General and Comparative Endocrinology 312 (2021) 113860

Contents lists available at ScienceDirect

General and Comparative Endocrinology

journal homepage: www.elsevier.com/locate/ygcen

Research paper

Effects of background color and feeding status on the expression of genes

associated with body color regulation in the goldfish Carassius auratus
Tingshu Yang , Satoshi Kasagi , Akiyoshi Takahashi , Kanta Mizusawa *
School of Marine Biosciences, Kitasato University, Sagamihara, Kanagawa 252-0373, Japan

A R T I C L E I N F O A B S T R A C T

Keywords: Alpha-melanocyte-stimulating hormone (α-MSH), a peptide derived from proopiomelanocortin (POMC), and
Background color melanin-concentrating hormone (MCH), act as neuromodulators and regulate food intake in vertebrates. In
Body color teleosts, these peptides are also involved competitively in body color regulation; α-MSH induces a dark body
Feeding
color, while MCH induces a pale body color. Similarly, members of the growth hormone (GH) family, somato­
Goldfish
lactin (SL) and prolactin (PRL), which are involved in the regulation of energy metabolism, are also associated
Hormone
with body color regulation in teleosts. Since these hormones are involved in both body color regulation and
energy metabolism, it is possible that feeding status can affect body color. Here, we examined the effects of
fasting on the response of goldfish body coloration to changes in background color. Goldfish were acclimated for
one week in tanks with a white or black background under conditions of periodic feeding or fasting. The results
showed that body color and expression levels of pmch1 and pomc were affected by background color, irrespective
of feeding status. Expression levels of sla were higher in fish maintained in tanks with a black background than in
tanks with a white background, and higher in the fasted fish compared to the fed fish. However, the pattern of slb
expression was almost the opposite of that observed in sla expression. The expression levels of gh and prl in the
pituitary, and pmch2a and pmch2b in the brain, were not affected by background color. These results suggest that
MCH, α-MSH, SLα, and SLβ might be involved in body color regulation and that they are affected by background
color in goldfish. The results also suggest that feeding status may affect body color regulation via SLα and SLβ,
although these effects might be limited compared to the effect of background color.

1. Introduction
Fish can change their body color in response to the hue and bright­
ness of background colors and photic conditions (Cal et al., 2017;
Takahashi et al., 2014). Neuroendocrine and endocrine systems located
in the hypothalamus-pituitary axis are intimately associated with
changes in teleost body coloration through their effects on hormone
levels in an antagonistic manner (Mizusawa et al., 2013; Sugimoto,
2002). Melanin-concentrating hormone (MCH), which is produced in
the neuronal somata of the hypothalamus and released from the nerve
endings in the pars nervosa of the pituitary, makes the body color pale
by stimulating the aggregation of pigments in chromatophores, such as
melanophores and xanthophores (Takahashi et al., 2014). In contrast,
α-melanophore-stimulating hormone (α-MSH), which is generated by
proteolytic cleavage of the precursor protein proopiomelanocortin
(POMC) and secreted from glandular cells in the pars intermedia of the
pituitary, darkens body color by dispersing pigments in chromatophores
(Takahashi et al., 2014). The expression of these genes is affected by the
photic environment, including the background color (Takahashi et al.,
2014). Although the primary functions of MCH and α-MSH in teleosts
are to regulate body color, they are multifunctional hormones with
widely distributed receptors (Takahashi et al., 2014). Indeed, MCH and
α-MSH are also associated with food intake and energy homeostasis in
teleosts as in mammals (Takahashi et al., 2014): Both hormones exhibit
anorexigenic functions in goldfish (Matsuda et al., 2006, 2007; Shima­
kura et al., 2008).
Food intake is intimately linked to growth and energy metabolism,
and these biological processes are regulated by the growth hormone
(GH) family. GH, which is secreted from the proximal pars distalis of the
pituitary in fish, is primarily responsible for promoting somatic growth
through a variety of direct and indirect mechanisms (Fuentes et al.,
2013). Another member of the GH family, prolactin (PRL), which is
secreted from the rostral pars distalis of the pituitary, has been shown to
be involved in both pigment dispersion (Fujii, 2000) and lipid

* Corresponding author.
E-mail address: mizusawa@kitasato-u.ac.jp (K. Mizusawa).

https://doi.org/10.1016/j.ygcen.2021.113860
Received 31 March 2021; Received in revised form 5 July 2021; Accepted 17 July 2021
Available online 21 July 2021
0016-6480/© 2021 Elsevier Inc. All rights reserved.

Downloaded for Anonymous User (n/a) at University of Nahdlatul Ulama Surabaya from ClinicalKey.com by Elsevier on
February 02, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
T. Yang et al.
metabolism (Sheridan, 1986; Sangiao-Alvarellos et al. 2006). In fish, the
primary function of PRL is freshwater adaptation (Hasegawa et al.,
1986; Mancera and McCormick, 2019). Another member of the GH
family, somatolactin (SL), which is secreted from the pars intermedia of
the pituitary, has been shown to be associated with lipid metabolism
(Sasano et al., 2012; Vega-Rubín De Celis et al., 2003). In addition, SL is
also involved in body color regulation in teleosts by aggregating mela­
nosomes (Nguyan et al., 2006; Zhu and Thomas, 1996), and the
expression of SL is higher in fish reared in tanks with a black background
compared to fish reared in tanks with a white background (Cánepa et al.,
2006; Cánepa et al., 2012).
Based on the findings of the aforementioned studies, it is considered
likely that the nutritional status and/or energy reserves of fish affect the
functioning of the endocrine systems related to body color regulation.
We previously showed that the body color of goldfish Carassius auratus is
also influenced by background color, with fish exhibiting paler and
darker colors when reared in tanks with white and black backgrounds,
respectively (Kasagi et al., 2020b; Mizusawa et al., 2018b). The
expression levels of pmch in the brain were high and low when fish were
reared in tanks with white and black backgrounds, respectively, whereas
expression levels of pomc, which codes for α-MSH, were high and low in
the pituitaries of fish reared in tanks with black and white backgrounds,
respectively (Kasagi et al., 2020b; Mizusawa et al., 2018b). In those
experiments, fish were fed daily to satiation until the day before tissues
were harvested for analysis. Since food intake is closely linked to
nutritional status and energy reserves, the present study was undertaken
to clarify the effects of feeding status (fed and fasted for several days) on
the expression of MCH, α-MSH, and the GH family of genes.
2. Materials and methods
2.1. Experimental tanks
The tank size was 45 cm (width) × 30 cm (height) × 30 cm (depth)
and filled with 35 L of water. Using acrylic silicon spray paint (Kanpe
Hapio, Osaka, Japan), the outside of the colorless transparent water tank
was painted white for the white background group and black for the
black background group. Two tanks were prepared for each background
color treatment.
2.2. Fish
Immature, red-colored common goldfish, C. auratus, were obtained
from commercial dealers in Tochigi, Japan. All experiments were con­
ducted following the Guidelines for the Care and Use of Animals at
Kitasato University. No bioethics report number is assigned because fish
are not included in animal experiments under the regulation. Before
starting the experiments, the goldfish were maintained in a conventional
glass tank for 3 days and fed a small amount daily (Kyorin Co., Ltd.,
Kasei, Japan) for acclimation.
2.3. Rearing of fish under black and white background conditions with or
without feeding
Goldfish (9.5 ± 5.4 g body weight, 80 ± 12 mm body length: mean ±
S.D.) were reared under fed or fasted conditions in white- or black-
colored tanks equipped with fluorescent lamps (FL) at room tempera­
ture (25 ◦ C). Ten goldfish per tank were reared at 25 ◦ C under a
controlled photoperiod (12:12, light:dark cycle; with light from
07:00–19:00) for 7 days (from day 0 to day 6): This rearing period was
determined based on data from a previous study showing that fasting for
seven days reduced the number of MCH-immunoreactive cells in the
hypothalamus of goldfish (Matsuda et al., 2007). The photon flux den­
sity (PFD) of the FL was 7 μmol⋅m− 2⋅s− 1 at the bottom of the empty tank.
The goldfish in the control treatment (fed group) were fed a commer­
cially prepared diet (Kyorin Co., Ltd., Kasei, Japan) daily at 12:00 and
Downloaded for Anonymous User (n/a) at University of Nahdlatul Ulama Surabaya from ClinicalKey.com by Elsevier on
February 02, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
General and Comparative Endocrinology 312 (2021) 113860
13:00 until they were satiated, excluding days 5 and 6. The fasted group
received no food during this seven-day period. The number of fish
decreased to 9 in the white background/fasted group because of an
accidental death on day 5. The brain and pituitary were sampled from
goldfish anesthetized by immersion in 0.05% 2-phenoxyethanol (FUJI­
FILM Wako Pure Chemical, Tokyo, Japan) at the end of each rearing
experiment.
2.4. Evaluation of body color
Body color brightness was measured using a slight modification of
the method of Kasagi et al. (2020b). After sampling, the lateral side of
the goldfish was photographed using a digital camera (D3100, Nikon,
Tokyo, Japan). The images were then analyzed using ImageJ 1.51
software (Schneider et al., 2012). Three adjacent scales on the dorsal
side of the lateral line were selected from between the operculum edge
and the anterior origin of the dorsal fin (Supplemental Fig. 1). An oval
area region of interest (ROI) ranging from 200 to 400 pixels was selected
for each scale. Non-weighted RGB intensity scores of each ROI were
measured using ImageJ software. The average intensity scores from each
ROI (scale) were then calculated to obtain an average score for each
individual scale and for the group of three scales.
2.5. Nucleic acid preparation
Total RNA was extracted from the whole brain using ISOGEN2 re­
agent (FUJIFILM Wako) and a MM400 Mixer Mill (Retsch, Haan, Ger­
many). Total RNA was extracted from the pituitary and brain using
RNeasy Mini Kit (Qiagen, Hilden, Germany). Total RNA was treated with
RNase-free DNase (TaKaRa, Otsu, Japan) to eliminate genomic DNA
contamination and then purified by phenol–chloroform extraction fol­
lowed by isopropanol precipitation.
2.6. Molecular cloning
The cDNAs encoding gh, prl, sla, and slb of goldfish were amplified by
reverse transcription-polymerase chain reaction (RT-PCR) from the pi­
tuitary total RNA using oligonucleotide primers designed according to
the nucleotide sequences obtained from the following NCBI GenBank
entries: EU157192 for gh, S82220 for prl, EU580712 for sla, and U72940
for slb (Table 1). RT-PCR was carried out using OneStep Primescript RT-
PCR kit (TaKaRa), and the cDNA fragments were cloned into a pGEM-T
EASY vector system (Promega, Madison, WI, USA). Following standard
alkaline-SDS plasmid DNA preparation, DNA sequences were verified
using a BigDye terminator v3.1 cycle sequencing kit (Applied Bio­
systems, Foster City, CA, USA) and a 3130xl Genetic Analyzer (Applied
Biosystems). cDNA clones for pomc were prepared as described previ­
ously (Mizusawa et al., 2018b). Here, two types of MCH genes (verte­
brate and teleost types) of goldfish are denoted as pmch1 and pmch2,
respectively, following the terminology of Berman et al. (2009) and
Mizusawa et al. (2018a), Mizusawa et al. (2018b). Three predicted
goldfish MCH2-like cDNA sequences that were homologous to zebrafish
pmch2 (FJ204828, Berman et al., 2009) were found in GenBank
(XM_026232862, XM_026209542, and XM_026209543). The latter two
are transcript variants derived from the same gene. Thus, PCR primers
for pmch2a and pmch2b (Table 1) were designed based on these entries to
amplify the pmch2 genes, and RT-PCR on brain RNA, sequencing anal­
ysis, and cDNA cloning was carried out as described above.
2.7. Measurement of hormone mRNA content in the brain and pituitary
The sense strand RNA of each neuropeptide and hormone gene was
transcribed in vitro from the plasmid cDNA clones described in section
2.6. In vitro transcription was carried out using T7 RNA polymerase or
SP6 RNA polymerase (TaKaRa) following linearization at the 3′ -terminal
end of inserts by restriction enzyme digestion with enzymes such as Sal I
T. Yang et al. General and Comparative Endocrinology 312 (2021) 113860

Table 1
Oligonucleotide primers used for RT-PCR.
Gene Orientation Nucleotide sequences (from 5′ to 3′ ) Amplicon size (bp)

pmch2a Forward CCTGCAAGTAAGTCAATCATATCACCTAAGAT 507

Reverse AGGTGCTTTGTCAGCTGCTCTGT

pmch2b Forward TGCAAGCAAATCAACCATCACTCATGATC 632

Reverse AGGTGCTTTGTCAGCTGCTCTGT

gh Forward ATGGCTAGAGCATTAGTGCTGTTATCGGT 633

Reverse CTACAGGGTGCAGTTGGAATCCAAGGATC

prl Forward ATGACTCAAGGATCTAGACTGTACTTTGC 633

Reverse CTAACACATCTCGGGTCTCTTCTTGG

sla Forward ATGAACAGGGTTAAAGTTCTGCAGGC 705

Reverse TTAGTAGGAAAGGCAGCTGAGCT

slb Forward ATGAAGAAAACTACAGTTCTACAGGTTTGTAT 693

Reverse TTAGAATAGGGAGCAATTCTCCTTATCAA

or Nco I. A reference series of RNA concentrations of each RNA was then
prepared by serial dilution.
Quantitative RT-PCR (qRT-PCR) was performed using a OneStep RT-
PCR kit (Qiagen) or a One Step PrimeScript RT-PCR kit (TaKaRa) on a
Thermal Cycler Dice Real Time System II (TaKaRa) or LightCycler 96
system (Roche Diagnostics, Basel, Switzerland). Primers, TaqMan probes,
and designed amplicon sizes are listed in Table 2. cDNA fragments of
pmch1a and pmch1b were amplified using the same primers, which were
based on AM403730 and AM403731 from the NCBI GenBank, because
amplification primers could not be prepared to distinguish between these
two sequences. Thus, these sequences are called pmch1. Goldfish also has
subfamily genes for gh, prl, sla, and slb. BLAST/BLAT searches on
Ensembl (http://www.ensembl.org/index.html) found transcripts derived
from two genes (ENSCARG00000002508 and ENSCARG00000026878)
matching gh (EU157192), two genes (ENSCARG00000025840 and
ENSCARG00000002943) matching prl (S82220), three genes (ENSCAR
G00000011854, ENSCARG00000017646, and ENSCARG00000069509)
matching sla (EU580712), and two genes (ENSCARG00000041197 and
ENSCART00000006789) matching slb (U72940) with more than 70%
nucleotide sequence identities. Although the sequences of the primers
Table 2
Oligonucleotide primers and TaqMan probes used for quantitative RT-PCR.
listed in Table 2 do not fully match the non-target genes, the possibility of
amplifying these transcripts by the qRT-PCR can not be excluded. The
compositions and thermal conditions of each qRT-PCR reaction were set
according to the manufacturer’s instructions. The brain and pituitary RNA
samples of eight individuals were randomly selected from each experi­
mental group. The mRNA levels of the genes in each sample were quan­
tified based on the amplitude scaled to the dilution series of the reference
RNA (typically 10− 1 to 104 fg) for each gene.
2.8. Statistics
R version 4.1.0 (R Core Team, Vienna, Austria) was used for the
statistical analyses. Normality and homogeneity of all data were vali­
dated using Shapiro–Wilk normality test and Bartlett test of homoge­
neity of variance, respectively. Since some of the data did not satisfy
normality or homogeneity, the significance of differences between the
values was assessed using Kruskal-Wallis rank sum test and following
Pairwise comparisons using Wilcoxon rank sum exact test. Differences
were considered statistically significant when P values were less than
0.05. All data were represented with box-and-whisker plots created by
using GraphPad Prism 6 (GraphPad Software, San Diego, CA, USA).
3. Results

Gene Orientation Nucleotide sequences (from 5 to 3 )

′ ′
Amplicon
size (bp)
3.1. Identification of additional pmch mRNA sequences

pmch2a Forward CATACTTGCAGACACAGGGATAAAA 110

Two pmch2 sequences (pmch2a and pmch2b) were obtained in the
Reverse TGAATCCATCCAGAGCATGATC
TaqMan CTTGCCTTTTCGAGAACCTTCACTGTGC present study. The deduced amino acid sequences were aligned together
probe with two PMCH1 sequences (PMCH1a and PMCH1b), as shown in Fig. 1.
pmch2b Forward CGCATCTTCATATTTGCTGACACA 119
The two newly identified PMCH2 sequences showed low sequence
Reverse CCAGCCAGAGCATGATCCAT identities against known PMCH1 sequences (Table 3), which required
TaqMan AAAACCTTCCCTGTGATGCCGCCA the insertion of numerous gaps to facilitate sequence alignment (Fig. 1).
probe The nucleotide sequence identities of the pmch1 subtypes and the pmch2
gh Forward CCCTCTGTCTTTCTGCAATTCTG 100 subtypes were less than 46%, and amino acid sequence identities of the
Reverse GCGGAAAGAAATGCGAAGAAG PMCH1 subtypes and the PMCH2 subtypes were less than 58%. Mature
TaqMan CGCCCACTGGAAAAGATGAAACACAGA MCH peptide sequences contained in PMCH1 and PMCH2 subtypes were
probe
comparable to vertebrate and teleost sequences, respectively.
prl Forward CCTCTCTCACTAATGACCTGGATTCT 101
Reverse ATTGGGAATCTGAAGAGAGGATGT
TaqMan TAATGATGCCCCGTCCGTCGATG 3.2. Effects of background color on body color under different feeding
probe regimes
sla Forward GGAATCAGGGAGGAACCATGT 100
Reverse ACCGAGTGAAGCAGCCATTT The body color of goldfish reared in tanks with black and white
TaqMan TCACACCAAACCCTTCCCCATCCC backgrounds, with or without feeding, is shown in Fig. 2 and Supple­
probe mental Fig. 2. In both the fed and fasted groups, the body coloration of
slb Forward AACGGTGTCGGTTCCTATGTCT 118 goldfish reared in tanks with a white background was significantly
Reverse CGCCTGTACATCTACCAGTGGAT brighter than those reared in tanks with a black background. No sig­
TaqMan CAGATTTCCGACAAATGGCTCCTTCACTC nificant difference was observed in body color brightness between the
probe
fed and fasted groups of goldfish reared in tanks with black and white

Downloaded for Anonymous User (n/a) at University of Nahdlatul Ulama Surabaya from ClinicalKey.com by Elsevier on
February 02, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
T. Yang et al. General and Comparative Endocrinology 312 (2021) 113860

Fig. 1. Amino acid sequences of goldfish (gf) PMCH subtypes compared with zebrafish (zf) PMCH subtypes. Accession numbers are AM403730 for gfPMCH1a,
AM403731 for gfPMCH1b, LC595602 for gfPMCH2a, LC595603 for gfPMCH2b, FJ392644 for zfPMCH1, and FJ204828 for zfPMCH2. Highlighted amino acid
residues are conserved in all six peptides. Asterisks show positions where different amino acid residues, which are shown by lower case symbols, are observed
between gfPMCH1a and gfPMCH1b. Box shows MCH peptide sequences flanked by dibasic amino acid.

backgrounds.
Table 3
Sequence similarity among goldfish PMCHs.
3.3. Effects of background color on the expression of pituitary hormone
PMCH1a PMCH1b PMCH2a PMCH2b genes under different feeding regimes
PMCH1a 92.1 57.7 54.1
PMCH1b 89.7 57.1 55.1 The sla mRNA levels in goldfish reared in tanks with black back­
PMCH2a 45.2 45.8 87.8
grounds were significantly higher than those reared in tanks with white
PMCH2b 43.9 43.2 77.4
backgrounds in the fed group, and similar results were observed in the
Pairwise sequence similarity (%) among amino acid sequences (upper-right) and fasted group (Fig. 3A). When fish reared in tanks with the same back­
nucleotide sequences (lower-left) of goldfish MCHs. ground color were compared, the sla mRNA content of the fed group was
significantly higher than that of the fasted group in tanks with a white
background, while no significant difference was observed in fish reared
in tanks with a black background.
The slb mRNA levels in goldfish reared in tanks with a white back­
ground were significantly higher than those reared in tanks with a black
background in the fasted group, while no significant difference was
observed among fed group (Fig. 3B). When fish from tanks with the same
background color were compared, the slb mRNA levels in the fasted
group were significantly higher than those in the fed group.
The gh mRNA levels in goldfish reared in tanks with a black back­
ground in the fasted group were significantly higher than that of fed
group, while no significant difference was observed among those reared
in tanks with a white background (Fig. 3C). No significant difference was
observed in the pituitary contents of prl mRNA between the fed or fasted
goldfish reared in tanks with both a black and white background
(Fig. 3D). In the case of gh and prl mRNA, no difference was observed
Fig. 2. Effects of tank background color and feeding status on the brightness of between fish reared in tanks with black or white backgrounds in both the
goldfish after 7-days of rearing. Goldfish were reared in the tank with a white fed and fasted groups (Fig. 3C, D).
background (gray frame) or black background (black frame). Sample sizes were In the fed group, the pomc mRNA levels in goldfish reared in tanks
10 in the fed group and black background/fasted group, and 9 in the white with a black background were significantly higher than those reared in
background/fased group. Different letters indicate statistically significant dif­ tanks with a white background (Fig. 4), and similar results were ob­
ferences estimated by Pairwise comparisons using Wilcoxon rank sum exact test tained for the fasted group. No significant difference in pituitary pomc
(P < 0.05). See Supplemental Fig. 2 for the associated picture. mRNA content was observed between the fed and fasted groups in
goldfish reared in tanks with black or white backgrounds.

Downloaded for Anonymous User (n/a) at University of Nahdlatul Ulama Surabaya from ClinicalKey.com by Elsevier on
February 02, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
T. Yang et al.
Fig. 3. Effects of background color and feeding status on the pituitary mRNA
content of GH family genes, (A) sla, (B) slb, (C) gh, and (D) prl, in goldfish after
7 days of rearing. Goldfish were reared in the tank with a white background
(gray frame) or black background (black frame). Different letters indicate sta­
tistically significant differences estimated by Pairwise comparisons using Wil­
coxon rank sum exact test (P < 0.05, n = 8).
3.4. Effects of background color on the expression of neuropeptide genes
under different feeding regimes
The pmch1 mRNA levels in the brains of goldfish reared in tanks with
a white background were significantly higher than those reared in tanks
with a black background in the fed group, but no such difference was
Downloaded for Anonymous User (n/a) at University of Nahdlatul Ulama Surabaya from ClinicalKey.com by Elsevier on
February 02, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
General and Comparative Endocrinology 312 (2021) 113860
Fig. 4. Effects of background color and feeding status on the pituitary mRNA
content of pomc in goldfish after 7 days of rearing. Goldfish were reared in the
tank with a white background (gray frame) or black background (black frame).
Different letters indicate statistically significant differences estimated by Pair­
wise comparisons using Wilcoxon rank sum exact test (P < 0.05, n = 8).
observed in the fasted group (Fig. 5A).
No significant difference was observed in the brain contents of
pmch2a mRNA and pmch2b mRNA between the goldfish reared in tanks
with a black or white background in both the fed and fasted groups
(Fig. 5B, C).
4. Discussion
In the present study, no difference in the body color of goldfish in the
fed and fasted groups (five days) was observed. This result was com­
parable to our previous report in which body color regulation was
examined using fasted goldfish (seven days) (Kasagi et al., 2020b). The
body color of the goldfish used in this study is all red, and we have
confirmed the absence of melanophores in the skin in the previous study
(Mizusawa et al., 2018b). In goldfish xanthophores, pigment organelles
of a carotenoid droplet can aggregate or disperse (Tchen et al., 1988).
Therefore, the body color change responding to the background color
would be due to the pigment translocation in the xanthophores.
This study examined whether feeding status affects the endocrine
systems that regulate body coloration. We found that the expression of
sla and slb in the pituitary responds to both background color and
feeding status with different manners. The same results were obtained in
a preliminary experiment and are reproducible (data not shown). SL has
been suggested to play a variety of biological roles in fish (Kaneko,
1996). Regarding body color regulation, SL has been associated with
adaptation to dark background colors, as reported by an increase in
plasma SL levels of red drum (Zhu and Thomas, 1995), protein levels
(Cánepa et al., 2006) and transcript levels (Cánepa et al., 2012) in the
pituitary in a cichlid, and plasma SL levels (Kakisawa et al., 1995) and
the pituitary transcript levels in rainbow trout (Kasagi et al., 2020a). The
results of sla expression obtained in this study, i.e., elevated in fish
reared in tanks with black backgrounds and low in fish reared in tanks
with white backgrounds, are consistent with the aforementioned pre­
vious studies. However, slb has been shown to be associated with body
color paling, and recombinant SLβ induces melanosome aggregation in
the skin of zebrafish (Nguyen et al., 2006). Thus, the higher expression
levels of slb observed in the fasting fish reared with a white background
than with a black background is suggestive of an association between
SLβ and body color paling. Moreover, the different expression profiles of
slb between the fasting and fed groups may be related to a possible
function of SLβ in the lipid metabolism, as discussed below.
Several lines of evidence have suggested an association between SL
in the intermediate lobe of the pituitary and lipid metabolism. High
levels of SL receptor gene expression have been observed in the fat tissue
T. Yang et al.
Fig. 5. Effects of background color and feeding status on the brain mRNA
content of pmch, (A) pmch1, (B) pmch2a, and (C) pmch2b, in goldfish after 7 days
of rearing. Goldfish were reared in the tank with a white background (gray
frame) or black background (black frame). Different letters indicate statistically
significant differences estimated by Pairwise comparisons using Wilcoxon rank
sum exact test (P < 0.05, n = 8).
and liver of coho salmon (Fukada et al., 2005). In cobalt trout, a rainbow
trout variant lacking most of the intermediate lobe of the pituitary, SL
cells are scarce in the pituitary, and fat is deposited in the body cavity
(Kaneko et al., 1993; Yada et al., 2002). In vivo administration of re­
combinant SL induces an increase in carbon dioxide excretion and ox­
ygen uptake and a decrease in the respiratory quotient (Vega-Rubín De
Celis et al., 2003). In juvenile gilthead sea bream, short-term fasting
induces an increase in plasma SL levels (Company et al., 2001). In the
present study, higher slb expression was observed in fasted goldfish
compared to that in fed goldfish, irrespective of tank background color
(see Fig. 3B), indicating a link between enhanced gene expression and
food deprivation or reduced energy reserves. If SLβ induces a lipolytic
effect in the liver, it is reasonable to suppress that function under feeding
conditions. In contrast to slb, expression of sla was higher in fed goldfish
compared to fasted goldfish (see Fig. 3A, B). It is possible that SLα and
Downloaded for Anonymous User (n/a) at University of Nahdlatul Ulama Surabaya from ClinicalKey.com by Elsevier on
February 02, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
General and Comparative Endocrinology 312 (2021) 113860
SLβ have antagonistic functions in lipid catabolism, just as SLα and SLβ
have antagonistic effects on body color regulation.
The findings of the present study suggest that fasting enhances gh
expression in the pituitary of goldfish. GH has been reported to stimulate
lipid mobilization in coho salmon (Sheridan, 1986) and rainbow trout
(O’Connor et al., 1993). Furthermore, numerous studies have reported
that fasting increases plasma GH levels in chinook salmon (Pierce et al.,
2005), coho salmon (Shimizu et al., 2009), and rainbow trout (Duan and
Plisetskaya, 1993; Farbridge and Leatherland, 1992a; Farbridge and
Leatherland, 1992b; Holloway et al., 1994; Norbeck et al., 2007; Pot­
tinger et al., 2003; Sumpter et al., 1991; Takahashi et al., 1991). Fasting
has also been reported to induce higher expression levels of gh in the
pituitary of channel catfish (Small and Peterson, 2005), Mozambique
tilapia (Fox et al., 2006), rabbit fish (Ayson et al., 2007), and striped bass
(Small et al., 2002). Our finding of elevated gh expression in the fasted
goldfish is consistent with these previous studies. In rainbow trout,
fasting increased the GH-sensitivity of the adipose tissue, resulting in
lipid depletion (Norbeck et al., 2007). GH may work in concert with SLβ
to promote lipolysis and contribute to somatic cell maintenance during
prolonged starvation.
The expression of pomc in the pituitary of goldfish affected black and
white background color (Kasagi et al., 2020b; Mizusawa et al., 2018b).
In the present study, the high and low pomc expression levels observed in
fish reared in tanks with black and white backgrounds, respectively, are
comparable to those observed in previous studies. However, the findings
reported here also show that differences in feeding status may have less
effect on pomc expression in response to background color.
Four pmch genes in goldfish were categorized into two groups; one
was pmch1 (combination of pmch1a and pmch1b in the present study,
because we were unable to prepare primers for independent amplifica­
tions) whose expression changed in response to changes in background
color, and the other group comprised pmch2a and pmch2b, whose
expression was unaffected by background color. The pigment-
aggregating activities of both MCH1 and MCH2 on melanophores and
xanthophores have been confirmed in vitro in barfin flounder (Mizusawa
et al., 2015), i.e., the potency of MCH1 was greater than that of MCH2.
Therefore, the different expression profiles of pmch1 and pmch2a/2b
suggest a greater contribution of MCH1 encoded on pmch1 than MCH2
encoded on pmch2a and pmch2b, although both MCH peptides could
aggregate pigments in chromatophores. In zebrafish, pmch1 expression
has been shown to correlate with paler body color with aggregation of
melanosomes in melanophores in fish reared in a tank with a white
background, while an increase in pmch2 expression in response to the
white background was limited (Berman et al., 2009). Considering the
distinct expression patterns of pmch genes in fish reared in tanks with
different background colors in goldfish and zebrafish, as well as some­
what different biological activities between MCH1 and MCH2 observed
in barfin flounder, pmch1 may play a more prominent role in body color
regulation than pmch2. However, a recent study on zebrafish reported
that some pmch2-expressing neurons target the posterior region of the
pituitary containing α-MSH and blood vessels (Madelaine et al., 2020),
which suggests that MCH2 might be involved in the regulation of body
color by modulating α-MSH production or a circulating hormone, such
as MCH1.
Although pmch1 is a teleost-specific pmch gene, pmch2 is widespread
in vertebrates (Diniz and Bittencourt, 2019). MCH2 has been suggested
to be associated with appetite control, food intake, and energy balance
in mammals (Noble et al., 2018). Different roles of pmch1 and pmch2
have been presumed in zebrafish because the expression of pmch1 and
pmch2 genes is observed in neurons that are closely localized, but that do
not overlap (Berman et al., 2009). Berman et al. (2009) suggested that
MCH might stimulate food intake in zebrafish because fasting increased
the number of MCH2-producing cells, while no difference was observed
in mRNA levels in the fed control. Conversely, in goldfish, the number of
MCH immunoreactive cells in the hypothalamus decreased after fasting
for 7 days, but the mRNA levels were not measured (Matsuda et al.,
T. Yang et al.
2007). Moreover, intracerebroventricular (ICV) injection of MCH1 has
been shown to suppress food intake in goldfish (Matsuda et al., 2006).
This suppression was supported by ICV administration of MCH anti­
serum prepared against MCH (Matsuda et al., 2007). Nevertheless, it is
considered likely that the expression of pmch2a and pmch2b was not
altered by fasting under the experimental conditions employed in the
present study. The robust similarities in the amino acid sequences of
MCH1 and MCH2 suggests that potential interactions with their re­
ceptors is shared. Indeed, both of these peptides aggregate melano­
somes, as stated above (Mizusawa et al., 2015). Additionally, antiserum
against MCH1 can cross-react with MCH2, as suggested by immuno­
staining of the hypothalamic area in teleosts (Baker and Bird, 2002;
Bertolesi and McFarlane, 2020; Diniz and Bittencourt, 2019). Suppres­
sion of food intake by ICV injection of the antiserum may also have
neutralized the function of MCH2. Taken together, the absence of any
difference in pmch2a and pmch2b expression in fish reared in tanks with
different background colors may imply that MCH2 plays a role in the
control of food intake.
5. Conclusion
Our results suggest that sla and pomc, as well as slb and pmch1, are
responsible for body color darkening and lightening, respectively, in
response to background color. Interestingly, the expression of sla and slb
genes was affected by feeding status. Considering that feeding condi­
tions did not affect body coloration under the experimental conditions
employed in the present study, the role of SL in body color regulation
appears to be more limited than that of MCH and α-MSH. Additionally,
background color had little or no effect on the expression of gh and prl in
goldfish, suggesting that GH and PRL might not play a major role in body
color change, at least in response to background color. Goldfish are
widely used as model fish for physiological studies related to hormone,
feeding, behavior and stress (Blanco et al., 2018). They are also useful as
models for understanding the mechanisms of body color regulation due
to their whole-body red coloration. Further studies of the neuro­
modulators in goldfish will elucidate the physiological basis of the
diverse functions of these molecules in fish and provide valuable context
to the evolution of neuroendocrinological systems in vertebrates.
CRediT authorship contribution statement
Tingshu Yang: Visualization, Investigation. Satoshi Kasagi: Re­
sources. Akiyoshi Takahashi: Supervision, Writing - original draft.
Kanta Mizusawa: Formal analysis, Writing - review & editing, Funding
acquisition.
Acknowledgements
The authors thank Ms. Honoka Furukawa, Kitasato University, for
her technical assistance. This study was partly supported by grants from
the Japan Society for the Promotion of Science (JSPS KAKENHI) to K. M.
(Grant No. 19K06224).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.ygcen.2021.113860.
References
Ayson, F.G., de Jesus-Ayson, E.G.T., Takemura, A., 2007. mRNA expression patterns for
GH, PRL, SL, IGF-I and IGF-II during altered feeding status in rabbitfish, Siganus
guttatus. Gen. Comp. Endocrinol. 150 (2), 196–204.
Baker, B.I., Bird, D.J., 2002. Neuronal organization of the melanin-concentrating
hormone system in primitive actinopterygians: evolutionary changes leading to
teleosts. J. Comp. Neurol. 442 (2), 99–114.
Downloaded for Anonymous User (n/a) at University of Nahdlatul Ulama Surabaya from ClinicalKey.com by Elsevier on
February 02, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
General and Comparative Endocrinology 312 (2021) 113860
Berman, J.R., Skariah, G., Maro, G.S., Mignot, E., Mourrain, P., 2009. Characterization of
two melanin-concentrating hormone genes in zebrafish reveals evolutionary and
physiological links with the mammalian MCH system. J. Comp. Neurol. 517 (5),
695–710.
Bertolesi, G.E., McFarlane, S., 2020. Melanin-concentrating hormone like and
somatolactin. A teleost-specific hypothalamic-hypophyseal axis system linking
physiological and morphological pigmentation. Pigment Cell Melanoma Res.
https://doi.org/10.1111/pcmr.12924.
Blanco, A.M., Sundarrajan, L., Bertucci, J.I., Unniappan, S., 2018. Why goldfish? Merits
and challenges in employing goldfish as a model organism in comparative
endocrinology research. Gen. Comp. Endocrinol. 257, 13–28.
Cal, L., Suarez-Bregua, P., Cerdá-Reverter, J.M., Braasch, I., Rotllant, J., 2017. Fish
pigmentation and the melanocortin system. Comp. Biochem. Physiol. 211, 26–33.
Cánepa, M.M., Pandolfi, M., Maggese, M.C., Vissio, P.G., 2006. Involvement of
Somatolactin in background adaptation of the cichlid fish Cichlasoma dimerus. J. Exp.
Zool. 305A (5), 410–419.
Cánepa, M.M., Zhu, Y., Fossati, M., Stiller, J.W., Vissio, P.G., 2012. Cloning, phylogenetic
analysis and expression of somatolactin and its receptor in Cichlasoma dimerus: Their
role in long-term background color acclimation. Gen. Comp. Endocrinol. 176 (1),
52–61.
Company, R., Astola, A., Pendón, C., Valdivia, M.M., Pérez-Sánchez, J., 2001.
Somatotropic regulation of fish growth and adiposity: growth hormone (GH) and
somatolactin (SL) relationship. Comp. Biochem. Physiol. 130 (4), 435–445.
Vega-Rubín De Celis, S., Gómez, P., Galduch-Giner, J., Médale, F., Pérez-Sánchez, J.,
2003. Expression and characterization of European sea bass (Dicentrarchus labrax)
somatolactin: Assessment of in vivo metabolic effects. Mar. Biotechnol. 5 92–101.
Diniz, G.B., Bittencourt, J.C., 2019. The melanin-concentrating hormone (MCH) system:
a tale of two peptides. Front. Neurosci. 13, 1280.
Fuentes, E.N., Valdés, J.A., Molina, A., Björnsson, B.T., 2013. Regulation of skeletal
muscle growth in fish by the growth hormone – insulin-like growth factor system.
Gen. Comp. Endocrinol. 192, 136–148.
Duan, C., Plisetskaya, E.M., 1993. Nutritional regulation of insulin-like growth factor-I
mRNA expression in salmon tissues. J. Endocrinol. 139, 243–252.
Farbridge, K.J., Leatherland, J.F., 1992a. Plasma growth hormone levels in fed and fasted
rainbow trout (Oncorhynchus mykiss) are decreased following handling stress. Fish
Physiol. Biochem. 10 (1), 67–73.
Farbridge, K.J., Leatherland, J.F., 1992b. Temporal changes in plasma thyroid hormone,
growth hormone and free fatty acid concentrations, and hepatic 5′ -monodeiodinase
activity, lipid and protein content during chronic fasting and re-feeding in rainbow
trout (Oncorhynchus mykiss). Fish Physiol. Biochem. 10 (3), 245–257.
Fox, B.K., Riley, L.G., Hirano, T., Grau, E.G., 2006. Effects of fasting on growth hormone,
growth hormone receptor, and insulin-like growth factor-I axis in seawater-
acclimated tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol. 148 (3),
340–347.
Fujii, R., 2000. The regulation of motile activity in fish chromatophores. Pigment Cell
Res. 13 (5), 300–319.
Fukada, H., Ozaki, Y., Pierce, A.L., Adachi, S., Yamauchi, K., Hara, A., Swanson, P.,
Dickhoff, W.W., 2005. Identification of the salmon somatolactin receptor, a new
member of the cytokine receptor family. Endocrinology 146, 2354–2361.
Hasegawa, S., Hirano, T., Kawauchi, H., 1986. Sodium-retaining activity of chum salmon
prolactin in some euryhaline teleosts. Gen. Comp. Endocrinol. 63 (2), 309–317.
Holloway, A.C., Reddy, P.K., Sheridan, M.A., Leatherland, J.F., 1994. Diurnal rhythms of
plasma growth hormone, somatostatin, thyroid hormones, cortisol and glucose
concentrations in rainbow trout, Oncorhynchus mykiss, during progressive food
deprivation. Biol. Rhythm Res. 25 (4), 415–432.
Kakisawa, S., Kaneko, T., Hasegawa, S., Hirano, T., 1995. Effects of fasting, background
adaptation, acute stress, and exhaustive exercise on plasma somatolactin
concentration in rainbow trout. Gen. Comp. Endocrinol. 98, 137–146.
Kaneko, T., 1996. Cell biology of somatolactin. Int. Rev. Cytol. 169, 1–24.
Kaneko, T., Kakizawa, S., Yada, T., 1993. Pituitary of ‘‘cobalt’’ variant of the rainbow
trout separated from the hypothalamus lacks most pars intermedial and
neurohypophysial tissue. Gen. Comp. Endocrinol. 92 (1), 31–40.
Kasagi, S., Miura, M., Okazaki, T., Mizusawa, K., Takahashi, A., 2020a. Effects of tank
color brightness on the body color, somatic growth, and endocrine systems of
rainbow trout Oncorhynchus mykiss. Gen. Comp. Endocrinol. 298, 113–581.
Kasagi, S., Mizusawa, K., Takahashi, A., 2020b. The effects of chromatic lights on body
color and gene expressions of melanin-concentrating hormone and
proopiomelanocortin in goldfish (Carassius auratus). Gen. Comp. Endocrinol. 285,
113–266.
Madelaine, R., Ngo, K.J., Skariah, G., Mourrain, P., Jackson, I.J., 2020. Genetic
deciphering of the antagonistic activities of the melanin-concentrating hormone and
melanocortin pathways in skin pigmentation. PLoS Genet. 16 (12), e1009244.
Mancera, J.M. and McCormick, S.D., 2019. Role of prolactin, growth hormone, insulin-
like growth factor I and cortisol in teleost osmoregulation. In Fish osmoregulation
(pp. 497-515). CRC Press.
Matsuda, K., Shimakura, S.-I., Maruyama, K., Miura, T., Uchiyama, M., Kawauchi, H.,
Shioda, S., Takahashi, A., 2006. Central administration of melanin-concentrating
hormone (MCH) suppresses food intake, but not locomotor activity, in the goldfish,
Carassius auratus. Neurosci. Lett. 399 (3), 259–263.
Matsuda, K., Shimakura, S.-I., Miura, T., Maruyama, K., Uchiyama, M., Kawauchi, H.,
Shioda, S., Takahashi, A., 2007. Feeding-induced changes of melanin-concentrating
hormone (MCH)-like immunoreactivity in goldfish brain. Cell Tissue Res. 328 (2),
375–382.
Mizusawa, K., Kasagi, S., Takahashi, A., 2018a. Melanin-concentrating hormone is a
major substance mediating light wavelength-dependent skin color change in larval
zebrafish. Gen. Comp. Endocrinol. 269, 141–148.
T. Yang et al.
Mizusawa, K., Kawashima, Y., Sunuma, T., Hamamoto, A., Kobayashi, Y., Kodera, Y.,
Saito, Y., Takahashi, A., 2015. Involvement of melanin-concentrating hormone 2 in
background color adaptation of barfin flounder Verasper moseri. Gen. Comp.
Endocrinol. 214, 140–148.
Mizusawa, K., Kobayashi, Y., Yamanome, T., Saito, Y., Takahashi, A., 2013. Interrelation
between melanocyte-stimulating hormone and melanin-concentrating hormone in
physiological body color change: roles emerging from barfin flounder Verasper
moseri. Gen. Comp. Endocrinol. 181, 229–234.
Mizusawa, K., Yamamura, Y., Kasagi, S., Cerdá-Reverter, J.M., Takahashi, A., 2018b.
Expression of genes for melanotropic peptides and their receptors for morphological
color change in goldfish Carassius auratus. Gen. Comp. Endocrinol. 264, 138–150.
Nguyen, N., Sugimoto, M., Zhu, Y., 2006. Production and purification recombinant
somatolactin β and its effects on melanosome aggregation in zebrafish. Gen. Comp.
Endocrinol. 145, 182–187.
Noble, E.E., Hahn, J.D., Konanur, V.R., Hsu, T.M., Page, S.J., Cortella, A.M., Liu, C.M.,
Song, M.Y., Suarez, A.N., Szujewski, C.C., Rider, D., Clarke, J.E., Darvas, M.,
Appleyard, S.M., Kanoski, S.E., 2018. Control of feeding behavior by cerebral
ventricular volume transmission of melanin-concentrating hormone. Cell
Metabolism 28 (1), 55–68.e7.
Norbeck, L.A., Kittilson, J.D., Sheridan, M.A., 2007. Resolving the growth-promoting and
metabolic effects of growth hormone: differential regulation of GH–IGF-I system
components. Gen. Comp. Endocrinol. 151 (3), 332–341.
O’Connor, P.K., Reich, B., Sheridan, M.A., 1993. Growth hormone stimulates hepatic
lipid mobilization in rainbow trout, Oncorhynchus mykiss. J. Comp. Physiol. B 163,
427–431.
Pierce, A.L., Shimizu, M., Beckman, B.R., Baker, D.M., Dickhoff, W.W., 2005. Time
course of the GH/IGF axis response to fasting and increased ration in chinook salmon
(Oncorhynchus tshawytscha). Gen. Comp. Endocrinol. 140 (3), 192–202.
Pottinger, T.G., Rand-Weaver, M., Sumpter, J.P., 2003. Overwinter fasting and re-feeding
in rainbow trout: plasma growth hormone and cortisol levels in relation to energy
mobilisation. Comp. Biochem. Physiol. B 136 (3), 403–417.
Sangiao-Alvarellos, S., Arjona, F.J., Míguez, J.M., Martín del Río, M.P., Soengas, J.L.,
Mancera, J.M., 2006. Growth hormone and prolactin actions on osmoregulation and
energy metabolism of gilthead sea bream (Sparus auratus). Comp. Biochem. Physiol.
144 (4), 491–500.
Sasano, Y., Yoshimura, A., Fukamachi, S., 2012. Reassessment of the function of
somatolactin alpha in lipid metabolism using medaka mutant and transgenic strains.
BMC Genetics 13 (1), 64.
Sheridan, M.A., 1986. Effects of thyroxin, cortisol, growth hormone, and prolactin on
lipid metabolism of coho salmon, Oncorhynchus kisutch, during smoltification. Gen.
Comp. Endocrinol. 64 (2), 220–238.
Downloaded for Anonymous User (n/a) at University of Nahdlatul Ulama Surabaya from ClinicalKey.com by Elsevier on
February 02, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
General and Comparative Endocrinology 312 (2021) 113860
Shimakura, S.-I., Miura, T., Maruyama, K., Nakamachi, T., Uchiyama, M., Kageyama, H.,
Shioda, S., Takahashi, A., Matsuda, K., 2008. α-Melanocyte-stimulating hormone
mediates melanin-concentrating hormone-induced anorexigenic action in goldfish.
Horm. Behav. 53 (2), 323–328.
Shimizu, M., Cooper, K.A., Dickhoff, W.W., Beckman, B.R., 2009. Postprandial changes
in plasma growth hormone, insulin, insulin-like growth factor (IGF)-I, and IGF-
binding proteins in coho salmon fasted for varying periods. Am. J. Physiol. Regul.
Integr. Comp. Physiol. 297 (2), R352–R361.
Small, B.C., Soares, J.H., Woods, L.C., Dahl, G.E., 2002. Effect of fasting on pituitary
growth hormone expression and circulating growth hormone levels in striped bass.
N. Am. J. Aquac. 64 (4), 278–283.
Small, B.C., Peterson, B.C., 2005. Establishment of a time-resolved fluoroimmunoassay
for measuring plasma insulin-like growth factor I (IGF-I) in fish: effect of fasting on
plasma concentrations and tissue mRNA expression of IGF-I and growth hormone
(GH) in channel catfish (Ictalurus punctatus). Domest. Anim. Endocrinol. 28 (2),
202–215.
Sugimoto, M., 2002. Morphological color changes in fish: regulation of pigment cell
density and morphology. Microsc. Res. Tech. 58 (6), 496–503.
Sumpter, J.P., Le Bail, P.Y., Pickering, A.D., Pottinger, T.G., Carragher, J.F., 1991. The
effect of starvation on growth and plasma growth hormone concentrations of
rainbow trout, Oncorhynchus mykiss. Gen. Comp. Endocrinol. 83 (1), 94–102.
Takahashi, A., Ogasawara, T., Kawauchi, H., Hirano, T., 1991. Effects of stress and
fasting on plasma growth hormone levels in the immature rainbow trout. Nippon
Suisan Gakkaishi 57 (2), 231–235.
Takahashi, A., Mizusawa, K., Amano, M., 2014. Multifunctional roles of melanocyte-
stimulating hormone and melanin-concentrating hormone in fish: evolution from
classical body color change. Aqua-BioSci. Mono. 7 (1), 1–46.
Tchen, T.T., Lo, S.J., Lynch, T.J., Palazzo, R.E., Peng, G., Walker, G.R., Wu, B.-Y., Yu, F.-
X., Taylor, J.D., 1988. Regulation of the distribution of carotenoid droplets in
goldfish xanthophores and possible implication to secretory processes. Cell Motil.
Cytoskeleton 10 (1-2), 143–152.
Yada, T., Moriyama, S., Suzuki, Y., Azuma, T., Takahashi, A., Hirose, S., Naito, N., 2002.
Relationships between obesity and metabolic hormones in the “cobalt” variant of
rainbow trout. Gen. Comp. Endocrinol. 128 (1), 36–43.
Zhu, Y., Thomas, P., 1995. Red drum somatolactin: Development of a homologous
radioimmunoassay and plasma levels after exposure to stressors or various
backgrounds. Gen. Comp Endocrinol. 99 (3), 275–288.
Zhu, Y., Thomas, P., 1996. Elevation of somatolactin in plasma and pituitaries and
increased alpha-MSH cell activity in red drum exposed to black background and
decreased illumination. Gen. Comp. Endocrinol. 101, 21–31.