I5road palnm wilh sngle palm visible

crease is
| 168 Given below arc two
statements
1n
persn sultermg trom- Stätement I: Vas delerens receives a duct
Turner's syndrome V from seminal vesfcle and opens into urethra
(2) Klinetfclier's syndrome
(3) Thalassemia as the ejaculatory duct.

(4) Down's syndrome Il: The cavity of the cervix is

Statement
called cervical canal which along with vagina
165 Which of the
following statements is coTect? forms birth canal.
()Biomagniticationrefers to increase in In the light of the above statements, choose
concentration of the toxicant at the correct answer from the options given
successive trophic levels.
(2) below:
Presence of large amount of nutrients
M water
restricts 'Algal (1) Both Statement I and Statement II
) Bloom
Algal Bloom decreases fish mortality are false.
(4) Eutrophication refers to increase in I is correct but
(2) Statement
domestic sewage and waste water in Statement I is false.
lakes.
Il
(3) Statement I incorect but Statement
166 Match List I with List IL. is
List I List LI Statement I and Statement II
4Both
A. Taenia I. Nephridia are true.
B. Paramoecium I. Contractile vacuole
C. Periplaneta II. Flamè cells
D. Pheretima IV. Urecóse gland 169)Radial symmetry is NOT found in adults of
Choose the correct answer from the options phylum
give below Hemichordata (2) Coelenterata
(11, B-I1, C-IV, D-III (3) Echinodemata (4) Ctenophora
) A-UI, B-I, C-IV, D-I
(3) A-II, B-1, C-IV, D-II
(4) A-I, B-lI, C-II, D-IV 0D 170 Match List I with List I1.
ListI List II
167 Given below are two statements:
Statement I: Electrostatic precipitator is (Cells) (Secretion)
most widely used in thermal power plant. A. Peptic cells I Mucus
Statement l : Electrostatic precipitator in B. Goblet cells II. Bile juice
thermal power plant removes ionising
radiations
C. Oxyntic cells II. Proenzyme pepsinogen
In the light of the above statements, D. Hepatic cells IV. HCI and intrinsic factor
the most appropriate answer from the
choose
for absorption of
options given below: vitamin B12
(1) Both Statement I and Statement II
are incorrect. Choose the correct answer from the options
(2) Statement I is correct but given below
Statement II is incorect.
(3) Statement I incorrect but Statement II ()A; B-l, C-II, D-IV
is correct.
2 A-II, B-I, C-IV, D-IIL
(4) Both StatementI and Statement II (3) A-1, B-IV, C-I, D-1li
are correct.
(4) A-IV, B-1I, C-lI, D-I

FI_English 25 I Contd.
 :
171 Match List I with List
I with List Il with Match List
human eye.
respect to| 174 List
List I Oral method
List 1 List I1 .
A. Vasectomy
. Barrier method
A. Fovea I. Visible coloured portion B. Coitus
of eye that
regulates interruptus
II. Surgical method
diameter of pupil. Cervical caps
C.
B. Iris I. I . . Natural method
External layer ofeye
D. Saheli
formed of dense answer
i r o m the options
correct
Choose the
connective tissue.
givenbelow:
C. Blind spot Il. Point C-I1, D-I
of greatest visual ) A-lI, B-IV,
acuity or resolution. C-1, D-IV
(2) A-II, B-III,
D. Sclera IV. Point where optic nerve D-II
(3) A-IV, B-II, C-L,
leaves the eyeball and C-IV, D-1I
4) A-II1, B-I,
photoreceptor cells
are absent. II.
175 Match List I with List
Choose the correct answer from the options
List I List II
givgn below:
(Type of Joint) (Found between)
A-IV, B-II, C-I, D- A. Cartilaginous I. Between flat
(2) A-L B-IV, C-II1, D-II
Joint skull bones
(3) A-II, B-1, C-II, D-v
(4) A-II, B-I, C-IV, D-I B. Ball and II. Between adjacent
Socket Joint vertebrae in

172 Which of the following functions is carried vertebral column

out by cytoskeleton in a cell? C. Fibrous Joint II. Between carpal
(1) Protein synthesis and metacarpal of
(2) Motility thumb
(3) Transportation D. Saddle Joint V. Between
(4) Nuclear division
Humerus and
Pectoral girdle
173 Once the undigested and
unabsorbed
their backflow
Choose the correct answer from the options
substances enter the caecum, givep, below:
is prefented by-
WY lleo caecal valve
A-I, B-IV, C-I, D-III
(2) Gastro - oesophageal sphincter
(2) A-1, B-IV, C-II, D-II

(3) Pyloric sphincter )A-I, B-IV, C-II, D-I

(4) Sphincter of Oddi (4) A-II, B-I, C-II, D-IV

F1 English | 26
I Contd..
 176 Given below are wo group/sct of
Australian

Statement
statements
I: RNA mutates at a laster
Select the corrcet
radiation.
rale. Marsupials cxhibiting adaptive
Statement II: Viruses
having RNA genome Numbat, Spotted cuscus.

and shorter life

span mutate and evolve Flying phalanger
Taster.
In the light of the above statements, (2) Mole, Flying squirrel,
choose Tasmanian tiger cat
the correet answer
from the options given Wolf
below: (3) Lemu, Anteater,

()Both Statement I Tasmanian wolí, Bobcat,

are false.
and Statement II (4)
Marsupial mole

(2) Statement I is true but Statement l

is false. is not a cloning
180 Which of the following
(3) Statement I false but Statement II
vector?
is true.
(2) pBR322
(4) Both Statement I and Statement
(1) YAC
I Probe
(4) BAC
are true.

177 Given below are two statements: 181 Match List I with List II.
Statement I: In prokaryotes, the positively List I List II
charged DNA is held with some negatively I. Efect on
A. Heroin
charged proteins in a region called nucleoid. cardiovascular system
Statement II: In eukaryotes, thenegatively lI. Slow down body function
charged DNA is wrapped around the | B. Marijuana
positively charged histone octamer to form C. Cocaine llI, Painkiller
nucleosome.
D. Morphine IV. Interfere with transport of
In the light of the above statements, choose
the correct answer from the options given
dopamine
Choose the correet answer from the options
below:
(1) Both Statement I and Statement II given below
are false. (1) A-1, B-I, C-lI, D-IV
Statement I is correct but
(2) (2) A-IV, B-Il1, C-I, D
Statement II is false.
(3) Statement I incorrect but Statement Il (3)A-III, B-IV, C-I, D-I
true. A-lIL, B-I, C-IV, D-II
(4) Both Statement I and Statement II
are true. 182 Which one of the following techniques does
not serve the purpose of early diagnosis of
178 Which one of the following symbols a disease for its early treatment?
represents mating between relatives in
(1) Serum and Urine analysis
human pedigree analysis?
2) Polymerase Chain Reaction (PCR)
O technique
Enzyme Linked Immuno-Sorbent Assay
(ELISA) technique
(3)
4) Recombinant DNA Technology

F1_English 27 I Contd..
 No.
186 to 200)
Section-B (Q.
Zoology: is characteries
following

183 of the sev

Sexual
Given below are two statements: 1 8 6 Which
c o c k r a c h
regarding

labelled as Assertion A and the other is eature ol

labelled as Reason R. dimopiism styles
of anal

Assertion A: Endometrium is necessary for

I
Presence

erites
implantation of blastocyst. (2)
Presence of
cerci
a s o n R: In the absence of fertilization, of anal
Prescence
the corpus luteum degenerates that causes (3) colour and anal
cerci
brown body
disintegration of endometrium. (4) Dark
n the light of the above statements, choose
statements.
correet answer from correct
the the options given 187 Select the
c is Seen durinp
below: Tetrad
formation
A.
(1) Both A and R are true but R is NOT Leptotene.
the correct explanation of A. the centromeres
split
(2) Ais true but R is false. B. During Anaphase,
and chromatids separate.
(3)A is false but R is true.
Both A and R are true and R is the C. Terminalization
takes place during
correct explanation of A. Pachytene.
D. Nucleolus, Golgi complex ER are and

184MatchListList
I
I with List I1. reformed during Telophase.
List I1 E. Crossingover takes place between sister
A. Gene 'a' I. B-galactosidase
chromatids of homologous
B. Gene "y IL. Transacetylase
chromosome.
C. Gene i' IIL. Permease
D. Gene *z IV. Repressor protein Che 2 the correct answer from the options
Choose the correct answer from the g below:
oplions
given below: (1) B andD only
(1) A-I, B-III, C-IV, D-I (2) A, C and E only
(2) A-1, B-IV, C-L, D-II (3) B and E only
3) A-II, B-I, C-IV, D-II
(4) A-, B-1, C-IV, D-III
(4) A and C only

185 Given below are statements: one is labelled68 Which o t the following statements are
A and the other is labelled correct?
as Assertion
Reason R.
as
A. An excessive loss of
Assertion A:
body fluid from
Nephrons are of two types: the
body switches off osmoreceptors.
Cortical & Juxta medullary, based on their B. ADH
relative position in cortex and
facilitates water reabsorption to
medulla.
Reason R: Juxta medullary nephrons have
prevent diuresis.
C. ANF causes
short loop of Henle whereas, cortical vasodilation.
D. ADH causes
nephrons have longer loop of Henle. increase in blood pressure.
in the light of the above statements, choose E. ADH is
the correct answer from the
options given GFR.
responsible for decrease in

below: Choose the correct

(1) Both A and R are true but R is NOT answer from the
the correct explanation of A.
given below: options
(1) B, C and D
2)A is true but R is false. only
(3)ATS false but R is true. (2) A, B and E
only
S Both A and R are true and R is the (3) C, D and E
corect explanation of A. (4) A and B
only
only
F1_English 8
I Contd..
 NOT under the
Which of the ollowing
are
189 Given below are lwo 192
statenenis: cell thyroid hormonc?
tatementl: Durng Go phase ot eycle, control
of
the cell is metabolically inactive. water and clectroiyte
A. Maintenance
ol
Statement Il: The cetrosome undergoes balance
duplication during S phase of interphasc. rale
B. Regulation of basal metabolic
In the light of the above statements, choose
answer Irom the C. Normal rhythm of sleep-wake cycle
ne mos appropriate
oplions given below: D. Development of immune system
() Both Statement I and Statement Il
E. Support the process of R.B.Cs formation
a r e incorTecl.

Statement I is correct but from the options

2 Choose the correct answer

Statement II is incorrect. given below:

(3) Statement I is incorrect but
Statement I is (1) BD and C only (2) C and D only
correcl. and E only (4) A and D only
(4) Both Statement I and Statement Il
are corTect.

9Which one of the following is NOT an 193 The unique mammalian characteristies are
advantage of inbreeding? (1) hairs, pinna and mammary glands
(1) It exposes harmful recessive genes that
(2) hairs, pinna and indirect development
are
eliminated by selection. skull and
(2) Elimination ofless desirable genes and (3) pinna, monocondylic
accumulation of superior genes takes mammary glands
place due to it. membrane and
G) It decreases the productivity of inbred (4) hairs, tympanic
population, after continuous inbreeding. mammary glands
(4) It decreases homozygosity
194 Which of the following statements are
191 Match List I with List II.
List I List I1 correct regarding skeletal muscle?
A. Logistic I. Unlimited resource Muscle bundles are held together by
growth availability condition collagenous connective tissue layer
B. Exponential II. Limited resource
growth availability condition B.
calledXascicle\
Sarcoplasmic reticulum of muscle fibre
C. 1.
Expanding
age pyramid
The percent individuals
or pre-reproductive 1S a store house of calcium ions.

age is
largest followed
Dy reproductive and Striated appearance of skeletal muscle
fibre is due to distribution pattern of
post reproductive actin and myosin proteins.
age groups
D. Stable age V, The percent individuals DM line is considered as functional unit
Pyramid of pre-reproductives of contraction called sarcomere.
and reproductive age
Choose the most appropriate answer from
group are same the options given below:
Choose the correct answer from the options
given below: 0) B and C only
(1) A-I, B-lII, C-I, D-IV
(2) A, Cand D only
(2) A-II, B-IV, C-I, D-III
W) C and D only
)A-I, B-V, C-1I, D-I
A - I I , B-I, C-II1, D-IV 4) A, B and C
only
FIEnglish 29
I Contd..
 195 Which of the following statements arc 198 Match List I with List i.
correct ? List I List II
A. Basophils A. Mast cells I. Ciliated epithelium
are most abundant celis or
the total WBCs B. Inner surface . Areolar

B. of bronchiole connective tissue

Basophils secrete histamine, serotonin
and heparin C. Blood II. Cuboidal epithelium
C. D. Tubular parts V. specialised
Basophils are involved in inflammatory
response of nephron connective tissue
D. Choose the correct answer from the options
Basophils have kidney shaped nucleus give below:
E. Basophils are
agranulocytes (1) A-1, B-1, C-I, D-IV
Choose the correct answer from the options (2) A-I1, B-1, C-IV, D-IlI
given below (3) A-III, B-IV, C-II, D-I
(1) C and E only (2) B and C (4) A-I, B-I, C-IV, D-II
only
(3) A and B only (4) D and E
only
199 In cockroach, excretion is brought about by
196 Which one of the
following is the sequence
A. Phallic gland B, Urecose gland
. Nephrocytes . Fat body
on
corresponding coding strand, if the E. Collaterial glands
sequence on mRNA fomed is as follows
Choose the correct answer from the
5" AUCGAUCGAUCGAUCGAUCG options
given below:
AUCG AUCG 3'?
(1) 3' UAGCUAGCUAGCUAGCUUA (1)AB and E only
B , C and D only
GCUAGCUAGC 5° (3) B andD only
(2) 5' ATCGATCGATCGATCGATCG 4) A and E only
ATCGATCG 3"
(3) 3' ATCGATCGATCGATCGATCG 200 Select the coITect statements with reference
ATCGATCG 5 to chordates.
A. Presence of
(4) 5' UAGCUAGCUAGCUAGCUA a mid-dorsal, solid and
GCUAGC UAGC 3'
double nerve cord.
B. Presence of closed circulatory
system.
C. Presence of
paired pharyngeal gillslits.
197 The parts of human brain that helps in D. Presence of dorsal
heart
regulation of sexual behaviour, expression E.
of exçitement, pleasure, rage, fear etc. are
Triploblastic pseudocoelomate animals.
Choose the correct answer from the options
Corpora quadrigemina & hippocampus given below:
(2) Brain stem & epithalamus (1) B andC only
(2) B, D and E only
(3) Corpus callosum and thalamus
(3) C, D and E only
(4) Limbic system & hypothalamus
(4) A, C and D only
F1_English] 30
[ Contd...