of Food Legumes 33(2): 69-70, 2020

Current affairs
Genomics-assisted breeding comes of age in pulses in India!
RAJEEV K VARSHNEY

Center of Excellence in Genomics Rajeev K Varshney specialises in genomics,

Systems Biology, International genetics, molecular breeding and capacity building
Crops Research Institute for the in developing countries. He is engaged
Semi-Arid Tropics (ICRISAT), in discovering, developing and delivering
Patancheru, India
innovative R&D solutions to problems global
agriculture. Dr. Varshney is currently serving
E-mail: R.K.Varshney@cgiar.org as Research Program Director - Genetic Gains;
and Director, Center of Excellence in Genomics &
Systems Biology at the International Crops
Research Institute for the Semi-Arid Tropics
(ICRISAT), a global agricultural research institute. He holds Adjunct/
Honorary/Visiting Professor positions at 10 academic institutions in
Australia, China, Ghana, Hong Kong and India.

Dr. Varshney, in his research career spanning for >20 years, has

made significant contributions to improving food security in Asia and
Africa by creating genomic resources of major “orphan” tropical crops.
He has developed and deployed DNA marker technology for
identification of useful genetic variation in them. Along with his colleagues
and he has used these resources and technologies to identify genetic
loci/candidate genes for drought and pest tolerances in key staple crops
for sub-Saharan Africa and India. He has led and contributed to major
international programs that are creating and delivering superior crop
varieties to some of the world’s poorest farmers.

Pulses, known as poor person’s meat, play
a key role in food and nutritional security in
India. Globally, pulses are grown in an area of
about 81 million ha with 73 million tonnes
production. India ranks first both in area and
production of pulses with 35 % of global acreage
and 25 % of world production. Besides being
protein rich sources to vegetarian diets, pulses
improve soil fertility through symbiotic
nitrogen fixation. Despite their importance, the
rate of productivity gains has remained limited
in many pulse crops. In addition, with the
increase in infrastructural and irrigation
facilities/resources the area of pulses has largely
shifted from northern India to central and
southern India during the last two decades.
Nevertheless, the last few years have registered
a quantum leap in pulses production in India,
with the year 2017-18 witnessing the highest
ever pulses production of 25.42 million tonnes.
More than 90% of total pulses production is
realized in 10 states of India namely, Madhya
Pradesh, Maharashtra, Rajasthan, Uttar
Pradesh, Karnataka, Andhra Pradesh, Gujarat,
Jharkhand, Chhattisgarh and Telangana.
Efforts to improve pulses with
conventional breeding systems have resulted in
the development of several high-yielding and
disease/pest resistant varieties for cultivation
across the agro-climatic zones in India. For
instance, in context of the two leading pulses
of India, 194 and 144 varieties of chickpea and
pigeonpea, respectively have been released by
the Central Varietal Release Committee or State
Varietal Release Committee over the last five
decades (1967-2017). The productivity of pulses
in India has increased by 58% from 534 kg/ha
in 1967-68 to 843 kg/ha in 2018-19. The
national pulse requirement, however, is
projected to rise to 39 million tonnes by the year
70 Journal of Food Legumes 33(2), 2020
2050, which necessitates an annual growth rate
of 2.2%. To narrow the increasing gap between
demand and supply, the pulse breeding
programmes need to have more precision and
efficiency. In this context, genomic resources
are of paramount significance to impart both
efficiency and precision to crop breeding
schemes. Earlier, pulses were considered as
orphan crops due to the paucity of genomic
resources. Nevertheless, last decade has
witnessed remarkable success in generating
unprecedented genomic resources in these
crops at a fast pace, thus transforming these
genomic orphans into genomic resource rich
crops. This genomics revolution has provided
the blue-prints of several pulse genomes like
chickpea (Cicer arietinum), pigeonpea (Cajanus
cajan), common bean (Phaseolus vulgaris), lentil
(Lens culinaris), pea (Pisum sativum), mungbean
(Vigna radiata), adzuki bean (Vigna angularis),
cowpea (Vigna unguiculata), urd bean (Vigna
mungo). In addition, several other type of
genomic resources such as genetic maps, gene
expression atlases, genotyping platforms, etc.
have been developed in several pulses crops.
Several million SNP markers including
several thousand on high-throughput
genotyping platforms are now available for
understanding the genetics of agronomic, biotic
stress resistance, abiotic stress tolerance and
nutrition traits. By using these molecular
markers and sequencing based trait mapping
approaches, several high-density genetic maps
have been developed and the genomic regions
for different traits, as mentioned, have been
identified and mapped with high-resolution in
these pulses crops. In several pulse crops,
genetic variations in germplasm collections have
been catalogued by sequencing germplasm sets
as done in chickpea and pigeonpea.
Furthermore, novel genetic variations created
through development of multi-parent
populations like MAGIC, NAM are being
harnessed for pulses improvement.
The efficient integration of the modern
genomic tools and technologies in pulses
breeding programs has facilitated delivery of
molecular breeding products in these crops in
recent years. For example, introgression of the
genomic regions identified in pulses, like
chickpea, into different genetic backgrounds
has led to the identification and release of the
first molecular breeding products such as Pusa
Chickpea 10216 (enhanced tolerance to
drought) and Super Annigeri 1/MABC-WR-
SA1 (enhanced resistance to Fusarium wilt) in
chickpea. Several improved molecular breeding
lines in different genetic backgrounds are being
evaluated and promoted to the next level in All
India Coordinated Research Project (AICRP)
on Chickpea. Similarly, molecular breeding
products are being developed for resistance to
Fusarium wilt and sterility mosaic disease in
pigeonpea.
In the current regime of climate change,
integration of genomics, phenotyping, systems
modelling and agronomy is direly essential for
developing climate resilence vareities for
sustainable pulse production. In addition, the
5Gs breeding approach is much-needed for
pulses improvement. Identification of superior
haplotypes following sequencing of large
germplasm collections paves the way for
haplotype-based breeding, a promising
approach to obtain designer pulses genotypes
having climate resilience. Two approaches that
hold the potential to improve genetic gains by
reducing the breeding cycle time are genomic
selection (GS) and speed breeding (SB). Recent
studies on GS in pulses like chickpea and pea
have demonstrated promising results.
Similarly, speed breeding protocols have been
optimized to reduce generation time in several
pulse crops including chickpea, pea.
Developing “plant-based meat” to ensure food
and nutritional security for burgeoning
population in Indian subcontinent where most
of the people are vegetarians, calls for such
transformative research efforts that integrate
multiple disciplines of science.
 Journal of Food Legumes 33(2): 71-76, 2020

Insect pest succession and screening for spotted pod borer tolerance in
short duration pigeonpea
SUJAYANAND GK1* , DIBENDU DATTA1 and FARINDRA SINGH1

*
ICAR-Indian Institute of Pulses
Research, Kanpur, Uttar Pradesh
*
E-mail: sujayanand.gk@icar.gov.in
Received: 19 June, 2020
Accepted: 10 August, 2020
Handling Editor:
Dr. Gaurav Kumar Taggar, PAU,
Ludhiana, India
ABSTRACT
Pigeonpea (Cajanus cajan L) is a major legume crop cultivated in India
and insect pests inflict heavy yield loss. The insect pest succession and
population dynamics varies according to agro-climatic zones. In Kanpur,
six insect pests viz., leaf webber, blister beetle, spotted pod borer, pod
bugs, gram pod borer and pod fly infested ICPL 67B during Kharif 2013.
Spotted pod borer (SPB), Maruca vitrata Fabricius is a serious pest that
causes severe flower and pod damage. Hence in the present study 30
different pigeonpea genotypes were screened under field conditions
against SPB. The larval webbing per plant varied from 0.13 (JA 4) to
10.13 (MN 5), while the pod evaluation index ranged from 1.12 (ICPL
88039) to 66.08 (JA 4). Among the 3 morphological parameters studied,
inflorescence stalk length was found to be negatively correlated with
spotted pod borer infestation. The results of field infestation and
morphological parameter correlation revealed JA 4 as a SPB resistant
genotype. Further confirmatory tests like no choice assay coupled with
biochemical and biophysical analysis may reveal the mechanism of
resistance in this genotype.

Key words: Host plant resistance, Maruca vitrata, Morphological factors,

Pest succession, Pod damage.

INTRODUCTION and prevailing climatic conditions. Information

Pigeonpea [Cajanus cajan (L)] is the second
prominent legume crop cultivated on an area
of 44.59 lakh ha in India with a production of
41.80 lakh tons as recorded during 2017-18.
Among the pigeonpea producing states of
India, Uttar Pradesh (U.P.) is the fifth largest
state in terms of both area (2.82 lakh ha) and
production (3.03 Lakh tons) with a
productivity of 1074 kg/ha during 2017-2018
(Anonymous, 2018). The productivity of
pigeonpea in U.P. was 1074 kg/ha in 2017-
2018.
More than 250 species of insects have been
found feeding on pigeonpea, although only a
few of these viz., spotted pod borer (Maruca
vitrata Fabricius), gram pod borer (Helicoverpa
armigera Hübner) and tur pod fly
(Melanagromyza obtusa Malloch) cause
significant and consistent damage to the crop
(Gopali et al. 2010). The pest succession in a
crop differs according to the crop phenology
on pest succession in a particular agro-climatic
condition is prerequisite for devising sustainable
management strategy against the insect pest by
understanding its occurrence window and its
population dynamics in that agro climatic
region. The spotted pod borer, M. vitrata inflicts
heavy yield loss (84.68% in MN1) by damaging
the flowers, pods and seed (Mahalle and
Taggar 2017). Thus it is very much essential to
screen the available pigeonpea genotypes
against spotted pod borer to decipher its host
plant reaction. Several insecticides have been
tested against spotted pod borer in pigeonpea.
However, due to concealed nature of feeding
of the pest, it necessitates deployment of
insecticide having fumigant action (i.e. DDVP)
to contain this pest in pigeonpea
(Karabhantanal et al. 2018). Hence there is a
dire need for identifying a tolerant or resistant
pigeonpea genotype to prevent the damage
caused by this notorious insect pest. Some
workers had reported that trichome density,
72 Journal of Food Legumes 33(2), 2020
trichome length and pod angle were involved
in imparting resistance against M. vitrata
infestation in pigeon pea (Wubneh and Taggar
2016; Devi et al. 2013). Host plant resistance is
cheapest technology that is genetically inherited
and can be easily distributed to farmers through
tolerant variety seeds for managing the spotted
pod borer. Thus, it is very much essential to
screen the available pigeonpea genotypes
against spotted pod borer to decipher its host
plant reaction.
MATERIALS AND METHODS
Insect pest succession: The pigeonpea entry,
ICPL67B (a short duration) was sown in 5 m x
5 m plot with a spacing of 0.60 m x 0.20 m
during Kharif 2013. The pigeonpea crop was
raised by following standard agronomic
package of practices to have a good crop except
for insecticidal spray. The field was maintained
insecticide free for facilitating natural
infestation of insect pests. Fifteen randomly
selected plants were tagged and observed every
week from germination to harvest for recording
the insect pest incidence and its pest succession
was recorded based on sweep net and visual
occurrence in each meteorological standard
week.
Screening for spotted pod borer tolerance:
Another field experiment was conducted in
pigeonpea during Kharif 2013 at New Research
Campus, ICAR-IIPR, Kanpur with an objective
of identifying M. vitrata tolerant pigeonpea
genotypes. Thirty pigeonpea genotypes were
sown in 1 meter row length (4 rows of each
genotype per replication) on 21st June 2013 (25th
Standard Meteorological Week (SMW)) in a
randomized block design with a spacing of 0.60
m x 0.20 m and each genotype was replicated
thrice. Pre-emergence herbicide, pendimethalin
38.7% CS “stomp®” was applied within 24 hrs
of sowing and three hand weeding on 29th, 33rd
& 37 th SMW were carried out for weed
management in the field. Basal dressing with
10kg DAP was done on 33rd SMW. Pods were
harvested on 23rd January 2014. The field was
maintained insecticide free to facilitate the
natural infestation of spotted pod borer and
other insect pests.
During the 42nd SMW, all 30 genotypes
were in flowering stage (most of genotypes
were in 50% flowering), M. vitrata larval
webbing/plant was recorded from 15 plants
per genotype for all the 30 pigeonpea
genotypes. Simultaneously, the leaf stalk length
(LSL), inflorescence stalk length (ISL) and
flower pedicel length (FPL) were recorded from
15 plants in each genotype i.e. 5 plants/
replication. The leaves and inflorescence of
pigeonpea genotypes were collected by excising
the samples from the base of stalk/pedicel using
a sterile scissors and were placed in a sterile
polythene cover and their length was measured
in the laboratory using Vernier calipers as
described by Parre et al. (2018). The M. vitrata
larval webbing data were subjected to
correlation analysis with LSL, ISL and FPL to
find out the morphological feature that favours
M. vitrata infestation in pigeonpea. To quantify
the pod damage in each genotype, five plants
in each replication were tagged for recording
the pod load rating (PL) and pod damage rating
(PD) during 45th SMW as described by Egho
and Enujeke (2012); Jackai (1995) (Table 1). This
method was adapted to quantify the loss by M.
vitrata which was inflicted to pigeonpea during
flowering (by destroying the flower buds and
flowers that results in bare peduncles or
peduncle with less pods) and podding (by
damaging seeds and pods) stages. As it
considers the pod load rating which takes into
account of the flower damage also. Hence this
method was adapted in pigeonpea. Based on
PL and PD, pod evaluation index (ipe) was
calculated as per the formula given below,
Ipe = PL x (9-PD)
The larval webbing data were subjected
to square root transformation (“x+0.5) before
Table 1. Pod load and pod damage rating (Egho and
Enujeke (2012); Jackai (1995))
Pod Load (PL) Pod Damge (PD)
Rating Degree of podding Rating Percentage
1 <60% peduncles bare 1 0-10
3 31-50% peduncles bare 2 11-20
3 21-30
5 16-30% peduncles bare 4 31-40
5 41-50
6 51-60
7 Upto 15% peduncles bare 7 61-70
8 71-80
9 Occasional bare peduncles 9 81-100
 Sujayanand et al. : Insect pest succession and screening for spotted pod borer tolerance in short duration pigeonpea
analysing in SAS 9.2 with PROC ANNOVA
procedure. The pigeonpea morphometric data
were correlated with M. vitrata larval webbing
by using OPSTAT software.
RESULTS AND DISCUSSION
Insect pest succession: The insect pest
succession in pigeonpea during Kharif 2013 was
recorded and is presented in Table 2. The first
insect pest that appeared in huge numbers (4/
plant) during vegetative stage (29th SMW) was
the leaf webber, Pammene critica Meyrick that
persisted up to flowering stage (37th SMW). The
minute creamy-yellowish larvae webbed the
young pigeonpea leaves by rolling them
longitudinally. It defoliated the chlorophyll in
leaves that were present inside the web. The
webs were often seen on terminal buds and it
arrested the growth of the pigeonpea plants.
The present result was in contradiction with
Vennila et al. (2019) with respect to the time of
occurrence, who reported G. critica incidence
during 32nd to 41st SMW during Kharif 2012-
2013 in pigeonpea variety Maruti (ICP8863) at
Gulbarga. This may be attributed due to
variation in variety and agro-climatic zone. The
present result also disagrees with the findings
of Gupta et al. (2011) wherein they had reported
P. critica infestation in UPAS 120 that occurred
at IIPR, Kanpur during 1st half of August 2011
to 2nd half of September 2011 corresponding to
32nd to 39th SMW.
The second major pest recorded in
pigeonpea was the blister beetle, Mylabris
pustulata Thunberg that infested pigeonpea
during flowering stage (37th SMW) (3/plant).
The blister beetle adults eat away the flower
buds and freshly opened flowers. This resulted
in reduction of number of flowers. The third
insect pest in succession was spotted pod borer,
Maruca vitrata Fabricius that infested during
flowering stage (40th SMW) and coincided with
Table 2. List of major insect pests recorded during Kharif 2013.
S.No Common name Scientific name
1 Leaf webber Pammene critica Meyrick
2 Blister beetle Mylabris pustulata Thunberg
3 Spotted pod borer Maruca vitrata Fabricius
4 Pod bugs Riptortus pedestris
Clavigralla gibbosa Spinola
5 Pod borer Helicoverpa armigera Hubner
6 Pod fly Melanagromyza obtusa Malloch
73
peak flowering phase of the crop. The present
result disagrees with Sonune et al. (2010)
wherein they had reported the incidence of M.
vitrata in blackgram from August 2ndweek (32nd
SMW) to October first week (40 th SMW) in
Junagadh region of India. The probable reason
for the difference in period of M. vitrata
incidence was attributed to geographical
variation and host phenology (Sujayanand et
al. 2020 and Sampathkumar et al. 2016).
The pod bugs, Riptortus pedestris Fabricius
and Clavigralla gibbosa Spinola were the next
insect pests that occurred during the podding
stage (44th SMW). These bugs sucked the sap
from developing seeds by piercing the pod wall
which resulted in shriveling of seeds. The
present finding was in congruence with Pawar
et al. (2014) wherein they had reported
infestation of pod bug during 44th SMW to 1st
SMW at Jabalpur in ICPL88039. While the
present result contradicts reports of Srilaxmi
and Ravinder Paul (2010) where in they had
recorded pod bugs from September to October
2007 & 2008 corresponding to 36th to 44th SMW
in Gulbarga, Karnataka. The pod borer, H.
armigera also started infesting in the same
period but its incidence was comparatively less
than spotted pod borer. The last insect pest to
appear in pigeonpea at Kanpur was pod fly,
M. obtusa during the pod maturation stage (1st
SMW). The pod fly maggots fed on developing
seeds inside the pod and made them unfit for
human consumption resulting in severe yield
loss. The present result was in agreement with
Pawaret al. (2014) wherein they had reported
pod fly incidence from 46th SMW to 1st SMW.
Spotted pod borer damage: The spotted pod
borer damage in different genotypes was
recorded at flowering stage (42 nd SMW) by
recording larval webbing and at podding stage
(45th SMW) by calculating ipe. The M. vitrata
webbings per plant ranged from 0.13 (JA 4) to
Crop stage infestation started Pest incidence/damage
Vegetative stage (29th SMW) 4 larvae/plant
Flowering (37th SMW) 3 adult /plant
Flowering (40th SMW) 5 webbings/plant
Podding (44th SMW) 3 adult/ plant
Podding (44th SMW) 2 larva/plant
Pod maturation (1st SMW) 5 damaged pods/plant
74 Journal of Food Legumes 33(2), 2020

10.13 (MN 5) during 42nd SMW (Table 3). The 0.13 and 4.33 larval webbing per plant
second highest larval webbing per plant was respectively (Table 3). Thus the criterions, ipe
8.47, followed by 7.33 recorded from the and larval webbing per plant revealed JA4 as
genotypes ICPL 7148 and ICPL 67B less preferred genotype for M. vitrata during
respectively. The lowest larval webbing per both flowering and podding stages. While
plant was recorded from JA4 and it was on par PUSA 2002-2 had high larval incidence during
with TJT 501, Banas, GT101, CORG9701, Pusa flowering stage it might have recovered during
855 and Pusa 84, followed by Pusa 2001. Some podding stage. Some genotypes recover the
biophysical or biochemical mechanism flower or pod damage by producing additional
functioning in JA4 helps it to resist M. vitrata flower buds. Short duration pigeonpea lines,
infestation at flowering stage. ICPL 88034, ICPL87113 and MPG 679 recorded
Similarly, the pod evaluation index (ipe) low damage (10 to 25 %) due to M. testulalis
was recorded during 45th SMW and it varied and showed excellent recovery from damage
from 1.12 (ICPL 88039) to 66.08 (JA 4). The when evaluated for recovery resistance on a 1
genotype, JA4 recorded highest ipe followed by to 5 scale (Saxena et al. 1992, Saxena et al.
PUSA 2002-2 (53.32).The higher ipe indicates 1995).
that the genotype is having resistance during Correlation of phenotypic characters and
both flowering and podding stages. The spotted pod borer damage: The morphometrics
genotypes, JA 4 and Pusa 2002-2 have recorded data for leaf stalk length (LSL) inflorescence
Table 3. Pigeonpea varieties screened against spotted pod borer during Kharif 2013.
Pod load rating Pod damage rating Pod evaluation index
S.no Name of Variety Mean larval webbing/plant* $
(PL) (PD) (ipe)
1 AL 15 3.93 (2.11)F,G,H 3.13 7.13 5.85
2 AL 201 3.53 (2.00)F,G,H 3.67 7.07 7.09
3 TJT 501 0.20 (0.83) K 1.27 7.13 2.36
4 Banas 0.20 (0.82) K 1.27 5.60 4.31
5 GT 101 0.87 (1.13) J,K 5.00 7.33 8.33
6 CORG 9701 0.40 (0.95) K 6.00 5.27 22.40
7 Pusa 84 0.80 (1.12) J,K 8.13 6.27 22.23
8 ICP 84031 4.33 (2.20) E,F 5.80 7.53 8.51
9 Pusa 2001 1.60 (1.42) I,J 2.20 4.67 9.53
10 Pusa 992 5.27 (2.38) C,D,E,F 7.07 7.00 14.13
11 Pusa 33 5.40 (2.42) C,D,E,F 7.53 3.33 42.69
12 Pusa 991 4.60 (2.25) D,E,F 7.13 3.60 38.52
13 Pusa 2002-2 4.33 (2.19) E,F 8.60 2.80 53.32
14 TAT-10 3.87 (2.08) F,G,H 7.87 4.13 38.28
15 Pusa 855 0.60 (1.04) J,K 5.07 5.07 19.93
16 WD 5 2.47 (1.60)H,I 1.47 7.07 2.84
17 ICPL 67B 7.33 (2.78)B,C 1.47 7.60 2.05
18 IPAC 8 4.40 (2.21)E,F 2.27 6.27 6.20
19 ICPL 88039 5.80 (2.51)C,D,E 1.40 8.20 1.12
20 ICPL 7148 8.47 (2.98)A,B 5.13 3.80 26.69
21 ICPL 84023 5.40 (2.43)C,D,E,F 4.13 3.73 21.77
22 ICPL 7124 2.47 (1.72)G,H,I 7.07 7.53 10.36
23 JA 4 0.13 (0.79)K 8.40 1.13 66.08
24 MN 8 4.60 (2.26)D,E,F 7.80 7.20 14.04
25 Manak 6.60 (2.66)B,C,D 7.47 4.20 35.84
26 ICPL 91045 5.87 (2.52)C,D,E 7.53 2.67 47.71
27 DSLR 129 2.40 (1.70)G,H,I 7.47 2.53 48.28
28 MN 5 10.13 (3.26)A 2.33 8.33 1.56
29 ICPL 87154 2.40 (1.70)G,H,I 4.13 7.07 7.99
30 UPAS 120 4.13 (2.15)E,F 7.60 3.67 40.53
CV 11.66
CD 0.37
*Means following same letter are not significantly different by DMRT (p=0.05)
$ values within bracket are square root transformed
 Sujayanand et al. : Insect pest succession and screening for spotted pod borer tolerance in short duration pigeonpea 75

Table 4. Correlation matrix for pigeonpea morphological characters and spotted pod borer infestation in Kharif 2013
Larval webbing Leaf stalk length Inflorescence stalk Flower pedicel length
length
Larval webbing 1 0.341* -0.167 0.335*
Leaf stalk length 1 0.158 0.136
Inflorescence stalk length 1 0.054
Flower pedicel length 1
* significant at 5 percent

stalk length (ISL) and flower pedicel length the genotypes with more inflorescence stalk
(FPL) showed variability within the 30 length have less M. vitrata infestation. Thus, the
pigeonpea genotypes during 42nd SMW (Fig 2). genotype, JA 4 with more inflorescence stalk
The three morphological parameters viz., LSL, length and more pod evaluation index was
ISL and FPL varied from 0.65 cm (Banas) to categorized as resistant against spotted pod
4.08 cm (MN 5); 1.12 cm (Banas) to 4.20 cm borer in pigeonpea. Still there is a need to study
(JA 4) and 0.63 cm (WD 5) to 1.50 cm (ICPL further morphometric parameters like pod stalk
84023), respectively. The correlation analysis of length, pod length, pod angle, etc and its
LSL, ISL and FPL with M. vitrata larval influence on spotted pod borer incidence along
webbing per plant revealed strong positive with biochemical analysis to confirm resistance
correlation between LSL (0.341), FPL (0.335) mechanism in identified pigeonpea genotype.
and larval webbing at 10% level. The ISL Table 5. Biophysical characters of pigeonpea genotypes
(-0.167) is negatively related to larval webbing screened in Kharif 2013
per plant (Table 4). If the inflorescence stalk Leaf stalk Inflorescence Flower pedicel
Pigeonpea
length increases the larval webbing will length stalk length length
genotype
(cm)$ (cm) $ (cm) $
decrease as the flowers were radiating out of AL 15 1.53(1.58) 2.28(1.81) 1.15(1.47)
the foliage and thereby it reduces compactness. AL 201 0.92(1.38) 3.88(2.21) 1.00(1.41)
If the flower pedicel length increases the TJT 501 1.35(1.53) 3.45(2.10) 1.12(1.46)
chances of two flowers coming together by Banas 0.65(1.28) 1.12(1.45) 0.77(1.33)
swing action will be more and it will enhance GT 101 1.30(1.49) 2.20(1.79) 1.05(1.43)
CORG 9701 1.02(1.42) 3.02(2.00) 0.68(1.30)
the web formation by M. vitrata. Devi et al. Pusa 84 1.53(1.59) 2.33(1.82) 1.02(1.42)
(2013) had reported negative correlation of ICP 84031 1.37(1.54) 2.20(1.79) 0.77(1.33)
trichome length and density in pigeonpea pods Pusa 2001 1.20(1.48) 3.07(2.01) 0.75(1.32)
with M. vitrata pod damage. Further they had Pusa 992 1.32(1.51) 3.17(2.03) 0.88(1.37)
Pusa 33 1.08(1.44) 3.23(2.06) 1.12(1.45)
reported a positive significant correlation of pod
Pusa 991 1.77(1.65) 3.90(2.21) 1.28(1.51)
damage with 50% flowering, days to pod Pusa 2002-2 1.90(1.69) 2.68(1.92) 0.95(1.40)
maturity and number of pods per plant. TAT-10 1.37(1.54) 2.48(1.87) 0.95(1.40)
Sujithra and Srinivasan (2012) reported that M. Pusa 855 1.23(1.49) 2.48(1.86) 0.90(1.38)
vitrata resistance in field bean was positively WD 5 1.58(1.61) 2.42(1.85) 0.63(1.28)
ICPL 67B 1.93(1.71) 1.98(1.71) 1.07(1.44)
correlated with pod length while negative and
IPAC 8 2.28(1.81) 4.15(2.26) 1.13(1.46)
significant correlation was established with pod ICPL 88039 1.05(1.42) 2.70(1.92) 0.90(1.38)
width. The pigeonpea genotypes having shorter ICPL 7148 1.35(1.53) 2.35(1.83) 1.02(1.42)
leaf stalk and flower pedicel concurrently with ICPL 84023 0.93(1.36) 1.43(1.56) 1.50(1.58)
longer inflorescence stalk length were less ICPL 7124 2.03(1.74) 2.58(1.89) 1.12(1.45)
JA 4 2.08(1.75) 4.20(2.28) 0.92(1.38)
preferred by M. vitrata for webbing and
MN 8 2.53(1.88) 1.30(1.52) 0.98(1.41)
feeding. The present result was in agreement Manak 1.02(1.42) 1.87(1.69) 1.03(1.43)
with Talekar (1994) who had recorded ICPL 91045 2.15(1.77) 4.18(2.28) 1.07(1.44)
mungbean cultivars with pods not touching DSLR 129 2.08(1.75) 3.62(2.14) 1.07(1.44)
each other and radiating from foliage showed MN 5 4.08(2.16) 2.10(1.76) 1.05(1.43)
ICPL 87154 3.02(2.00) 3.45(2.11) 0.95(1.40)
resistance to larvae for adjacent webbing and
UPAS 120 1.87(1.69) 2.77(1.94) 0.95(1.40)
making bore holes. CD 0.17 0.15 0.06
It could be inferred from the above that $ values within bracket are square root transformed
76 Journal of Food Legumes 33(2), 2020
REFERENCES
Anonymous 2018. Pulses Revolution from Food to
Nutritional security. Crops division, Ministry of
Agriculture and Farmers welfare, Department of
Agriculture Co-operation & Farmers Welfare. Krishi
Bhavan, New Delhi-110001. p 16.
Devi MS, Sreekanth M and Rao MR. 2013. Influence of
morphological traits on spotted pod borer, Maruca
vitrata resistance in pigeonpea. Indian Journal of
Plant Protection 41(1): 97-99.
Egho EO and Enujeke EC. 2012. Effect of Native Soap
on Insect Pests and Grain Yield of Cowpea (Vigna
unguiculata (L) Walp) in Asaba and Abraka during
the Late Cropping Season in Delta State,
Nigeria. Sustainable Agriculture Research 1(2):
275-283.
Gopali JB, Raju T, Mannur DM and Suhas Y. 2010.
Web-forming lepidopteran, Maruca vitrata (Geyer):
an emerging and destructive pest in pigeonpea.
Karnataka Journal of Agricultural Sciences 23(1):
35-38.
Gupta A, Ghosh A, Baby NL and Jalali SK. 2011.
Morphological and molecular characterization of
Apanteles mohandasi Sumodan & Narendran
(Hymenoptera: Braconidae), a solitary
endoparasitoid of Pammene critica Meyrick
(Lepidoptera: Tortricidae), with notes on biology
from India. Entomological news 122(4): 354-365.
Jackai LE. 1995. The legume pod borer Maruca testulalis,
and its principal host plant, Vigna unguiculata (L.)
Walp.—use of selective insecticide sprays as an
aid in the identification of useful levels of
resistance. Crop Protection 14(4): 299-306.
Karabhantanal SS, Udikeri SS, Jagginavar SB and Jolli
RB. 2018. Population buildup of leaf and flower
web forming insect, Maruca vitrata (Geyer) and their
management in redgram ecosystem. Journal of
Entomology and Zoology Studies 6(2): 2192-2196.
Mahalle RM and Taggar GK. 2017. Yield loss
assessment and establishment of economic
threshold level of Maruca vitrata in pigeonpea.
Journal of Food Legumes 31(1): 36-44.
Parre S, Raje RS, Singh NK and Kumar J. 2018. Genetic
variability and association analysis for
morphological and biochemical traits related to pod
borer (Helicoverpa armigera) resistance in Pigeonpea
[Cajanus cajan (L) Millspaugh] among recombinant
inbred lines. Journal of Entomology and Zoology
Studies 6(3): 1570-1575.
Pawar UA, Chintkuntalawar PS and Ugale TB. 2014.
Studies on succession of insect pest complex and
their natural enemies in pigeonpea [Cajanus cajan
(L.) Millsp.]. International Journal of Plant
Protection 7(2): 318-24.
Sampathkumar S, Durairaj C, Mohankumar S and
Ganapathy N. 2016. Colour polymorphism studies
in larvae of legume pod borer, Maruca vitrata Geyer
(lepidoptera: Crambidae) on pulses. The Bioscan
11(2): 1203-1210.
Saxena KB, Jayasekera SJBA and Ariyaratne HP. 1992.
Pigeonpea Adoption and Production Studies in Sri
Lanka. Department of Agriculture. International
Crops Research Institute for the Semi-Arid Tropics,
Patancheru, Andhra Pradesh (limited distribution).
p173.
Saxena KB, Lateef SS, Ariyaratne HP, Fonseka HHD
and Dharmasena CMD. 1995. Maruca testulalis
damage in determinate and indeterminate lines of
pigeonpea. International Chickpea and Pigeonpea
Newsletter 2: 15-18.
Sonune VR, Bharodia RK, Jethva DM and Dabhade
PL. 2010. Seasonal incidence of spotted pod
borer,Maruca testulalis (Geyer) in blackgram. Legume
Research 33: 14-17.
Srilaxmi K and Ravindra Paul. 2010. Diversity of insect
pest of pigeon pea (Cajanus cajan L. Mill sp.) and
their succession in relation to crop phenology in
Gulbarga, Karnataka. The Ecoscan 4(4): 273-276.
Sujayanand GK, Chandra A, Pandey S and Bhatt S.
2020. Seasonal Abundance of Spotted Pod Borer,
Maruca vitrata Fabricius in Early Pigeonpea
[Cajanus cajan (L.) Millsp.] and its Management
through Farmscaping in Uttar Pradesh. Legume
Research. Doi: 10.18805/LR-4329
Sujithra M and Srinivasan S. 2012. Bio-physical and
bio-chemical factors influencing plant resistance
in pod borers on field bean, Lablab purpureus var.
lignosus Medikus. Annals of Plant Protection
Science 20(2): 329-333.
Talekar NS. 1994. Maruca testulalis. In: Insect Pests of
Mungbean and Their Control. Asian Vegetable
Research and Development Center, Shanhua,
Taiwan, pp. 39-45.
Vennila S, Paul RK, Bhat MN, Yadav SK, Kumar NB,
Rachappa V, Yelshetty S, Chandra P and Sharma
OP. 2019. Approach to study of pigeonpea leaf
webber [Grapholita critica (Meyr.)] damage dynamics
and its relation to weather. Legume Research-An
International Journal 42(6): 844-849.
Wubneh WY and Taggar GK. 2016. Role of
morphological factors of pigeonpea in imparting
resistance to spotted pod borer, Maruca vitrata Geyer
(Lepidoptera: Crambidae). Journal of Applied and
Natural Science 8: 218-224.
 Journal of Food Legumes 33(2): 77-81, 2020

Comparative agroclimatic indices of desi and kabuli chickpea genotypes

under irrigated and rainfed conditions
NORAH JOHAL*1, JAGMEET KAUR2, ASHUTOSH KUSHWAH2 and SARVJEET SINGH2

1
Department of Botany, Punjab
Agricultural University, Ludhiana;
2
Department of Plant Breeding and
Genetics, Punjab Agricultural
University, Ludhiana
*
E-mail: norah-cobsbot@pau.edu
Received: 6 April, 2020
Accepted: 31 August, 2020
Handling Editor:
Dr. Amarender Reddy, ICAR-CRIDA,
Hyderabad
ABSTRACT
The present study was conducted in relation to agroclimatic indices i.e.
accumulated growing degree days (AGDD), accumulated photothermal
units (APTU) and accumulated heliothermal units (AHTU) on eight desi
and four kabuli chickpea genotypes under irrigated and rainfed
conditions at transitional phenophases of flower initiation, pod initiation
and at maturity. Significant differences in AGDD, APTU and AHTU at
different phenophases were recorded but no significant difference was
observed amongst desi and kabuli genotypes. Genotypes pooled higher
photothermal units under irrigated conditions; however, earliness in
flowering reduced the accumulation window of heat units under rainfed
conditions. Desi genotype PBG 7 and kabuli genotype IPCK-2009-165
recorded high HUE (heat use efficiency) values and displayed low dip
(6.90 and 0.54 % respectively) in yield. Agroclimatic indices i.e. AGDD,
APTU and AHTU in kabuli and desi genotypes significantly pooled to
final high yields (P=0.78, P=0.82 and P=0.77 respectively) under irrigated
conditions at maturity.

Key words: Chickpea, Heat units, Path coefficient analysis, Phenophases,

Rainfed crops.

INTRODUCTION nutritional status of soil due to its nitrogen fixing

In rainfed areas, crops with low water
requirement are considered effective for
improving water strata and nutrient balance
of soil for climate resilience agriculture. Rainfed
legume crops such as pearl millet (Pennisetum
glaucum), blackgram (Vigna mungo L. Hepper),
pigeon pea (Cajanus cajan L. Millsp) and
chickpea (Cicer arietinum L.) (Vanaja et al. 2017)
seems to be an effective alternative than non-
legumes for the inclusion in crop diversifications
due to reduced water requirement and their
ability in elevating the nitrogen requirement of
the soil (Oliveira et al. 2019). However,
persistently low rainfall in these rainfed crops
leads to drought like condition.
Chickpea ranks third amongst the pulse
crops grown worldwide with India being the
main contributor of approximately 75% to this
production (Ahsan et al. 2018). Chickpea is an
important protein dietary source particularly
for vegetarian people and also enhance the
potential. The rainfed crop, though requires
low rainfall for its growth and development,
but faces drought stress during reproductive
phases especially during pod formation.
Drought affects chickpea production in India
and the severity of the stress accounts for
approximately 33% damage to the total
production (Kashiwagi et al. 2015). The final
yield of chickpea genotype is an output of
individual factors and their individual capacity
to cope up with abiotic and biotic stress
conditions thus pooling to the end result of
productivity.
During drought stress or water scarce
conditions, apart from declining soil water
levels, abiotic agroclimatic indices viz., AGDD,
APTU and AHTU that are accumulated over
the life cycle of chickpea contribute their share
towards total yield (Johal et al. 2018). The
influence of these agroclimatic indices vary with
stage i.e. vegetative, reproductive and maturity
78 Journal of Food Legumes 33(2), 2020
and thus affect the final yield (Qiao-yan et al.
2012). This is evident from the fact that a delay
in sowing in Brassica juncea (Bio-92) reduced
the GDD and HTU thus negatively affecting
productivity (Solanki and Mundra 2015).
Drought stress influences the phenological
attributes i.e. days to flower initiation, pod
formation and maturity. The change in the
phenological development affects the
agroclimatic indices and thus the yield
characteristics. The present study validates the
contribution of agroclimatic indices in desi and
kabuli (two sub types of chickpea differing in
the deposition of anthocyanin pigments)
genotypes (Thudi et al. 2017) under irrigated
and rainfed treatments in field conditions.
Moreover phenological attributes i.e. days to
flower initiation, days to pod initiation and days
to maturity have been correlated with grain
yield via path coefficient analysis.
MATERIAL AND METHODS
Twelve genotypes bifurcated into desi and
kabuli were subjected to two treatments i.e.
irrigated (lined with water channels on two
sides) and rainfed (no irrigation) in the
experimental area of Pulses section,
Department of Plant Breeding & Genetics,
Punjab Agricultural University, Ludhiana
during Rabi 2016-17 and 2017-18 seasons.
Irrigation of field was done prior to sowing
against rainfed treatment and sowing was done
as per the instructions of package of practices
in randomized block design. Data for
phenological attributes in terms of days to
flower initiation, days to pod initiation and days
to maturity were recorded from three
replications with five plants tagged in each
replication. School of Climate Change and
Agrometeorology, Punjab Agricultural
University, Ludhiana provided the
meteorological data and agroclimatic indices
were calculated as below with base temperature
of chickpea taken into consideration as 5 0 C
(Roberts et al. 1985):
GDD (ºC)= (Max. Temp. + Min. Temp.)/2–Base Temp. (Tb)
PTU=GDD X Day length
HTU= GDD X Actual Sunshine
HUE= Grain yield/GDD (Aggarwal et al.
2016).
Accumulated GDD, HTU and PTU were
calculated (Singh et al. 1990 and Nuttonson
1957) from the duration of initiation of one
phenophase onto the completion of it.
Statistical analysis
Mean value of genotypes from both the Rabi
trials and calculated values were subjected to
SPSS 16.0 software Tukey’s post hoc test
(Wragg et al. 2000) to test the difference
between treatments and genotypes. Path
coefficient analysis (Dewey and Lu 1959)
including correlation and polynomial
regression coefficients between agroclimatic
indices and yield were analysed using
Microsoft office Excel version 2010. Mean fold/
percent increase or decrease data was
calculated in rainfed plants against irrigated
ones.
RESULTS AND DISCUSSION
Phenology and agro climatic indices
Plant’s transitional processes hastened
under rainfed conditions at flower initiation,
pod initiation and maturity stage in comparison
to irrigated conditions in both desi and kabuli
genotypes (Table 1 and 2). Two kabuli
genotypes GNG 2285 (20.39, 10.21 and 9.15%)
and BG 3057 (43.46, 12.07 and 6.57%) showed
maximum rapidity to escape drought stress and
complete their days to flower initiation, pod
initiation and maturity respectively under
rainfed conditions in comparison to irrigated
one. The reason for rapidity is attributed to early
completion of life cycle that acts as an important
strategy to evade drought conditions. This
hypothesis was proved by Ulemale et al (2013)
which demonstrated that yield potential and
early flowering are two major components of
drought escape in lentil and chickpea.
Kabuli and desi genotypes depicted
significant differences in terms of AGDD,
APTU and AHTU at flower initiation, pod
initiation and maturity stages under irrigated
and rainfed conditions. The mean value of
 Johal et al.: Comparative agroclimatic indices of desi and kabuli chickpea genotypes under irrigated and rainfed conditions 79

Table 1. Duration and agroclimatic indices at different phenophases of desi and kabuli chickpea genotypes under
irrigated conditions.
Genotypes Days to flower initiation Days to pod initiation Days to maturity
Desi DAS AGDD APTU AHTU DAS AGDD APTU AHTU DAS AGDD APTU AHTU
GL 12020 93.00ab 944.65cd 9677.46cd 4642.07c 111.00c 1158.98c 12063.15c 6324.32b 144.00abc 1683.95 abc 17916.18abc 10974.37ab
GL 13029 94.50ab 959.18bc 9835.14bc 4754.74abc 112.00bc 1172.98bc 12221.45bc 6426.96b 147.00ab 1752.13 ab 18756.83ab 11364.37a
GL 29078 91.00b 925.80d 9478.38d 4507.56d 115.00abc 1215.08abc 12698.68abc 6800.19ab 146.00abc 1728.80 abc 18468.85abc 11258.68a
GL 29098 95.50a 968.85abc 9941.68abc 4801.11ab 111.50c 1166.18c 12144.68c 6392.45b 144.50abc 1694.65 abc 18047.74abc 11075.47ab
GNG 1581 94.00ab 954.15c 9779.84c 4719.66bc 113.50abc 1194.03abc 12459.95abc 6607.26ab 143.50bc 1672.90 bc 17780.09bc 10873.06ab
PBG 5 95.50a 968.85abc 9941.68abc 4801.11ab 114.00abc 1201.23abc 12541.48abc 6675.39ab 148.50a 1784.73 a 19159.92a 11492.81a
PBG 7 94.50ab 959.18bc 9835.14bc 4754.74abc 115.50abc 1222.20abc 12779.53abc 6860.69ab 143.50bc 1672.90 bc 17780.09bc 10873.06ab
PDG 4 91.00b 925.80d 9478.38d 4507.56d 117.50ab 1250.80ab 13105.20ab 7103.02a 145.00abc 1706.65 abc 18195.70abc 11130.24ab
Kabuli
HK-10-103 97.00a 984.25a 10111.64a 4896.32a 119.00a 1271.13a 13337.45a 7240.71a 142.00c 1639.08c 17364.67c 10524.67b
IPCK-2009-165 96.50a 979.60ab 10060.40ab 4885.02a 115.50abc 1222.20abc 12779.53abc 6860.69ab 146.50abc 1740.13 abc 18608.87abc 11309.60a
BG 3057 95.50a 968.85abc 9941.68abc 4801.11ab 116.00abc 1229.10abc 12857.96abc 6927.97ab 144.50abc 1694.65 abc 18047.74abc 11075.47ab
GNG 2285 93.00ab 944.65cd 9677.46cd 4642.07c 117.50ab 1250.63ab 13103.51ab 7084.23a 147.50ab 1763.23 ab 18893.88ab 11391.50a
Mean 94.25 956.98 9813.24 4726.09 114.83 1212.88 12674.38 6775.32 145.21 1711.15 18251.71 11111.94
Mean values marked with same alphabets are significantly not different
DAS- Days after sowing
(Data pooled for both years)
Table 2. Duration and agroclimatic indices at different phenophases of desi and kabuli chickpea genotypes under
rainfed conditions.
Genotypes Days to flower initiation Days to pod initiation Days to maturity
Desi DAS AGDD APTU AHTU DAS AGDD APTU AHTU DAS AGDD APTU AHTU
GL 12020 86.50a 884.65a 9046.01a 4282.89a 105.00ab 1084.78bcd 11228.97bcd 5615.48bcd 136.50ab 1527.40abc 16326.68ab 9387.35abc
GL 13029 91.50a 930.45a 9527.56a 4549.17a 104.00ab 1072.03cd 11086.58cd 5508.24cd 138.00ab 1556.58a 16538.08a 9653.04a
GL 29078 87.00a 888.90a 9090.43a 4309.67a 104.00ab 1073.35cd 11101.24cd 5496.71cd 136.00ab 1518.70abc 16221.06ab 9293.74abc
GL 29098 91.00a 925.80a 9478.38a 4507.56a 107.00a 1107.78ab 11486.56ab 5853.95ab 137.00ab 1537.10abc 16393.34ab 9475.33abc
GNG 1581 89.00a 907.53a 9285.93a 4402.59a 108.00a 1119.35a 11616.43a 5973.65a 137.00ab 1536.85abc 16394.34ab 9458.70abc
PBG 5 88.00a 898.10a 9186.92a 4348.02a 106.50a 1101.68abc 11418.06abc 5792.50abc 134.50b 1492.30bc 15947.75ab 9036.87bc
PBG 7 91.50a 930.45a 9527.56a 4549.17a 104.00ab 1072.03cd 11086.58cd 5508.24cd 136.50ab 1527.40abc 16326.68ab 9387.35abc
PDG 4 89.50a 912.13a 9334.25a 4422.30a 106.00ab 1096.20abc 11356.69abc 5734.25abcd 138.00ab 1556.58a 16538.08a 9653.04a
Kabuli
HK-10-103 92.00a 935.65a 9582.36a 4566.53a 104.00ab 1072.03cd 11086.58cd 5508.24cd 139.00a 1558.15a 16551.42a 9688.67a
IPCK-2009-165 92.00a 935.65a 9582.36a 4566.53a 106.50a 1101.68abc 11418.06abc 5792.50abc 138.00ab 1542.78ab 16415.52ab 9555.25ab
BG 3057 64.00b 719.68b 7341.52b 3717.42b 102.00b 1063.83d 10995.39d 5469.30d 135.00ab 1501.00abc 16053.38ab 9130.49abc
GNG 2285 91.50a 930.45a 9527.56a 4549.17a 105.50ab 1083.75bcd 11217.66bcd 5616.34bcd 134.00b 1483.60c 15842.43b 8951.70c
Mean 87.79 899.95 9209.24 4397.58 105.21 1087.37 11258.23 5655.78 136.63 1528.20 16295.73 9389.29
Mean values marked with same alphabets are significantly not different at 0.05 level
DAS- Days after sowing
(Data pooled for both years)

increase in agroclimatic indices i.e. AGDD,
APTU and AHTU transcended from days to
flower initiation (1.06, 1.06 and 1.07 folds
respectively) to days to pod initiation (1.11, 1.11
and 1.20 folds respectively) and finally to
maturity (1.12, 1.12 and 1.1.8 folds respectively)
under irrigated conditions in comparison to
rainfed treatment. The accumulation of higher
photothermal and heliothermal units till
vegetative stage directly corresponded to an
increased yield in irrigated conditions against
rainfed treatment. However, under rainfed
condition the earliness in flowering
accumulated lower proportion of photo and
heliothermal units till vegetative stage those
were insufficient to accumulate photosynthates
ultimately leading to a decline in final yield. The
finding is in confirmation with Jain and Sandhu
2018 who revealed that the early sown Brassica
genotypes accumulated more GDD, HTU and
PTU along the cropping period thus showing
significantly higher yield attributes in
comparison to late sown genotypes that were
unable to gather photo-units in the same
duration.
The time interval in terms of AGDD and
grain yield was explored by the heat use
efficiency (Table 3). Among the desi genotypes,
80 Journal of Food Legumes 33(2), 2020

Table 3. Heat use efficiency (HUE) of desi and kabuli correlation was found between AGDD, APTU
chickpea genotypes under rainfed conditions and AHTU with grain yield under rainfed
at maturity.
Genotypes Heat Use Efficiency
conditions. Under high yielding irrigated
Desi IRRIGATED RAINFED conditions agroclimatic indices i.e. AGDD
GL 12020 0.68d 0.59a (P=0.78), APTU (P=0.82) and AHTU (P= 0.77)
GL 13029 0.74c 0.57c pooled directly to the final grain yield.
GL 29078 0.70cd 0.44d
GL 29098 0.29 g 0.21h In conclusion, no significant difference
GNG 1581 0.26h 0.17g was found in desi and kabuli genotypes.
PBG 5 0.39 f 0.35e However irrigated and rainfed treatment
PBG 7 0.29 g 0.27fg depicted significant differences amongst final
PDG 4 0.44e 0.37e
Kabuli
yield (Table 5) and agroclimatic indices at
HK-10-103 0.90a 0.89a different phenophases. Agroclimatic indices i.e.
IPCK-2009-165 0.29 g 0.20h AGDD, APTU and AHTU pooled their share
BG 3057 0.81 b 0.70b in enhancing final grain yield under irrigated
GNG 2285 0.39 f 0.33ef
conditions in both desi and kabuli genotypes.
Mean 0.57 0.39
Mean values marked with same alphabets are significantly not Table 5. Yield (Kg/ha) of desi and kabuli chickpea
different genotypes under rainfed and irrigated
(Data pooled for both years) conditions.
Genotypes Yield (kg/ha)
GL 29078 and GNG 1581 and kabuli genotype Desi IRRIGATED RAINFED
IPCK-2009-165 depicted maximum percent GL 12020 1148.68 907.57
GL 13029 1302.29 881.32
decline of 37.17 and 34.62 under rainfed GL 29078 1207.50 666.46
conditions, highlighting the importance of GL 29098 487.08 325.21
growing degree days and accumulating higher GNG 1581 489.24 399.58
quantity of accumulated photo and PBG 5 700.00 525.49
PBG 7 456.46 438.47
heliothermal units. Desi and kabuli genotypes
PDG 4 749.10 568.75
PBG 7 and IPCK-2009-165 respectively Kabuli
displayed low influence of AGDD on the final HK-10-103 1471.46 1391.25
yield by recording only 6.90 and 0.54% decrease IPCK-2009-165 505.07 315.49
in HUE under rainfed conditions. C. judaicum BG 3057 1374.72 1056.32
GNG 2285 695.63 493.89
212 a rainfed resistant wild chickpea cultivar
Mean 865.60 664.15
also maintained high HUE under rainfed
Source of Variation SS df MS F P-value F crit.
conditions on account of prolonged life cycle
Genotypes 2896711.81 11 263337.44 17.71 0.00* 2.82
(Johal et al. 2018). Treatments 243498.77 1 243498.77 16.37 0.00* 4.84
Error 163608.736 11 14873.52
Correlation coefficient and path analysis Total 3303819.32 23
Path coefficient analysis was carried out ANOVA table for above data
*p < 0.05 level, Significant difference in yield between genotypes
between agroclimatic indices and grain yield under rainfed and irrigated conditions.
at maturity (Table 4). A non-significant
ACKNOWLEDGEMENT
Table 4. Path coefficient analysis depicting the direct
effects of accumulated growing degree days at The authors duly acknowledge financial
maturity (AGDDM), accumulated photothermal assistance provided by the UGC (Maulana
units at maturity (APTUM), accumulated helio- Azad National Fellowship).
thermal units at maturity(AHTUM) on grain
yield (GY) under irrigated and rainfed
conditions.
REFERENCES
IRRIGATED RAINFED Aggarwal N, Singh A and Singh S P. 2016. Heat
Grain yield AGDD APTU AHTU AGDD APTU AHTU utilization and radiation interception in
P 0.78* 0.82* 0.77* 0.21 0.21 0.13 transplanted rice (Oryza sativa L.) in relation to
r 0.089 0.072 0.092 -0.38 -0.38 -0.46
seedling stage. Journal of Agrometeroogy 18(1):
*Significant at 0.05 level. 93-96.
 Johal et al.: Comparative agroclimatic indices of desi and kabuli chickpea genotypes under irrigated and rainfed conditions
Ahsan M S, Kumar M, Upadhyay J P, Hussain M A,
Gupta P K and Singh A. 2018. Effect of different
doses of Trichoderma harzianum and fungicides for
the management of collar rot of chickpea caused
by Sclerotium rolfsii. International Journal of Pure
and Applied Bioscience 6: 1656-1660.
Dewey D R and Lu K H. 1959. A correlation and path
coefficient analysis of components crested wheat
grass and seed production. Agronomy Journal 52:
515–518.
Jain G and Sandhu S K. 2018. Agroclimatic indices
and yield of mustard under different thermal
regimes. Journal of Agricultural Physics 18: 232-
239.
Johal N, Kaur J and Singh S. 2018. Phenophasic
development of wild Cicer species in relation to
agroclimatic indices under rainfed and irrigated
conditions. Journal of Agrometeroogy 20: 293-296.
Kashiwagi J, Krishnamurthy L, Purushothaman R,
Upadhyaya HD, Gaur PM, Gowda C L L, Ito O,
Varshney RK (2015) Scope for improvement of yield
under drought through
Nuttonson MY. 1957. Wheat climatic relationship and
use of phenology in ascertaining the thermal and
photothermal requirements of wheat. Soil Science
83(2): 39-40.
Olivera M, Castro C, Coutinho J and Trindade H. 2019.
N supply and pre-cropping benefits to triticale from
three legumes in rainfed and irrigated
Mediterranean crop rotations. Field Crop Research
237: 32-42.
Qiao-yan L I, Jun Y I N, Liu W, Zhou M, Lei L I, Niu
J, Niu H and Ying M A. 2012. Determination of
optimum growing degree days (GDD) range before
winter for wheat cultivars with different growth
characteristics in North China Plain. Journal of
Integrative Agriculture 11: 405–415.
81
Roberts EH, Hadley P and Summerfield RJ. 1985.
Effects of temperature and photoperiod on
flowering in chickpeas (Cicer arietinum L.). Annals
of Botany 55: 881–892.
Solanki NS and Mundra SL. 2015. Phenology and
productivity of mustard (Brassica juncea L.) under
varying sowing environments and irrigation levels.
Annals of Agricultural Research 36: 312-317.
Singh G, Narwal SS, Rao VUM and Dhaiya DS. 1990.
Effects of sowing date on requirement of growing
degree days, heliothermal units and photothermal
units and phenology of winter maize (Zea mays).
Indian Journal of Agricultural Sciences 60: 723-
731.
Thudi M, Upadhyaya H D, Rathore A, Gaur P M,
Krishnamurthy L, Roorkiwal M,  Nayak S
N, Chaturvedi S K, Basu P S, Gangarao N V, Fikre
A, Kimurto P, Sharma P C, Sheshashayee M
S, Tobita S, Kashiwagi J, Ito O, Killian A
and Varshney R K. 2017. Genetic dissection of
drought and heat tolerance in Chickpea through
genome-wide and candidate gene-based
association mapping approaches. PLoS ONE
9:e96758.
Ulemale C S, Mate S N and Deshmukh D V. 2013.
Physiological indices for drought tolerance in
chickpea. World Journal of Agricultural Science 9:
123-131.
Vanaja M, Yadav S, Maheswari M and Srinivasarao
C. 2017. Increasing atmospheric carbon dioxide
and Temperature—Threats and opportunities for
rainfed agriculture. In V. Belavadi (Ed.), Agriculture
under climate change: Threats, strategies, and
policies (pp. 84- 90) Allied Publishers.
Wragg CB, Maxwell N S and Doust J H. 2000.
Evaluation of the reliability and validity of a soccer-
specific field test of repeated sprint ability.
European Journal of Applied Physiology 83 (1): 77–
83.
 Journal of Food Legumes 33(2): 82-92, 2020

Understanding molecular divergence and population structure of

parental lines of CMS hybrids in pigeonpea
KISHAN PATEL1,2, KAREN P PACHCHIGAR3, RACHIT K SAXENA1,
RAJEEV K VARSHNEY1 and ABHISHEK BOHRA4,*

ABSTRACT
1
Center of Excellence in Genomics Pigeonpea is an important food legume crop providing significant protein
& Systems Biology, International and nutrients to the human diet in less-developed regions of Asia and
Crops Research Institute for the
Africa. CMS-based hybrid technology has been established in pigeonpea
Semi-Arid Tropics (ICRISAT),
Telangana, India to impart yield stability and resilience in pigeonpea. Understanding the
2
Department of Biotechnology, genetic relationships between parental lines is a key to find the cross
Hemchandracharya North Gujarat combinations that offer increased level of heterosis. In the present study,
University, Gujarat, India
3 we used 35 simple sequence repeat (SSR) markers to screen 75 pigeonpea
Department of Biotechnology,
College of Basic Science & genotypes including A, B and R lines, and inferred genetic diversity and
Humanities, Sardarkrushinagar population structure. Phylogenetic analysis suggested strong convergent
Dantiwada Agricultural University, pattern of evolution among the lines. Our results indicate presence of
Gujarat, India
4 moderate genetic diversity in the panel. Population structure and
Crop Improvement Division,
ICAR-Indian Institute of Pulses principal coordinate analysis (PCoA) confirmed existence of two distinct
Research (IIPR), Uttar Pradesh, India subpopulations. Furthermore, analysis of molecular variance (AMOVA)
accounted for 4% variance among and 96% variance within
E-mail: abhi.omics@gmail.com
subpopulations, implying towards a high rate of gene exchange (or low
Received: 03 June 2020
Accepted: 08 July 2020 genetic differentiation) between the two subpopulations. These ûndings
provide a preliminary molecular framework to enable discovery of
Handling Editors: optimal hybrid combinations to enable improved hybrid vigour in
Dr. Pawan Kulwal, Mahatma Phule
pigeonpea.
Agricultural University, Rahuri,
Maharashtra, MS, INDIA
Dr. Shailendra Sharma, Ch. Charan Key words: Genetic diversity, Pigeonpea, Polymorphism, Population
Singh University, Meerut, UP, India structure, Simple sequence repeat

INTRODUCTION (Bohra et al. 2020), the pigeonpea hybrids have

also shown higher tolerance to biotic and
Pigeonpea [Cajanus cajan (L.) Millsp.] is an
abiotic stresses such as Fusarium wilt, sterility
important grain legume crop of the semi-arid
mosaic disease, water logging etc. (Saxena et
tropical regions. Despite breeding a number of
al. 2010a). It is, therefore, anticipated that the
high-yielding cultivars, the productivity of
area under pigeonpea hybrids will increase
pigeonpea has remained stagnant at around
substantially in the near future and will
780 kg/ha for the last five decades (http://
contribute towards increasing the crop
faostat.fao.org/). To boost productivity gains
production. However, this is possible only
in pigeonpea, hybrid breeding technology based
when the hybrid breeding system is versatile
cytoplasmic-nuclear male-sterility (CMS)
and is adapted to different agro-ecological
system has been implemented in pigeonpea
zones and cropping systems (Kumar et al. 2016).
(Bohra et al. 2016, 2020; Saxena et al. 2013). A
robust hybrid breeding system requires stable Understanding patterns of genetic and
CMS or A line and restorer line (R), and phenotypic diversity on parental lines is crucial
maintainer (B) line for maintaining male sterility for better exploitation of heterosis and to
of the CMS line and hybrid development. enhance the adaptation of hybrids to different
Besides offering yield advantage of up to 45% regions. Prior selection of crossing parents on
 Patel et al.: Understanding molecular divergence and population structure of parental lines of CMS hybrids in pigeonpea 83

the basis of genetic divergence instead of
evaluating F 1, F 2 , and advanced generations
may help breeders to better allocate available
resources to the most promising combinations
(Saxena and Sawargaonkar, 2014). Based on
molecular markers assays, genetic distance and
degree of heterosis have been estimated in
several crop species such as rice (Khush 2005),
maize (Springer and Stupar, 2007), sorghum
(Menz et al. 2004), etc. Availability of pigeonpea
genome has enriched the understanding of
pigeonpea genetics and their gene pool that
served as a resource for molecular marker
discovery and diversity studies (Varshney et al.
2012).
Among the various marker systems
established in pigeonpea, simple sequence
repeat (SSR) markers remained the most
extensively used for genetic diversity studies
(Gupta and Varshney, 2000; Bohra et al. 2017).
Estimation of genetic diversity in parental lines
with newly discovered marker could be useful
for selecting diverse parental genotypes that
may enhance hybrid vigour (Bohra et al. 2015;
Saxena et al. 2010b). In this context, the co-
dominant nature of SSR markers makes them
particularly suitable for assessing genetic
diversity and purity of parental lines and
corresponding hybrids. The present study was
undertaken with the following objectives: (1)
molecular characterization of parental (A, B,
and R) lines of selected pigeonpea hybrids, and
(2) elucidation of genetic relationships among
A, B, and R lines.
MATERIALS AND METHODS
Plant material: A total of 75 parental
genotypes including 55 restorer (R)-lines, 10 A-
lines and cognate B-lines were selected for the
present study. These lines are being maintained
at ICRISAT, India (Table 1).
SSR analysis: Genomic DNA was isolated and
purified from 1-2-week-old seedlings using 0.5-
1.0 g fresh leaves following standard CTAB
(Cetyl trimethyl ammonium bromide) method
with slight modification (Patel et al. 2010). The

Table 1. List of the 75 pigeonpea genotypes used for diversity analysis

S. Name of the Description S. Name of the Description S. No. Name of the Description
No. genotype No. genotype genotype
1 ICPA 2039 CMS line 26 ICPL 131 Restorer line 51 ICPL 20205 Restorer line
2 ICPB 2039 Maintainer line 27 ICPL 20058 Restorer line 52 ICPL 20236 Restorer line
3 ICPA 2048 CMS line 28 ICPL 20093 Restorer line 53 ICPL 20237 Restorer line
4 ICPB 2048 Maintainer line 29 ICPL 20094 Restorer line 54 ICPL 20238 Restorer line
5 ICPA 2156 CMS line 30 ICPL 20095 Restorer line 55 ICPL 20241 Restorer line
6 ICPB 2156 Maintainer line 31 ICPL 20096 Restorer line 56 ICPL 20242 Restorer line
7 ICPA 2043-11 CMS line 32 ICPL 20097 Restorer line 57 ICPL 20243 Restorer line
8 ICPB 2043-11 Maintainer line 33 ICPL 20098 Restorer line 58 ICPL 20244 Restorer line
9 ICPA 2047-24 CMS line 34 ICPL 20099 Restorer line 59 ICPL 332 Restorer line
10 ICPB 2047-24 Maintainer line 35 ICPL 20100 Restorer line 60 ICPL 83057 Restorer line
11 ICPA 2078 CMS line 36 ICPL 20101 Restorer line 61 ICPL 85063 Restorer line
12 ICPB 2078 Maintainer line 37 ICPL 20102 Restorer line 62 ICPL 87051 Restorer line
11 ICPA 2092 CMS line 38 ICPL 20103 Restorer line 63 ICPL 96053 Restorer line
12 ICPB 2092 Maintainer line 39 ICPL 20104 Restorer line 64 ICPL 96058 Restorer line
15 ICPA 2189 CMS line 40 ICPL 20105 Restorer line 65 ICPL 96061 Restorer line
16 ICPB 2189 Maintainer line 41 ICPL 20108 Restorer line 66 ICPL 94062 Restorer line
17 ICPA 2198 CMS line 42 ICPL 20116 Restorer line 67 ICPL 99004 Restorer line
18 ICPB 2198 Maintainer line 43 ICPL 20137 Restorer line 68 ICPL 99044 Restorer line
19 ABRG 1 CMS line 44 ICPL 20139 Restorer line 69 ICPL 99046 Restorer line
20 BBRG 1 Maintainer line 45 ICPL 20177 Restorer line 70 ICPL 99048 Restorer line
21 ICP 1514-1-1 Restorer line 46 ICPL 20186 Restorer line 71 ICPL 99051 Restorer line
22 ICP 1571 Restorer line 47 ICPL 20187 Restorer line 72 ICPL 99054 Restorer line
23 ICP 1575 Restorer line 48 ICPL 20188 Restorer line 73 ICPL 99055 Restorer line
24 ICP 1940 Restorer line 49 ICPL 20201 Restorer line 74 ICPL 99061 Restorer line
25 ICP 1941 Restorer line 50 ICPL 20202 Restorer line 75 ICPL 99050 Restorer line
84 Journal of Food Legumes 33(2), 2020

yield of genomic DNA per gram of leaf tissue agarose gel to check the quality.
extracted was measured using a nano-drop For molecular characterization of parental
spectrophotometer. The purity of DNA was lines of hybrids, a total of 35 unlabelled primer
determined by calculating the ratio of pairs were used (Table 2). Bohra et al. (2012)
absorbance at 260nm and 280nm. DNA constructed a consensus genetic linkage map
samples were electrophoresed on a 0.8% from six different mapping populations and the
Table 2. List of SSR markers used in the present study
S Marker SSR Motif Forward primer (5'-3') Reverse primer (5'-3') Product
No. name size
(bp)
1 CcM0021 (TTA)10 TGAATGTTTTCCAGGATTTTACA GCGCAAATATAAGAGCCCAG 280
2 CcM0121 (TA)17 AGAAATTGGAGGCTTGGTCA GGTATAAGGCTCAAACCCGA 273
3 CcM0133 (TA)9 GTTGTCCCATTTTGACCTCC CCATAATCCAATCCAAATCCA 176
4 CcM0195 (AT)11 CAACAATAAAGCATAAACCACCA TGACGTAGATTGGGTAGTTAGGA 223
5 CcM0207 (TA)15 TTTTGGCGGTCATTTTAACC TTAGTCGGGAGCAACACTGA 235
6 CcM0252 (AT)23 CATAGAAGCCCACCTTCCAA CTGCATGCAAAACGAAGAAG 234
7 CcM0257 (AG)7(TG)15 GCCGTTACGAGGGTAATGAA CTGTCTCAAAGGGACCCTGA 241
8 CcM0361 (TA)9 TCTTCCTGTCCTCATCCTCG TGGAAACCAAAGTTGTGCAT 172
9 CcM0374 (TA)11 GAACCGTCTTAAAATTTCTCATTT CAATGGCACATTGTCAAAAA 161
10 CcM0444 (TA)7 TGTCATGAGTGGCTGATCCT TCAACCAAAATCCAAACCAA 184
11 CcM0484 (T)12n(ATT) TGGAAATTAAACACCATGAAACA TGCATGCTACCAAGGAATTG 248
5n(AT)5
12 CcM0492 (AT)21 AAAATTTACGAGCACTAAAATGAAAAA TCAACAATAAATTGTCATATGTCTGG 271
13 CcM0494 (AT)21 ACGTGAAAAATCCGCAACTT GCTTGTGTTTCAAAATCCAACTT 117
14 CcM0594 (GA)9n(TC)9 GGCTTGGTTCTTTCTTGGTG AAGTCCCTGACTTTCCCCAT 185
15 CcM0673 (AT)6(AG)9 TGACCACCAACCATTACCAA CATGCACCAGACCAGAATCA 272
16 CcM0698 (AAT)17 CTCTTCTTGTTGTCCCTCGC GCAGTTCTGGAATACCTCGC 188
17 CcM0721 (AT)19 ATCCAACCACGTGTTTCACA TTTGAAATGGTATCGATGATTAAA 169
18 CcM0785 (AT)9 GCATGTGTTTTTACTTGAGTCGTC TGGAGGCGATCTCTTTCTTG 277
19 CcM0831 (TC)6 GAATACTCAAGCTTCTCCCCA AAGGAAACAACAATGGTGGC 227
20 CcM0834 (AT)10 GTCCGGCTTGCCTATAAGGT AAGGCAACCTCCCCAGTATT 262
21 CcM0956 (AT)16 AGCCCCAACTCAATTATCAAA TTCCTTGCGGTTTGAGCTAT 224
22 CcM0970 (TA)16 TTAAAATCACATCTTACGAAACATAAA AGGACATACGTTCCAAAATTGA 187
23 CcM1045 (AT)6 AACCTTAGTTGGTGATAGATTTCAGA ACCGTCAAGTCCCAAATCAC 262
24 CcM1251 (CCA)9 CAAATGGCAGAACAGAGCAG CGGAGATTGCATTGTTCCTT 228
25 CcM1357 (AT)15n(ATA)5 TCTAGCATCTCCATTAAACCATTT ACACATATGACATTTAGCAAATAAAAA 280
26 CcM1982 (TC)17 TATCAAACCTGGCGATCACA ATTCCGCAAACACATCACAA 246
27 CcM2004 (CT)7n(AG)12 AGGAATGCGACATTTTGGAG TCCCCATCCCTTTCTTTCTT 209
28 CcM2044 (TAT)9 ATCACTCCAAGCACCCAAAC TGCAAATGGAAGGGAATAGC 212
29 CcM2049 (TAT)9 GCGACCAGGTACTTTCAAGC CGAAAAGCGATTTCAGAATTT 260
30 CcM2097 (CT)12 TGATAGGAATATTTCGGCGG CCTTTGAAATTGAAGGCGAG 193
31 CcM2379 (TC)10 CCGGAAAAATTGCCTATTGA TTCGATGACAGAATTTAGGTGC 151
32 CcM2394 (TC)12 TGGAAACGATTTCCTACCACA ACAAGGGGAAAAGGGAAAGA 260
33 CcM2505 (GGA)8 CCTCGGAAGAGATTGCAGTT TGATGAATTGGGAAGCAACA 201
34 CcM2697 (CT)(9n(T)14 AGAGTTCGGTGACGGTTACG GATCTGTCGAGGTTGAGGCT 242
35 CcM2704 (AT)10 AAAAATGTTCAATGTCGTAGTATTTGA TGCCATATATCATGCCCTCA 127
 Patel et al.: Understanding molecular divergence and population structure of parental lines of CMS hybrids in pigeonpea
resulting genetic linkage map provides map
locations to several of these CcM markers. PCRs
were performed in a 5 µl reaction volume [0.5
µl of 10 X PCR buffer, 0.3 µl of 25 mM MgCl2,
0.5 µl of 2 mM dNTPs, 0.15 µl of 10 pM primer
(MWG-Biotech AG, Bangalore, India), 0.3 U of
Taq polymerase (Bioline, London, UK), and 1.0
µl (5 ng) of template DNA] in 96-well micro-
titre plate (AB-gene, Rockford, Illinois, USA)
using thermal cycler Gene-Amp PCR System
9700 (Applied Bio-systems, Foster City,
California, USA). A touch-down PCR
programme was used to amplify the DNA
fragments. An initial denaturation for 3 min at
95ºC was used. This was followed by initial 10
cycles of denaturation for 20 s at 94ºC,
annealing for 20 s at 55ºC (the annealing
temperature for each cycle being reduced by
1ºC per cycle), and extension for 30 s at 72ºC.
Subsequently, 35 cycles of denaturation for 20
s at 94ºC, annealing for 20 s at 48ºC, and
extension for 30 s at 72ºC were used, followed
by 20 min final extension at 72ºC.
Electrophoresis of PCR products: For genetic
diversity assessment experiments, the
amplification products obtained by using
fluorescent dye-labelled primer pairs, together
with Liz Gene Scan-500 labelled internal size
standards, were analysed on 36-cm capillaries
with POP7 polymer on ABI 3130 Genetic
Analyzer. Fragment analysis data were
collected by the data collection software and
pre-processed by Gene-Scan software version
3.7 (Applied Bio-systems, Foster City,
California, USA). Gene-Scan data were
imported, converted to pseudogel images, and
further analysed by Genotyper software version
3.7 (Applied Bio-systems, Foster City,
California, USA).
Allelic data scoring and analysis: For all 35 SSR
markers, allelic data were recorded with
GeneMapper ver. 3.2. For understanding
relationships among parental lines of hybrids,
allelic data thus obtained were used to prepare
a dissimilarity matrix and to construct a two-
dimensional (2D) plot using the factorial
analysis method with DARWIN ver. 6.0.13
(Perrier and Jacquemoud-Collet 2006). The PIC
value of each SSR marker was calculated using
the following formula.
85
where, n is the total number of alleles
detected for a given marker locus and Pi is the
frequency of the ith allele in the lines analysed.
Further, heterozygosity index (H), effective
marker ratio (EMR), marker index (MI) and
resolution power (RP) were calculated using R
based shiny app iMEC (marker efficiency
calculator) with default settings and
parameters.
Analysis of population structure: SSR data of
all 75 parental lines of pigeonpea was analyzed
with STRUCTURE ver. 2.3.4 to infer genetic
structure (Pitchard et al. 2003). Structure
analysis was carried out with initial assumption
of K=1 to 10 with default admixture model and
simulation was performed with MCMC
replication N=50000, burnin period n=10000
and 20 iteration for better optimization and
inferring population structure. Further, result
was noted for output Q-Matrix and other data
was analysed for finding optimum population
number (K) using popular Evano’s algorithm
with ÄK and L(K) study.
Population genetics and marker heritability
analysis: SSR data were also used for inferring
population nature using MS Excel’s add-in
GenAlex ver. 6.5 (Peakall and Smouse 2012).
Parameters like overall GST, Hardy Weinberg
Equilibrium, AMOVA, PCoA, Nei’s genetic
distance and others were done to understand
and infer basic population tendency with over
all marker loci under study.
RESULTS AND DISCUSSION
Estimation of the genetic diversity among
the parental lines has been a long-standing goal
of hybrid breeding programs in plants.
Furthermore, the analysis of genetic variation
among breeding materials is of key interest to
plant breeders, as it contributes greatly to
selection, germplasm management, and also to
prediction of potential genetic gains (Bohra et
al. 2017). Limitations of morphological
characterization, including difficulties
concerning the definition and validation of
86 Journal of Food Legumes 33(2), 2020

neutral traits, experimental costs, and Table 3. Summary of polymorphic information content
evaluation time and genotype × environment (PIC), effective marker ratio (EMR), marker
index (MI) and resolution power (RP) of SSR
interaction are widely discussed in germplasm markers analyzed
characterization studies (Varshney, 2016). In
Name of N* Np* PIC EMR MI RP
this context, molecular markers owing to their
marker
independence from environmental factors and
CcM0021 130 5 0.646 0.19 0.12 2.7
abundance in genome have proven powerful CcM0121 130 9 0.782 0.62 0.49 2.6
tools for establishment of genetic relationships CcM0133 130 5 0.580 0.19 0.11 2.3
among different genotypes (Varshney et al. CcM0195 130 6 0.683 0.28 0.19 2.3
2012). However, microsatellite or SSR markers CcM0207 130 8 0.789 0.49 0.39 3.3
are preferred molecular markers for studying CcM0252 130 14 0.861 1.51 1.30 2.3
genetic variation in many plant species due to CcM0257 130 7 0.739 0.38 0.28 2.4
their co-dominance, multi-allelic nature, ease- CcM0361 130 3 0.367 0.07 0.03 2.2
to-use and reproducibility of assays (Gupta and CcM0374 130 7 0.704 0.38 0.27 2.4
Varshney 2000, Bohra et al. 2011). CcM0444 130 4 0.507 0.12 0.06 2.3
CcM0484 130 2 0.318 0.03 0.01 2.2
In the present study, 35 SSRs covering CcM0492 130 8 0.841 0.49 0.41 2.3
entire 11 linkage groups of pigeonpea were CcM0494 130 12 0.876 1.11 0.97 2.7
used to assess the genetic diversity among 75 CcM0594 130 4 0.236 0.12 0.03 2.2
pigeonpea genotypes that represent parental CcM0673 130 6 0.569 0.28 0.16 2.4
lines of different CMS hybrids. Selecting DNA CcM0698 130 9 0.661 0.62 0.41 2.4
markers with known genomic positions instead CcM0721 130 7 0.759 0.38 0.29 2.2
of a random sample offers greater opportunities CcM0785 130 2 0.378 0.03 0.01 2.2
for an unbiased representation of the genome, CcM0831 130 10 0.845 0.77 0.65 2.3
which could otherwise lead to inaccurate CcM0834 130 3 0.425 0.07 0.03 4.1
CcM0956 130 8 0.814 0.49 0.40 1.9
estimation of genetic similarities among
CcM0970 130 7 0.686 0.38 0.26 2.2
genotypes (Varshney et al. 2013).
CcM1045 130 2 0.497 0.03 0.02 2.5
The present study reveals higher level of CcM1251 130 4 0.345 0.12 0.04 2.2
allelic diversity among the pigeonpea lines CcM1357 130 7 0.768 0.38 0.29 2.5
considered. Concerning the SSR motifs, 22 of CcM1982 130 5 0.651 0.19 0.13 3.6
the 35 SSRs had di-nucleotide repeats, whereas CcM2004 130 2 0.221 0.03 0.01 2.3
six and seven were of tri-nucleotide and CcM2044 130 3 0.623 0.07 0.04 2.9
compound type, respectively. The amplicons CcM2049 130 2 0.410 0.03 0.01 2.3
CcM2097 130 4 0.553 0.12 0.07 2.6
generated by the SSRs were found to be in the
CcM2379 130 3 0.460 0.07 0.03 2.1
range of 117–280 bp. Our observation that the
CcM2394 130 4 0.388 0.12 0.05 2.3
maximum number of alleles are shown by SSRs CcM2505 130 3 0.336 0.07 0.02 2.3
with tri nucleotide repeat motifs remains in CcM2697 130 4 0.691 0.12 0.09 2.4
agreement with an earlier report by Poncet et CcM2704 130 15 0.618 1.73 1.07 2.3
al. (2006). Average 130 5.8 0.589 0.35 0.25 2.5
DNA polymorphism among parental lines: A marker utility, the effective marker ratio (EMR)
total of 130 alleles were obtained following is of great significance (Varshney et al. 2007).
analysis of 75 lines with 35 SSRs. The majority We reported EMR values from 0.03 (CcM2004,
of the SSRs (6) amplified four alleles, while CcM0484, CcM0785, CcM1045 and CcM2049)
maximum alleles were obtained for two to 1.73 (CcM2704) in the current SSR dataset.
markers viz. CcM0252 (14) and CcM2704 (15). Marker index (MI) aids for selection of marker
The PIC values calculated for these 35 at over all genotypes, we calculated MI from
polymorphic markers ranged from 0.22 0.01 (CcM 0484, CcM0785, CcM 2004,
(CcM2004) to 0.87 (CcM0494), with an average CcM2049) to 1.30 (CcM0252). Concerning
of 0.59 (Table 3). resolving power (RP), we found values between
Of the various parameters used to estimate 1.9 (CcM0956) to 4.1 (CcM0834). Among all
 Patel et al.: Understanding molecular divergence and population structure of parental lines of CMS hybrids in pigeonpea 87

SSRs, CcM0494 found to be the most potent

marker, with EMR, MI, RP values of 1.11, 0.97
and 2.7, respectively (Table 3). A consistent
increase was observed in MI with respect to PIC
at all loci except CcM0121, CcM0361,
CcM0594, CcM0673, CcM0698, CcM1045,
CcM1251, CcM2044, CcM2049, CcM2394,
CcM2697 and CcM2704 (Table 3).
Phylogenetic relationship among pigeonpea
parental lines and their population:
Phylogenetic relationship is basis for inferring
evolutionary tract of population and hallmarks
for their cladistic relationship with and
amongst various wild and domestic
populations of same crop and their respective
cultivars (Budak et al. 2004). A variety of
phylogenetic analysis methods and models
were proposed by various researchers for
studying molecular phylogeny in various crop.
UPGMA method for revealing multiple variant
analysis for clustering is the most popular and
in our case we found the analysis to classify
entire population into two clusters (Fig. 1),
where cluster 1 had most genotypes from A
lines with mixture of R and B lines. Shared Fig. 1. The UPGMA phylogenetic tree based on genetic
ancestry among the studied genotypes may be distance matrix representing the grouping of
a possible reason for this pattern of clustering. pigeonpea genotypes. CMS lines, B lines and R lines
are shown with green, blue and orange colours,
In Fig. 2, a principal coordinate analysis respectively.
(PCoA) plot depicts a scattered distribution of
genotypes across all the axes, and the trend (0.981), ICPA 2043-11 (0.979), ICPB 2043-11,
shows similarity to topology obtained with tree ICPB 2092 and ICP 1571 (0.979) showed values
distribution. greater than 0.95, indicating pure line nature
Understanding population structure of the of respective parental lines. However no
parental panel: Bayesian-based STRUCTURE parental lines in our study could show 100%
program is extremely popular among purity, which may be attributed to varying
researchers for inferring population structure. degree of controlled self-pollination of the lines.
As elucidated in Fig. 3, entire 75 lines were Further analysis of genetic divergence
clustered through admixture model using K=1 based on phylogenetic study strongly concurred
to 10, which clearly suggests admixture nature with the patterns inferred from STRUCTURE
of few lines (i.e. level of admixture consider as analysis. We employed Bayesian study on 75
standard < 70% or 0.7). lines using 10000 burn in period for 50000
Among the genotypes analysed, ICPL 131 number of MCMC based simulation and found
was found to show maximum divergence while out mean score for alpha=0.3416, Fst1=0.3067
maximum admixture was reported with ICPL and Fst2=0.0010 indicating perfect relationship
20243 (0.489). The average distance between for simulated data with support to admixture
individuals ranged from 0.46 to 0.63 as nature of population as alpha is not equal to 1
elucidated at K=2. Parental lines ICPL and value of Fst near to zero indicating partial
131(0.986), ICPB 2047-24 (0.984), ICPL 332 inbreeding among population studied. In
(0.983), ICPL 83057 (0.982), ICPA 2047-24 additions to this, as shown in graph for iterative
88 Journal of Food Legumes 33(2), 2020

study vs alpha value, graph remain

steady with trends for overall alpha
value indicating support of simulation
to alpha value over whole range and
its sturdiness for determined K value of
population. Our findings were
supported by previous work done by
(Kassa et al. 2012), where authors
studied accessions from all gene pools
of pigeonpea using SNP markers. The
authors reported range of population
number from K=2 to 5.

Population genetic divergence and

allelic inheritance profiling:
A, B and R lines were analysed for
their population F statistics, AMOVA,
Hardy-Weinberg equilibrium, Genetic
distance and diversity between and Fig. 2. Principal coordinates analysis (PCoA) based on genetic
within population etc. Further, distance showing two clustered subpopulations. CMS lines, B lines
and R lines are shown with red, green and blue colours,
genotypes were clustered based on respectively.
principle coordinate analysis (PCoA) as
per their eigen score for principal two axes (Fig.
that remain unique to a single population) in
2). As shown in Table 4, the effective allele
all populations implied that all alleles existing
number (Ne) averaged around 3.0 for overall
in overall population were shared with each
population, while number of allele (Na) has
other (Fig. 4). Shannon diversity index (Sh) is
remained 3.0 for both A & B lines and ~ 5.5 for
an important indicator of available biological
R lines, indicating more than two alleles and
diversity in the population (Allen et al. 2009).
their admixture could be responsible for
We reported Sh values of 1.077, 1.071 and
population origin and during their course of
1.153 for A, B and R populations, respectively,
evolution. We found expected heterozygosity
observation that remains in harmony with
(He) of population approaching to ~ 0.03 for
findings by previous researchers (Green et al.
all three populations, suggesting minimum
2004). We reported average scaled diversity (D’)
genetic variability among populations.
and weighted diversity of 0.095 and 1.686,
Lower frequency of private alleles (alleles respectively for overall population. Sh index is

Table 4. Heterozygosity, polymorphism and population statistics for pigeonpea parental lines
Population Na Na Freq. >= Ne I No. Private Ho He UHe F
5% Alleles
A 3.829 3.829 2.929 1.077 0.143 0.128 0.578 0.611 0.777
B 3.914 3.914 2.906 1.071 0.057 0.133 0.568 0.599 0.710
R 5.543 3.657 3.009 1.153 1.629 0.232 0.578 0.584 0.579
Mean 4.429 3.800 2.948 1.100 0.610 0.164 0.575 0.598 0.689
Na = No. of Different Alleles;
Na (Freq >= 5%) = No. of Different Alleles with a Frequency >= 5%;
Ne = No. of Effective Alleles
I = Shannon’s Information Index
Private Alleles = Alleles unique to a single population
Ho: Observed heterozygosity
He = Expected Heterozygosity
uHe = Unbiased Expected Heterozygosity
 Patel et al.: Understanding molecular divergence and population structure of parental lines of CMS hybrids in pigeonpea 89

Table 5. Results of AMOVA within and among populations of 75 pigeonpea lines

Source df SS MS Est. Var. %
Among Pops 2 347549.167 173774.584 2181.483 4%
Among Individuals 72 7485634.073 103967.140 51898.397 96%
Within Individuals 75 12776.000 170.347 170.347 0%
Total 149 7845959.240 54250.226 100%
Rst 0.040
Nm 5.967

mutation rate of SSR marker

and also due to high
heterozygosity among sub
population as mean unbiased
heterozygosity was found to
be 0.5979 for all population.
AMOVA accounted for
96% variance within
population, while remaining
4% was attributed to among
populations (Table 5).
Migration of alleles and their
balance in population
determines allelic richness
and cardinal nature of any
population. The HWE
analysis revealed that all 35
SSRs showed significant
Fig. 3. Structure based analysis of pigeon pea genotype, where (A) Delta K difference for population R
(“K) for different number of subpopulations (K) from 2 to 5, with optimum and majority of lines in A &
k=2 and (B) overall population of 75 genotype, showing distribution of B groups (Table 6). Four loci
admixture distribution in two type pop 1 (Red) and Pop 2 (Green).
viz. CcM0252, CcM0374,
considered to be imperative for ecological CcM1357 and CcM2697 exhibited significant
survey, with recent body of research difference in distribution in all three
demonstrating quasi-evenness index with “no populations. Genetic distance among
direct biological meaningfulness”. population can be retrieved by many different
criterions like Rogers distance, Jaccard distance,
Among populations overall scaled
Kimura, Nei genetic distance (Nei). Our
diversity (D’) was 0.104 (at P >= 0.360) and
population A, B & R found to be 0.048 (A & B),
Shannon diversity index was 0.057, while
within population values of D’ and Sh were
0.688 and 1.133, respectively (at P>=0.641).
Similar trend was reflected in our STRUCTURE
analysis. Earlier, Meirmans and Hedrick (2011)
suggested that it is necessary to adequate
correction of G statistic with Nei distance, so
we incorporate that, and we found
comprehensive genetic differentiation statistics
analog of Fst (i.e. Gst) for overall loci and it marks
to G st =-0.015, G’stN=-0.023, G’stH=-0.053,
G’’st=-0.061 and Dest=-0.037. Here, negative Fig. 4. Allelic pattern distribution of over population
of pigeonpea
value for overall result could be due to high
90 Journal of Food Legumes 33(2), 2020

Table 6. Summary of Chi-square tests for Hardy-Weinberg equilibrium of 75 genotypes

A B R
Marker Name CHISQ SIG Marker Name CHISQ SIG Marker Name CHISQ SIG
CcM0252 50.000 *** CcM0252 50.000 *** CcM0252 455.133 ***
CcM1982 40.000 *** CcM0374 30.000 *** CcM0831 339.692 ***
CcM0374 30.000 *** CcM0956 36.000 *** CcM2704 379.274 ***
CcM0207 45.000 *** CcM0698 34.746 *** CcM0956 259.289 ***
CcM0594 20.000 *** CcM0970 40.400 *** CcM0673 216.869 ***
CcM2697 24.746 *** CcM1357 31.111 *** CcM0195 154.532 ***
CcM1357 30.887 *** CcM0121 31.111 *** CcM0492 196.158 ***
CcM0133 23.315 *** CcM0492 31.111 *** CcM0494 279.555 ***
CcM0673 16.049 ** CcM2697 23.600 *** CcM0207 161.244 ***
CcM0831 46.000 ** CcM0444 22.178 ** CcM0721 152.882 ***
CcM0834 10.000 ** CcM1982 15.566 ** CcM0444 109.399 ***
CcM2379 10.000 ** CcM0785 10.000 ** CcM1982 88.552 ***
CcM2394 10.000 ** CcM0831 36.184 ** CcM0257 123.954 ***
CcM2505 15.228 ** CcM0133 20.469 ** CcM0970 116.445 ***
CcM0956 28.000 ** CcM0207 43.898 ** CcM2379 69.007 ***
CcM0492 28.000 ** CcM0494 53.289 ** CcM0374 98.172 ***
CcM0698 28.000 ** CcM0361 13.600 ** CcM0121 123.869 ***
CcM0257 20.625 ** CcM0257 31.111 ** CcM1357 93.310 ***
CcM0970 27.360 ** CcM2394 11.111 * CcM2697 59.180 ***
CcM0785 9.000 ** CcM1045 6.368 * CcM0133 67.383 ***
CcM1045 9.000 ** CcM0834 6.087 * CcM0021 66.385 ***
CcM2704 20.059 ** CcM2049 6.087 * CcM2097 47.831 ***
CcM0494 53.289 ** CcM0721 15.524 * CcM0834 39.450 ***
CcM0021 13.600 ** CcM2379 10.035 * CcM0698 96.091 ***
CcM0444 13.025 ** CcM2704 21.194 * CcM0361 28.434 ***
CcM1251 11.276 * CcM0484 5.378 * CcM0785 18.976 ***
CcM0721 16.520 * CcM2505 5.378 * CcM0594 24.905 ***
CcM0484 4.706 * CcM0673 9.074 * CcM1251 24.541 ***
CcM0361 3.695 ns CcM0021 12.449 ns CcM2049 16.689 ***
CcM2049 3.240 ns CcM0195 16.077 ns CcM0484 9.763 **
CcM0121 27.178 ns CcM1251 1.406 ns CcM2505 9.763 **
CcM2097 4.810 ns CcM2044 3.956 ns CcM1045 7.984 **
CcM2004 1.406 ns CcM2097 3.956 ns CcM2004 6.555 *
CcM2044 4.105 ns CcM0594 0.028 ns CcM2394 10.734 *
CcM0195 7.490 ns CcM2004 0.028 ns CcM2044 10.320 *
ns=not significant, * P<0.05, ** P<0.01, *** P<0.001

0.082 (A & R) while 0.0067 (B & R) indicating ACKNOWDGEMENTS

trivial genetic distance among population.
Authors are thankful to the US Agency for
Similar trends were reported earlier in
International Development (USAID)- India
pigeonpea by Songok et al. (2010), and the
mission and Department of Agriculture
authors reported that inbreeding nature of
Cooperation & Farmers Welfare, Government
pigeonpea under conserved regeneration led to
of India for financial support. This work has
deviation from HW equilibrium and promoted
been undertaken as part of the CGIAR Research
non-random mating. The genetic diversity
Program on Grain Legumes and Dryland
patterns obtained in the present study will help
Cereals. ICRISAT is a member of CGIAR
pigeonpea breeders to make informed decisions
Consortium.
on selection of diverse cross combinations that
would show significantly higher level of
heterosis in hybrid breeding.
 Patel et al.: Understanding molecular divergence and population structure of parental lines of CMS hybrids in pigeonpea
REFERENCES
Allen B, Kon M and Bar-Yam Y. 2009. A new
phylogenetic diversity measure generalizing the
Shannon index and its application to phyllostomid
bats. American Naturalist 117: 236-243.
Bohra A, Saxena KB, Varshney RK and Saxena RK.
2020. Genomics-assisted breeding for pigeonpea
improvement. Theoretical and Applied Genetics
DOI 10.1007/s00122-020-03563-7.
Bohra A, Jha R and Pandey G et al. 2017. New
hypervariable SSR markers for diversity analysis,
hybrid purity testing and trait mapping in
pigeonpea [Cajanus cajan (L.) Millspaugh]. Frontiers
in Plant Sciences 8: 377.
Bohra A, Jha UC, Premkumar A, Bisht D and Singh NP.
2016. Cytoplasmic male sterility (CMS) in hybrid
breeding in field crops. Plant Cell Reports 35: 967–
993
Bohra A, Singh IP, Yadav AK, Pathak A, Soren KR,
Chaturvedi SK and Nadarajan N. 2015. Utility of
informative SSR markers in the molecular
characterization of cytoplasmic genetic male
sterility based hybrid and its parents in pigeonpea.
National Acadamy Science Letters-India 38: 13-19.
Bohra A, Saxena RK, Gnanesh BN, Saxena KB,
Byregowda M, Rathore A, Kavi Kishor PB, Cook
DR and Varshney RK. 2012. An intra-specific
consensus genetic map of pigeonpea [Cajanus cajan
(L.) Millspaugh] derived from six mapping
populations. Theoretical and Applied Genetics
125: 1325-1338.
Bohra A, Dubey A and Saxena RK et al. 2011. Analysis
of BAC-end sequences (BESs) and development of
BES-SSR markers for genetic mapping and hybrid
purity assessment in pigeonpea. BMC Plant Biology
11: 56.
Budak H, Shearman RC, Parmaksiz I and Dweikat I.
2004. Comparative analysis of seeded and
vegetative biotype buffalograsses based on
phylogenetic relationship using ISSRs, SSRs,
RAPDs, and SRAPs. Theoratical and Applied
Genetics 109: 280-288.
Green JL, Holmes AJ, Westoby M, Oliver I, Briscoe D
and Dangerfield M et al. 2004. Spatial scaling of
microbial eukaryote diversity. Nature 432: 747-750.
Gupta PK and Varshney RK. 2000. The development
and use of microsatellite markers for genetic
analysis and plant breeding with the emphasis on
bread wheat. Euphytica 113: 163-185.
Kassa MT, Penmetsa RV, Crrasquilla-Garcia N, Sarma
BK, Datta S, Upadhyaya HD, Varshney RK, von
91
Wettberg EJB and Cook DR. 2012. Genetic patterns
of domestication in pigeonpea (Cajanus cajan (L.)
Millsp.). and wild Cajanus Relatives. PLoS One 7:
e39563.
Khush GS. 2005. What it will take to feed 5.0 billion
rice consumers in 2030. Plant Molecular Biology
59: 1-6.
Kumar SCV, Singh IP, Kumar VR, Patil SB, Tathineni
R, Mula, MG and Kumar NM. 2016. Pigeonpea -a
unique jewel in rainfed cropping systems. Legume
Perspectives 11: 08-10.
Meirmans PG and Hedrick PW. 2011. Assessing
population structure: FST and related
measures. Molecular Ecology Resources 11: 5-18.
Menz MA, Klein RR, Unruh NC, Rooney WL, Klein PE
and Mullet JE. 2004. Genetic diversity of public
inbreeds of sorghum determined by mapped AFLP
and SSR markers. Crop Science 44: 1236-1244.
Patel K, Acharya S, Vaghela KO, Patel JB, Patel BT,
Kanbi VH and Sheikh W. 2010. Modified efficient
CTAB DNA isolation protocol for cultivated and
wild backgrounds pigeonpea. GAU Research
Journal 35: 75-79.
Peakall PE and Smouse R. 2012. GenAlEx 6.5: genetic
analysis in Excel. Population genetic software for
teaching and research an update. Bioinformatics
28: 19.
Perrier X and Jacquemoud-Collet JP. 2006. DARwin
software available at http://darwin.cirad.fr/
Poncet V, Rondeau M, Tranchant C, Cayrel A, Hamon
S, De Kochko A and Hamon P. 2006. SSR mining in
coffee tree EST databases: potential use of EST–
SSRs as markers for the Coffea genus. Molecular
Genetics and Genomics 276: 436-449.
Pritchard JK, William Wen and Daniel Falush. 2003.
Documentation for STRUCTURE software: Version
2.
Saxena KB and Sawargaokar SL. 2014. First
information on heterotic groups in pigeonpea
[Cajanus cajan (L.) Millsp.]. Euphytica 200: 187–196.
Saxena KB, Ravikoti VK and Tikle AN et al. 2013. ICPH
2671 – the world’s first commercial food legume
hybrid. Plant Breeding 132: 479-485.
Saxena RK, Saxena KB, Kumar RV, Hoisington DA
and Varshney RK. 2010a. Simple sequence repeat
based diversity in elite pigeonpea genotypes for
developing mapping populations to map resistance
to Fusarium wilt and sterility mosaic disease. Plant
breeding 129: 135-141.
Saxena RK, Saxena KB and Varshney RK. 2010b.
Application of SSR markers for molecular
92 Journal of Food Legumes 33(2), 2020
characterization of hybrid parents and purity
assessment of ICPH 2438 hybrid of pigeonpea
[Cajanus cajan (L.) Millspaugh].  Molecular
Breeding 26: 371-380.
Sangok S, Ferguson M, Muigai AW and Silim S. 2010.
Genetic diversity in pigeonpea [Cajanus cajan (L.)
Millsp.] landraces as revealed by simple sequence
repeat markers. African Journal of Biotechnology
22: 3231-3241.
Springer NM and Stupar RM. 2007. Allelic variation
and heterosis in maize: how do two halves make
more than a whole? Genome Research 17: 264-
275.
Varshney RK, Chabane K, Hendre PS, Aggarwal RK
and Graner A. 2007. Comparative assessment of
EST-SSR, EST-SNP and AFLP markers for
evaluation of genetic diversity and conservation of
genetic resources using wild, cultivated and elite
barleys. Plant Science 173: 638-649.
Varshney RK, Chen W and Li Y et al. 2012. Draft
genome sequence of pigeonpea (Cajanus cajan. L),
an orphan legume crop of resource-poor farmers.
Nature Biotechnology 30: 83-89.
Varshney RK. 2016. Exciting journey of 10 years from
genomes to field and markets: some success stories
of genomics assisted breeding in chickpea,
pigeonpea and groundnut. Plant Science 242: 98-
107.
Varshney RK, Mohan SM and Gaur PM et al. 2013.
Achievements and prospects of genomics assisted
breeding in three legume crops of the semi arid
tropics. Biotechnology Advances 31: 1120-1134.
 Journal of Food Legumes 33(2): 93-100, 2020

Cultural and morphological variability among Trichoderma harzianum

and Trichoderma asperellum collected from chickpea growing areas of
Rayalaseema Region of Andhra Pradesh
P NAGAMANI*1, SOMESHWAR BHAGAT2, K VISWANATH1 and MK BISWAS3

1
*Regional Agricultural Research
Station, Tirupati 517 502, Andhra
Pradesh; 2NRRI-Central Rainfed
Upland Rice Research Station,
Hazaribagh 825301, Jharkhand;
3
Department of Plant Protection,
Palli Siksha Bavana, Viswava
Bharati, Bolpur-731235
*Email: manipath28@gmail.com
Received: 5 June, 2020
Accepted: 31 August, 2020
Handling Editor:
Dr. Mohd. Akram, ICAR-IIPR,
Kanpur, India
Dr. Meenal Rathore, ICAR-IIPR,
Kanpur, India
ABSTRACT
The genus Trichoderma contains species of great economic importance
due to their ability to act as biological control agents against a broad
range of fungal plant pathogens. In the present study ten isolates of
Trichoderma species were isolated from rhizospheric soil of chickpea
growing areas of Rayalaseema Region, Andhra Pradesh. The isolates
were characterized on the basis of their cultural and morphological
characteristics. Out of 10 isolates, 5 isolates were identified as T.
asperellum and 5 isolates as T. harzianum. Cultural Characteristics T.
asperellum isolates were fast growing with light green to dark green fluffy
granular growth, mottled with white flecks and often with inconspicuous
wefts of yellow hyphae whereas T. harzianum isolates were relatively
slow grower, with green to dark green coloured colony and effuse
conidiation in different media. The size of phialides of T. harzianum
isolates KNO 9 recorded 7.8-9.7 x 3.3-4.3 µm while the highest size of
phialospores 3.5-4.0x 2.5-2.8 µm recorded by ATPU 2. The size of
phialides of T. asperellum isolate was highest recorded in KNP 1 with
5.3-8.2 x 1.2-1.6 µm , while the size of phialospores was observed in KJ 12
with 2.1-3.5 x 1.6-2.0 µm. The chlamydospores sizes was more in KJ 12
with 9.5 - 13.3 x 8.2 - 9.4 µm.

Key words: Chickpea rhizosphere, Cultural, Morphological, Trichoderma,

Variability

INTRODUCTION Rhizospheric microorganisms act as an initial

Andhra Pradesh is one of the major
chickpea producing states in the country with
an area of 5.21 lakh ha with production of 6.76
lakh tones (Anonymous 2018). In the state,
chickpea is predominantly grown in the districts
of Kurnool, Kadapa and Ananatapur during
rabi season on residual soil moisture as a winter
crop. Low yield of chickpea is primarily
attributed to its susceptibility to several fungal,
bacterial and viral diseases. Among the
economically important diseases, wilt
(Fusarium oxysporum f. sp. ciceris), dry root rot
(Macrophomina phaseolina) and collar rot
(Sclerotium rolfsii) are the major and widespread
affecting chickpea cultivation
Biological control of soil-borne plant
pathogens using antagonistic microorganisms
is a proven success in many countries (Sivan,
1987) and is therefore becoming popular.
barrier against pathogens attacking the root
and are ideal for use as bio-control agents
(Reddy et al., 2013).
The genus Trichoderma is one of the most
widely commercialized bio-control agents for
soil-borne diseases in various crops (Pan et al.,
2001) and hence its precise identification and
characterization is essential (Lieckfeldt et al.,
1999). Trichoderma have normally been defined
on the basis of their morphology by many
taxonomists (Rifai, 1969, Samuel 2006). As is
usually the case with other fungal genera,
species of Trichoderma too were defined
originally on the basis of morphology by
workers like Rifai (1969) and Bisset (1991a, b
and c). The culture sporulation pattern varies
within and between species. Seaby (1996) also
reported that differentiation of Trichoderma spp.
using classical microscopic features alone was
94 Journal of Food Legumes 33(2), 2020
difficult since cultural morphology varied
widely on different media and spore size varied
significantly with incubation temperature.
Moreover, variation among the isolates based
on size of the phialides, and their arrangements
was small. Keeping the above facts in view, the
present research was undertaken to
characterize the cultural and morphological
variability among 10 isolates of Trichoderma
isolated from the chickpea rhizospheric soil of
Rayalaseema region.
MATERIALS AND METHODS
Isolation of Trichoderma from Rhizosphere
soil sample
Soil samples were collected from different
locations of Kurnool, Kadapa and Anantapur
districts of Andhra Pradesh at a depth ranging
5-6 cm, by removing top 2 cm surface soil. The
soil collected from rhizosphere of healthy
chickpea plants was mixed thoroughly to make
a composite sample. Isolation of Trichoderma
was done by serial dilution technique. The
probable colonies of Trichoderma were
observed closely and picked up from petri plates
containing Trichoderma specific media (TSM)
and finally pure culture was obtained by
repeated subculture. They were identified on
the basis of their morphological characters
(Rifai, 1969, Samuel 2006).
Cultural characteristics of T. harzianum and
T. asperellum
The cultural characteristics of 10 isolates
of Trichoderma were studied in four media, viz.,
potato dextrose agar (PDA), oat meal agar
(OMA), Cazpex Dox Agar (CZA) and Malt
Extract Agar (MEA). Mycelial discs (6 mm) of
young growing culture of each isolate of
Trichoderma was inoculated at edge of the
Petriplates containing solidified PDA, OMA,
MEA and CZA medium seperately, and
incubated at 28 ± 1°C for one week. The growth
pattern of isolates of Trichoderma was observed
daily and all distinguishing characters were
recorded. The experiment was replicated thrice.
The characters recorded were colony
appearance, growth rate, presence or absence
of pigments, hyphae and presence of any
distinguishing odour.
Morphological characterization of T.
harzianum and T. asperellum
Morphological/Anamorphic characterization
of Trichoderma isolates were done by growing
them in potato dextrose agar medium in order
to unequivocally verify taxa and species.
Morphological characteristics viz., conidiophores
length, width and branching pattern, phialides
width at tip, middle and base, phialides length
and shape, phialospores and chlamydospores
shape, length and width including colouration.
For morphological characterization, slide
culture technique was used and incubated at
25°C with alternating 12 hr dark and 12 hr cool
white fluorescent light. All conidiophores,
phialides conidia and chlamydospores were
measured following the methods of Lieckfeidt
et al. (2001).
RESULTS AND DISCUSSION
Isolation and identification of Trichoderma
spp.
Trichoderma cultures were isolated from
soil samples collected from chickpea
rhizosphere. Trichoderma isolates revealed pale
or yellowish color with rapid growth, loosely
arranged conidia and effused conidiation on
TSM. Based on colony morphology 10 isolates
were selected for further studies.
Effect of different media on growth of
Trichoderma isolates
In general, there was dense mycelial
growth of Trichoderma spp. in MEA followed
by OMA, relatively less dense growth in PDA
and lesser granular growth of antagonists in
CZA. The sporulation was first observed in
MEA, followed by OMA and PDA and
sporulation was not observed in CZA. Radial
growth rate of potential Trichoderma isolates on
OMA, MEA, PDA and CZA medium were used
and growth rate recorded at different intervals
of time (Table 1). Out of 10 isolates, MEA and
OMA medium supported faster growth rate of
89.0 mm after 72 h compared to other media.
Isolates KNN4, KNPG 3, ATPP 6 and KNO 9
recorded more growth rate in four types of
 Nagamani et al.: Cultural and morphological variability among Trichoderma harzianum and Trichoderma asperellum 95
collected from chickpea growing areas of Rayalaseema Region of Andhra Pradesh

Table 1. Cultural characteristics of some isolates of Trichoderma in OMA, MEA, PDA and CZA medium at 25 ± 2º C
Tricho- MEA OMA PDA CZA
derma spp. 24 hr 48 hr 72 hr 24 hr 48 hr 72 hr 24 hr 48 hr 72 hr 24 hr 48 hr 72 hr
KJ-12 21.67±0.91j* 50.33±1.57g 76.67±1.14d 19.67±1.02d 55.00±1.22ecd 74.00±1.05dbec 29.00±0.65cdb 46.67±1.46hi 70.33±1.10c 20.67±0.61edfg 39.67±0.50gf 57.33±0.72gh
KNP-1 22.00±0.91ij 59.00±1.57def 88.67±1.14a 21.00±1.02dc 48.00±1.22fhgi 71.67±1.05dbecf 21.00±0.65hij 61.33±1.46bc 77.00±1.10c 19.33±0.61efg 34.00±0.50h 67.00±0.72bc
KNP-3 25.33±0.91hig 60.67±1.57cdef 78.67±1.14dc 23.00±1.02dc 44.67±1.22jhki 69.67±1.05gef 24.33±0.65ghf 58.67±1.46dbec 79.00±1.10c 21.33±0.61edfcg 44.00±0.50cab 54.00±0.72ih
KT6 26.67±0.91hig 75.00±1.57a 87.33±1.14a 23.00±1.02dc 60.33±1.22bc 88.33±1.05a 23.00±0.65ghif 60.33±1.46dbc 82.00±1.10bc 19.00±0.61fg 40.00±0.50gfe 55.00±0.72igh
KNN-2 30.33±0.91cedgf 52.33±1.57gf 89.00±1.14a 24.00±1.02cdb 49.00±1.22efgi 69.67±1.05gef 24.33±0.65ghf 59.33±1.46dbc 86.33±1.10ab 21.00±0.61edfcg 32.67±0.50h 56.33±0.72igh
KNK-1 31.67±0.91cedbf 60.67±1.57cdef 76.67±1.14d 25.00±1.02cadb 52.67±1.22ef 67.33±1.05g 21.33±0.65ghij 40.00±1.46i 86.33±1.10ab 26.33±0.61b 39.67±0.50gf 58.00±0.72fge
KNO-9 33.00±0.91cab 60.00±1.57cdef 85.00±1.14ab 26.33±1.02cab 47.67±1.22fhgi 88.67±1.05a 22.33±0.65ghij 49.33±1.46hg 87.67±1.10ab 30.00±0.61edfg 44.00±0.50cab 58.00±0.72fge
KNN-4 33.00±0.91cab 63.67±1.57cdb 89.00±1.14a 26.33±1.02cab 59.33±1.22bc 68.00±1.05gf 32.00±0.65ab 61.00±1.46bc 87.67±1.10ab 19.67±0.61efg 31.67±0.50h 67.00±0.72bc
KT-13 32.67±0.91cadb 59.67±1.57cdef 89.00±1.14a 26.00±1.02cab 50.00±1.22efhg 67.67±1.05gf 25.33±0.65gef 57.33±1.46dfeg 87.00±1.10ab 24.00±0.61bc 42.67±0.50cde 63.00±0.72dc
ATPP-6 33.67±0.91cab 57.33±1.57gdef 87.67±1.14a 29.00±1.02ab 53.00±1.22efd 73.00±1.05dbecf 28.00±0.65ced 45.00±1.46hi 88.33±1.10a 20.00±0.61edfg 38.00±0.50g 55.67±0.7igh

*Mean of three replicates

*Means with different superscripts are significantly different with p<0.05 by Tukey’s HSD test

media. CZA medium supported slow growth, isolates on PDA and all isolates were fast
sparse and less sporulation of all the 10 isolates growing reaching a radius of 42.5 to 56.5 mm
There were clear differences in growth after 72 h at 250C and 20 - 37.8 mm after 72 h
pattern and other cultural characters of at 35 0 C. Conidiation in the T. harzianum
Trichoderma spp. when they were grown in four isolates was predominantly effuse covering the
types of media. The colour of Trichoderma entire surface of the plates.
colony in all media was light green to dark Our present findings are similar with the
green, yellowish green to dark green with white reports of Bissett (1991a-c) who characterized
tinge. More aggregated growth of Trichoderma the T. harzianum as fast growing colonies, aerial
spp. near the periphery region was observed. mycelium floccose, white to greyish or
The white, yellowish or faint yellows to light sometimes yellowish.
green pigmentation in the reverse side of growth Similar findings were also reported by
of Trichoderma spp. were also observed. several researchers (Pan and Bhagat, 2008;
Coconut odour were noticed in most of the Chattannavar and Hosagoudar, 2012) that the
isolates of T. asperellum (Table 2) T. harzianum and T. viride were fast growing
T. harzianum was found to be fast growing green coloured, mycoparasitic fungi with
on all 4 different media, aerial mycelium distinct coconut aroma with 4-5 days old
floccose, white to greyish or yellowish in colour. culture in Petriplates. The distinctive sweet or
pustule are flat, surface appearing granular or coconut odour is also produced by cultures of
powdery owing to dense conidiation, exudates losely related T. viride and many reports of á-
amber to colourless or greenish yellow, odour pyrone production by the more distantly related
indistinct and hyphae hyaline. While, T. T. harzianum (Saxena et al., 2014;Prameela et
asperellum as rapidly growing fungus, aerial al., 2012; Rajesh et al., 2013; Sriram et al., 2013;
mycelium usually limited, floccose to arachnoid, Shahid et al., 2014).
reverse side of the growth was colourless to dull
yellowish, some isolates with distinctive Morphological Characterization of T.
aromatic odour resembling coconut, conidiation harzianum and T. asperellum
effuse, loosely tufted, or in some isolates forming Trichoderma isolates were characterized by
compact pustules, white at first, eventually following slide culture technique using half
green or brown. (Table 2&3) strength PDA medium. All the 10 isolates of
The present results are in agreement with Trichoderma were characterized on the basis of
earlier findings of Singh and Kumar (2011) and morphological parameters viz., shape, size,
Chattannavar & Hosagoudar (2012) where ornamentation and arrangement of
they have reported T. viride (TV 97) and T. anamorphic characters, i.e., conidiophores,
koningii grew much faster i.e. @ 7.25 and 7.10 phialides, phialospores and chlamydospores in
cm respectively, T. harzianum (Th 21) was the the PDA medium. The shape and size of
slowest (5.83cm). Sharma and Singh (2014) conidiophores (length and breadth), phialides
studied growth rates of the 30 Trichoderma (length: breadth: middle portion) and
96 Journal of Food Legumes 33(2), 2020

Table 2. Cultural characteristics of Trichoderma asperellum*

Isolate Character PDA OMA MEA CZA
Dark green with light Green to dark green colony Pale yellowish or greenish White to pale green
yellowish coloured tinge, with relatively scanty mycelial fluffy growth more near with suppressed
dense mycelial growth and growth and whitish green ring the periphery region of growth. radial growth
Colony
aerial mycelium is usually on the colony margin plate, radial growth pattern with white
limited, floccose to pattern with white border border mark on the
KNP 1 arachnoids mark on the margin margin
Growth rate Rapid Rapid Rapid Slow
Pustules More, Dark green More, Dark green More, Dark green Few , dark green
Pigment Yellowish green Pale yellow Yellow Yellow
Odour Coconut like aroma Coconut like aroma Coconut like aroma Coconut like aroma
Hyphae Hyaline, smooth walled Hyaline, smooth walled Hyaline, smooth walled Hyaline, smooth walled
Greenish fluffy growth with Greenish colour colony with Dark green, raised Dirty white to light
effuse conidiation and whitish margin and effuse growth, effuse conidiation green with suppressed
Colony
uniform distribution on the conidiation and whitish margin at the growth. colony with
plate colony margin. whitish margin
Growth rate Rapid Rapid Rapid Slow
KNP3
Greenish to dark green Abundant, dark green to Abundant, dark green to Limited, dark green to
Pustules
greyish brown brown brown
Pigment Yellow Yellow Dull yellow Dull yellow
Odour Coconut like aroma Coconut like aroma Coconut like aroma Coconut like aroma
Hyphae Hyaline, smooth walled Hyaline, smooth walled Hyaline, smooth walled Hyaline, smooth walled
Colony Light yellowish to green Green with pale yellow on the Pale yellowish or dark Pale yellowish and
colony, dense mycelialupper surface of growth, slight green, fluffy growth near radial growth pattern
growth with uniform fluffy growth and whitish the periphery region and with whitish border at
distribution and slight fluffy
border in the margin. radial growth pattern the margin
KJ 12 growth in the periphery with whitish border at the
region. margin.
Growth rate Rapid Rapid Rapid Slow
Pustules Abundant, dark green Abundant, dark green to Abundant, dark green to Abundant, dark green
brown brown to brown
Pigment Dull yellowish Dull yellowish Dull yellowish Dull yellowish
Odour Coconut like aroma Coconut like aroma Coconut like aroma Coconut like aroma
Hyphae Aerial mycelium is limited, Aerial mycelium is limited, Hyaline, smooth walled Hyaline, smooth walled
hyaline and smooth walled Hyaline smooth walled
Colony Light green with effuse Yellowish green, sparsely Dull green to green, fluffy Pale green, sparsely
conidiation, uniformly distributed with concentric growth with uniform distributed with
distributed throughout the ring formation and white distribution and whitish concentric ring
plate with whitish border. border at the colony margin. green border at the colony formation and white
margin. border at the colony
KT 6 margin.
Growth rate Moderate Moderate Moderate Slow
Pustules Abundant, dark green Moderate, green Abundant, brown moderate, brown
Pigment Dull yellowish Dull yellowish Pale yellowish Pale yellowish
Odour Coconut like aroma Coconut like aroma Coconut like aroma Coconut like aroma
Hyphae Hyaline, smooth walled, Hyaline, smooth walled, Hyaline, smooth walled Hyaline, smooth walled
Pale green to dark green Green to dark green,
Light green to green, Light green, uniform
colony, scanty at the centre dense growth with radial
uniform and compact and compact growth
Colony with radial growth pattern pattern and whitish
growth with radial growth with radial growth
and greenish border in the border at the colony
pattern. pattern.
margin. margin.
KNN 2 Growth rate Very rapid Rapid Very rapid Slow
Pustules Fairly abundant, brown Abundant, dark brown Abundant, brown Moderate , brown
Pigment Dull yellow Dull yellow Dull yellow Dull yellow
Odour Coconut like aroma Coconut like aroma Coconut like aroma Coconut like aroma
Hyphae Hyaline, smooth walled Hyaline, smooth walled Hyaline, smooth walled Hyaline, smooth walled
* Data are Mean of Three Replications
 Nagamani et al.: Cultural and morphological variability among Trichoderma harzianum and Trichoderma asperellum 97
collected from chickpea growing areas of Rayalaseema Region of Andhra Pradesh

Table 3. Cultural characteristics of Trichoderma harzianum*

Isolate Character PDA OMA MEA CZA
Colony Dark green, granular,Green, submerged and Dark green submerged, Dull green, ,
submerged mycelialwhitish colour at the densely growth with submerged mycelial
growth with more growth margin of colony. slightly raised at the growth with more
at the margin. margin. growth at the margin
ATPP 6 Growth rate Rapid Rapid Rapid Slow
Pustules More Moderate More Less
Pigment Yellowish Whitish yellow Yellow Whitish
Odour Coconut like aroma Coconut like aroma Coconut like aroma Coconut like aroma
Hyphae Hyaline, submerged Hyaline, submerged Hyaline, submerged. Hyaline, submerged.
growth. growth.
Colony Greenish colony with fluffyGreenish coloured colony Greenish coloured colony White coloured colony
growth but slow at centre but whitish with fluffy growth and with slow sporulation
sporulation colour at the margin with whitish colour at the
slow sporulation margin
Growth rate Slow Slow Slow Very Slow
KT 13
Pustules Moderate Moderate Moderate less
Pigment No pigment No pigment No pigment No pigment
Odour Indistinct Indistinct Indistinct Indistinct
Hyphae Hyaline mycelium with Hyaline mycelium Hyaline mycelium Hyaline mycelium
floccose.
Colony Light green with Green to dark green, Light green to green with Light green ,
submerged growth and submerged growth and fluffy growth at the submerged growth at
sparsely distributed in the very scanty growth at the margin but scanty growth the margin but scanty
plate centre but it is denser at at centre growth at centre
margin
KNN 4 Growth rate Moderate Moderate Rapid slow
Pustules More Medium More less
Pigment Orange yellow Creamy colour Yellow Yellow
Odour Indistinct Indistinct Indistinct Indistinct
Hyphae Hyaline Hyaline Hyaline Hyaline
Colony Colonies powdery to felty, Whitish granular colony Whitish colony, becomes Whitish concentric ring
white coloured became with no any concentric light green or greyish formation, later on
slightly green after ring formation, later on green after sporulation. turned light greenish
sporulation, no concentric turned light greenish
ring
KNK 1 Growth rate Moderate Moderate Moderate Slow
Pustules No pustule No pustule No pustule No pustule
Pigment No pigment No pigment No pigment No pigment
Odour Indistinct Indistinct Indistinct Indistinct
Hyaline, smooth
Hyphae Hyaline, smooth walled Hyaline, smooth walled Hyaline, smooth walled
walled
Colony Dark green, granular and Dark green, submerged Dark green, granular light green, granular
submerged growth with with flat growth at the growth, evenly and submerged growth
typical whitish raised colony margin distributed on the plate, with concentric at
growth at the margin more dark green colour at margin
the margin
KNO 9 Growth rate Rapid Moderate Rapid moderate
Pustules More More More Less
Pigment No pigment No pigment No pigment No pigment
Odour Indistinct Indistinct Indistinct Indistinct
Hyphae Hyaline Hyaline Hyaline Hyaline
· Data are Mean of Three Replications
phialospores were measured with the help of from ampulliform to subglobose or lageniform
phase contrast stereo zoom microscope with divergent or crowded whorls of 2-5, the middle
camera attachment. of phialides were markedly swollen and
Anamorphic characteristics isolates of T. abruptly tapered towards the tip, shape of
harzianum is presented in Table 4, which conidia were subglobose to ovoid, the
indicated that the shape of phialides varied conidiophores were highly branched
98 Journal of Food Legumes 33(2), 2020

Table 4. Morphological Characteristics of Trichoderma harzianum* grown on PDA

Phialides Phialospores Conidiophores Chlamydospores
Isolate Size Size Size Size
Shape Shape Shape Shape
(µm) (µm) (µm) (µm)
ATPP 6 Ampulliform or 5.3 - 9.1 Subglobose, 1.7 - 3.5 Straight, primary 6.0 - 29.0 Ellipsoid or 10.5-12.6
lageniform abruptly x green x branches arise at nearly x pyriform, x
tapered towards the 3.2 - 4.5 coloured 1.1 - 2.0 right angles. 3.0 - 4.2 intercalary and 8.0 - 9.5
tip of phialide. terminal, light
brown
KT 13 Lageniform with 3.7 - 8.4 Subglobose 2.0 - 3.5 Straight or flexuous, 5.9 – 22.6 Ellipsoid or 9.5 - 12.2
divergent whorls of x to obvoid. x macro-nematous x pyriform, pale x
3-5. 2.9 - 3.9 1.2 - 2.6 conidiophores, highly 3.4 - 7.2 yellowish to 6.8 - 8.7
branched, primary brownish colour
branch arises at nearly
right angles, bent slightly
towards the apex.
KNN 4 Ampulliform to 3.6 - 7.9 More obvoid, 1.9 - 3.0 Hyaline, smooth wall, 5.5 - 34.2
Fairly abundant, 10.2-13.0
subglobose or x smooth x straight or flexuous, x intercalary and x
lageniform with 2.8 - 3.5 walled. 1.4 - 1.8 highly branched and 3.0 - 6.9terminal, 7.5 - 9.3
strongly swollen in primary branch arises at subglobose or
the middle. nearly right angles. pyriform, brownish
in colour
KNK 1 Ampulliform to 3.9 - 6.8 Subglobose 1.7 - 2.7 Straight, highly branched 6.0 - 36.2 Subglobose to 9.4 - 13.2
subglobose, x to obvoid. x with primary branches x ellipsoidal or x
markedly constricted 2.6 - 3.4 1.3 - 1.4 arising at nearly right 2.4 - 4.9 pyriform, Solitary 7.5 - 9.4
at base but broadly angles. contents subhyaline
swollen at middle. to pale yellow
KNO 9 Ampulliform, 7.8 - 9.7 Subglobose, 3.5 - 4.0 Straight or flexuous, 6.0 - 36.0 Subglobose or 10.1-12.5
markedly constricted x smooth wall, x highly branched x pyriform x
at the base but 3.3 - 4.3 green 2.5 - 2.8 2.4 - 3.7 7.5 - 9.2
broadly swollen at coloured.
middle.
*Data are the means of five replications

pyramidally at nearly right angles and the
intercalary or terminal chlamydospores were
subglobose to ellipsoid or pyriform. The size of
phialides of T. harzianum isolates varied from
3.9-6.8 x 2.6-3.4 ìm (KNK1) to 7.8-9.7 x 3.3-4.3
ìm (KNO 9) while the size of phialospores
varied from 1.7-2.7 x 1.3-1.4 ìm (KNK 1) to 3.5-
4.0x 2.5-2.8 ìm (ATPU 2). The conidiophores
sizes were varied from 5.9-22.6 x 3.4-7.2 ìm (KT
13) to 6.0-36.2 x 3.0-4.9 ìm (KNK 1). The
chlamydospores sizes were varied from 9.5-
12.2 x 6.8-8.7ìm (KT13) to 9.4-13.2 x 7.5-9.4 ìm
(KNK 1). The rest of isolates of T. harzianum
were with intermediate size of phialides,
phialospores, conidiophores and
chlamydospores.
Anamorphic characteristics of T.asperellum
isolates has been presented in Table 5, revealed
that phialides were of lageniform to subglobose,
sometimes ampulliform to lageniform,
verticillate with divergent whorls of 2-4. The
shapes of phialosphores were varied from
globose to ellipsoid or oblong with distinctive
rough epispore walled. The conidiophores were
comparatively narrow and flexuous, with
primary branches at regular internodes,
typically pyramidally branched and flexuous.
The shapes of chlamydospores were varied from
ellipsoid to oval, pyriform or globose, born
intercalary and terminal. The size of phialides
of T. asperellum isolates were varied from 5.3-
8.2 x 1.2-1.6 ìm (KNP 1) to 4.7-7.8 x 1.5-1.7 ìm
(KT 6), while the size of phialospores were
varied from 2.1-3.5 x 1.6-2.0 ìm (KJ 12) to 1.9-
2.8 x 1.7-2.1 ìm (KNP 1). The chlamydospores
sizes varied from 8.7 -12.4 x 7.4 – 9.6 ìm (KNN
2) to 9.5 - 13.3 x 8.2 - 9.4 ìm (KJ12).
Identification of Trichoderma spp. at species
level by cultural and anamorphic is important
for morphological characteristics. These
findings are duly supported by earlier
observations (Tan Siew 2013; Shahid et al.,
2014; Roughanian et al., 2013.) where they
characterized different species of Trichoderma.
spp. and also reported that T. asperellum and
its related species are able to secrete a - pyrone,
a sweet coconut like aroma. Bhagat and Pan
(2010) reported that shape of phialides varied
 Nagamani et al.: Cultural and morphological variability among Trichoderma harzianum and Trichoderma asperellum 99
collected from chickpea growing areas of Rayalaseema Region of Andhra Pradesh

Table 5. Morphological characteristics of Trichoderma asperellum* grown on PDA

Phialides Phialospores Conidiophores Chlamydospores
Isolate
Shape Size (µm) Shape Size (µm) Shape Size (µm) Shape Size (µm)
KNP 1 Phialides in 5.3 - 8.2 Spores rough 1.9 - 2.8 Comparatively narrow 5.6 - 35.0 Abundant, ellipsoid 9.5 - 12.7
verticilloid of 3 or x , globose to x and flexuous, with x to oval, intercalary x
4, lageniform to 1.2 - 1.6 ellipsoid or 1.7 - 2.1 primary branches at 2.0 - 3.5 and terminal, dark 7.5 - 8.9
subglobose. oblong. regular internodes. brown colour
KNP 3 Regularly paired 4.7 - 7.8 Rough 2.0 - 2.4 Short branches near 5.1 - 35.0 Ellipsoid to globose, 9.5 - 13.3
phialides, slender x spored, x the tip and longer ones x both intercalary and x
irregularly bent. 1.5 - 1.7 globose to 1.8 - 2.0 with repeated 3.1 - 4.8 terminal, dark green 7.5 - 9.3
oval. branching at the base,
without sterile hypha
at the tip.
KJ 12 Bottle shaped with 4.0 - 7.5 Subglobose, 2.1 - 3.5 Flexuous with 7.2 - 39.7 Fairly abundant, 9.7 - 13.8
rather slender and x rough spores. x pyramidally branched x subglobose to x
divergent whorls 1.3 - 1.6 1.6 - 2.0 at regular intervals. 3.0 - 4.1 elliptical, intercalary 8.2 - 9.4
of and terminal at short
3-4. branches
KT 6 Lageniform, 4.7 - 7.8 Rough 2.0 - 2.4 Short branches near 5.1 - 35.0 Ellipsoid, both 9.7 - 13.2
regularly paired x spored, x the tip and longer ones x intercalary and x
phialides, slender 1.5 - 1.7 globose to 1.8 - 2.0 with repeated 3.1 - 4.8 terminal, dark green 7.5 - 9.3
irregularly bent. oval. branching at the base,
not nearly or at right
angles.
KNN Verticillate, 4.5 - 8.5 Rough 2.2 - 3.0 Flexuous, irregularly 4.9 - 33.4 Ellipsoid, intercalary 8.7 - 12.4
2 slender with open x spored, x branched, smooth x and terminal, dark x
phialides, slender, 1.3 - 1.5 ellipsoid. 1.8 - 2.2 walled. 2.9 - 3.7 brown 7.4 - 9.6
abruptly tapered
towards the apices.
*Data are the means of five replications subglobose to obovoid, chlamydospore were
from ampulliform to subglobose or lageniform infrequently producing and both terminally
divergent or crowded whorls of 2-5; the middle and intercalary
of phialides were markedly swollen and
abruptly tapered towards the tip; shape of CONCLUSION
conidia were subglobose to ovoid, All isolates of Trichoderma harzianum
conidiophores were highly branched initially formed white mycelia which then
pyramidally nearly at right angles in T. changed into yellowish green or dark green on
harzianum and T. hamatum and nearly at acute its maturation. The fungus showed faster
angles for T. viride; and the intercalary or growth of 85-89 mm per 72 hr. Due to the
terminal chlamydospores were subglobose to faster colonization of mycelia, formation of
ellipsoid or pyriform. Sharma and Singh (2014) white aerial mycelia and green colour colony,
observed that conidiophores are highly the characteristics made the species easier to
branched divergent and dendritic, longest be identified. Conidiophores of Trichoderma
branches form near the base of the hypha and harzianum were formed as Straight or flexuous,
nearest the main axis. Branches toward the tip highly branched, primary branch arises at
and secondary branches tended to be held at nearly right angles, bent slightly towards the
90° with respect to the axis from which they apex. Whereas, T. asperellum growth was
arise in T. harzianum. recorded moderate 78-88 mm/72 hr. The
Chandra Sekhar et al (2017) the isolate, colony of T.asperellum forms less white pustules
GRT-7 identified as Trichoderma harizanum mycelium compare to T. harzianum. The
based on the morphological characters. Colony conidiation was predominantly effused and
showed dark green producing tufts or pustules powdery. Most of the conidiophores of T.
fringed by sterile white mycelium, colony asperellum were formed symmetrically paired
reverse showed dull yellowish. Conidiophores along the main branches and axis. The
are branching and verticillate. Phialide were conidiophores branching patterns was broad,
ampulliform and convergent. Conidia verticillate, and almost 90° angle.
100 Journal of Food Legumes 33(2), 2020
REFERENCES
Anonymous 2018. DES, Ministry of Agri. &
FW(DAC&FW), Govt of India 2017-18- III Adv.Est
Bhagat S, and Pan S. 2010. Cultural and phenotypic
characterization of Trichoderma species from
Andaman and Nicobar Islands. Journal of
Mycology and Plant Pathology. 40(1): 145-157
Bissett J. 1991a. A revision of the genus Trichoderma II.
Infrageneric classification. Canadian Journal of
Botany. 69: 2357-2372.
Bissett, J. 1991b. A revision of the genus Trichoderma
III. Section Pachybasium. Canadian Journal of
Botany. 69: 2373-2417.
Bissett J. 1991c. A revision of the genus Trichoderma
IV. Additional notes on section Longibrachiatum.
Canadian Journal of Botany. 69: 2418-2420.
Chandra Sekhar Y, Khayum Ahammed S, Prasad
TNVKV and Sarada Jayalakshmi Devi R. 2017.
International Journal of Science, Environment and
Technology. Vol 6(3): 2056 – 2063
Chattannavar SN, and Hosagoudar GN. 2012.
Morphological characters and per cent inhibition
of major pathogens of cotton by different effective
isolates of Trichoderma species and Pseudomonas
fluorescens. Journal of Cotton Research and
Development. 26 (1): 101-104.
Lieckfeldt E, Samuels GJ, Nirenberg HI and Petrini O.
1999. A morphological and molecular perspective
of Trichoderma viride, is it one or two species.
Applied and Environmental Microbiology. 65:
2418-2428.
Lieckfeldt E, Kulling CM, Kubicek CP, Samuels G J
and Borner T. 2001. Trichoderma aureoviride:
Phylogenetic position and characterization.
Mycological Research. 103: 313-322.
Pan, S and Bhagat, S. 2008. Characterization of
antagonistic potential of Trichoderma species
against some soil borne plant pathogens. Journal
of Biological Control. 22: 43-49.
Pan S, Roy A and Hazra S. 2001. In vitro variability in
biocontrol potential among some isolates of
Gliocladium virens. Advances in Plant Sciences. 14:
301-303.
Prameela D, Prabhakaran N, Deeba Kamil, Pankaj
Pandey and Jyoti Lekha Borah. 2012.
Characterization of Indian native isolates of
Trichoderma species and assessment of their bio-
control efficiency against plant pathogens. African
Journal of Biotechnology. 11(85): 15150-15160.
Rajesh M, Prameela Devi, Malathi VG, Deeba Kamil,
Borah JL, Prabhakaran N and Srinivasa N. 2013. A
combined morpho-genetic approach towards
identification of Trichoderma species. Journalof
Mycopathology Research. 51(1): 19-28.
Reddy NG, Thahir BS and. Eswara RNP . 2013.
Evaluation of Trichoderma Sp. against Rhizoctonia
bataticola Causing Dry Root Rot Of Chick Pea (Cicer
Arietinum L.). Progressive Research 8 (Special): 572-
574
Rifai M A. 1969. A revision of the genus Trichoderma.
Mycological Papers.116: 1-56
Roughanian M, Zafarij D, Amini and Abdollahzadeh
J. 2013. Identification of Trichoderma species from
West Iran. Indian Phytopathology. 66(2): 186-189.
Samuels G J. 2006. Trichoderma: Systematics, the
sexual state and ecology. Phytopathology. 96: 195-
206.
Saxena D, Tewari AK and Dinesh Rai .2014. In vitro
antagonistic assessment of Trichoderma harzianum,
PBT 23 against plant pathogenic fungi. Journal of
Microbiology and Biotechnological Research. 4 (3):
59-65.
Seaby, D. 1996. Differentiation of Trichoderma taxa
associated with mushroom production. Plant
Pathology 45: 905–912.
Shaid, M, Srivastava M, Sonika Pandey, Anuradha
Sing and Vipul Kumar. 2014. Molecular
characterization of Trichoderma species. Isolated
from rhizospheric soils of Uttar Pradesh (India)
based on microsatellite profiles. African Journal of
Biotechnology. 13(35): 3650-3656.
Sharma KK and Singh US. 2014. Cultural and
morphological characterization of Rhizospheric
isolates of fungal antagonist Trichoderma. J. Appl.
& Nat. Sci. 6(2): 451-456.
Sivan, A .1987. Biological control of Fusarium crown
rot of tomato by Trichoderma harzianum under field
conditions. Plant Disease, 71: 587-592.
Sriram S, Savitha MJ, Rohinil HS and Jalali SK . 2013.
The most widely used fungal antagonist for plant
disease management in India, Trichoderma viride is
Trichoderma asperellum as confirmed by
oligonucleotide barcode and morphological
characters. Current Science. 104(10): 1332-1340
Tan Siew Hui . 2013. Morphological characterization
and sequence analysis of 5.8s-Its region of
Trichoderma species. A project report submitted to
the Department of Biological Science Faculty of
Science. B.Sc (Biotechnology). University of Tunku
Abdul Rahman.
 Journal of Food Legumes 33(2): 101-105, 2020

Analysis of growth, instability and time series decomposition of price

indices of pulses in India
SHRIPAD BHAT*1, HEMANT KUMAR1, DEVRAJ1 and RAJESH KUMAR1

1
ICAR-Indian Institute of Pulses
Research, Kanpur
*Email: shripadsmail@gmail.com
Received: 20 June, 2020
Accepted: 10 August, 2020
Handling Editor:
Dr. Amarender Reddy, ICAR-CRIDA,
Hyderabad
ABSTRACT
Price analysis of pulses helps to understand trends, variability and
seasonality in price series which is useful for different stakeholders such
as farmers, consumers, traders and policy makers. Monthly Wholesale
Price Indices (WPI) from the Office of the Economic Adviser, Ministry of
Commerce & Industry and Monthly Consumer Price Indices (CPI) from
the Ministry of Statistics and Programme Implementation were retrieved
and analyzed using R software. Time series decomposition was carried
out to estimate trends, variability and seasonal components in both WPI
and CPI series. Seasonal indices revealed that price indices of pulses
were higher during the months of October and November along with
higher variability during these months.
Key words: Decomposition, Growth, Instability index, Pulses, Seasonality

Pulses are important food crops that enrich
soils and are grown mostly under rainfed
conditions in India (81% - 2015-16) which
contribute to the instability in pulses production
(Reddy, 2013). Pulses are important both from
economic and environmental sustainability
points of view (Chand et al 2015). As prices
often indicate and guide farmers in choosing
the crop, variability in prices affect profitability,
increases the risk of pulse growers who already
bear substantial production risk owing to
rainfed cultivation. Price analysis is useful to
understand the behaviour of prices at
wholesale and retail levels. It provides an
overview on trends, variability and seasonality
in prices of pulses. Understanding price
scenario is useful for policy makers, producers,
traders, consumers and the government. In this
study, using the time series data on price indices
of pulses, an attempt was made to estimate
growth rates, variability and to decompose the
price series to understand trends and
seasonality in pulses in India at wholesale and
at retail levels.
Price analysis in pulses has been attempted
previously. Darekar and Reddy (2017)
forecasted pigeonpea prices by using time series
data of monthly average prices (January 2006
to December 2016) using Auto Regressive
Integrated Moving Average (ARIMA) models
for price forecast using the R programming
software. Bisht and Kumar (2019) studied the
variability in the prices of pulses in India and
noted that fluctuation in prices of pulses was a
major concern for decision makers. Authors
pointed out that volatility in the price series of
pigeonpea was persistent and explosive in
recent periods. Sekhar et al (2018) analyzed
behaviour of food prices in India at a
disaggregate level. After performing
econometric analysis authors found that effects
of supply and demand factors appeared almost
equal in case of prices of pulses.  However,
cereal and edible oil prices were mainly driven
by supply-side factors like production, wage
rates, and minimum support prices. But to
understand the price scenario both at wholesale
and retail level simultaneously, this study used
price series at both these levels. This gives
additional information about price behaviour
at various stages of supply chain and provides
information regarding marketing efficiency.
102 Journal of Food Legumes 33(2), 2020
MATERIALS AND METHODS
In India, inflation is being measured using
two indices: Wholesale Price Index (WPI) and
Consumer Price Index (CPI). CPI captures the
price change from the perspective of the
purchaser (consumer) while the WPI measures
the price changes at wholesale stage. In
nutshell, CPI captures the retail prices while
WPI is closer to farm prices (farm gate prices
plus transport and other handling cost to
market). In WPI, the weight given for food items
is 24 while it is 39 in case of CPI. In WPI, pulses
have the weightage of 0.64 while in CPI, it is
2.38.  Both the measures are currently used in
India. For CPI the base year is 2012 i.e. 2012=100
and for WPI it is 2011-12. The monthly WPI
were collected from the Office of the Economic
Adviser, Ministry of Commerce & Industry. The
monthly CPI were collected from the Ministry
of Statistics and Programme Implementation.
Both these two series were collected from the
new base year (WPI- 2011-12 series and CPI -
2012 series).
Exponential growth rates were estimated
for area, production and yield of pulses over
years. The functional form is,
y(t )  abt eu
Where, y(t) is Dependent variable for which
growth rate is estimated
a = intercept
b = regression coefficient
t = time variable (year)
e = error coefficient
u = disturbance term
The growth rate coefficient (b) was
computed by transforming the above equation
to the log linear form as equation:
Ln y(t) = ln a +t ln b+ u
The method of ordinary least squares was
adopted to estimate the coefficients. The
compound growth rates (g’s) in percentage was
computed using the relationship:
g = {(Anti ln of ln b)-1} x 100
The significance of the regression co-
efficient was tested using the Student’s t-test
as
bi
t
SE (bi )
Where, bi is the regression co-efficient of
the independent variable
SE (bi) is the standard error of the
regression co-efficient bi
t is the calculated t- value.
To measure the instability, Cuddy-Della
Valle index (Cuddy and Valle, 1978) was used.
This index overcomes the problems associated
with coefficient of variation when there is a time
trend in the data series. The Instability Index is
given by,
Instability Index = CV * (1-R2)0.5
Where, CV is the Coefficient of Variation
and is equal to standard deviation/mean
R2 is the coefficient of determination from
time trend regression.
Time series decomposition was carried out
to decompose the price series into different time
series components such as trend, seasonality
and remainder or the noise assuming a
multiplicative model (Hyndman &
Athanasopoulos (2018). The analysis was
carried out using R programming software.
RESULTS AND DISCUSSIONS
Both in terms of Wholesale Price Index
(WPI) and Consumer Price Index (CPI) based
measures, price indices of pulses were on decline
since the peak during 2016 as depicted in Figure
1 and Figure 2. As depicted in both figures,
prices of pulses started to increase gradually
after the peak during 2016.
Results of growth and instability analysis
Fig. 1. Monthly Wholesale Price Indices of Pulses in
India (April-2012 to March-2020)
 Bhat et al. : Analysis of growth, instability and time series decomposition of price indices of pulses in India 103

Table 2. Growth and instability in monthly price indices

of pulses in India (Jan-2014 to Feb-2020)
Pulses Growth rate Instability Index
(%) (%)
WPI Gram 0.41 *** 25.41
based Arhar -0.17 NS 23.76
Moong -0.27 *** 12.75
Masur -0.4 *** 13.62
Urad -0.1 NS 25.51
Peas/Chawali 0.57 *** 11.66
Rajma -0.37 *** 5.04
Fig. 2. Monthly Consumer Price Indices of Pulses in CPI Arhar (Tur) -0.12 NS 23.29
based Besan 0.44 *** 14.43
India (Jan-2013 to March-2020)
Gram products 0.47 *** 8.70
of monthly wholesale and consumer price Gram split 0.36 *** 17.04
indices for general, food and pulses categories Gram whole 0.37 *** 15.70
Khesari 0.28 *** 7.70
are presented in Table 1. The monthly
Masur -0.1 NS 12.08
compound growth rates were significant for Moong -0.16 *** 9.47
these three categories across CPI and WPI Other pulses products 0.36 *** 4.34
measures. The monthly compound growth Other pulses 0.28 *** 4.41
rates in pulses indices were lying between the peas [Pulses] 0.47 *** 7.69
growth rates of general and food categories. Urd -0.01 NS 20.28
Note: ***, ** and * indicate significance at 1, 5 and 10 per cent,
Table 1. Growth and instability in monthly price indices respectively
in India (Jan-2013 to March-2020)
Particulars WPI based measures CPI based measures to negative territory from February-2017 to
General Food Pulses General Food Pulses November-2018. Since December-2018, the
Growth rate (%) 0.31 *** 0.37 *** 0.21 *** 0.12 *** 0.29 *** 0.23 ***
Instability Index (%) 3.27 1.56 15.23 2.58 3.48 18.07
inflation rates in pulses were on the positive
Note: ***, ** and * indicate significance at 1, 5 and 10 per cent,
side. 
respectively In Figure 4, monthly inflation rate (%)
The growth and instability analysis of based on Consumer Price Indices in India from
monthly wholesale and consumer price indices Jan-2014 to March-2020 have been shown.
for different pulses are presented in Table 2. Here, inflation in pulses in percentage terms
The results indicated that among pulses, were negative from December 2016 to April-
instability in price indices of gram, arhar and 2019. Since May-2019, the inflation rate in
urad were on the higher sides in both WPI and pulses were positive and increasing.
CPI based measures. Year-wise seasonal plot of Wholesale Price
Monthly inflation rate (%) based on Indices of pulses in India from April-2012 to
Wholesale Price Indices in India from April- March-2020 has been presented in Figure 5.
2013 to March-2020 have been depicted in The Wholesale Price Indices of pulses were
Figure 3. The inflation rates in pulses slipped

Fig. 3. Monthly inflation rate (%) based on Wholesale Fig. 4. Monthly inflation rate (%) based on Consumer
Price Indices in India (April-2013 to March-2020) Price Indices in India (Jan-2014 to March-2020)
104 Journal of Food Legumes 33(2), 2020

plotted against months in year-wise fashion to

understand underlying seasonal patterns and
to identify years in which the patterns deviate.
During the year 2016 and 2015, prices were
unusually higher than the rest of the years./
Year-wise seasonal plot of Consumer Price
Indices of pulses in India from January-2013 to
March-2020 have been presented in Figure 6.
In case of Consumer Price Indices as well, the Fig. 7. Boxplot of Wholesale Price Indices of pulses in
India (April-2012 to March-2020)
year 2015 and 2016 were on the higher side
compared to other years.

Fig. 8. Boxplot of Consumer Price Indices of pulses in

Fig. 5. Year-wise seasonal plot of Wholesale Price
Indices of pulses in India (April-2012 to March-2020)
Fig. 6. Year-wise seasonal plot of Consumer Price
Indices of pulses in India (Jan-2013 to March-2020)
Boxplot of Wholesale Price Indices of
pulses in India (April-2012 to March-2020) is
depicted in Figure 7./ Boxplot visually depicts
the variability in the series across months. The
variability as indicated by boxplots were on the
higher side during the months from September
to December and from April to June.
Boxplot of Consumer Price Indices of
pulses in India (Jan-2013 to March-2020) is
depicted in Figure 8. It can be noted that
variability was lower during the months from
April to August.
Decomposition of multiplicative Wholesale
Price Indices of pulses in India (April-2012 to
March-2020) have been depicted in Figure 9
India (Jan-2013 to March-2020)
and decomposition using consumer price
indices have been shown in Figure 10.
Assuming the multiplicative time series model,
wholesale price indices of pulses were
decomposed. From Figure 9, it can be observed
that price series has been decomposed into
trend, seasonal components and the remaining
reminder for the noise was separated from
these two components. This time series
decomposition is helpful in estimating the
seasonal indices after removing the trend
components. Similar analysis was also carried
out for the consumer price index of pulses in
India. 
Seasonal indices were estimated using the
multiplicative decomposition model. Seasonal
indices (%) for Wholesale Price Indices of pulses
in India (April-2012 to March-2020) have been
Fig. 9. Decomposition of multiplicative Wholesale
Price Indices of pulses in India (April-2012 to March-
2020) please add observatory statement in legend
 Bhat et al. : Analysis of growth, instability and time series decomposition of price indices of pulses in India
Fig. 10. Decomposition of multiplicative Consumer
Price Indices of pulses in India (Jan-2013 to March-
2020)
graphically presented in Figure 11. The months
of October and November recorded higher
levels of seasonal indices whereas the month
of March recorded lowest seasonal index.
Fig. 11. Seasonal indices (%) for Wholesale Price
Indices of pulses in India (April-2012 to March-2020)
Seasonal indices (%) for Consumer Price
Indices of pulses in India (Jan-2013 to March-
2020) have been presented in Figure 12. As
indicated in the Figure 12, from the March
onwards till November, price indices were on
the rise, whereas price indices declined from
November onwards till March. It can be noted
that the period from October to December
coincides with major festival season in India.
Fig. 12. Seasonal indices (%) for Consumer Price
Indices of pulses in India (Jan-2013 to March-2020)
please add observatory statement in legend
105
CONCLUSION
Time series analysis of both consumer and
wholesale price indices were carried out, along
with time series decomposition to breakdown
the time series components into trends and
seasonality. This study estimated trends,
growth and instability in prices. The inflation
rates in pulses based on both consumer and
wholesale price were increasing after a period
of negative inflation rates in India. The analysis
revealed that the major festival period in India,
from October to December, coincided with
higher levels of prices in pulses in both consumer
and Wholesale based price indices clubbed with
higher variability during this period. This
suggests a need for policy measures to improve
the marketing efficiency in pulses to help both
consumers and also producers to realize better
prices and to establish a stable pulses price
regime. Recent policy changes to agricultural
marketing in India, have the potential to
increase competition among traders which in
turn leads to more transparent and efficient
markets for pulses in India.
REFERENCES
Bisht, A. and Kumar, A., 2019. Estimating Volatility in
Prices of Pulses in India: An Application of Garch
Model. Economic Affairs, 64(3), pp. 513-516.
Chand, Ramesh, S. S. Raju, and A. Amarender Reddy.,
2015. Assessing performance of pulses and
competing crops based on market prices and
natural resource valuation. Journal of Food
Legumes, 28(4): pp. 335-340.
Cuddy, J. D., AND Valle, P. D., 1978, Measuring the
instability of time series data. Oxford Bulletin of
Economics and Statistics, 40(1): 79-85.
Darekar, A. and Reddy, A.A., 2017. Price forecasting
of pulses: case of pigeonpea. Journal of Food
Legumes, 30(3), pp. 212-216.
Hyndman, R.J., & Athanasopoulos, G. 2018.
Forecasting: principles and practice, 2nd edition,
OTexts: Melbourne, Australia. OTexts.com/fpp2.
Reddy AA (2013) Strategies for reducing mismatch
between demand and supply of grain legumes,
Indian Journal of Agricultural Sciences 83 (3): 243-
59.
Sekhar, C.S.C., Roy, D. and Bhatt, Y., 2018. Food
inflation and volatility in India: trends and
determinants. Indian Economic Review, 53(1-2),
pp. 65-91.
 Journal of Food Legumes 33(2): 106-111, 2020

Impact of phosphorus, sulphur and seaweed sap on yield and economics

of chickpea (Cicer arietinum L.)
SL YADAV*1, ARVIND VERMA2, V NEPALIA3, GN YADAV4 ,
RK YADAV5 and KHAJAN SINGH6

ABSTRACT
1
Department of Agronomy, A Field experiment was conducted during two consecutive rabi seasons
Maharana Pratap University of viz. 2012-13 and 2013-14, to assess the response of different phosphorus,
Agriculture & Technology, Udaipur, sulphur and seaweed sap (prepared from Kappaphycus alvarezzi and
Rajasthan-313001, India Gracilaria sp.) levels on growth, yield and nutrient uptake of chickpea.
2
Department of Agronomy, The results reveal that application of phosphorus fertilizer at 40 and 60
MPUA&T, Udaipur, Rajasthan, India
3
kg/ha significantly increased the grain, haulm and biological yield in
Department of Agronomy,
chickpea. Application of sulphur at 20 and 40 kg/ha significantly
MPUA&T, Udaipur, Rajasthan, India
4
influenced the economic parameters. Seaweeds sap sprays at 10 % also
Department of Agronomy,
SKNAU, Jobner, Rajasthan, India
significantly enhanced the economics of chickpea. Applications of 40 kg
5
SKRAU, Bikaner, Rajasthan, India
phosphorus, 20 kg sulphur and 10 % seaweed sap spray recorded better
6
Agriculture University, Kota,
yield, net return and B:C ratio.
Rajasthan, India
Key words: Chickpea, Gracilaria, Kappaphycus, Phosphorus, Seaweed Sap,
*E-mail: yadav.agro@gmail.com Sulphur
Received: 26 April, 2020
Accepted: 31 August, 2020

Handling Editor:
Dr. Narendra Kumar, ICAR-IIPR,
Kanpur, India

India is the largest producer and consumer
of pulses in the world contributing to around
25-26 per cent to global pulse basket of 67.71
million tonnes (Ali et al., 2012), with total
production of 22.95 million tonnes from 29.46
million ha area, majority of which fall under
rainfed, resource poor and harsh environments
frequently prone to drought and other abiotic
stress conditions (Directorate of Economics and
Statistics, 2017). Chickpea is the third important
pulse crop in the world after dry bean and field
pea (Pisum sativum L.) (FAO, 2015). India
produced 11.23 million tonnes chickpea in
10.56 million ha area (Directorate of Economics
and Statistics, 2018). A number of factors,
including genetics and environment are
responsible for low yield of pulses and
imbalanced fertilization is one of the key factors
amongst them. Phosphorus is required in large
quantity for optimum growth and yield of
pulses. Chickpea is generally considered to be
highly efficient in extracting phosphorus from
low phosphorus soils due to the production of
acidic root exudates which dissolve insoluble
soil P. Phosphorus is the element for which
prudent management is required. In addition,
sulphur is also an important plant nutrient. Due
to continuous use of high analysis fertilizers like
urea and DAP and high yielding varieties,
sulphur deficiency has been reported as hidden
hunger in many crops, especially oilseeds and
pulses. Sulphur is a constituent of three amino
acid viz., methionine, cysteine and cystine,
deficiency of which results in serious
malnutrition. Disadvantages of chemical
fertilizers have led farmers to turn towards
suitable organic source of plant nutrients. To
meet increasing demand of organic sources,
among many viable options, one is the use of
seaweed extracts.
In recent years, use of natural seaweed
products as a substitute to conventional
chemical fertilizers has assumed importance
(Lingakumar et al., 2002) and has many
 Yadav et al.: Impact of phosphorus, sulphur and seaweed sap on yield and economics of chickpea (Cicer arietinum L.)
beneficial effects on plants (Norrie and Hiltz,
1999). Many claims have been made for
seaweed extract including increased frost
resistance, increasing nutrient uptake and
change in plant tissue composition, increased
resistance to fungal diseases, reduced incidence
of insect attack, higher yields, longer self-life of
produce, improved animal health when
livestock grazes on treated crops of pastures,
deeper root developments and better seed
germination (Zodape, 2001), delay of fruit
senescence, improved plant vigour, yield,
quality and also improved ability to withstand
adverse environmental conditions (Selvaraj et
al., 2004). Keeping the above facts in view, the
experiment was conducted with the objectives:
to standardize phosphorus and sulphur levels
for chickpea and to assess the effects of seaweed
saps spray on growth and productivity of
chickpea.
MATERIALS AND METHODS
The present investigation was carried out
during two consecutive rabi seasons of 2012-
13 and 2013-14 at Instructional Farm, College
of Technology and Engineering, Maharana
Pratap University of Agriculture & Technology,
Udaipur, Rajasthan, India, situated at South-
Eastern part of Rajasthan at the altitude of
582.17 meter above mean sea level with 24º35’
N latitude and 73°42’ E longitude. This region
falls under agro-climatic zone IVa “Sub-humid
Southern Plain and Aravalli Hills of Rajasthan’’.
This zone has typical sub-tropical climatic
conditions characterized by mild winters and
moderate summer associated with high relative
humidity during the months of July to
September. The mean annual rainfall of the
region is 637 mm, most of which is contributed
by south-west monsoon from July to September.
Soil of the site was sandy clay loam in texture,
alkaline in reaction and medium in organic
carbon status. The soil was medium in available
nitrogen, low in available phosphorus, high in
available potassium and low in available
sulphur.
The experiment consisted of 27 treatment
combinations of three phosphorus levels (20,
40 and 60 kg P2O5 ha-1), three sulphur levels (0,
20 and 40 kg S ha-1) and three foliar seaweed
107
sap sprays (water spray, 10% Kappaphycus sap
and 10% Gracilaria sap). These treatments were
evaluated using split plot design with three
replications. The sources used for applying N
(uniform basal dose) and P were urea and DAP,
respectively. Gypsum was used to supply S.
Three sprays of seaweeds sap were applied, 30,
45 and 60 days after sowing. The total spray
volume was 600 l/ha in each application.
Complete dose of N, P and S was applied before
sowing as basal application in furrows. The
same experimental site and lay out was
retained during both the years under study.
Most popular recommended chickpea variety
Pratap channa-1, treated with Rhizobium
culture, was sown in the experiment at the seed
rate of 80 kg/ha in the 4th week of October each
year after a pre-sowing irrigation. Furrows of
10-12 cm deep were opened with the help of
kudali in each plot at row spacing of 30 cm.
Fertilizers were placed in furrows as per
treatment after which the furrows were covered
with soil to 2-3 cm height. The crop was sown
in the same furrows where fertilizers were
placed at depth of about 6-8 cm deep. Foliar
spray of seaweed saps was done with the help
of knapsack sprayer. In order to make the spray
retention effective teepol, a sticking agent was
mixed @ 0.5 ml/l to spray solution.
Data were analyzed using analysis of
variance (ANOVA) as described by Panse and
Sukhatme (1989). Differences were considered
significant at 5% level of probability.
RESULTS AND DISCUSSION
Effect on yield parameters and yield of
chickpea: Pooled data (Table 1) revealed that
plant height of chickpea at harvest significantly
increased by 8.26 and 5.33 per cent when crop
was fertilized with 60 kg P2O5 ha-1 and 40 kg
P 2 O 5 ha -1 over 20 kg P 2 O 5 ha -1 (52.89 cm),
respectively. However, no significant difference
was observed amongst the treatments of 60 kg
P2O5 ha-1 and 40 kg P2O5 ha-1.
The magnitude of increase in primary
branches plant-1 at harvest with 40 kg P2O5 ha-1
was 8.60 per cent over 20 kg P2O5 ha-1 (3.14),
whereas phosphorus fertilization at 60 kg ha-1
failed to bring about perceptible variation in
number of primary branches. Application of
108 Journal of Food Legumes 33(2), 2020

Table 1. Effect of phosphorus, sulphur and seaweed sap on growth parameters and yield attributes of chickpea (2 year
pooled basis)
Plant height at Branches plant-1 Pods plant-1 Grains Grains Grain yield 100-grain
Treatment
harvest (cm) at harvest (nos.) (Nos.) pod-1 (Nos.) plant-1 (Nos.) plant-1 (g) weight (g)
Phosphorus levels (P2O5 kg ha-1)
20 52.89 3.14 39.09 1.32 45.80 5.37 13.71
40 55.71 3.41 42.36 1.41 54.03 6.53 14.31
60 57.26 3.45 44.23 1.43 55.41 6.75 14.58
S.Em.± 0.62 0.04 0.49 0.01 0.54 0.08 0.12
CD (P=0.05) 1.78 0.13 1.40 0.04 1.57 0.23 0.35
Sulphur levels (S kg ha-1)
00 52.72 3.10 39.85 1.33 46.77 5.60 13.82
20 56.37 3.43 42.23 1.41 53.51 6.39 14.31
40 56.76 3.47 43.61 1.42 54.97 6.65 14.47
S.Em.± 0.62 0.04 0.49 0.01 0.54 0.08 0.12
CD (P=0.05) 1.78 0.13 1.40 0.04 1.57 0.23 0.35
Seaweed sap spray
Control 53.24 3.11 39.68 1.33 47.02 5.58 13.72
Kappaphycussap(10%) 56.66 3.48 43.40 1.43 54.58 6.56 14.72
Gracilaria sap(10%) 55.95 3.41 42.62 1.40 53.65 6.50 14.15
S.Em.± 0.35 0.03 0.34 0.01 0.38 0.08 0.11
CD (P=0.05) 0.98 0.10 0.96 0.03 1.06 0.21 0.31

phosphorus at 60 kg ha-1 significantly increased
all the yield attributes of chickpea over 20 kg
ha-1. The highest number of pods plant-1, grains
pod-1, grains plant-1, grain yield plant-1 and 100-
grain weight were observed at 60 kg P2O5 ha-1
which was significantly superior over 20 kg
P2O5 ha-1 and at par with 40 kg P2O5 ha-1 (Table
1).
On application of sulphur @ 40 and 20 kg
S ha -1 , the plant height (cm) significantly
increased by 7.66 and 6.92 per cent,
respectively over control (52.72 cm). However,
the crop fertilized with 40 S ha-1 failed to exhibit
significant increase in plant height over 20 kg
S ha-1. The primary branches plant-1 at harvest
was significantly increased with 40 kg S ha-1
with 11.94 per cent increase over control (3.10),
however, sulphur fertilization at 40 kg ha -1
failed to bring about perceptible variation in
number of primary branches over 20 kg S ha-1.
40 kg S ha-1 recorded maximum values of yield
attributes but it was not significantly better over
20 kg S ha-1 except grain yield plant-1.
The pooled result show that foliar spray
of 10 per cent Kappaphycus and Gracilaria saps
recorded better plant height at harvest. The
magnitude of increase in plant height (cm) of
chickpea was 6.42 and 5.09 per cent with
application of 10% Kappaphycus sap and
Gracilaria sap over control, respectively (53.24
cm). However, the Kappaphycus and Gracilaria
saps recorded at par results. The magnitude of
increase in primary branches plant -1 with
Kappaphycus and Gracilaria saps was 13.38 and
9.65 per cent, respectively over control (3.11).
The spray of the seaweed extracts significantly
increased the yield attributes of chickpea over
control (water spray). Application of
Kappaphycus and Gracilaria seaweed saps
recorded at par results to each other in case of
all the yield attributes of chickpea except 100-
grain weight.
Grain yield was observed highest at 40 kg
P2O5 ha-1 which was statistically similar to 60
kg P2O5 ha-1. Application of 40 and 60 kg P2O5
ha-1 significantly increased the grain yield of
chickpea by 10.76 and 14.39 per cent over 20
kg P 2 O 5 ha -1 . The effect of phosphorus on
haulm yield was also depicted a similar trend,
where highest yield was recorded with 60 kg
P2 O5 ha-1 followed by 40 kg P 2 O5 ha-1 (14.58
and 10.93 per cent respectively) increase over
20 kg P2O5 ha-1. However, both the treatments
were not significantly different, biological yield
(grain + haulm) of chickpea also followed
similar trend to grain and haulm yield.
Application of increasing levels of sulphur
up to 60 kg ha-1 significantly increased the grain,
haulm as well as biological yield of chickpea
over preceding levels upto 60 kg P2O5 ha-1 levels.
The increase in terms of grain yield was 22.99
and 3.83 per cent over control and 20 kg S ha-1.
 Yadav et al.: Impact of phosphorus, sulphur and seaweed sap on yield and economics of chickpea (Cicer arietinum L.) 109

In case of seaweed saps maximum grain 43.51 per cent increase in net return over
yield was recorded with the foliar application control, respectively. Further, it was found that
of Kappaphycus sap over control however, it increase in S levels from control to 40 kg ha-1
recorded statistically at par results to that of progressively increased B: C ratio however, it
recorded under foliar application of Gracilaria was at par with 20 kg S ha-1. 40 kg S ha-1 gave
sap. The increase was in significant order over 1.49 of B: C ratio which was significantly higher
control by 15.96 and 13.43 per cent over by 4.93 and 43.27 per cent over 20 kg S ha -1
control, respectively due to application of and control, respectively.
Kappaphycus and Gracilaria sap. The haulm Data indicates significance of the foliar
yield of chickpea also recorded same trend as application of Kappaphycus and Gracilaria saps
that of grain yield. over control in making more net returns from
Effect on economics of chickpea : Pooled data cultivation of chickpea. On the basis of pooled
(Table 2) revealed that, significantly greater net data, when compared with net returns
return was obtained with the application of 60 recorded under control (Rs. 26620 ha-1), foliar
kg P2O5 ha-1 which was at par with 40 kg P2O5 application of Kappaphycus and Gracilaria saps
ha-1. On the other hand, 40 and 60 kg P2O5 ha- increased significantly by 17.75 and 13.22 per
1
registered 16.04 and 18.62 per cent higher net cent, respectively. B: C ratio of chickpea crop
returns over 20 kg P 2 O 5 ha -1 , respectively. remained unaffected by seaweed saps
Application of phosphorus at 40 kg P2O5 ha-1 application.
resulted in significantly higher B: C ratio
however, further increasing in phosphorus dose DISCUSSION
to 60 kg ha-1 was non-significant with 40 kg. In general, overall increase in chickpea
Data further revealed that application of 40 kg growth with increase in phosphorus can be
P2O5 ha-1 registered significantly higher B: C ascribed to its pivotal role in several
ratio over 20 kg P2O5 ha-1 which was statistically physiological and biochemical processes which
at par with higher dose of 60 kg P2O5 ha-1. The are of vital importance for growth and
account of increase in B: C ratio with 40 kg P2O5 development of the plant. It is an established
over 20 kg P2O5 is 11.38 per cent. fact that among nutrients, phosphorus is most
The figures are clear in presenting the important for exploiting the genetic potential
significance of 40 kg S ha-1 over all preceding of the crop for its growth and development
levels. Pooled statistics indicate that application (Tisdale et al., 2003). It is an established fact
of 20 and 40 kg S ha-1 resulted in 35.92 and that photosynthesis together with availability
Table 2. Effect of phosphorus, sulphur and seaweed sap on yield and economics of chickpea (2 year pooled basis)
Treatment Grain yield (kg ha-1) Haulm yield (kg ha-1) Biological yield (kg ha-1) Net returns (Rs./ha) B: C ratio
Phosphorus levels (P2O5 kg ha-1)
20 1320 2489 3809 26327 1.23
40 1462 2761 4223 30550 1.37
60 1510 2852 4362 31228 1.34
S.Em.± 18 34 49 628 0.03
CD (P=0.05) 51 98 140 1808 0.08
Sulphur levels (S kg ha-1)
00 1257 2370 3626 23220 1.04
20 1489 2813 4302 31561 1.42
40 1546 2920 4465 33324 1.49
S.Em.± 18 34 49 628 0.03
CD (P=0.05) 51 98 140 1808 0.08
Seaweed sap spray
Control 1303 2456 3759 26620 1.30
Kappaphycussap(10%) 1511 2855 4366 31346 1.35
Gracilaria sap (10%) 1478 2791 4269 30139 1.30
S.Em.± 17 31 46 595 0.03
CD (P=0.05) 47 88 129 1677 NS
110 Journal of Food Legumes 33(2), 2020
of assimilates (source) and storage organs (sink)
exerts an important regulatory effect on the
complex processes of yield formation. The
regulatory functions of phosphorus in
photosynthesis and carbohydrate metabolism
of leaves can be considered to be one of the
major factors limiting plant growth, particularly
during reproductive phase. The level of
phosphorus during this period regulates
starch/sucrose ratio in the source leaves and
reproductive organs (Gianquinta and
Quebedeaux, 1980). The results of improvement
in growth and yield of chickpea with
application of P in present investigation are in
cognizance with that of Deo and Khandelwal
(2009), Nawange et al. (2011) and Shivran and
Prakash, (2012).
The role of sulphur can be viewed from its
participation in the primary and secondary
metabolism as constituent of various organic
compounds that are vital for functioning of
plant processes. Sulphur in the form of
sulphate, is best known for its role in synthesis
of sulphur containing amino acids, namely
methionine, cysteine and cystine (Lakkaneni
and Abrol, 1994). It is also involved in
chlorophyll formation, being a constituent of
succinyl coenzyme A synthetase (Pirson, 1955).
It is also a constituent of glutathione, a
compound supposed to play vital role in plant
respiration and synthesis of oil (Jordon and
Reisenaur, 1957). Increase in yield parameters
of chickpea with S application could be ascribed
to its role in improving mineral nutrition of the
crop. S fertilization play an important role to
alter physico-chemical properties of soil
conducive for growth and development of the
crop. Reviewing the work done on effect of
gypsum (S source) application to a variety of
crops, it was inferred that its application
promoted root growth and yield of crops
(Shainberg et al., 1989). This eventually suggests
better availability of nutrients. These nutrients
upon translocation towards reproductive
structures and also higher photosynthetic
activity might have resulted in significant
increase in yield attributes and yield.
Seaweed extracts are rich source of several
primary nutrients like K, P; secondary nutrients
like Ca, Mg; trace elements like zinc (Zn),
copper (Cu), iron (Fe), manganese (Mn) and
beneficial elements like nickel (Ni), sodium (Na)
etc. Sea weed extracts stimulate various aspects
of growth and development resulting in overall
good health of the plants, while deliberating
the effect of seaweed extracts on crops the
aspects of root development and mineral
absorption, shoot growth and photosynthesis
and ultimately crop yield, even vegetative
propagation can also be taken into
consideration.
It is an established fact that India has vast
sea coast having abundance of marine
seaweeds. Seaweeds are good source of
nutrient and plant growth promoting
substances (Norrie and Hiltz, 1999).
Kappaphycus and Gracilaria seaweed extracts
has growth substance like indole acetic acid,
riboflavin and auxins which may have
increased cell division, cell development and
caused beneficial effect on the growth and
development of root and shoot of the plant. It
also enhanced the nutrient supply, absorption,
translocation and their metabolism and also the
growth promoting substances present in extract
resulted in enhanced plant height and
branches/plant. Increase growth may probably
due to the availability of auxin, cytokinin and
other micro elements present in the seaweed
sap (Selvakumari et al. 2013).
ACKNOWLEDGEMENT
The authors are thankful to Dr. S.T.
Zodape, C.S.M.C.R.I., Bhavnagar (Gujarat) for
providing the seaweed extract.
REFERENCES
Ali, M, Kumar N and Ghosh, PK 2012. Molestones on
agronomic research in pulses in India. Indian
Journal of Agronomy 57: 52-57.
Deo, C and Khandelwal, RB 2009. Effect of P and S
nutrition on yield and quality of chickpea
(Cicerarietinum L.). Journal of the Indian Society of
Soil Science 57: 352-356.
Directorate of Economics and Statistics. 2017.
Agricultural Statistics at a Glance 2017.
Department of Agriculture and Cooperation.
Ministry of Agriculture & Farmers Welfare,
Government of India.
Directorate of Economics and Statistics. 2018.
 Yadav et al.: Impact of phosphorus, sulphur and seaweed sap on yield and economics of chickpea (Cicer arietinum L.)
Agricultural Statistics at a Glance 2018.
Department of Agriculture and Cooperation.
Ministry of Agriculture & Farmers Welfare,
Government of India.
FAO, 2015. FAOSTAT Production statistics, Food and
Agriculture Organization, Rome. (http://
www.faostat.fao.org).
Gianquinta, R.T. and Quebedeaux, B. 1980. Phosphate
induced changes in assimilate partioning in
soybean leaves during pod filling. Plant Physiology
65: 119.
Jordon, H.V. and Reisenaur, H.M. 1957. Sulphur and
soil fertility. pp.107-111. In: Soil Year Book
Agriculture, USDA, Washington.
Lakkaneni, K.C. and Abrol, Y.P. 1994. Sulphur
requirements of crop plants: Physiological analysis.
Fertilizer News 39(3): 11-18.
Lingakumar, K, Jayaprakash, R, Manimuthu, C and
Haribaskar, A 2002. Gracilaria edulis an effect source
as growth regulator for legume crops. Seaweed
Research and Utilization 24: 117-123.
Nawange, D.D., Yadav, A.S. and Singh, R.V. 2011.
Effect of phosphorus and sulphur application on
growth, yield attributes and yield of chickpea (Cicer
arietinum L.). Legume Research 34: 48-50.
Norrie, J. and Hiltz, D.A. 1999. Seaweed extract
research and application in agriculture. Agro Food
Industry Hi-Tech 10: 15-18.
111
Panse, V.G. and Sukhatme, P.V. 1989. Statistical
Methods for Agricultural Workers, ICAR, New
Delhi
Pirson, A. 1955. Functional aspects of mineral nutrition
of green plants. Plant Physiology 6: 71-144.
Selvakumari, P., Venkatesan, K., Jeyakumar, P. and
Pugalendhi, L. 2013. Response to Seaweed Extract
on Growth and Yield of Tomato (Solanum
lycopersicum L.) Hybrid COTH 2. The Madras
Agricultural Journal 100: 163-166.
Selvaraj, R., Selvi, N. and Shakila, P. 2004. Effect of
seaweed liquid fertilizer on Abelmoschus esculentus
(L.) Moench and Lycopersicon lycopersicom Mill.
Seaweed Research and Utilization (Special issue)
26: 121-123.
Shainberg, I., Sumner, M.E., Miller, W.P., Farina,
M.P.W., Pawan, M.A. and Fey, M.V. 1989. Use of
gypsum on soils : A review. Advances of Soil
Science 9: 1-111.
Shivran, RK and Prakash, C 2012. Productivity,
profitability and protein content of chickpea (Cicer
arietinum) as influenced by farm yard manure,
phosphorus and sulphur application. Trends in
Biosciences 5: 104-106.
Tisdale, S.L., Nelson, W.L., Beaton, J.D. and Havlin,
J.L. 2003. Soil fertility and fertilizer (6th ed). Person
Education (Singapore), Pte. Ltd., New Delhi, India.
Zodape, S.T. 2001. Seaweed as a biofertilizer. Journal
of Scientific and Industrial Research 60: 378- 82.
 Journal of Food Legumes 33(2): 112-117, 2020

Impact of greengram demonstrations in Jabalpur district of

Madhya Pradesh
AK SINGH1*, SIDDARTH NAYAK1, SRK SINGH2, YR KHARE1,
NITIN SINGHAI1 and DP SHARMA1

1
Krishi Vigyan Kendra, Jawaharlal
Nehru Krishi Vishwa Vidyalaya,
Jabalpur – 482004, Madhya Pradesh,
India;
2
ICAR-Agricultural Technology
Application Research Institute, Zone
IX, Adhartal, Jabalpur-482004,
Madhya Pradesh, India
*
Email: singhak123@rediffmail.com
Received: 25 April, 2020
Accepted: 10 August, 2020
Handling Editor:
Dr. Uma Sah, ICAR-IIPR, Kanpur
ABSTRACT
To assess the cumulative impact of greengram improved cultivars,
integrated weed, nutrient and pest management, frontline
demonstrations were conducted in summer season from 2016-17 to 2018-
19 at 225 farmers’ fields in thirteen villages under six blocks of the district.
Three years pooled data revealed that the yield attributes i.e. primary
branches and pods/plant under demonstration were 28.53 and 27.14 per
cent greater to that of farmers practice. Grains/pod and test weight were
noted to be 9.25 and 36.28 g in the demo which were 10.51 and 15.76 per
cent higher over farmer’s practice. Average seed yield under
demonstrated plots was found to be 1281 kg/ha and it was 40.92 per cent
higher to that of farmers practice (909 kg/ha), with additional net return
of Rs. 19485/ha. The summer greengram technology disseminated in
further 38869 ha in 2019-20 over the area reported in 2014-15 and
generated 293 crores revenue over that of 32.21 crores in 2014-15.
Key words: Cultivar, Technology demonstration, Promising parameters,
Yield, Adoption, Diffusion etc.

The major sources of dietary protein are
pulses for majority of population in our country.
Besides being the source of protein, pulses
contribute substantially to food production
system by enriching the soil through biological
nitrogen fixation and improving soil physical
conditions. Though pulses are consumed all
over the world, its consumption is higher in
those parts of the world where animal proteins
are scarce and expensive (Ofuya and Akhidue
2005). Among the food crops, pulses are very
important for human consumption and animal
feed. Being leguminous in nature, they are
considered to be important components of
cropping systems because of their feasibility to
fix atmospheric nitrogen, add substantial
amounts of organic matter to the soil and
produce reasonable yields with low inputs
under harsh climatic and soil conditions
(Rakhode et al. 2011).
Owing to stagnant pulse production and
continuous increase in population, the per
capita availability of pulses has decreased
considerably. The major constraints in pulse
production are inadequate supply of quality
seeds, low seed rate replacement, insufficient
use of inputs, cultivation mostly under rainfed
conditions because more than 87 per cent of
the area under pulses is presently rainfed, biotic
and abiotic stress, technology gap, lack of
attractive market price, lack of proper
procurement and poor storage facilities of the
farm produce. According to recent estimates,
pulses were cultivated in more than 29 million
ha area with the production of 25.23 million
tonnes at a productivity level of 841 kg/ha in
the country during 2017-18 (Anonymous 2019).
Among the twelve major producing states,
Madhya Pradesh is the leading state in the
country which contributed more than 8 million
tonne of the total production. During 2017-18
greengram was sown over an area of 4.26
million ha nationwide and recorded a
production of 2.01 million tonne at yield level
of 472 kg/ha.
Madhya Pradesh is the second largest state
in greengram production in the country.
Greengram is widely grown in Kymore Plateau
& Satpura Hill region of the state especially in
Jabalpur district; however the productivity is
 Singh et al. : Impact of demonstrations on greengram
relatively less looking at the availability of
resources. Improved production technologies
illustrate there is a gap in potential and realized
yield. Keeping in view the significant role in
appropriate transfer of technologies and
changing methodical nature of the famers,
frontline demonstrations on summer
greengram were conducted in different blocks
with the intention to have better impact of the
demonstrated technologies on the farmers and
field level extension functionaries.
Description of area and conceptual
framework: Jabalpur is a district of Madhya
Pradesh state which falls under Kymore Plateau
and Satpura Hills agro-ecological region. Nearly
70 per cent area of the district is covered by
medium to deep black soils; however red-
yellow skeletal soils exist in rest part of the
district. Rice, blackgram, greengram, soybean
are the major kharif crops and wheat, chickpea,
fieldpea, lentil grown in the district in rabi
season. Major cropping pattern of the district
is rice-wheat, rice-chickpea, Fallow-fieldpea-
wheat-greengram. Nearly 77 per cent of the net
sown area is double cropped with more than
80 per cent irrigated area in the district.
Greengram is reported to be grown in 11000
ha in the district during kharif 2017 with the
production of 4900 tonne at productivity level
of 444 kg/ha (Anonymous 2018), which was
quite low than national productivity. There are
ample possibilities to elevate the productivity
in view of the climate and prospective
availability of natural resources in the region.
The area under summer greengram in the
district is progressively increasing due to
enhanced irrigated area in the district as well
as in the agro-ecological region. This practice
may probably be the better alternative of
waterlogging problem in black soils for such
crops which are sensitive to this problem and
affected adversely during kharif season; and
finally in enhancing the productivity and
acreage with increase in cropping intensity as
well. Saravanakumar and Alagesan (2017)
conducted technology demonstrations on
greengram and found that the seed yield under
recommended practice was 689 kg/ha
compared to 574.5 kg/ha in farmers’ practice
with a yield advantage of 19.9 per cent over
113
the farmers’ practice. Similarly Poonia and
Pithia (2011), Singh and Meena (2011), Meena
et al. (2012), Raj et al. (2013), Math et al. (2014),
and Meena and Singh (2017) found more grain
yield of FLD plots than the existing farmer’s
practices. Sharma et al. (2014) found in a study
that majority of FLD farmers (88 per cent) had
medium to high knowledge level whereas only
50 per cent non FLD farmers have medium to
high knowledge level about improved
technologies of green gram. Trivedi et al. (2019)
reported that the cultivation practices
comprised under CFLD viz. use of improved
varieties, proper seed rate, seed inoculation by
Rhizobium and PSB culture, soil test based
application of fertilizer, integrated pest
management, irrigation and hand weeding
produced on an average of 49% more yield of
green gram as compared to farmer’s practices.
MATERIALS AND METHODS
Cluster frontline demonstrations were
conducted in participatory mode on greengram
in summer season to evaluate the impact of
improved cultivar with integrated nutrient and
pest management in rice-wheat-greengram,
rice-chickpea-greengram and Fallow-fieldpea-
wheat-greengram cropping system at 100, 75
and 50 farmers’ fields respectively during 2016-
17 to 2018-19 in thirteen randomly selected
villages spread over six blocks namely Panagar,
Majhouli, Patan, Shahpura, Sihora and
Kundam of the district. Each demonstration
was conducted in an area of 0.40 ha with a
check plot that was closest to the demonstration
site and kept as farmers’ practice. The improved
production technology package included
MYMV disease tolerant resistant cultivars PDM
139, IPM 02-03 and MH 421 in 2016-17, 2017-
18 and 2018-19 respectively in the technology
demonstrations. Seed treatment was carried
out with pre-mix fungicide (carbendazim 12%
+menkojeb 63%) @ 2g/kg seed, followed by
insecticide (thiamethoxam 30% FS) @ 5 ml/kg
seed and biofertilizers (rhizobium & phosphate
solubilizing bacteria) @ 10g/kg seed for
increasing the availability of nitrogen to the
crop and better phosphorus use efficiency. All
the demonstrations were laid in second fortnight
of March every year using the seed rate of 25
114
kg/ha. Sowing was carried out with seed-cum-
ferti-drill and the distance between the rows
and plants within rows was kept 30 and 10 cm
respectively. Soil application of phosphate
solubilizing bacteria (PSB) and vesicular
arbuscular mycorrhiza (VAM) was done @ 5
and 10 kg/ha respectively in each
demonstration before last ploughing during
field preparation. NPK was applied @ 20:50:20
kg/ha on the basis of soil test values. Fertilizer
sources included urea (46% N), single super
phosphate (16% P 2 O 5 and 12% S) and
potassium chloride (60% K2O). Entire quantities
of the NPK fertilizers were applied during
sowing. Post-emergence pre-mix herbicide i.e.
imazethapyr 35% + imazamox 35% w/w WG
(70 WG) was applied through flat fan nozzle
sprayer @ 75g a.i./ha at 18-20 DAS for efficient
weed management. Foliar application of plant
growth promoting rhizobacteria i.e.
Pseudomonas fluorescens was done twice at 25
and 35 DAS @ 2.5 litre/ha for better crop vigour
and spray of pre-mix insecticide betacyfluthrin
+ imidacloprid 300 OD was done for control of
white fly and other sucking pests @ 500 ml/ha
at 45 DAS. The crop was harvested at maturity
stage in first fortnight of June every year.
RESULTS AND DISCUSSION
Promising Parameters: The mean of the values
of promising parameters of the technology
demonstrations on greengram presented in
Table 1 revealed that the plant height under
demonstrated plot was 50.81 cm which was
2.54 per cent high over farmers practice (49.55
cm). The yield attributing characters i.e.
Table 1. Effect of technology demonstrations on
promising parameters of greengram
Promising Unit Observation
parameters
Farmers’ Improved over FP
practice practice
Plant height cm 49.55 50.81
Branches/plant Number 3.75 4.82
Pods/plant Number 26.68 33.92
Grains/pod Number 8.37 9.25
Test weight g 31.34 36.28
(1000 seed)
Journal of Food Legumes 33(2), 2020
primary branches and pods/plant under
demonstration were 4.82 and 33.92 respectively
which were 28.53 and 27.14 percent greater to
that of farmers practice. Number of grains/
pod, one of the important yield attributes, was
recorded to be 9.25 in technology
demonstrations and it was 10.51 per cent high
over farmer’s practice (8.37). The data
pertaining to test weight (1000 seed) indicated
that it was 36.28 g in technology
demonstrations which was 15.76 per cent
higher over existing practice. The findings
confirm with the findings of Yadav et al. (2007),
Meena et al. (2012) and Meena and Singh
(2017) who found higher yield attributes in
pulses under FLD plots.
Economic Parameters: Three year cluster
demonstration results revealed that the average
greengram yield under demonstrated plots was
observed to be 1281 kg/ha (Table 2) which was
40.92 per cent higher over farmers existing
practice (909 kg/ha). These results are in
agreement with those of with
Saravanakumar and Alagesan (2017) who
found 19.9 per cent higher seed yield of
greengram over farmers practice. Trivedi et al.
(2019) also reported that the improved variety
and other technology components resulted 49%
more yield of green gram as compared to
farmer’s practices. Meena (2018) reported that
grain yield of mungbean under demonstration
varied from 27.07 to 54.60% than farmers own
practices. The economics of the technology
demonstrations indicated that an additional net
return of Rs. 19485/ha recorded over the
traditional farmers’ practice. The B:C ratio
under technology demonstration was noticed
to be 3.64 which was 0.67 units greater over
farmers practice (2.97). The higher additional
Per cent returns and effective gain obtained under
increase
technology demonstrations could be due to
improved technology, non-monetary factors,
timely operations of crop cultivation and
2.54
technical monitoring. The results are in
28.53 conformity with the findings of front line
27.14 demonstrations on pulses by Yadav et al. (2004),
Lothwal (2010), Gauttam et al. (2011),
10.51
Chaudhary (2012), Dayanand et al. (2012),
15.76 Meena and Dudi (2012) and Meena and Singh
(2017).
 Singh et al. : Impact of demonstrations on greengram 115

Table 2. Economics of summer greengram cluster frontline demonstrations (pooled data of three years)
Particulars Pooled yield Cost of Gross Return Net Return Additional Benefit Cost Incremental
(2016-17 to 2018-19) Cultivation (Rs/ha) (Rs/ha) Net Return (B:C) Ratio BCR
in kg/ha (Rs ha-1) (Rs/ha)
Improved practice 1281 21059 76604 55545 19485 3.64 0.67
Farmer’s practice 909 18298 54358 36060 -- 2.97 --

Socio-economic and environmental impact of demonstrated in 2016-17, 2017-18 and 2018-

the technology: Cultivation of improved
varieties (PDM 139, IPM 02-03, MH 421) with
proper seed treatment reduced the cost of
production. This was because it reduced various
seed borne diseases, aerial diseases and pest
infestations which usually occurred earlier as
most farmers’ sprayed fungicides after disease
appearance. This did not effectively control the
disease, rather the cost of production increased.
Insecticide used for seed treatment protected
the crop from insect-pests up to 35 days, saved
one insecticide spray and indirectly reduced
environmental pollution in comparison to most
farmers who did not treat the seed with
insecticide, used one foliar spray of insecticide
at 25-30 days and second at 40-45 days crop
stage. Seed treatment with rhizobium & PSB,
soil application of PSB & VAM and foliar
application of Pseudomonas fluorescens increased
the N2 fixation, solubility and availability of
P2 O5 ; and other essential nutrients to plants
which saved phosphate, potassium and
micronutrient fertilizers to the extent of 20-25
per cent. A detailed survey was carried out by
KVK in 2019-20 to assess the impact of three
years of greengram cluster demonstrations with
the help of Agriculture Technology
Management Agency (ATMA) and Farmer’s
Welfare & Agricultural Development
(FW&AD) department Jabalpur. The results
of the survey indicated that the improved
varieties (PDM 139, IPM 02-03 and MH 421)
Table 3. Yield enhancement through technology dissemination of summer greengram and additional revenue generation
in the district
Summer greengram area (ha) Yield
(kg/ha)
BTD* ATD@
AADT#
(2014- (2019- FP¶
(2019-20)
15) 20)
19 were found to be disseminated in additional
38869 ha over the area recorded before
technology dissemination during 2014-15 i.e.
6516 ha (Table 3). Due to extensive adoption
of the technology, a considerable increase in
area was noticed and it reached to 45385 ha in
2019-20 with remarkable increase in seed yield
(30.58 per cent) and increased net return that
ultimately lifted the socio-economic status of the
farming community in the district. Due to
extensive adoption of improved varieties and
other technology components, the revenue from
the crop increased manifolds and it recorded
293 crores in the district in 2019-20 in
comparison to that of 2014-15 (32.21 crores).
Additional revenue of Rs.250.94 crores
generated through the demonstrated varieties
and technology in the district vis-a-vis increase
in cropping intensity which reached to 300 per
cent in 45385 ha area in 2019-20. A study
conducted by Sarkar et al. (2018) reflected that
CFLD programme on pulses in Cooch Behar
district improved the socio-economic condition
of farmers as well as it generated additional
employment through pulse processing industry.
Horizontal spread of the technology: The block
wise net sown, double cropped, irrigated and
absolute area under demonstrated technology
of summer greengram given in table-4, revealed
that the highest area under summer greengram
cultivation was observed in Shahpura block
followed by Patan, Majholi and Jabalpur blocks
Yield Total production Revenue Additional
enhancement in metric tonne generation in Revenue
% (Yield/ha x Area district (in crores) generation in
in ha) @Rs.6000 per q district
(in crores)
IP§ BTD ATD BTD ATD

6516 45385 38869 824 1076 30.58 5369.18 48834.26 32.21 293 250.94
* @ # ¶
Before technology dissemination, After technology dissemination, Absolute area under disseminated technology, Farmer’s practice,
§
Improved practice
116 Journal of Food Legumes 33(2), 2020

of the district with an absolute area of 12060,
9095, 7860 and 4875 ha under disseminated
technology, respectively (Table 4). The irrigated
area in the year 2018-19 was recorded to be
16.14 to 100 per cent among all the blocks with
an average of 81.21 per cent in the district.
Highest irrigated area was recorded in Sihora
(100 per cent) and the lowest in Kundam block
(16.14 per cent) of the district. Amongst
resources, availability of irrigation water largely
contributed in the extensive adoption vis-a-vis
area enhancement of the demonstrated summer
greengram technology with remarkable
increase in yield.
Cluster demonstration of improved
varieties of summer greengram with other
technology components led to increase in area
from 6516 ha reported in 2014-15 (before
technology dissemination) to 45385 ha in 2019-
20 in the district. Technology was disseminated
in 67 villages across all seven blocks (Jabalpur,
Panagar, Majholi, Patan, Shahpura, Sihora and
Kundam) of the district amongst 66890 farmers
(Table 5). An average yield of 1076 kg/ha was
observed in summer greengram due to adoption
of improved varieties (PDM 139, IPM 02-03,
MH 421) and other technology components by
the farmers. An average net return of Rs. 45020
per ha was received under the demonstrated
technology with the B:C ratio of 3.30.
Technology adoption and diffusion mechanism:
Subsequent to assessment of improved cultivars
with integrated nutrient and pest control
measures through on farm trials integrated crop
management demonstrations on greengram
were conducted in kharif and summer season
during the year 2012 to 2015. Based on the
results of these demonstrations the technology
was disseminated through cluster frontline
demonstrations (CFLDs) from 2016-17 to 2018-
19. Trainings on different aspects were
conducted for farmers and farm women in each
village; besides this farmers’ seminar, training
to extension personnel, group discussion and
field day was organized and the technology
was popularized through news coverage,
scientific advisories, popular articles and
folders/pamphlets. The neighbour villagers
also adopted the whole technological package
after conducting the cluster frontline
demonstrations in the cluster of villages and the
mass diffusion of the technology was carried
out in convergence with Agriculture
Technology Management Agency (ATMA),
Farmer’s Welfare & Agricultural Development
(FW&AD) through various extension tools.
Based on the above findings it may be

Table 4. Block wise net sown, irrigated and absolute area under greengram technology demonstration using improved
cultivars
Blocks Net sown Double Per cent of Irrigated Per cent Summer greengram area (ha)
area in ha cropped net sown area in ha of net BTD* ATD@ AADT#
(2018-19) area in ha area (2018-19) sown (2014-15) (2019-20)
(2018-19) area
Jabalpur 34441 20215 58.69 28242 82.00 534 4875 4341
Panagar 28136 20893 74.26 27792 98.78 138 2480 2342
Kundam 35193 8840 25.12 5679 16.14 166 2185 2019
Patan 49695 48308 97.21 49604 99.82 1695 10790 9095
Shahpura 55347 43715 78.98 42290 76.41 2485 14545 12060
Sihora 27745 26186 94.38 27745 100 378 2650 2272
Majholi 39824 39730 99.76 38086 95.64 1120 7860 6740
Total 270381 207887 76.89 219565 81.21 6516 45385 38869
*
Before technology dissemination, @ After technology dissemination, #Absolute area under disseminated technology

Table 5. Horizontal spread and average net return of summer greengram production technology in district

ACZ / District Varieties Technology No. of Area Average Cost Net B:C
spread farmers (ha) yield (Rs/ha) return Ratio
(No of (q/ha) (Rs/ha)
villages)

Kymore Plateau & PDM 139, 67 66890 45385 10.76 19540 45020 3.30
Satpura Hills/ IPM 02-03,
Jabalpur MH 421
 Singh et al. : Impact of demonstrations on greengram
inferred that disease tolerance, mungbean
yellow mosaic virus (MYMV) in particular and
high yielding characteristics which were the
strength of demonstrated cultivars, resulted in
remarkably greater yield when coupled with
integrated nutrient, weed and pest
management components. The cluster
demonstration approach and various extension
tools boosted diffusion of the cultivars which
not only raised seed yield but also the acreage
and revenue of the district.
REFERENCES
Anonymous 2018. Agriculture statistics of Madhya
Pradesh. Ministry of Farmers Welfare & Agriculture
Department. Government of Madhya Pradesh,
India.164 pp.
Anonymous 2019. Pulses Revolution - From Food to
Nutritional Security. Ministry of Agriculture &
Farmers Welfare, Department of Agriculture
Cooperation & Farmers Welfare, GoI, New Delhi,
India. 122 pp.
Chaudhary S. 2012. Impact of frontline demonstration
on adoption of improved greengram production
technology in Nagaur district of Rajasthan. M.Sc.
Thesis, SKRAU, Bikaner, India.
Dayanand, Verma RK and Mahta SM. 2012. Boosting
the mustard production through front line
demonstrations.Indian Research Journal of
Extension Education 12(3): 121-123.
Gauttam US, Paliwal DK and Singh SRK. 2011. Impact
of frontline demonstrations on productivity
enhancement of chickpea. Indian Journal of
Extension Education 48(3&4): 10-13.
Lothwal OP. 2010. Evaluation of front line
demonstrations on blackgram in irrigated agro-
ecosystem. Annals of Agricultural Research
31(1&3): 24-27.
Math G., Vijayakumar AG, Hegde Y and Basamma K.
2014. Impact of improved technologies on
productivity enhancement of sesame (Sesamum
indicum L.). Indian Journal of Dryland Agricultural
Research and Development 29(2): 41-44.
Meena ML and Dudi A. 2012. On farm testing of
chickpea cultivars for site specific assessment
under rainfed condition of western Rajasthan.
Indian Journal of Extension Education 48(3&4):
93-97.
Meena ML and Singh D. 2017. Impact assessment of
frontline demonstrations on greengram: Experience
from rainfed condition of Rajasthan. Journal of
Applied and Natural Science 9(4): 2456–2460.
Meena ML and Singh D. 2017. Technological and
extension yield gaps in greengram in Pali district
117
of Rajasthan, India. Legume Research 40(1): 187-
190.
Meena OP, Sharma KC, Meena RH and Mitharwal BS.
2012. Technology transfer through FLDs on
mungbean in semi-arid region of Rajasthan.
Rajasthan Journal of extension Education 20: 182-
186.
Meena ML. 2018. Scaling mungbean production in
rainfed agroecology of Rajasthan in India through
frontline demonstrations. Journal of Food Legumes
31(4): 247-253.
Ofuya ZM and Akhidue V. 2005. The role of pulses in
human nutrition: A review. Journal Applied
Sciences and Environmental Management 9: 99-
104.
Poonia TC and Pithia MS. 2011. Impact of front line
demonstrations on chickpea in Gujarat. Legume
Research 34(4): 304-307.
Raj AD, Yadav V and Rathod JH. 2013. Impact of front
line demonstrations (FLD) on the yield of pulses.
International Journal of Scientific and Research
3(9): 1-4.
Rakhode PN, Koche MD and Harne AD. 2011.
Management of powdery mildew of greengram.
Journal of Food Legumes 24(2): 120-122.
Sarkar S, Das G and Biswas S. 2018. Outcome of CFLD
programme on pulse production: A study in
Eastern Himalayan Terai Region of India. Journal
of Food Legumes 31(3): 178-180.
Saravanakumar S and  Alagesan P. 2017. Productivity
enhancement in green gram through frontline
demonstrations in Erode district of Tamil Nadu.
International Journal of Farm Sciences 7(4): 16-19.
Singh D and Meena ML. 2011. Boosting seed spices
production technology through front line
demonstrations. International Journal of Seed
Spices 1(1): 81-85.
Sharma R, Arora D, Porwal Rand Bhati DS. 2014.
Knowledge empowerment of green gram growers
through frontline demonstrations. Journal of
Progressive Agriculture 5(2): 121-123.
Trivedi HK, Jain VK, Tomar SS, Gupta BS and Panika
AK. 2019. Enhancing the Productivity of Green
gram (moong) through Cluster Front Line
Demonstration in the Ashoknagar District of
Madhya Pradesh. Technofame 8(2): 63–66.
Yadav DB, Kambhoj BK and Garg RB. 2004. Increasing
the productivity and profitability of sunflowers
through frontline demonstrations in irrigated agro
ecosystem of eastern Haryana. Haryana Journal of
Agronomy 20(1): 33-35.
Yadav VPS, Kumar R, Deshwal AK, Raman RS, Sharma
BK and Bhela SL. 2007. Boosting pulse production
through frontline demonstration. Indian Journal
of Extension Education 7(2): 12-14.
 Journal of Food Legumes 33(2): 118-122, 2020

Short Communication
Simultaneous selection index based on yield, stability and resistance to
wilt for desi chickpea in North West Plain Zone of India
HEMANT KUMAR*1, GP DIXIT1, AK SRIVASTAVA1 and NP SINGH1

*1ICAR-Indian Institute of Pulses
Research, Kanpur -208024, India
*Email: rushtohemant@rediffmail.com
Received: 24 June, 2020
Accepted: 01 September, 2020
Handling Editor:
Dr. Amarender Reddy, ICAR-CRIDA,
Hyderabad
ABSTRACT
Development and use of high-yielding genotypes, resistant to the
prevalent race of wilt (Fusarium oxysporum L) in a given area is the most
practical and cost-efficient disease control measure and is accorded
priority for promoting entries to in next level of evaluation trial in national
coordinated evaluation programs. Taking consideration of wilt infestation
along with genotypic stability and average yield, an index has been
developed and computed to rank the chickpea genotypes for the
promotion of genotypes in next level of the trial. Average yield, genotypic
stability and percentage wilt infestation are three components in this
index. For stability component additive main effects and multiplicative
interaction (AMMI) model is used. Based on the AMMI model, this index
has been used to rank the genotypes along with wilt infestation and
average yield. This index is the weightage of wilt infestation, genotypic
stability and yield component and higher the index value better is the
genotypes.

Key words: Desi chickpea, Genotype stability, Selection index, Wilt

Resistance, Yield

Chickpea has the largest share of area and
production among all the pulse crops grown
in India (Anonymous, 2019). More than 200
varieties have been released till date in the
country which are suitable for cultivation in
different ecological regions (Dixit et al., 2019).
Historically, productivity per se has been given
highest priority for varietal release of chickpea
in the country. With most of the chickpea being
cultivated in rainfed condition (DAC 2018),
stability of the yield becomes an important
criterion. The yield fluctuation over years can
be attributed to variation in biotic as well as
abiotic factors prevalent in different ecological
regions of the country. Yield stability between
genotypes is variable due to the wide
occurrence of genotype × environmental
interactions (G×E) i.e. the ranking of genotypes
depends on particular environmental
conditions where they are grown (Becker &
Leon, 1988). Genotype × environment (G×E)
interaction poses a continuous challenge
among plant breeders and agronomists in
making cultivar recommendations to farmers
because of the associated consequences
especially when selection is based on yield alone
(Kang, 1993). This is due to lack of emphasis
on both yield and stability in most breeding
programs (Mekbib, 2002) as well as lack of
appropriate policy in which variety are released
without consideration of yield and stability
simultaneously. Taking consideration of both
yield and stability the AMMI model can be used
to rank the genotypes (Kumar, 2018) Apart
from yield, fusarium wilt resistance in chickpea
is also very important as it is prevalent in all
chickpea growing regions of the country. Thus,
to assess the real worth of the genotype, the
parameters of yield, stability and fusarium wilt
resistance has to be considered together. Taking
consideration of fusarium wilt infestation along
with genotypic stability and average yield, an
index has been developed and computed to
rank the chickpea genotypes for the promotion
of genotypes in next level of the trial. Average
yield, genotypic stability and percentage wilt
 Kumar et al. : Simultaneous selection index based on yield, stability and resistance to wilt for desi chickpea in 119
North West Plain Zone of India

infestation are three components in this index. Yij =the mean yield of ith genotype in
For stability component additive main effects the jth environment;
and multiplicative interaction (AMMI) model gi = ith genotypic effect;
is used which was proposed by Rao and
Prabhakaran (2005), as it captures a large ej = jth location effect;
portion of the interaction sum of squares and n = the non-zero eigen values of Z’Z or
often provides meaningful interpretation of ZZ’ (in descending order)
data to support a breeding program such as in = the principal components ofthe rows
genotypic stability. Based on the AMMI model, of the sum of squares and cross product matrix
this index has been used to rank the genotypes ZZ’ and
along with wilt infestation and average yield.
jn = the principal components of the
Thirty-one promising genotypes of columns of the sum of squares and cross
chickpea in initial varietal trial evaluated at product matrix Z’Z
three locations viz. New Delhi, Ludhiana and
Durgapura representing the north west plain n’ =the number of PCA axes retained in
zone of All India Coordinated Research Project the model.
on chickpea program during 2016-17 were The stability measure ASTAB i for ith
taken into account. In all three locations, genotypes is given as
genotypes laid out in a Randomized Complete ′
Block Design (RCBD) with each genotype ASTABi=
2

replicated three times. In each season, =1

experimental plots were kept free of weed by A variety is considered more stable when
different means. Fertilizers and/or the value of ASTABi is lower,
supplementary water through irrigation were
applied during the trials. The threshed grain The selection indices (Ii) consist of (a) a yield
was then weighed on a plot basis to obtained component, measured as the ratio of the
plot grain yield which was later extrapolated average performance of the ith genotype to the
to yield per hectare. overall mean performance of the genotypes
under test, and (b) a stability component,
The AMMI model for T genotypes and S measured as the ratio of stability information
environments is given as (l/ASTABi ) of the ith genotype (c) the wilt
′ infestation component measured as the ratio
of (l/Wi ) of the ith genotype. The simultaneous
=µ+ + + + selection index is given as
=1
(1/ ) (1/ )
= 1 + 2∑ + 3∑
2 .. =1 (1/ ) =1 (1/ )
~ (0, ) , i =1,2, ... T; j =1,2, ... , S
where 1, 2, 3 are the weight given to
The model can be reparameterized as
yield, stability and wilt infestations. Two
=µ+ + + simultaneous selection models were tested
based on different weightage given to each
′ parameter. In Model I, the yield, stability and
wilt resistant component weightage were 70%,
= + 15% and 15% respectively while in Model II,
=1 the weightage of yield component was 80% and
stability and wilt resistant each was 10%.
Let the interaction in the (i,j)thcell Zij and
using matrix notation, denote Z=a matrix of Presence of high level of GxE interaction
order T x S. complicates the assessment of genotype based
on mean performance only. The performance
Where,
of a genotype relative to the remaining
120 Journal of Food Legumes 33(2), 2020

genotypes grown in one environment is usually
inconsistent over other locations, resulting in
alteration ordering of genotypes from one
environment to the next, or to changes in
absolute differences between genotypes which
leave the rank order unchanged. Such
interactions make utilizing data from multi-
environmental trials complex (Tukamuhabwa
et al., 2012). A perusal of Table 1 showed that
Genotype H13-36 is best yielder followed by
H12-63 and AKG1303, the most stable line is
BG3075 followed by CSJ907 and RG2011-02
and BRC-1 is the most wilt resistant followed
by IPC2012-108 and RKG13-75 among the 31
genotypes assessed. The entry H 13-36, which
ranked 1st in terms of yield, ranked 16th in terms
of stability and 6th in terms of wilt resistance.
The entry BG3075 which ranked 1st in terms of
stability showed 12th rank on the basis of yield
and 8th rank in wilt resistance. Similarly, entry
BRC-1 which ranked first in resistance, lagged
at 4th and 7th place in terms of yield and stability.
Thus, none of the entries were absolute
superiors in terms of all three parameters and
some allowance has to be made for one or two
parameters to reach to a meaningful
conclusion.
A genotype that is widely adaptable,
having reliable performance across
environments needs to be identified through
analysis and utilization of genotype ×
environmental interactions. In order to analyze
genotype × environmental interactions, it is
important to integrate both yield and stability
of genotype performances across environments
using reliable stability statistics (Kang, 1993).
An ideal entry should be having higher yield
along with relatively higher stability and
possessing resistance against fusarium wilt.
Taking consideration of all the three-
component yield, stability and wilt resistant a

Table 1. Yield index, stability index and wilt index of genotypes and corresponding rank
SN Entry Yield Index Rank (yield) Stability Index Rank (stability) Wilt Index Rank (wilt)
1 AKG1303 1.1758 3 0.8275 10 1.1936 7
2 BG3075 1.0748 12 1.7724 1 1.1829 8
3 BG3076 1.0422 18 0.6483 18 1.0691 12
4 BGD138 0.9314 25 1.1616 5 0.6190 29
5 BRC-1 1.1646 4 1.0047 7 1.9345 1
6 CSJ866 1.1063 11 0.7266 13 1.1374 11
7 CSJ907 1.1099 8 1.6911 2 0.8649 22
8 DBGV206 0.8645 27 0.3553 28 0.4317 31
9 GJG1403 0.8462 28 0.4512 24 0.8712 21
10 GJG1416 0.7648 30 0.4429 25 0.7362 26
11 GL13001 1.0291 19 0.5450 22 0.9650 15
12 GL13042 1.1069 10 0.6907 15 0.9452 17
13 GNG2325 1.1303 6 0.4243 26 1.3300 5
14 GNG2338 1.1604 5 0.5192 23 0.9144 19
15 H12-63 1.1933 2 0.6908 14 1.1517 10
16 H13-36 1.2972 1 0.6743 16 1.3094 6
17 IPC2012-108 1.1162 7 0.6599 17 1.4194 2
18 IPC2013-21 1.0515 13 0.5863 21 1.3321 4
19 JG2016-43 0.7863 29 0.9049 8 1.1729 9
20 JG2016-44 0.9490 24 0.8231 11 0.6810 28
21 NBeG738 0.9098 26 0.2410 31 0.9418 18
22 NBeG776 1.0004 21 0.3876 27 0.6956 27
23 NDG15-6 1.0510 15 1.3813 4 0.7624 25
24 PG177 1.0479 16 0.6062 19 0.9682 14
25 PG214 0.9687 23 0.7825 12 1.0138 13
26 PhuleG0818 1.1096 9 0.6059 20 0.7995 24
27 PhuleG09019 0.9789 22 0.8723 9 0.9495 16
28 RG2011-02 1.0475 17 1.6492 3 0.8892 20
29 RKG13-380 1.0018 20 0.3520 29 0.8244 23
30 RKG13-75 1.0514 14 1.0433 6 1.3842 3
31 RVSSG42 0.7132 31 0.2751 30 0.5099 30
 Kumar et al. : Simultaneous selection index based on yield, stability and resistance to wilt for desi chickpea in 121
North West Plain Zone of India

simultaneous selection index for the 31
genotypes were computed with results given
in Table 2. Genotype BRC-1 with 1.2561 index
value was found best genotype followed by
H13-36 with index value 1.2056 and BG3075
with index value 1.1957 in Model I when yield,
stability and wilt resistant component weightage
were 70%, 15% and 15% respectively. In Model
II, when weightage of yield component is 80%
and stability and wilt resistant each was 10%,
the genotype H13-36 with 1.2361 index value
was found best genotype followed by BRC-1
with index value 1.2256 and BG3075 with
index value 1.1554. Hence, these genotypes
may be used by the chickpea breeder for
developing high yield and stable chickpea lines
on AMMI based simultaneous selection for
yield stability, and wilt resistant. Based on
relative importance of individual parameters,
the model can be suitably modified in terms of
adding new parameters as well as providing
different weightage to each parameter making
it useful for evaluating entries in not only
breeders field but also promoting entries in
national coordinated trials of different crops.
Instability in yield is a major reason for lack
of adoption of most of the high-yielding vaities
especially rainfed crops like pulses, oilseeds and
coarse cereals (Reddy et al., 2013). In case of
chickpea, wilt is a major problem resulting in
wide fluctuations in yields. Development and
use of high-yielding genotypes, resistant to the
prevalent race of wilt (Fusarium oxysporum L)
in a given area is the most practical and cost
efficient disease control measure and is
accorded priority for promoting entries to in
next level of evaluation trial in national
coordinated evaluation programs.In this paper,
taking consideration of wilt infestation along

Table 2. Combined index and corresponding rank of genotypes

SN Entry Model I Model II
(Yield:Stability:Wilt = 70:15:15) (Yield:Stability:Wilt = 80:10:10)
Index Rank Index Rank
1 AKG1303 1.1262 5 1.1427 5
2 BG3075 1.1957 3 1.1554 3
3 BG3076 0.9872 17 1.0055 17
4 BGD138 0.9191 22 0.9232 22
5 BRC-1 1.2561 1 1.2256 2
6 CSJ866 1.0540 12 1.0715 12
7 CSJ907 1.1603 4 1.1435 4
8 DBGV206 0.7232 29 0.7703 29
9 GJG1403 0.7907 28 0.8092 28
10 GJG1416 0.7122 30 0.7298 30
11 GL13001 0.9469 21 0.9743 19
12 GL13042 1.0202 15 1.0491 14
13 GNG2325 1.0543 11 1.0796 10
14 GNG2338 1.0273 13 1.0716 11
15 H12-63 1.1117 7 1.1389 6
16 H13-36 1.2056 2 1.2361 1
17 IPC2012-108 1.0933 9 1.1009 7
18 IPC2013-21 1.0238 14 1.0330 15
19 JG2016-43 0.8621 26 0.8368 27
20 JG2016-44 0.8899 23 0.9096 24
21 NBeG738 0.8143 27 0.8461 26
22 NBeG776 0.8627 25 0.9086 25
23 NDG15-6 1.0572 10 1.0551 13
24 PG177 0.9697 18 0.9958 18
25 PG214 0.9475 20 0.9546 21
26 PhuleG0818 0.9875 16 1.0282 16
27 PhuleG09019 0.9585 19 0.9653 20
28 RG2011-02 1.1140 6 1.0919 8
29 RKG13-380 0.8777 24 0.9191 23
30 RKG13-75 1.1001 8 1.0839 9
31 RVSSG42 0.6170 31 0.6491 31
122 Journal of Food Legumes 33(2), 2020
with genotypic stability and average yield, an
index has been developed and computed to
rank the chickpea genotypes for the promotion
of genotypes in next level of the trial. Average
yield, genotypic stability and percentage wilt
infestation are three components in this index
and higher the index value better is the
genotypes.
REFERENCES
Anonymous., 4thAdvance estimate of Production of
Foodgrains for 2018-19. Directorate of Economics &
Statistics, Department of Agriculture, Cooperation
and Farmers Welfare, Ministry of Agriculture and
Farmers Welfare, Government of India. 2019.
(https://eands.dacnet.nic.in/Advance_Estimate/
4th%20Adv%20Estimates%202018-
19%20Eng.pdf). Accessed on 29-01-2020.
Becker HC and Leon J. 1988. Stability analysis in plant
breeding. Plant Breeding, 101(1): 1-23.
DAC., Agricultural Statistics at a Glance 2018.
Government of India Ministry of Agriculture &
Farmers Welfare Department of Agriculture,
Cooperation & Farmers Welfare Directorate of
Economics and Statistics. 2018, 468 pages.
Dixit GP, Srivastava AK and Singh NP. 2019.
Marching towards Self-sufficiency in Chickpea.
Current Science, 116 (2): 239-242.
Kang MS. 1993. Simultaneous selection for yield and
stability in crop performance trials: Consequences
for growers. Agronomy Journal, 85(3): 754-757.
Kumar H, Dixit GP, Srivastava AK and Singh NP (2018)
Simultaneous selection using AMMI ocedure for
yield and stability of chickpea genotypes in north
west plain zone of India. Journal of Food Legumes
31(1): 15-17.
Mekbib F. 2002. Simultaneous selection for high yield
and stability in common bean (Phaseolus vulgaris)
genotypes. The Journal of Agric. Sci., 138(03): 249-
253.
Rao AR and PrabhakaranVT.2005. Use of AMMI in
simultaneous selection of genotypes for yield and
stability. Journal of the Indian Society of
Agricultural Statistics 59: 76-82.
Reddy AA, Parthasarathy Rao P, Yadav OP, Singh IP,
Ardeshna NJ, Kundu KK, Gupta SK, Rajan Sharma,
Sawargaonkar G, Dharm Pal Malik, Shyam Moses
D andSammi Reddy K. 2013. Prospects for kharif
(Rainy Season) and Summer Pearl Millet in Western
India. Working Paper Series no. 36.Patancheru 502
324, Andhra Pradesh, India. 24 pp.
Tukamuhabwa P, Oloka HK, Sengooba TandKabayi
P.2012. Yield stability of rust-resistant soybean
lines at four mid-altitude tropical locations.
Euphytica, 183: 1-10.
 Journal of Food Legumes 33(2): 123-126, 2020

Short Communication
DALHANDERMA (IIPRTh-31): Multi-trait Trichoderma based
formulation for management of wilt diseases of pulse crops
RK MISHRA*1, MONIKA MISHRA, SONIKA PANDEY, NAIMUDDIN,
PR SAABALE and BANSA SINGH

1
* ICAR-Indian Institute of Pulses
Research, Kanpur-208024 (India),
Division of Crop Protection
*Email: rajpathologist@yahoo.com
Received: 26 August, 2020
Accepted: 01 September, 2020
Handling Editor:
Dr. Meenal Rathore, ICAR-IIPR,
Kanpur
ABSTRACT
Several species of Trichoderma were identified from pulses rhizosphere
and characterized for their antagonistic potential against Fusarium udum,
Fusarium oxysporum f. sp. ciceri and F. oxysporum f. sp. lentis and plant
growth (germination percentage, plant height, shoot and root length)
promoting ability in chickpea, pigeonpea and lentil. Among the 14
Trichoderma isolates tested under in-vitro and green house condition at
ICAR- Indian Institute of Pulses Research, Kanpur, one isolate, IIPRTh-
31 (Trichoderma asperellum) was identified to inhibited maximum
mycelial growth (>80%) of wilt pathogens, promote plant growth in
respect of root and shoot length and tolerate temperature upto 500C. Three
formulations were developed using different carrier materials (Talc,
Parafin oil, Glycerol) and tested for their shelf-life up to 6 months at
room temperature. Maximum inoculum viability (4.2x108cfu/g) was
observed in talc based formulation of Dalhanderma. This talc based
formulation of DALHANDERMA would be popularized among the
pulses growing farmers as a plant growth promoter and also for soil
borne disease management in chickpea, pigeonpea and lentil crops.

Key words: Dalhanderma, Diseases, Formulations, IIPRTh-31, Pulse Crops,

Trichoderma asperellum

A diverse group of beneficial
microorganisms exist in pulses rhizosphere that
is known for their beneficial role in plant
growth in these crops. Amongst them,
Trichoderma spp. is the most widely used
organism as bio-fungicide and is reported to
manage several plant pathogens (Mishra et al.,
2018a, 2018b, Dubey et al., 2013). Pulse crops
are affected by several biotic and abiotic stresses
at various growth stages. Among the biotic
stresses, soil borne pathogens are the most
important yield limiting factors affecting crops
at different stages. A number of Trichoderma
spp. were identified from pulses rhizosphere
and characterized for their antagonistic and
plant growth promoting potential in chickpea,
pigeonpea and lentil (Mishra et al., 2020).
Biocontrol agents have assumed special
significance in the present day strategy for
developing environmentally safe methods of
plant disease management. Prospects of
biological control of soil borne pathogens using
Trichoderma spp. have been described and these
have been used widely as commercial
biocontrol agents all over the world (Papavizas,
1985, Harman et al., 2004a, Mukherjee et al.,
2013). Presently, Trichoderma spp. share almost
70% of fungal BCAs market and are extensively
used for their twin advantages of managing
several phytopathogens in addition to their
capacity to act as a bio-fertilizer (Keswani et
al., 2013). On the other hand, Trichoderma spp.
Have also been exploited for commercial
production of enzymes like cellulases,
hemicellulases, proteases, and â-1, 3-glucanase.
India alone has more than 250 commercial
formulations that are used against many
diseases of different crops (Mukherjee et al.,
2013, Singh et al., 2016). In pulses, scanty
information is available on biocontrol
formulations having multi-trait ability. Hence,
the present study was under taken to develop
cost effective talc based formulation of
Trichoderma based product to use its
124
antagonistic potential and plant growth
promoting ability against wilt diseases of
pigeonpea, chickpea and lentil for wider
application in pulses based cropping system at
farmers’ fields.
Soil samples were collected from healthy
pigeonpea, chickpea, lentil and field pea
rhizosphere and stored in sterile plastic bags.
Trichoderma strain (IIPRTh-31) was isolated on
Trichoderma specific medium (TSM) (Elad et al.,
1981) through serial dilution technique
(Goldman and Green, 2008). Cultures were
purified by single spore culture technique (Choi
et al. 1999) on PDA plates and incubated at
27°C for 24-48 hr. Isolated Trichoderma strain
was initially identified on the basis of their
cultural and morphological characters (Rifai,
1969) based on colony colour, conidia and
conidiophores characteristics through
microscopic observation. The identity of the
IIPRTh-31isolate was further confirmed
through molecular characterization (by using
TS4/6 (Acc.no. MK968811) and tef-1a (Acc.
No. MN232100) (Chaverri et al., 2015).
Biochemical profiling (chitinase, endochitinases,
siderophore production, glucanase, phosphate
solubilization) of IIPRTh-31 was also performed
(Lima et al., 1999, Vinale et al., 2012, Lisboa et
al., 2003, Pyne, 1995) (Table 1).
Antagonistic potential of IIPRTh-31was
tested against Fusarium udum, F. oxysporum f.
sp. ciceri and F. oxysporum f. sp. lentis under in-
vitro and in-situ conditions. Petridishes (90mm)
containing PDA were inoculated with 5mm
mycelial disc of 7 days old culture of 7 days old
cultures of test pathogens and Trichoderma spp.
at equal distance from the periphery.
Table 1. Parameters for Biochemical characterization of Dalhanderma (IIPRTh-31)
Lytic Enzymes
Enzyme Unit/ml
Xylanase 1.529
Endoglucanase 0.640
Fpaase 2.057 (mg/ml)
Chitinase 50
Beta-glucosidase activity 0.661
Beta-1, 3-glucanase activity 0.671
Journal of Food Legumes 33(2), 2020
Petridishes were incubated at 27°C in BOD and
the radial growth of test pathogens was
measured after 2, 4, 5 and 7 days of incubation.
Percent inhibition of the pathogens was
calculated by formula suggested by Vincent,
1927.
Percent (%) inhibition (I) = (C – T/ C) × 100
Where, I = % inhibition, C = radial growth
of test pathogen with absence of antagonist
(mm), T = radial growth of test pathogen with
antagonist (mm)
Isolate was further evaluated for its growth
promoting potential. Talc based formulation of
IIPRTh-31 treated seeds of chickpea, pigeonpea
and lentil (Fig.1) were sown in earthen pots
(13×13×5 cm) containing 1.0 kg of sterilized soil,
10 seeds of each crops was sown in individual
pots. Germination percentage was recorded 15
days after sowing DAS. The growth parameters
viz. shoot length and root length were recorded
at 60 DAS.IIPRTh-31 inhibited maximum
mycelial growth of Fusarium udum (80.6%)
followed by Fusarium oxysporum f. sp. ciceri
(82.5%) and F. oxysporum f. sp. lentis (85.6%).
Maximum plant growth was observed in
Fig. 1. DALHANDERMA treated chickpea, pigeonpea,
lentil seeds (A) with non treated seeds (B)
Plant Growth Promoting Enzymes Sterol Production
Enzyme μg/ml sterol mg/ml
IAA content 7.9 Ergosterol 3.4
Siderophore 24.16 Sequalene 1.536
Phoshatase 0.108
 Mishra et al. : Multi-trait Trichoderma based formulation for management of wilt diseases of pulse crops
Table 2. Shelf life evaluation of Dalhanderma (IIPRTh-31) after 6 month of storage
Carrier materials
February March
Talc based 4.8×108 4.7×108
Paraffin oil 2.6×108 2.5×108
Glycerol 2.6×108 2.4×108
chickpea followed by pigeonpea and lentil. For
mass multiplication of Dalhanderma, culture
was multiplied on sorghum grains. Pure culture
of IIPRTh-31 (106-108CFU/ml) was inoculated
in sorghum containing bags, incubated at 25 ±
2°C for 15 days. After 15 days of incubation,
dried seeds of the sorghum were grinded and
mixed in sterilized talcum powder in 1:9
(Trichoderma spore: talc) ratio and packed in
polythene bags for further use as seed treatment
and soil application (Fig. 2). Paraffin wax and
glycerol were other bases that were
experimented for development of a formulation.
It was observed that the talc based formulation
retained the microbial load of 4.2x10 8cfu/g
even after six months of storage. Hence, this
formulation had the highest shelf life (Table:
2).
Thus, Dalhanderma talc, that is
Trichoderma asperellum strain IIPRTh-
31(MK968811) formulation, can be very useful
for the management of soil borne diseases and
promoting growth of pulse crops such as
chickpea, pigeonpea and lentil through seed
treatment and soil application.
Fig. 2. Process of talc based formulation
DALHANDERMA preparation
125
CFU /gm
April May June July August
4.7×108 4.6×108 4.6×108 4.2×108 4.2×108
2.5×108 2.4×107 2.1×106 2.1×106 2.1×106
2.4×108 2.1×108 2.1×107 2.1×107 2.1×107
ACKNOWLEDGEMENTS
Authors are highly grateful to Council of
Science and Technology, Lucknow, Uttar
Pradesh for financial assistance and Dr. N.P.
Singh, Director, ICAR-IIPR, Kanpur for his
encouragement and constant support.
REFERENCES
Bhardwaj D, Ansari MW, Sahoo RK, Tuteja N. 2014.
Biofertilizers function as key player in sustainable
agriculture by improving soil fertility, plant
tolerance and crop productivity. Microb Cell Fact.
13: 66
Choi, YW, Hyde, KD and Ho, WH. 1999.Single spore
isolation of fungi.Fungal Diversity. 3: 29-38.
Dubey SC, Aradhika T, BirendraS. 2013. Integrated
management of Fusarium wilt by combined
application of soil and seed dressing formulations
of Trichoderma species to increase grain yield of
chickpea. Int J Pest Manag 59: 47–54
Elad, Y, Chet, I and Henis, Y. 1981. A selective medium
for improving quantitative isolation of Trichoderma
spp. from soil.Phytoparasitica., 9: 59- 67.
Ghimire, GP, Hei, CL, and Jae, KS. 2009. Improved
sequence production via modulation of the
methylerythritol 4-phosphate pathway and
heterologous expression of genes from Streptomyces
peucetius ATCC 27952 in Escherichia coli.Appl.
Environ. Microbiol. 75: 7291–7293.
Goldman, E and  Green LH. 2008. Practical Handbook
of Microbiology (2nd edition), CRC Press, Boca
Baton, Florida.
Harman, GE, CR Howell, A Viterbo, Chet I. and Lorito
M. 2004a. Trichoderma species-opportunistic,
avirulent plant symbionts. Nature Rev. Microbiol.,
2: 43-56.
Keswani C, Singh SP and Singh HB. 2013. A Superstar
in Biocontrol Enterprise : Trichoderma spp Biotech
Today 3 (2): 27-30.
Lima, LHC, De Marco, JL and Felix, CR. 1999. Synthesis
of a Trichoderma chitinase which acts the Sclerotium
of rolfsii and Rhizoctonia solani cell walls. Folia
Microbiologica 44: 45-49.
126 Journal of Food Legumes 33(2), 2020
Mishra RK, Mishra Monika, Naimuddin and Kumar
Krishna 2018a. Trichoderma asperellum: A potential
biocontrol agents against wilt of pigeonpea caused
by Fusarium udum Butler. Journal of Food Legumes.
31(1): 50-53.
Mishra, RK, Bohra, A, Naimuddin, Kumar Krishna ,
Sujayanand, GK, Saabale, PR, Naik, SJ, Sarma, BK,
Kumar, D, Mishra Monika, Srivastava, DK  and
Singh NP. 2018b. Utilization of biopesticides as
sustainable solutions for management of pests in
legume crops: achievements and prospects.
Egyptian Jr. Biological Pest Control.DOI 10.1186/
s41938-017-0004-1.
Mishra RK, Pandey Sonika, Mishra Monika, Rathore
US, Naimuddin, Mohd. Akram, Kumar Krishna
and Singh Bansa. 2020. Molecular identification,
enzyme profiling and biocontrol potential of
Trichoderma isolates against wilt disease of major
pulse crops.Journal of Food Legumes 33(1): 50-54.
Mukherjee, PK, Horwitz B., Herrera-Estrella A.,
Schmoll M., and Kenerley C. 2013. Trichoderma
research in the genome era. Annu. Rev.
Phytopathol. 51, 105–129.
Papavizas, GC. 1985. Trichoderma and Gliocladium:
their biology, ecology and potential of biocontrol.
Annual review of Phytopathology 23: 23–47.
Pyne SM. 1993. Iron acquisition in microbial
pathogenesis. Trends Microbiol., 1(2): 66-69.
Rifai, MA. 1969. A revision of the genus Trichoderma.
Mycological Papers. 116: 1-56.
Singh, V, Upadhyay, RS, Sarma, BK and Singh, HB.
2016. Seed biopriming with Trichoderma asperellum
effectively modulate plant growth promotion in
pea. Int. J. Agricul. Envit. Biotech., 9(3): 361-365.
Vinale F, Sivasithamparam K, Ghisalberti EL, Ruocco
M, Wood S, Lorito M. 2012. Trichoderma secondary
metabolites that affect plant metabolism. Nat Prod
Commun. 7: 1545-155.
Vincent, JM. 1927. Distortion of fungal hyphae in
presence of certain inhibitors. Nature. 159: 850.
 Journal of Food Legumes 33(2): 127-132, 2020

Short Communication
Phenology, thermal indices and yield of chickpea (Cicer arietinum L.)
varieties under different sowing dates in New Alluvial Zone of West Bengal
SHREYASEE SETH*1, MRITYUNJAY GHOSH1, R NATH1,
MD HEDYATULLAH1 and MK NANDA2

1
Department of Agronomy, Bidhan
Chandra Krishi Viswavidyalaya,
Mohanpur, Nadia 741252, West
Bengal, India
2
Department of Agricultural
Meteorology and Physics, Bidhan
Chandra Krishi Viswavidyalaya,
Mohanpur, Nadia 741252, West
Bengal, India
*Email: mghoshbckv@rediffmail.com
Received: 26 Feb, 2020
Acceptance: 10 August, 2020
Handling Editor:
Dr. Narendra Kumar, ICAR-IIPR,
Kanpur
ABSTRACT
A field experiment was conducted at Instructional Farm of Bidhan
Chandra Krishi Viswavidyalaya, Jaguli, Nadia, West Bengal, India to
study the effect of four sowing dates and four varieties on phenology
and yield of chickpea during rabi season of 2017-18. Mean cultivar days
of chickpea crop from sowing to emergence, flower initiation, pod
initiation and maturity were 6.7, 59.6, 80.5 and 112.6 days, respectively.
The duration of chickpea and summed growing degree days (GDD) were
reduced successively with delay in sowing from 4 November (119.8 days
and 1715) to 19 December (103.9 days and 1604). The average GDD,
heliothermal units (HTU) and photothermal units (PTU) for entire life
cycle of chickpea were recorded as 1661, 11403 and 18766, respectively.
Chickpea sown on 20 November produced the highest seed yield (1084.50
kg/ha), which was 11.4, 16.9 and 34.7% greater over 4 November, 5
December and 19 December, respectively. The correlations between
thermal indices and seed yield revealed that GDD (r = 0.483**), HTU (r =
0.633**) and PTU (r = 0.379**) during pod initiation to maturity had positive
effect (P < 0.01) on economic yield of chickpea. Based on seed yield,
chickpea varieties could be arranged as ‘Uday’ (1058 kg/ha) > ‘JG 14’
(908 kg/ha) > ‘Anuradha’ (904 kg/ha) > ‘Vaibhav’ (787 kg/ha).
Key words: Chickpea, Phenology, Sowing date, Thermal indices, Variety,
Yield

Chickpea, known as bengal gram or chana, of chickpea over farmers’ practices in

is one of major pulses cultivated and consumed
in the country since long. India is the largest
producer of chickpea (9.63 Mt) in the world
covering an area of 9.38 Mha with the average
productivity of 974 kg/ha during 2016-17
(Government of India, 2019). Chickpea is
mainly cultivated in western part of India;
where Madhya Pradesh (37.8%), Maharashtra
(18.3%) and Rajasthan (15.0%) contribute
about 70% production in the country. Large
numbers of important high-yielding varieties of
chickpea have evolved, but yield of most of such
varieties is not stable over environments, which
is one of the reasons for poor adaptation
(Yogesh et al., 2017). The front-line
demonstrations in recent times revealed
improvement in productivity and profitability
Bhagalpur district of Bihar (Mauriya et al.,
2017) and Ferozepur district of Punjab (Kaur
et al., 2019). In West Bengal, chickpea is grown
in 0.26 lakh ha land with production of 0.31
lakh tonnes and yield of 1178.3 kg/ha
(Government of West Bengal, 2016), which
indicate scope of adaptation of the crop with
proper technology in different agro-climatic
zones of the state. Nitesh et al. (2018) observed
that selection of high number of pods/plant
and 100 seed weight would lead to high seed
yield; while number of secondary branches/
plant, plant height and number of seeds/pod
facilitate selecting genotypes for high number
of pods/plant. The commonly cultivated
chickpea varieties viz. ‘Mahamaya 1’,
‘Mahamaya 2’, ‘Anuradha’, etc. are usually
128 Journal of Food Legumes 33(2), 2020
sown between mid October to mid November
in West Bengal; but sowings are often delayed
when grown in sequence with kharif rice, which
leads to drastic reduction (20-50%) in grain
yield. As the State Department of Agriculture
take initiatives for area expansion of suitable
chickpea varieties in recent times, the
optimization of sowing time along with
selection of promising varieties in particular
region needs to be done. Keeping these in view,
a comprehensive study was done on the effect
of sowing time on phenology, thermal indices
like growing degree days (GDD), heliothermal
units (HTU) and photothermal units (PTU) and
yield of chickpea varieties in new alluvial zone
of West Bengal.
A field experiment was conducted for
chickpea crop (Cicer arietinum) during rabi
season (November-March) of 2017-2018 on a
medium land loamy soil at Instructional Farm
(22o­93’ N, 88o53’ E and 9.75 m m.s.l.) of Bidhan
Chandra Krishi Viswavidyalaya (BCKV),
Mohanpur, Nadia, West Bengal, India.
Treatments replicated thrice were assigned in
a split-plot design with four sowing dates (4
November, 20 November, 5 December and 19
December) in main plots and four varieties
(‘Anuradha’, ‘Uday’, ‘Vaibhav’ and ‘JG 14’) in
sub-plots. Seeds of four chickpea varieties
collected from AICRP on MULLaRP, BCKV
were sown at 30 cm row spacing in the
experimental plots (4 m × 3 m) as per sowing
time schedule. The standard crop management
practices like uniform fertilizer dose of 20:40:40
kg/ha of N:P2O5:K2O, one hand weeding at 30-
40 days after sowing (DAS) and one irrigation
at 30-40 DAS were adopted.
The phenophases (viz. emergence, flower
initiation, pod initiation and maturity) of
chickpea varieties at different sowing dates were
noted by regular field inspection method. The
daily meteorological data at Mohanpur for the
period of investigation (November, 2018 to
March, 2019) were collected from the
Department of Agricultural Meteorology and
Physics, BCKV, West Bengal. Phenophase-wise
growing degree days (GDD) were calculated
following Nuttonson (1955) by taking a base
temperature of 5ÚC, while Heliothermal units
(HTU) and photothermal units (PTU) were
determined by the equations proposed by Singh
et. al. (1990) and Nuttonson (1948), respectively.
The correlation studies between thermal and
photothermal requirements for each
phenological stage and grain yield were made.
The plant height, yield components, grain and
stover yield of chickpea were recorded at crop
maturity stage.
Phenology: The average emergence of seedlings
of four chickpea varieties was relatively faster
(5.3 days) in 5 December sown plots compared
to other three sowings on 4 November (6.58
days), 20 November (7.0 days) and 19 December
(7.8 days) in the study (Table 1). This might be
due to the fact that early December sown crop
received 9.13 mm rainfall just after sowing,
which hastened the germination of seeds as well
as emergence in the field. Although the
variations in length of phenophases among
three sowing dates were complex, but the
trends during emergence to flower initiation (E-
FI) and pod initiation to maturity (PI-M)
primarily determined the life cycle of chickpea
crop. The phenophasic durations of chickpea
crop during above mentioned two stages as
well as the life cycle were reduced successively
with delay in sowing from 4 November to 19
December. Chickpea sown on 4 November took
119.8 days from sowing to maturity which was
decreased by 2.6 days in 20 November, 10.2
days in 5 December and 15.8 days in 19
December sowing in the investigation.
Similarly, Sahu et al. (2007) reported that the
life cycle of four chickpea varieties was reduced
by 22 days (103 vs. 81 days) due to delay in
sowing from 15 October to 15 November at
Junagarh, Gujarat.
The phenophase-wise average duration of
chickpea was 6.7 days (sowing to emergence),
52.9 days (emergence to flower initiation), 20.9
days (flower initiation to pod initiation) and
32.1 days (pod initiation to maturity). Based on
the length of life cycle, chickpea varieties could
be arranged as ‘Uday’ (114.2 days) >
‘Anuradha’ (113.9 days) > ‘JG 14’ (112.1 days)
> ‘Vaibhav’ (110.3 days).
Growing degree days (GDD): Mean cultivar
GDD for chickpea from sowing to emergence,
flower initiation, pod initiation and maturity
 Seth et al. : Sowing date effects on phenology and yield of chickpea 129

Table 1. Effect of sowing date on phenology and thermal indices of chickpea varieties in West Bengal
Sowing to Emergence Flower Initiation to Pod Initiation to Sowing to
Treatment Emergence to Flower Initiation Pod Initiation Maturity Maturity
(S - E) (E - FI) (FI - PI) (PI - M) (S - M)
Phenological duration (days)
Sowing date
4 November 6.6 55.9 22.5 34.8 119.8
20 November 7.0 54.2 21.5 34.5 117.2
5 December 5.3 51.2 21.7 31.4 109.6
19 December 7.8 50.4 18.1 27.7 103.9
CD (P=0.05) 0.42 2.37 NS 0.58 1.44
Variety
‘Anuradha’ 7.5 52.8 21.1 32.5 113.9
‘Uday’ 6.3 53.8 21.7 32.3 114.2
‘Vaibhav’ 6.3 52.8 20.1 31.0 110.3
‘JG 14’ 6.5 52.2 20.9 32.5 112.1
CD (P=0.05) 0.44 NS NS 0.81 1.05
Growing degree days
Sowing date
4 November 119 796 236 564 1715
20 November 109 661 290 632 1692
5 December 77 603 325 628 1633
19 December 96 608 330 570 1604
CD (P=0.05) 7.1 28.3 43.3 13.4 30.3
Variety
‘Anuradha’ 113 663 301 613 1690
‘Uday’ 95 677 308 612 1693
‘Vaibhav’ 95 669 282 566 1612
‘JG 14’ 98 658 291 603 1650
CD (P=0.05) 6.4 NS NS 14.4 21.3
Helio-thermal units
Sowing date
4 November 1142 5091 1633 4037 11903
20 November 982 4129 2089 4651 11850
5 December 268 3981 2329 4432 11011
19 December 501 4299 2405 3644 10850
CD (P=0.05) 61.8 226.9 303.9 63.2 179.8
Variety
‘Anuradha’ 807 4360 2143 4246 11556
‘Uday’ 692 4442 2213 4223 11570
‘Vaibhav’ 692 4389 2203 4032 11116
‘JG 14’ 702 4310 2098 4263 11373
CD (P=0.05) 54.3 NS NS 100.2 115.3
Photo-thermal units
Sowing date
4 November 1351 8669 2607 6484 19111
20 November 1203 7152 3267 7388 19009
5 December 833 6547 3711 7420 18511
19 December 1021 6759 3837 6818 18434
CD (P=0.05) 79.3 317.7 489.6 166.8 362.6
Variety
‘Anuradha’ 1237 7244 3420 7204 19105
‘Uday’ 1048 7396 3506 7197 19149
‘Vaibhav’ 1048 7304 3199 6635 18187
‘JG 14’ 1074 7181 3295 7074 18624
CD (P=0.05) 70.6 NS NS 171.7 255.5

were 100, 767, 1062 and 1661, respectively December (1604). This might be mainly due to
(Table 1). There was successive reduction in reduction in days to maturity for delay in
summed GDD for entire life cycle with delay sowing from early November to mid December
in sowing from 4 November (1715) to 19 during rabi season. Tyagi (2014) also reported
130 Journal of Food Legumes 33(2), 2020

that total summed GDD was reduced with
delay in sowing of 3 chickpea varieties from
October 25 to December 4 at Tikamgarh,
Madhya Pradesh. Varieties differed
significantly for accumulated GDD at different
phenophases and life cycle, excluding
emergence to flower initiation (E-FI) and flower
initiation to pod initiation (F-PI) stage.
Heliothermal unit (HTU): There was a little
variation in daily bright sunshine hour
averaged over entire life cycle (6.71-6.95 hour)
among four sowing dates in the study. The
variation in mean daily temperature and bright
sunshine hour among four sowing dates
resulted in varied accumulated HTU at different
phenophases as well as life cycle of chickpea
crop. Early sowing (4 November) of chickpea
recorded highest summed total HTU (11903),
which was successively decreased due to
delayed sowings on 20 November (11850), 5
December (11011) and 19 December (10850)
in the investigation (Table 1). Mean cultivar
summed total HTU for the entire life cycle was
11403 with a range between 11116 (‘Vaibhav’)
and 11570 (‘Uday’).
Photothermal unit (PTU): Temperature
generally governed the onset of different
phenophases in chickpea, but day length had
also influence on photo-thermal requirements
of the crop. The total PTU for entire life cycle
was highest (19111) in early sown crop
primarily due to greater duration (119.8 days)
than three late sowings on 20 November (19009
and 117.2 days), 5 December (18511 and 109.6
days) and 19 December (18434 and 103.9 days)
(Table 1). Mean cultivar summed PTU at
different phenophases were recorded as 1102
(sowing to emergence), 7282 (emergence to
flower initiation), 3355 (flower initiation to pod
initiation), 7027 (pod initiation to maturity) and
18766 (sowing to maturity).
Yield attributes and seed yield: Although the
plant height of two November sown crops (4
and 20 November) was more or less similar (53.7
cm and 51.3 cm), but it was gradually
decreased for delayed sowings on 5 December
(43.8 cm) and 19 December (41.4 cm) (Table
2). Perusal of data revealed that three varieties
(‘Anuradha’, ‘JG 14’ and ‘Vaibhav’) had <45
cm height, while ‘Uday’ recorded >65 cm plant
height at harvest indicating erect plant type.
Sowing time had significant influence on
branching habit, number of pods/plant,
number of seeds/pod and 100-seed weight of
chickpea in the investigation. Chickpea sown
on 4 November produced the maximum
number of branches (3.97/plant) and number
of pods/plant (59.5), these were gradually
decreased with delay in sowing to 19 December
(2.83/plant and 31.1/plant). Similar number of
pods/plant (43.1-49.3) was reported by
Rehman et al., (2015), but less number of pods/
plant (12.1-18.0) was noted by Chaitanya and
Chandrika (2006). Among four varieties,
‘Vaibhav’ recorded the highest number of
primary branches (3.46/plant) and 100 seed
weight (20.6g), but lowest number of seeds/
pod(1.15).
Chickpea sown on 20 November recorded
the highest seed yield (1084.5 kg/ha), stover

Table 2. Effect of sowing date and variety on growth, yield attributes and yield of chickpea
Treatment Plant No. of No. of No. of No. of 100 seed Seed yield Stover Heat use
height plants/m2 branches/ pods/ seeds/ weight (g) (kg/ha) yield efficiency
(cm) plant plant plant (kg/ha) (kg/oC /day)
Sowing date
4 November 53.7 28.7 3.97 59.5 1.33 15.3 960.9 1256.0 0.56
20 November 51.3 30.5 3.32 55.7 1.52 15.7 1084.5 1345.1 0.64
5 December 43.6 29.9 2.82 39.5 1.58 14.7 903.0 1235.1 0.55
19 December 41.4 29.2 2.63 31.1 1.43 14.6 708.0 1085.2 0.44
CD (P=0.05) 2.22 NS 0.31 3.65 0.15 0.55 128.36 127.32 0.08
Variety
‘Anuradha’ 39.5 30.0 3.33 50.8 1.82 10.2 903.9 1206.2 0.53
‘Uday’ 65.1 32.3 2.83 42.8 1.36 17.2 1057.9 1427.6 0.62
‘Vaibhav’ 44.1 25.4 3.46 48.1 1.15 20.6 786.8 1079.5 0.49
‘JG 14’ 41.3 30.6 3.13 44.2 1.53 12.4 908.0 1208.1 0.55
CD (P=0.05) 3.74 2.69 0.35 4.67 0.14 0.82 105.20 87.54 0.06
 Seth et al. : Sowing date effects on phenology and yield of chickpea 131

yield (1345.1 kg/ha) and heat use efficiency Table 4. Correlations between thermal indices at
(0.64 Kg 0C-1 day-1) in the study. Perusal of data different growth stages and yield of chickpea
varieties
revealed that 20 November sowing resulted in
Thermal indices Growth stage Correlation
11.4%, 16.9% and 34.7% greater seed yield over co-efficient
4 November, 6 December and 19 December (r)
sowings, respectively. Based on seed yield, four GDD S-E 0.172
varieties could be arranged as ‘Uday’ (1057.9 E-FI 0.348*
FI-PI -0.314*
kg/ha) > ‘JG 14’ (908.0 kg/ha) > ‘Anuradha’
PI-M 0.483**
(904.0 kg/ha) > ‘Vaibhav’ (786.8 kg/ha). Thus, HTU S-E 0.370**
‘Uday’ produced 149.9, 154.0, 271.1 kg/ha E-FI 0.125
greater yield over JG 14, ‘Anuradha’ and FI-PI -0.315*
‘Vaibhav’, respectively. Kumar et al. (2017) PI-M 0.635**
PTU S-E 0.216
identified ‘Birsa Chana 3’ as a promising variety
E-FI 0.302*
among ten cultivars/genotypes in Jharkhand. FI-PI -0.345*
The interaction between sowing date and PI-M 0.379**
variety shows that ‘Anuradha’ performed
equally better at two November sowings December. Mean summed GDD, HTU and PTU
(1006.5 and 1025.8 kg/ha); while ‘Uday’ could for entire life cycle were 1661, 11403 and 18766,
be sown upto first week of December for respectively. Chickpea sown on 20 November
sustained yield, and ‘Vaibhav’ and ‘JG 14’ gave recorded highest seed yield (1084.1 kg/ha).
maximum yield in third week of November Among the four varieties, ‘Vaibhav’ took
(Table 3). minimum days (110.3) to maturity, but ‘Uday’
produced the highest seed yield (1057.9 kg/ha)
Table 3. Interaction between sowing time and variety in the study.
on seed yield of chickpea
Variety Seed yield (kg/ha) REFERENCES
Sowing date
4 20 5 19 Chaitanya SK and Chandrika V. 2006. Performance of
November November December December chickpea varieties under varied dates of sowing in
‘Anuradha’ 1006.5 1025.8 897.0 686.2 Chittoor district of Andhra Pradesh. Legume
‘Uday’ 1071.5 1246.2 1099.7 814.2 Research, 29 (2): 137–139.
‘Vaibhav’ 810.3 936.6 741.5 658.7
‘JG 14’ 955.5 1129.5 874.0 673.0 Government of India. 2019. Agricultural Statistics at a
Glance 2018. Directorate of Economics and
Correlations between thermal indices and seed Statistics, Department of Agriculture, Cooperation
yield: The correlation studies between thermal & Farmers’ Welfare, Government of India.
indices and seed yield revealed that GDD (r = Government of West Bengal. 2016. Districtwise
0.483**), HTU (r = 0.635**) and PTU (r = Estimates of Yield Rate and Production of Nineteen
0.379**) during pod initiation to maturity (PI- Major Crops of West Bengal during 2014-15.
M) showed positive effect (P < 0.01) on Bureau of Applied Economics and Statistics,
Department of Statistics and Programme
economic yield of chickpea in the investigation
Implementation, Government of West Bengal.
(Table 4). Thus, it could be concluded that
temperature, bright sunshine hour and day Kaur J, Singh V, Aulakh GS and Raina D. 2019.
Assessment of front line demonstrations on
length during late growth phase favoured the
chickpea in Ferozepur district of Punjab. Journal
pod and seed development i.e. seed yield of of Food Legumes, 32(1): 49-52.
chickpea. Sahu et al. (2007) also reported
Kumar Y, Ghosh J, Mishra RK and Chaturvedi SK.
similar positive correlation for grain yield of
2017. Performance of stability of promising
four chickpea varieties with GDD, HTU and
chickpea (Cicer arietinum L.) cultivars in Jharkhand.
PTU at Junagarh, Gujarat. Journal of Food Legumes, 30(4): 251-255.
Thus, it could be concluded that the Mauriya AK, Kumar V, Kumari A, Kumar P, Kumari
duration of chickpea was reduced by 15.8 days M and Hoda MZ. 2017. Impact of cluster front line
with delay in sowing from 4 November to 19 demonstrations on productivity and profitability
132 Journal of Food Legumes 33(2), 2020
of chickpea (Cicer arietinum L.). Journal of Food
Legumes, 30(1): 57-60.
Nitesh, SD, Talwade AC and Katna G. 2018.
Correlation and path analysis studies in chickpea
(Cicer arietinum L.) for seed yield and its attributes
in the Himalayan region. Journal of Food Legumes,
31(4): 258-260.
Nuttonson MY. 1948. Some preliminary observations
of phenological data as a tool in the study of
photoperiod and thermal requirements of various
plant materials. In: Proceedings of a symposium
on Vernalization and photoperiodism (Eds. A.E.
Murneek and P.R. Whyte). Chronica Botanica
Publishing Co. Walthani, M.A., U.S.A.
Nuttonson MY. 1955. Wheat climatic relationships
and use of phenology in ascertaining the thermal
and photothermal requirement of wheat. Am. Inst.
Crop Ecol. Washington D.C.
Rehman H, Qamar R, Rehman A, Ahmad F, Qamar J,
Saqib M and Nawaz S. 2015. Effect of different
sowing dates on growth and grain yield of chickpea
(Cicer arietinum L.) cultivars under agro-
environment of Taluka Dokri Sindh, Pakistan.
American Journal of Experimental Agriculture, 8
(1): 46-53.
Sahu DD, Chopada MC and Patoliya BM. 2007.
Determination of sowing time for chickpea varieties
in South Saurashtra, India. Journal
Agrometeorology, 9 (1): 68-73.
Singh G, Narwal SS, Rao VUM and Dhaiya DS. 1990.
Effects of sowing date on requirement of growing
degree days, heliothermal units and photothermal
units on phenology of winter maize (Zea mays).
Indian Journal Agricultural Sciences, 60(11): 723-
731.
Tyagi PK. 2014. Thermal requirements, heat use
efficiency and plant responses of chickpea (Cicer
arietinum L.) cultivars under different environment.
Journal Agrometeorology, 16 (2): 195-198.
Yogesh K, Ghosh J, Mishra RK and Chaturvedi SK.
2017. Evaluation of chickpea (Cicer arietinum L.)
germplasm in Jharkhand. Journal of Food
Legumes, 30(3): 183-185.
 Journal of Food Legumes 33(2): 133-134, 2020

Commentary
Food legumes to prevent an impeding nutrition famine in India
SK SHARMA

Former Vice-Chancellor, CSK Prof. S.K. Sharma received MSc and PhD in Genetics
Himachal Pradesh Krishi from IARI, New Delhi. He started his scientific
Vishvavidyalaya, Palampur-176062 career from CPRI, Shimla during 1976 and moved
to Himachal Pradesh Agricultural University,
E-mail: skspbg@yahoo.co.in Palampur during 1980 and rose to the position of
Programme Director, Advanced Centre of Hill Bio-
resources & Biotechnology and Dean, College of
Basic Sciences. He joined as Director, NBPGR,
New Delhi, during 2006 and worked until 2010
when he was appointed as Vice-Chancellor, CSK
Himachal Pradesh Agricultural University, Palampur. Having an
illustrious academic, research and administrative career he combines in
him a range of expertise, a teacher, researcher and institutional leader
with background in Genetics, Crop Improvement, Biotechnology and
PGR. He has been on board of numerous national and international
expert and advisory committees for improvement of food legumes,
including Chair, Research Advisory Committee of ICAR-IIPR, Kanpur
and currently Chair, QRT.

Despite the 50% increase in GDP since
2013, more than one third of the world’s
malnourished children live in India. Among
these, half of the children under three years are
underweight. One of the major causes for
malnutrition is economic inequality. Due to the
low social status of population, their diet often
lacks in both quality and quantity. Deficiencies
in nutrition inflict long-term damage to both
individuals and society. Compared to their
better-fed peers, nutrition-deficient individuals
are more likely to have infectious diseases, which
leads to a higher mortality rate. In addition,
nutrition-deficient individuals are less
productive at work. Low productivity not only
gives them low pay that traps them in a vicious
circle of under-nutrition, but also brings
inefficiency to the society, especially in India
where labor is a major input factor for economic
production.
Nutrition is a great equalizer. It can create
the right environment to stimulate growth,
economic development and progress of an
entire generation, thus propelling India on a
path of excellence. India has demonstrated
early success in managing the Covid 19
pandemic through strict isolation measures,
innovative use of technology, and public health
services. As we fight this pandemic of epic
proportions, accounting for the nutritional
needs of the world’s most vulnerable will not
only give us the strength and immunity to fight
any pandemic but also save lives irrespective
of the socio-economic status.
Food legumes or pulses are annual crops
that constitute an affordable source of protein
and minerals for a large proportion of rural
populations across the globe. These play a vital
role in metabolic and physiological processes
due to the presence of various bioactive
compounds. These are also a good source of 15
essential minerals and vitamins, high in
potassium that supports health of the heart and
plays an important role for digestive and
muscular functions; and are an excellent source
of folate – a B-vitamin essential to the nervous
system function.
India has been growing about 12 different
pulse crops. These have a range of
characteristics that make them a relatively
sustainable crop. For example, legumes release
134 Journal of Food Legumes 33(2), 2020
up to seven times less greenhouse gases per unit
area compared to other crops, and can
sequester carbon in the soils. The plants have
amazing adaptation to harsh environments
such as limited moisture supply, temperature
extremes, poor soil fertility, degraded soils, etc.
These can also make their own nitrogen from
the atmosphere, thus reducing the application
of nitrogen fertilizers. This leaves nitrogen-rich
residues in the soil after harvesting; a benefit
for the next crop planted in its place. According
to FAO, drought-resistant species of legumes
can be of particular benefit to dry environments
where food and nutrition security is often a
challenge. These can also help minimize food
waste, since pulses can be dried and stored for
relatively long periods of time without losing
their nutritional value.
Bioavailability of nutrients in pulses is low
due to the presence of anti-nutrient factors.
Biofortification is a method by which the
nutritional value can be increased with the help
of breeding, transgenic techniques, or
agronomic practices and thus help in preventing
malnutrition. In view of these details, pulses and
legumes provide immense opportunities for
their inclusion in snacks and sports foods
manufacturing industries.
The current record production of about 24
million tones (MT) has been achieved
continuously during the last three years. It is
expected that about 32 MT of pulses with an
annual growth rate of 2.2% is needed by 2030
to meet the ever increasing domestic demand.
It calls for all round efforts and strategic
planning in research, generating innovations,
its dissemination and capacity building. ICAR-
IIPR with its partners in NARS is continuously
and persistently striving hard in scaling up the
productivity goals through its multifarious
efforts.
The pulse revolution has started and there
is no room for complacency. There is a
continuous need for budgetary and policy
support for research and development to
achieve further genetic gains. New scientific
innovations can play an important role in
developing farmer friendly technologies.
Steadfast efforts for multidisciplinary research
along with modern biotechnological
interventions for pulse improvement are crucial
to accelerate the enhanced production in order
to sustain food and nutritional security. Marker
assisted breeding and development and
utilization of genomic tools are very important
to develop high yielding and multiple disease
resistant cultivars for the different regions of
the country. Genetic engineering and genome
editing techniques have great potential for
seeking genetic improvement. Besides, pre-
breeding and genetic enhancement,
incorporating photo- and thermal insensitivity,
breeding for biotic and abiotic stresses,
conservation agriculture, post harvest
management and value addition, strengthening
seed sector, etc. are very crucial to accelerate
their enhanced production in order to sustain
Indian food and nutritional security.
 Journal of Food Legumes 33(2): 135, 2020

List of Referees for Vol. 33(2)

The Editorial Board gratefully acknowledges the help rendered by following referees in
reviewing manuscripts for the Vol. 33(2): 2020.

Dr. A. Amarender Reddy, ICAR-CRIDA, Hyderabad

Dr. A.R. Sharma, RLBCAU, Jhansi

Dr. Brij Nandan, SKUAST, Jammu

Dr. Gaurav Taggar, PAU, Ludhiana

Dr. Jitendra Kumar, ICAR-IIPR, Kanpur

Dr. Mohd. Akram, ICAR-IIPR, Kanpur

Dr. M. Sreekanth, RARS, Lam, Guntur

Dr. N.V. Kumbhare, ICAR-IARI, New Delhi

Dr. Narendra Kumar, ICAR-IIPR, Kanpur

Dr. Pawan Kulwal, MPAU, Rahuri, Maharashtra

Dr. Shanmugavadivel P.S., ICAR-IIPR, Kanpur

Dr. Shailendra Sharma, CCSU, Meerut

Dr. Uma Sah, ICAR-IIPR, Kanpur

 Instructions to Authors
Journal of Food Legumes (formerly Indian Journal of Pulses
Research) publishes original papers, short communications
and review articles by renowned scientists, covering all
areas of food legumes research. The paper should not have
been published or communicated elsewhere. Authors will
be solely responsible for the factual accuracy of their
contribution. Language of publication is English (British).
Please send your manuscript to following address:
Secretary
ISPRD
Indian Institute of Pulses Research
Kalyanpur, Kanpur 208 024, India
Email: secretary.isprd@gmail.com
Manuscript must be submitted through e-mail author(s)
required to submit a certificate that the paper is exclusive
for Journal of Food Legumes. Manuscripts must conform
to the Journal style (see the latest issue). Correct language
is the responsibility of the author. After having received
your contribution (date of submission), there will be a
review process before the editorial board takes decision
regarding acceptance for publication. One copy of the
revision together with the original manuscript must be
returned to the subject editor or Secretary. The submitted
paper must be one complete word document file
comprising a title page, abstract, text, references, tables,
figure legends and figures. When preparing your text file,
please use only Times New Roman for text (12 point,
double spacing) and Symbol font for Greek letters to avoid
inadvertent character substitutions.
F orma t
Every original paper should be divided into the following
five sections: ABSTRACT, Key words, INTRODUCTION,
MATERIALS AND METHODS, RESULTS AND
DISCUSSION, and REFERENCES. The manuscript should
be double spaced, and with 4-cm margins with page and
line numbers. The main title must be capital bold.
Subheading must be bold italic and Sub-sub heading
normal italic.
At the head of the manuscript, following information
should be given: title of paper, name(s) of author(s),
institute where the research was carried out, present
addresses of authors (foot note) and of the corresponding
author (if different from above Institute). Authors are
required to provide running title of the paper. You must
supply an E-mail address for the corresponding author.
The abstract should contain at least one sentence on each
of the following: objective of investigation (hypothesis,
purpose, aim), experimental material, method of
investigation, data collection, result and conclusions.
Maximum length of abstract is 175 words. Up to 10 key
words should be added at the end of the abstract and
separated by comma. Key words must be arranged
alphabatically (e.g., EMS, Gamma ray, Mungbean,
Mutations, Path coefficient, ......).
Each figure, table, and bibliographic entry must have a
reference in the text. Any correction requested by the
reviewer should also be integrated into the file.
Manuscript file including tables must be in MS Word and
Windows-compatible and must not contain any files other
than those for the current manuscript. Please do not import
the figures into the text file. The text should be prepared
using standard software (Microsoft Word); do not use
automated or manual hyphenation.
Length
Manuscripts should not exceed a final length of 15 printed
pages, i.e., 5,000 words, including spaces required for
figures, tables and list of references. Manuscripts for short
communications should not exceed 3000 words printed
pages, with not more than a total of 2 figures or tables.
Units, abbreviations and nomenclature
For physical units, unit names and symbols, the SI-system
should be employed. Biological names should be given
according to the latest international nomenclature.
Botanical and zoological names, gene designations and
gene symbols are italicised. Yield data should be reported
in kg/ha. The name of varieties or genotypes must start
and end with single inverted comma (e.g., ‘Priya’, ‘IPA
204’, ......).
Tables and Figures
Tables and figures should be limited to the necessary
minimum. Please submit reproducible artwork. For
printing of coloured photograph, authors will be charged ` 4000/
- per photograph. It is essential that figures are submitted as
high-resolution scans.
References
The list of references should only include publications
cited in the text. They should be cited in alphabetical order
under the first author’s name, listing all authors, the year
of publication and the complete title, according to the
following examples:
Becker HC, Lin SC and Leon J. 1988. Stability analysis in
plant breeding. Plant Breeding 101: 1-23.
Sokal RR and Rholf FJ. 1981. Biometry, 2nd Ed. Freeman,
San Francisco.
Tandon HLS. 1993. Methods of Analysis of Soils, Plants,
Water and Fertilizers (ed). Fertilizer Development and
Consultation Organization, New Delhi, India. 143 pp.
Singh DP. 1989. Mutation breeding in blackgram. In: SA
Farook and IA Khan (Eds), Breeding Food Legumes.
Premier Publishing House, Hyderabad, India. Pp 103-109.
Takkar PN and Randhawa NS. 1980. Zinc deficiency in
Indian soils and plants. In: Proceedings of Seminar on
Zinc Wastes and their Utilization, 15-16 October 1980,
Indian Lead-Zinc Information Centre, Fertilizer
Association of India, New Delhi, India. Pp 13-15.
Satyanarayan Y. 1953. Photosociological studies on
calcarious plants of Bombay. Ph.D. Thesis, Bombay
University, Mumbai, India.
In the text, the bibliographical reference is made by giving
the name of the author(s) with the year of publication. If
there are two references, then it should be separated by
placing ‘comma’ (e.g., Becker et al. 1988, Tandon 1993). If
references are of the same year, arrange them in alphabatic
order, otherwise arrange them in ascending order of the
years.
While preparing manuscripts, authors are requested to
go through the latest issue of the journal. Authors are
also required to send the names & E-mail address of at
least 3-4 reviewers appropriate to their articles.