Analyse: Separate information into components

Argue: Present a reasoned case

and identify their characteristics

Assess: Make an informed judgement Compare: Identify similarities and/ or differences

Consider: Review and respond to given

Contrast: Identify differences
information

Criticise: Access worth against explicit Debate: Present different perspectives on an

expectations issue

Define: Specify meaning Describe: Give an account of

Discuss: Present key points Evaluate: Judge from available evidence

Explain: Give reasons Identify: Name or otherwise characterise

Justify: Support a case with evidence State: Express in clear terms

Suggest: Present a possible case

Accuracy: A measurement result is considered accurate if it is judged to be close to the true value.

Calibration: Marking a scale on a measuring instrument.

This involves establishing the relationship between indications of a measuring instrument and
standard or reference quantity values, which must be applied. For example, placing a thermometer
in melting ice to see whether it reads 0⁰C, in order to check if it has been calibrated correctly.

Errors: See also uncertainties.

Measurement error: The difference between a measured value and the true value.

Anomalies: These are values in a set of results which are judged not to be part of the variation
caused by random uncertainty.

Random error: These cause readings to be spread about the true value, due to results varying in an
unpredictable way from one measurement to the next. Random errors are present when any
measurement is made, and cannot be corrected. The effect of random errors can be reduced by
making more measurements and calculating a new mean.

Systematic error: These cause readings to differ from the true value by a consistent amount each
time a measurement is made. Sources of systematic error can include the environment, methods of
observation or instruments used. Systematic errors cannot be dealt with by simple repeats. If a
systematic error is suspected, the data collection should be repeated using a different technique or a
different set of equipment, and the results compared.

zero error: Any indication that a measuring system gives a false reading when the true value of a
measured quantity is zero, eg the needle on an ammeter failing to return to zero when no current
flows. A zero error may result in a systematic uncertainty.
Evidence: Data which has been shown to be valid.

Fair test: A fair test is one in which only the independent variable has been allowed to affect the
dependent variable.

Hypothesis: A proposal intended to explain certain facts or observations.

Interval: The quantity between readings, eg a set of 11 readings equally spaced over a distance of 1
metre would give an interval of 10 centimetres.

Precision: Precise measurements are ones in which there is very little spread about the mean value.
Precision depends only on the extent of random errors – it gives no indication of how close results
are to the true value.

Prediction: A prediction is a statement suggesting what will happen in the future, based on
observation, experience or a hypothesis.

Range: The maximum and minimum values of the independent or dependent variables; important in
ensuring that any pattern is detected.
For example a range of distances may be quoted as either: 'From 10cm to 50 cm' or 'From 50 cm to
10 cm'

Repeatable: A measurement is repeatable if the original experimenter repeats the investigation

using same method and equipment and obtains the same results.

Reproducible: A measurement is reproducible if the investigation is repeated by another person, or

by using different equipment or techniques, and the same results are obtained.

Resolution: This is the smallest change in the quantity being measured (input) of a measuring
instrument that gives a perceptible change in the reading.

Sketch graph: A line graph, not necessarily on a grid, that shows the general shape of the
relationship between two variables. It will not have any points plotted and although the axes should
be labelled they may not be scaled.

True value: This is the value that would be obtained in an ideal measurement.

Uncertainty: The interval within which the true value can be expected to lie, with a given level of
confidence or probability, eg “the temperature is 20 °C ± 2 °C, at a level of confidence of 95 %.

Validity: Suitability of the investigative procedure to answer the question being asked. For example,
an investigation to find out if the rate of a chemical reaction depended upon the concentration of
one of the reactants would not be a valid procedure if the temperature of the reactants was not
controlled.

Valid conclusion: A conclusion supported by valid data, obtained from an appropriate experimental
design and based on sound reasoning.

Variables: These are physical, chemical or biological quantities or characteristics.

Categoric variables: Categoric variables have values that are labels. Eg names of plants or types of
material.
continuous variables: Continuous variables can have values (called a quantity) that can be given a
magnitude either by counting (as in the case of the number of shrimp) or by measurement (eg light
intensity, flow rate etc).

control variables: A control variable is one which may, in addition to the independent variable, affect
the outcome of the investigation and therefore has to be kept constant or at least monitored.

dependent variables: The dependent variable is the variable of which the value is measured for each
and every change in the independent variable.

independent variables: The independent variable is the variable for which values are changed or
selected by the investigator.
New A level Biology

Topic: Surface area to volume ratio

Specification
 The relationship between the size of an organism or structure and its surface area to volume
ratio.
 Changes to body shape and the development of systems in larger organisms as adaptations
that facilitate exchange as this ratio reduces.
 Students should be able to appreciate the relationship between surface area to volume
ratio and metabolic rate.

Previous knowledge
 Define diffusion
 Suggest some factors that affect rate of diffusion

EMPA investigation: looking at SA:VOL using agar cubes (with cresol red) and HCL

Biofactsheet: 165

Organisms must exchange materials (food, gases, heat) between themselves and their surroundings.

Calculating surface area to volume ratio (SA:Vol)

Cube side Surface area (SA) Volume (Vol) cm3 SA:VOL (SA÷Vol)
length cm2

2
3
4
6
10
20
30
 Q. What is the relationship between SA:VOL and what does this mean for the organisms?

As organisms get bigger the surface area to volume ratio decrease. Volume increases at a greater rate than surface
area. In other words the volume of cells demanding materials increases but the surface area to provide them
decreases.

Single cell organisms and other small organisms often have a large surface area compared to their volume and thus
can exchange materials by diffusion across their body surface as the diffusion pathway is short

Larger organisms have a small SA:VOL ratio and must

1) Develop gas exchange surfaces (Gills, lungs)

2) As diffusion is slow and most cells are far away from the gas exchange surface they also need to develop
transport system (circulatory system)

Some larger organisms may adopt unique body shapes, like flat worm

Q. Features of an exchange surface that help increase the efficiency of exchange

Large SA compared to the

volume Q. Features of a transport system

Thin: create a short diffusion

pathway A suitable medium to carry
materials (normally a
Maintain a diffusion
medium based on water as Q2.How does SA:VOL affect
gradient by moving an
substances readily dissolve heat loss in animals (particular
internal medium (like blood) emphasis on mammals and
in it)
birds that are warm blooded)?
A closed system of vessels
Use model experiment to that branch to transport and answer this question. The small
beaker represents a small contain the medium animal and the large beaker
represents a large animal
A mechanism to move the
0
Time (minutes) medium.Temperature C
Requires pressure Use the information to calculate
Large beaker Small beaker
differences. Can be achieved the SA:Vol ratio for the two
0
beakers whilst gathering your data
1
2
3 50ml beaker
4 Holds 70ml water
5 Has a surface area of: 100.00cm2
6
7 250ml beaker
8 Holds 300ml of water
9
Has a surface area of 270.00cm2
10
SA:VOL for beakers

Conclusion:
Q. Use the results to suggest why a large mammal such as an elephant might experience difficulties in
regulating body temperature (2) (Extension: what is their solution to this problem)
A. Elephants have a small surface area to volume ratio and generate heat in metabolic processes, less heat is
lost in a warm climate as the difference between the surrounding temperature and internal temperature is
small.

A zoologist investigated the

relationship between
body mass and rate of
oxygen uptake in four
species of mammal. The
results are shown in the
graph.

Q. Describe the relationship between body mass and oxygen uptake. (1)
A. Decrease in uptake with an increase in mass

Q. Heat from respiration helps mammals to maintain a constant body temperature. Use this information
to explain the relationship between body mass and oxygen uptake shown in the graph. (3)
A. Smaller animals have a large surface area to volume ratio
Lose more heat/gram of tissue
Respire faster to maintain body temperature
Oxygen demand increases
Depending on the circumstances, it may be advantageous to have a small S/V while at other times a large S/V is
an advantage. Thus, optimizing S/V ratios has been a driving force in the evolution of all organisms. Since S/V
is a function of both size and shape, these have also been under strong evolutionary pressure.

Flatworms are small animals that live in water. They have no

specialised gas exchange or circulatory systems.

(Thin & flat body) so short diffusion pathway; large surface area
to volume ratio; so gases can move across the body by diffusion

The table below will illustrate=rate the effect of a body shape like the tape worm on SA:VOL

Q. What do you notice about the data??

Q. Voles in northern Scotland are much bigger than those found in southern France; explain how the voles in the
North of Scotland became so big (5)
SA to volume ratio and leaves

Water evaporates from leaves through the stomata, a process called transpiration. In dry climates plants need to
conserve water and thus reduce transpiration. So xerophytic plants have leaves with a small surface area to
volume ratio, like the cactus has reduced its leaves to spines.

Considering the theoretical calculations we made above, we hypothesize that plants that live in a
xeric (dry) environment will have a smaller S/V than a plant that lives in a mesic (moderate)
environment. You will be provided with the leaves of two plants (Jade plant (Crassula argenta) and
honeysuckle (Lonicera tartarica) or other species.
Examine the leaves and then make some predictions about the conditions in which these species
evolved.

Method
1. Estimate the SA of each leaf by tracing the leaf on graph paper. Count the number of boxes
completely within the tracing (Table 5). Count as 0.5 any box that is intersected by the tracing.
Measure the size of one box (_____ cm x ______ = _____ cm2). Determine the surface area of one
side of a leaf. Multiply by 2 for both sides of the leaf. Note: we will ignore the surface area of the
edge of the leaves.
Surface area estimate: ____________________ cm2

Then try this method to estimate surface area

Cut a piece of graph paper that is 10cm × 10cm (100cm2) then weigh it.
a) 100cm2 = ___________g
b) 1cm2 = _____________g
Draw round the leaf and cut out the shape and weigh it. c) Mass of cut out = ___________g
Divide the mass of the leaf cut out (c), by the mass of 1cm2 of graph paper (b) and multiply by 2
Surface area estimate = ______________________ cm2

2. Calculate the volume by weighing each leaf to the nearest 0.01 g. This will give a rough
approximation to volume since the fresh weight of the leaves is largely water (density = 1 gm/cm3).

3. Calculate SA/VOL
 Adaptations of gas exchange surfaces
Specification
Adaptations of gas exchange surfaces, shown by gas exchange:
 across the body surface of a single-celled organism
 in the tracheal system of an insect (tracheae, tracheoles and spiracles)
 across the gills of fish (gill lamellae and filaments including the counter-current principle)
 by the leaves of dicotyledonous plants (mesophyll and stomata).

Structural and functional compromises between the opposing needs for efficient gas exchange and
the limitation of water loss shown by terrestrial insects and xerophytic plants.

The gross structure of the human gas exchange system limited to the alveoli, bronchioles, bronchi,
trachea and lungs.
The essential features of the alveolar epithelium as a surface over which gas exchange takes place.
Ventilation and the exchange of gases in the lungs. The mechanism of breathing to include the role
of the diaphragm and the antagonistic interaction between the external and internal intercostal
muscles in bringing about pressure changes in the thoracic cavity.

Students should be able to:

 interpret information relating to the effects of lung disease on gas exchange and/or ventilation
 interpret data relating to the effects of pollution and smoking on the incidence of lung disease
 analyse and interpret data associated with specific risk factors and the incidence of lung
disease
 evaluate the way in which experimental data led to statutory restrictions on the sources of
risk factors
 Recognise correlations and causal relationships.

Previous knowledge

Cross section of a leaf and adaptations (specifically aimed at spongy mesophyll, stomata, guard cells
and waxy cuticle)

Diffusion definition and factors affecting it

SA:VOL ratio relationship

Practical investigations

Biofact sheets: 26 & 81 & 160 & 193

We have said that as organisms get bigger their SA:VOL decreases. This can be a good thing as it
reduces heat loss, but when it comes to exchanging gases by simple diffusion across the body
surface, diffusion would be too slow provide cells with the oxygen needed. Consequently, organisms
develop specialised exchange surfaces and transport systems. Here we wish to focus on how these
exchange surfaces maximise the rate of diffusion. We will focus on
 Mammalian lungs
 Fish gills
 Insect tracheal system
 Leaves of plants
Fick’s law suggests that the rate of diffusion is related to…….
 How the Lungs/Alveoli are adapted for efficient gas exchange
1. Many alveoli: provide a large surface area;
2. walls of alveoli thin (1 cell): to provide a short diffusion pathway;
3. walls of capillary thin(1 cell) &close to alveoli provides: a short diffusion pathway;
4. walls of capillaries/alveoli have flattened cells (squamous): short diffusion pathway
5. Cell membrane permeable to gases: allows gases to pass through
6. Many blood capillaries: provide a large surface area; good circulation to maintain a steep concentration
gradient
7. Intercostal & diaphragm muscles: allow ventilation, to maintain a concentration gradient;
8. wide trachea & branching of bronchi &bronchioles: for efficient flow of air;
9. cartilage rings keep airways open;

The mechanism of breathing

Breathing in: …………..Inspiration

Breathing out: ……………….Expiration

Inspiration
Active process, requires energy as muscles contract
External intercostal contract: ribs move up and out
Diaphragm contracts and flattens
Volume in lungs increases
Pressure decreases below atmospheric pressure
Air forced in
Expiration
Passive process where the intercostal muscles and
diaphragm relax
Volume of the lungs decreases
Pressure increases
In forced expiration the internal intercostal muscles and
abdominal muscles are used, this is active
 Trachea:
Flexible airway support by C shaped rings of cartilage. These prevent the
trachea from collapsing when the air pressure inside falls. The C shape
leaves them some flexibility to compress the trachea when food moves
along the oesophagus
The walls are made up of muscle, and are lined with ciliated epithelium
and goblet cells, with roles in preventing entry of bacteria and dirt.

Bronchi
Divisions of the trachea also supported by cartilage

Bronchioles
Branching divisions of the bronchi. Walls are made of muscle and lined
with epithelial cells. The muscle enables them to control the air in and out

Alveoli (site of gas exchange)

Small air-sacs, with folded walls to increase the surface area. They are a
single cell thick and the cell is flattened (squamous ) to reduce the
diffusion distance in gas exchange. The walls contain elastic fibres and
collagen. Elasticity to stretch and recoil to help expel air and maintain a
steep concentration gradient.

The lungs are inside the thoracic cavity, surrounded by the rib-cage
and diaphragm. Lining the entire cavity and encasing the lungs are the
two pleural membranes. These secrete pleural fluid that:
a) Reduces friction from the movement of the lungs during breathing
and
b) Attaches the lungs to the inside of the ribs (by surface tension), so
allowing them to move with the ribs.
Pulmonary ventilation: this is the total volume of air moved into the lungs in a
minute

Tidal volume: the volume of air taken in with a normal breath

Ventilation rate: the number of breaths taken in one minute

Pulmonary Ventilation Rate = Tidal Volume × Ventilation

(dm3min-1) (dm3) (min-1)
For fish gas exchange is difficult because

1) Low oxygen content in water (and as water temperature increases, oxygen content will decrease,
solubility of gases in water decreases with temperature
2) Water has a high density and requires a lot of energy to move it across the exchange surfaces

How the gills are adapted for efficient gas exchange

1. Many filaments and secondary lamellae: provide a large surface area makes diffusion efficient;
3 Thin epithelium: short diffusion distance between water and blood;
3 counter-current flow (Water and blood flow in opposite directions):5 maintains concentration gradient along
the entire length of the gill. Equilibrium not reached as blood always encounters water with a higher oxygen
concentration
4 Circulation replaces blood saturated with oxygen;
5 Ventilation replaces water (as oxygen removed);

Explain how the counter-current principle helps fish to extract oxygen from water.
Water flows in opposite direction to blood across (gill) lamellae;
so difference in concentration maintained;
diffusion occurs across over full length of lamellae.

You can see that in the counter current flow

1. Blood and water flow in opposite directions

2. AnWater is dense,
equilibrium so areached
is not lot of energy
(bloodisalways
required to move it,
encounters waa
a slightly higher oxygen concentration)

3. So a concentration gradient is maintained across the entire

 How the tracheal system of insects are adapted
Spiracle = opening to the trachea
Oxygen diffuses in down a concentration gradient, low in the tissues where it is used in
respiration

Tracheoles heavily branched to increase surface area

Branch deep into tissue so no cell is far from source of oxygen, short diffusion pathway as
diffusion through the muscle is slow

Abdominal beating: muscular contractions in the abdomen help with ventilation maintaining a
concentration gradient

Ends of tracheoles are filled with fluid. In flight, lactic acid produced in the muscles, draws the
fluid out by osmosis, increases the surface area for exchange and speeding up diffusion as it is
through a gaseous medium.

Spiracles need to open for gas exchange

When the spiracles are open water can evaporate out
The spiracles are not always open this conserves water…….

Spiracles are controlled by valves

Valves open when CO2 concentrations get to a critical level, shown in the graph above.
When CO2 gets to 4.2 units, CO2 decreases and oxygen increases, meaning gas exchange can
take place.
 Leaves have a large surface area to volume ratio (they are broad and flat)
Large number of stomata provides a large surface area
Guard cells open stomata
CO2 enters through the stomata by diffusion (down a concentration gradient)
Diffuses through the air spaces, which allows faster diffusion
Leaves are thin to provide a short diffusion pathway
Air movements around the leaf help to maintain concentration gradients

Reducing water loss in plants

 Thick Waxy cuticle: increase diffusion distance
 Guard cells can close
 Reduced number of stomata: reduce SA
Reducing water loss in insects
 Leaves reduced to spine: Reduce surface area of
leaf Exoskeleton is waxy; so is water proof

 Sunken stomata and hairs: traps moist air, Spiracles are not open all the time, open when CO2 reaches
increases humidity, reduces diffusion gradient a critical level, and can open independently

 Reduced number of stomata; reduced surface Spiracles can be sunken, and/or surrounded by hair, traps a
area; layer of moisture, reducing air movements, and reducing
the concentration gradient.
 Curled leaves; traps moist air reduce
concentration; difference
 Close arrangement of stomata: interferes with
evaporation, overlap diffusion shells
 Increasing gas exchange

Effects of lung disease on gas

exchange
Fibrosis TB Asthma
Emphysema
1 (Bacteria transmitted in) droplets;
Scar tissue, thicker and 2 (Bacteria) engulfed by phagocytes; Inflammatory response caused by
Persistent inflammation in the alveoli attracts
less elastic 3 (Bacteria) encased in named tubercle allergy to pollen, dust
phagocytes
4 (Bacteria) are dormant;
Reduces expansion of 5 If immunosuppressed, tubercle Smooth muscle in bronchioles
They produce elastase which breaks down elastin in
lungs and tidal volume liquefies and bacteria activate contracts, mucus produced
alveoli walls, and reduces surface area
6 Bacteria destroy alveoli reducing
Increase in diffusion surface area Narrows air ways, reduces air flow
Elastic tissue allows alveoli to recoil after inhaling
distance and a decrease in 7 (Leads to) fibrosis (calcification) occurs;
and exhaling, failure to do tis effectively reduces increasing diffusion pathway, and So less oxygen absorbed, less
concentration gradient
concentration gradient reduces elasticity and ventilation so respiration, less energy
Blocking sensation means reduces concentration gradient
8 (Damage) leads to less diffusion Inhalers try to relax the muscle
person coughs a lot,
9 (Activation / damage allows bacteria) to
causes damage to lining,
enter blood / spreads (to other organs);
causes mucus production,
causes more coughing.
Fibrosis occurs
Summary sheet:
Questions

Describe and explain how the counter-current system leads to efficient gas exchange across the gills
of a fish. (3)
……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

Amoebic gill disease (AGD) is caused by a parasite that lives on the gills of some species of fish. The
disease causes the lamellae to become thicker and to fuse together. AGD reduces the efficiency of
gas exchange in fish. Give two reasons why. (2)

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

The volume of water passing over the gills increases if the temperature of the water increases.
Suggest why. (1)
……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

Explain how the structure of the gill makes oxygen uptake efficient. (2)

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

Describe how the gills of a fish are ventilated after water has entered through its mouth. (3)

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

……………………………………………………………………………………………………………..………………………………….

………………………………………………………………………………………………………………………………………….…….

There is a one-way flow of water over the gills of a fish whereas there is a two-way flow of air
in the lungs of a mammal. Suggest one advantage to a fish of this one-way flow of water over
its gills. (1)

...................................................................................................................................

...................................................................................................................................
 (a) When first hatched, the young of some species of fish are less than 2 mm long.
Explain how these young fish get enough oxygen to their cells without having
gills.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................
(2)

(b) Mackerel are fast swimming fish whereas toadfish only swim slowly. The table
shows some features of the gills of these fish.

Thickness of Number of lamellae

lamellae / µm per mm of gill length

Mackerel 5 32

Toadfish 35 8

Use evidence from the table to explain how mackerel are able to swim faster
than toadfish.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................
(3)
(Total 5 marks)

(a) Scientists who investigate disease may look at risk factors. What is a risk factor?

.......................................................................................................................

...................................................................................................................(1)

Scientists investigated the link between pollution from vehicle exhausts and the
number of cases of asthma. Between 1976 and 1996, the scientists recorded
changes in the following

• the concentration in the air of substances from vehicle exhausts

• the number of cases of asthma.

 The graph shows their results

(b) Between which years on the graph was there

(i) a positive correlation between the number of cases of asthma and the
concentration in the air of substances from vehicle exhausts

........................................................................................................ (1)

(ii) a negative correlation between the number of cases of asthma and the
concentration in the air of substances from vehicle exhausts?

......................................................................................................(1)

(c) The scientists concluded that substances in the air from vehicle exhausts did not
cause the increase in asthma between 1976 and 1980. Explain why.

.......................................................................................................................

.......................................................................................................................

.......................................................................................................................

.......................................................................................................................

.......................................................................................................................

.................................................................................................................. (3)
Emphysema reduces the efficiency of gas exchange in the lungs. Explain why.

...................................................................................................................................................

..................................................................................................................................................

...................................................................................................................................................

..................................................................................................................................................

...................................................................................................................................................

..................................................................................................................................................

...................................................................................................................................................(4)
 Miner’s lung is a disease caused by breathing in dust in coal mines. The dust causes the alveolar
epithelium to become thicker. People with miner’s lung have a lower concentration of oxygen in
their blood than healthy people. Explain why people with miner’s lung have a lower concentration
of oxygen in their blood.

.............................................................................................................

............................................................................................................. (1)

Read the following passage.

Several diseases are caused by inhaling asbestos fibres. Most of these

diseases result from the build-up of these tiny asbestos fibres in the lungs.

One of these diseases is asbestosis. The asbestos fibres are very small and
enter the bronchioles and alveoli. They cause the destruction of phagocytes
5 and the surrounding lung tissue becomes scarred and fibrous. The fibrous
tissue reduces the elasticity of the lungs and causes the alveolar walls
to thicken. One of the main symptoms of asbestosis is shortness of breath
caused by reduced gas exchange.

People with asbestosis are at a greater risk of developing lung cancer. The time
10 between exposure to asbestos and the occurrence of lung cancer is 20–30 years.

Use information in the passage and your own knowledge to answer the following
questions.

(a) Destruction of phagocytes (lines 4–5) causes the lungs to be more susceptible to
infections. Explain why.

......................................................................................................................

......................................................................................................................

................................................................................................................. (2)

(b) (i) The reduced elasticity of the lungs (lines 6–7) causes breathing difficulty.
Explain how.

.............................................................................................................

.............................................................................................................

.............................................................................................................

......................................................................................................... (2)
 (ii) Apart from reduced elasticity, explain how changes to the lung tissue reduce
the efficiency of gas exchange.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

........................................................................................................ (4)

(c) (i) Doctors did not make the link between exposure to asbestos and an
increased risk of developing lung cancer for many years. Use information in
the passage to explain why.

.............................................................................................................

......................................................................................................... (1)

(ii) Give one factor, other than asbestos, which increases the risk of developing
lung cancer.

.......................................................................................................... (1)

Pulmonary ventilation is the volume of air that can be breathed in and out in one minute. Pulmonary
ventilation is calculated from the equation
Pulmonary ventilation = breathing rate × tidal volume
Where breathing rate is the number of breaths per minute and tidal volume is the volume of air
breathed in and out in one breath. Table 1 shows the pulmonary ventilation and breathing rates of
an athlete at rest and after vigorous exercise.

 Calculate the tidal volume of the athlete at rest. (1 mark)

 Calculate the percentage increase in pulmonary ventilation after vigorous exercise. Show
your working. Answer (2 marks)
 Suggest why the percentage of nitrogen is lower in exhaled air than in inhaled air. (1 mark)
Answers
1. Water and blood flow in opposite directions;
2. Maintains concentration/diffusion gradient / equilibrium not reached / water always next to blood
with a lower concentration of oxygen;
3. Along whole/length of gill/lamellae;

1. (Thicker lamellae so) greater/longer diffusion distance/pathway;

2. (Lamellae fuse so) reduced surface area;

1. Increased metabolism/respiration/enzyme activity;

2. Less oxygen (dissolved in water);

(many) filaments / lamellae / secondary lamellae: so large surface area;

large number of capillaries; (NOT “good blood supply”): maintains a diffusion gradient /
removes oxygen;

thin epithelium / lamellae wall: short diffusion pathway;

fish closes mouth and raises the floor of the mouth;

this decreases the volume / increases the pressure (of mouth);
Increased volume / decreased pressure of opercular cavity;
water forced over the gills;
operculum / opercular valve opens;

less energy needed / continuous flow of water or O2;

(a) exchange/diffusion across body surface/skin;

short diffusion pathway/distance/large SA:V ratio;2

(b) large numbers of lamellae so large SA;

lamellae thin so short (diffusion) pathway to blood/capillaries;
high rate of oxygen uptake for respiration/energy release;
(accept more oxygen)3

(a) Something that increases chance / increases probability / makes it more likely;1

(b) (i) 1976 - / to / and 1980;1

(ii) 1980 - / to / and 1996;1

(c) 1. Correlation does not mean that there is a causal relationship;

2. May be some other factor / named factor;

3. Associated with vehicles and asthma / producing rise in both;

4. (After 1980) asthma continues to rise but exhaust concentration falls /

negative correlation (after 1980);
 1. Alveoli break down / collapse / rupture / fewer alveoli / larger alveoli or
alveolar wall/epithelium walls thicken;

2. Reduced surface area / increased diffusion pathway;

3. (So) less diffusion;

4. Less elastin / elastic (tissue) / not recoiling / loss of elasticity / elastin

permanently stretched;

5. Reduced flow rate / less air expelled;

6. So small / reduced diffusion or concentration gradient;

(So) Longer diffusion pathway/slower diffusion;

(a) Phagocytes engulf/ingest pathogens/microorganisms/bacteria/viruses;

Phagocytes destroy pathogens/microorganisms/bacteria/viruses;

Lung diseases are caused by pathogens/microorganisms/bacteria/viruses;

Q Allow description of process of engulfing
2 max

(b) (i) Alveoli/lungs will not inflate/deflate fully/reduced lung capacity;

Breathing out particularly affected/no longer passive;

Concentration/diffusion gradient / rate of diffusion reduced;

2 max
(ii) Alveolar walls thicken;
Longer diffusion pathway;
Scarred/fibrous tissue;
Reduces surface area (for gaseous exchange);
Q Diffusion is essential for 2nd point and surface area for
4th point.
4
(c) (i) Cancer develops 20 – 30 years after exposure (to asbestos);
1
(ii) Smoking / air pollution / specified industrial source;
1

500

(135000 – 7500) x 100 divided by 7500; 1700

Due to increase in percentage of water vapour (in expired air);

Gas exchange quiz /24 ____% Grade: _____

1. Where gas exchange occurs in plants? (1)

2. Where gas exchange occurs in insects? (1)

3. Write out Ficks law (1)

4. The scientific word for ‘flattened cells’ (1)

5. What happens to SA:Vol as organisms get bigger (1)

6. What controls the opening of the valves in insects? (1)

7. Why is it important insects do not always have the entrance to trachea open? (1)

8. Explain what counter current flow means and why it is so efficient? (3)

9. Name the abundant structure that give fish gills a large surface area? (1)

10. Explain how a fish takes water into the mouth (4)

11. How do organisms use oxygen (2)

12. What are the narrowest vessels of the insects gas exchange system called? (1)

13. How do small unicellular organisms get the oxygen they require? (2)

14. Why is it an advantage to fish to have a one way flow of water over the gills (2)

15. How is a single alveolus adapted for gas exchange [adaptation and function] (2)
1. stomata

2. spiracle

3. SA x Conc/distance

4. squamous

5. it decreases

6. carbon dioxide concentration

7. reduce water loss by evaporation

8. blood and water opposite directions, maintains concentration gradient, diffusion across

entire lamellae

9. filaments and secondary lamellae

10. Open mouth, lower flood, increase volume, reduce pressure, opercular valves close

11. in respiration to release energy

12. tracheoloes

13. diffusion across their body

14. high density of water expends a lot of energy to move

15. Single squamous cell thick, cell membranes are permeable

Specification

During digestion, large biological molecules are hydrolysed to smaller molecules that can be absorbed
across cell membranes.
Digestion in mammals of:
Carbohydrates by amylases and membrane-bound disaccharidases
Lipids by lipase, including the action of bile salts
Proteins by endopeptidases, exopeptidases and membrane-bound dipeptidases.
Mechanisms for the absorption of the products of digestion by cells lining the ileum of mammals, to
include:
Co-transport mechanisms for the absorption of amino acids and of monosaccharides
The role of micelles in the absorption of lipids.

Previous knowledge GCSE/unit 1 knowledge

 Digestion is hydrolysis of large insoluble molecules into smaller molecules that can be
absorbed across cell membranes into blood stream
 Enzyme structure, properties
 Digestive enzymes, site of production, site of activity, products, role of bile
 Digestive system components
 Structure of polymers, biochemical tests, biochemistry
 Structure of membranes and role of carrier proteins, channel proteins

Practical

 Effect of pH on enzyme activity

 Effect of bile on enzyme activity
 Model gut investigation

Biofact sheets: 24 & 140

 Enzyme properties
They are made of _____________ chains folded in a specific way.
They have a special region on them where the substrate attaches called the ___________
They increase the rate of chemical reactions because they __________ the activation energy
______________________ in the reaction

They have a temperature and pH where they work best, it is called the __________
temperature/pH.

In very high temperatures or extreme pH values the enzyme may become _____________.
This means the active site has changed shape and is no longer ______________ to the
substrate
Proteins are folded into unique shapes to
make enzymes. But proteins can also be
muscles components
hormones
If the temperature passes the optimum for a particular
antibodies
catalysts. enzyme, then the enzyme begins to __________,
meaning the _________________ changes shape and
is no longer complementary to the ____________

As the temperature increases the rate

of activity increases because

The ______________ have more

___________ energy and therefore
they __________ more often and
more _______________. This means
there are more enzyme substrate
complexes formed and more
successful reactions

As the pH moves away from the optimum the activity decreases

Enzymes have optimum activity in different pH values, those in

the stomach need acidic conditions and would not work in the
small intetsine
 What do you know about bile??? Tissue: group of similar cells
Organ: group of different tissues
Produced in the liver. Stored in gall bladder. It neutralises stomach acid Muscular: contracts, glandular secretes enzymes and
(create optimum conditions for enzymes), emulsifies fats, increasing the hormones, epithelial
Previous knowledge surface area

How the Villi are adapted to increase the rate of absorption

SA: folding of villi and the folding of the membrane to create the microvilli/brush boarder

Concentration gradient: muscular contraction in the villi, the rich blood capillary network
removing sugars and amino acids, and the lacteal removing fast helps keep a steep concentration
gradient

Diffusion pathway: thin layer of cells, 1 columnar epithelial cell

Mitochondria supply ATP/energy for active transport; and the epithelial membrane contains carrier
proteins.

1. Mouth (Buccal cavity). The teeth and tongue physically break up the food into small
pieces with a larger surface area, and form it into a ball or bolus. The salivary glands
secrete saliva, which contains water to dissolve soluble substances, mucus for lubrication,
lysozymes to kill bacteria and salivary amylase to digest starch. The food bolus is
swallowed by an involuntary reflex action through the pharynx (the back of the mouth).
During swallowing the trachea is blocked off by the epiglottis to stop food entering the
lungs.
2. Oesophagus (gullet). This is a simple tube through the thorax, which connects the mouth
to the rest of the gut. No digestion takes place here. There is a epithelium, no villi, a few
glands secreting mucus, and a thick layer of circular and longitudinal muscle to propel the
food by peristalsis. Peristalsis is a wave of circular muscle contraction, which passes down
the gut and is completely involuntary. The oesophagus is a soft tube that can be closed,
The mucosa, which secretes digestive juices and absorbs digested food. It is often folded to
increase its surface area. There is a layer of columnar epithelial cells lining the mucosa. These
epithelial cells contain microvilli, membrane proteins for facilitated diffusion and active transport,
mitochondria, and membrane-bound enzymes. Epithelial cells are constantly worn away by
friction with food moving through the gut, so are constantly being replaced.
• The submucosa, which contains blood vessels, lymph vessels and nerves to control the muscles.
It may also contain secretory glands.
• The muscle layer, which is made of smooth muscle, under involuntary control. It can be
subdivided into circular muscle (which squeezes the gut when it contracts) and longitudinal
muscle (which shortens the gut when it contracts). These two muscles therefore have opposite
effects and so are antagonistic. The combination of these two muscles allows food to be pushed
along the gut by peristalsis.
3. Stomach. This is an expandable bag where the food is stored for up to a few hours. There are
three layers of muscle to churn the food into a liquid called chyme. This chime is gradually released
in to the small intestine by a sphincter, a region of thick circular muscle that acts as a valve. The
mucosa of the stomach wall has no villi, but does have numerous gastric pits (104 cm-2) leading to
gastric glands in the mucosa layer. These glands secrete gastric juice, which contains: hydrochloric
acid (pH 1) to kill bacteria (the acid does not help digestion, in fact it hinders it by denaturing most
enzymes); mucus to lubricate the food and to line the epithelium to protect it from the acid; and
some protease enzymes. No other digestion takes place in the stomach.
4. Small Intestine. The first 30cm of the small intestine is called the duodenum. Although this is
short, almost all the digestion takes place here, due to two secretions: pancreatic juice and bile.
Pancreatic juice is secreted by the pancreas into the duodenum through the pancreatic duct.
Pancreatic juice contains numerous amylase, protease and lipase enzymes. Bile is secreted by the
liver, stored in the gall bladder, and released into the duodenum through the bile duct. Bile doesn’t
contain any enzymes, but it does contain bile salts to aid lipid digestion, and the alkali sodium
hydrogen carbonate to neutralise the stomach acid. This alkali gives chyme in the duodenum a pH
of around 7.5, so the pancreatic enzymes can work at their optimum pH. The mucosa of the
duodenum has few villi, since there is no absorption, but the submucosa contains glands secreting
mucus and sodium hydrogen carbonate. The rest of the small intestine is called the Ileum. This is
the site of final digestion and absorption. To maximise the rate of absorption the ileum has the
three features dictated by Fick’s law: large surface area, short diffusion distance and a steep
concentration gradient sustained by movement of fluids on both sides of exchange surface (see
sheet above for detail).
 Digestion

Types of digestion

Mechanical digestion: grinding and chewing breaks food into smaller pieces increasing the surface area.
The tongue forms food into a bolus for swallowing

Chemical digestion: salivary glands produce amylase whilst gastric glands in stomach and other glands in
the stomach and small intestine secrete digestive enzymes directly into the lumen of the gut

Salivary glands and pancreas secrete their enzymes through ducts into the lumen.

In the duodenum and ileum many digestive enzymes are membrane bound

Saliva also contains water to dissolve soluble substances, mucus for lubrication and lysozymes to kill
bacteria

Humans, like all animals, use holozoic nutrition, which consists of these stages:
• Ingestion- taking large pieces of food into the body
• Digestion- breaking down the food by mechanical and chemical means
• Absorption- taking up the soluble digestion products into the body's cells
• Assimilation- using the absorbed materials
• Egestion- eliminating the undigested material

Food moves through the alimentary canal by peristalsis, a wave of circular muscle contraction

Carbohydrate digestion

Common carbohydrate polymers are starch and cellulose. We lack the enzyme to digest cellulose so it
forms the bulk of the fibre in our diet.

Amylase hydrolyses glycosidic bonds in starch forming maltose (disaccharide)

Continued in the duodenum using pancreatic amylase

The membranes of the micro-villi (the folding in the membranes of the epithelial cells lining the small
intestine) contain enzymes (maltase, sucrose, lactase) that hydrolyse disaccharides to monosaccharides

Maltose  glucose

Sucrose  glucose + fructose

Lactose  glucose + galactose.

Write a summary question to explain the digestion of carbohydrates

Amylase Maltase
Starch  Maltose  glucose
Protein digestion

Begins in the stomach

Pepsin an endopeptidases hydrolyses peptide bonds within the polypeptide chain, breaking it into smaller
chains (6-12 amino acids long), forms many ends 9starting points) for other proteases, exopeptidases.

Pepsin has an optimum pH around pH2-3

Pancreas produces other endopeptidases which continue protein digestion in the duodenum. Different
endopeptidases have different peptide bonds that they target and so all proteins are hydrolysed to shorter
chains. Different enzymes have different tertiary structures, and thus different active sites, and so bind with
different substrates, the amino acids have different shapes due to the R groups

Exopeptidases in the small intestine hydrolyse the terminal peptide bonds releasing amino acids. There are
aminopeptidases working from the N terminal end, and carboxypeptidases working from the C terminal
end. Dipeptidases cut the dipeptides in half.

Exopeptidases and endopeptidases are can be bound to the membranes of the microvilli

endopeptidase exopeptidase
Protein  smaller polypeptides  amino acid

Proteases are synthesised in inactive forms called zymogens. They are activated when required

Inactive form Active form Activator

Pepsinogen Pepsin HCl

Rennin Prorennin pepsin

The pancreatic exopeptidases are activated by specific enzymes in the duodenum

Membrane bound peptidases do not need to be in an inactive state as they cannot come into contact with
body cells
Lipid digestion

Occurs in the small intestine

Bile emulsifies large lipid droplets into smaller ones (micelles), increasing the surface area for lipase
enzymes and speeding up fat digestion

Bile neutralises the stomach acid and creates alkaline conditions for enzymes in small intestine.

Pancreatic lipase hydrolyses ester bonds in lipids to produce fatty acids and glycerol

Each glycerol remains attached to one fatty acid forming a monoglyceride. These are fat soluble and can
pass quickly through the phospholipid bilayer along with cholesterol

Lipase
Lipids  fatty acids + glycerol

Digestion and absorption of fats

1Bile emulsifies triglycerides to smaller droplets;

2 provide large surface area for faster digestion;
3 Lipase (hydrolyses the ester bonds in triglycerides);
4 producing fatty acids and glycerol
(monoglycerides)
5 Fatty acids and glycerol are; lipid soluble and pass
through the membrane by simple diffusion
7 once inside the epithelial cells these components
are recombined into triglycerides (at the SER)
8 Chylomicrons formed where the lipid is coated by
proteins (occurs at the Golgi);
9 these then leave the epithelial cell (by exocytosis)
and move into the lacteals
Activation

Pancreatic

An enzyme
epithelium
then activa
Site of production Enzyme Classification Substrate Products
hydrolysed
Salivary Glands Amylase Carbohydrase Starch Maltose
Stomach Pepsin Endopeptidases Protein Peptides
Amylase Carbohydrase Starch Maltose
Trypsin Endopeptidases Protein Peptides

Pancreas Chymotrypsin Endopeptidases Protein Peptides

Carboxypeptidase Exopeptidase Peptides Amino acids
Fatty acids &
Lipase Lipase Lipids
glycerol
Maltase Carbohydrase Maltose Glucose + glucose
Sucrase Carbohydrase Sucrose Glucose + fructose
Ileum Lactase Carbohydrase lactose Glucose + galactose
Amino/carboxy
peptidase & Exopeptidases Peptides Amino acids
dipeptidase
Questions

(a) Describe how lipids are digested and absorbed in the ileum.

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
................................................................................................................... (4 marks)

Surgery is sometimes carried out to remove the gall bladder. Explain why a change in
diet is required after removal of the gall bladder.

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
................................................................................................................... (3 marks)

Pancreatic enzymes become active when they reach the duodenum. If the pancreatic
duct becomes blocked, enzymes can become active in the pancreas. Suggest how
activation of these enzymes in the pancreas could affect the pancreas.
.............................................................................................................................................
................................................................................................................................(1 mark)

Explain how glucose and fructose are absorbed by the ileum when no inhibitor is
present. (3 marks)
Describe how the gut wall is adapted
(a) to push food down the oesophagus (2 marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

(b) to neutralise the stomach acid in the duodenum (2 marks)

..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
........................................................................................................................................
..........................................................................................................................................

(c) to absorb the products of digestion in the ileum. (3 marks)

..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

6 Students investigated the digestion of lipids in milk by lipase. They set up three test tubes.
In tube A, milk was incubated with lipase only.
In tube B, milk was incubated with lipase and bile salts.
In tube C, milk was incubated with bile salts only.
Their results are shown in the table.
  The pH changed in test tube A. Explain why. ( 2marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

 The pH did not fall below a value of 6.5 in tube A. Suggest one reason why. (1 mark)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

 The rate at which the pH fell in tube A was different from the rate at which the pH fell in
tube B. Explain why the pH fell at a different rate. (2 marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

 Explain why test tube C was set up. (1 mark)

..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

Some of the enzymes produced by the gut wall hydrolyse polypeptides. Different enzymes hydrolyse
the peptide bonds between different amino acids in a polypeptide. Use your knowledge of the way
in which enzymes work to explain why. (3 marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
Endopeptidases are produced by the stomach wall and by the pancreas. Exopeptidases are produced
by the small intestine. This results in the efficient digestion of polypeptides. Explain why. (2 marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

Describe the processes involved in the digestion of triglycerides and the absorption of
the products of this digestion in the small intestine. (6 marks)

..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................

Explain how the structures of the stomach wall and the ileum wall are related to the
functions of these organs.(6 marks)
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
Explain how the action of these enzymes accounts for the results. (4 marks)

..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
..........................................................................................................................................
Bile increases SA / Emulsification;
Bile creates alkaline conditions / optimum pH (for lipase)
Lipase produces fatty acids and glycerol;
Diffusion into epithelial cells;
Lipids / Micelles / chylomicrons enter lacteal / lymph capillary;
4 max
Ignore “Neutralises acid”

Less fat in diet;

Bile emulsifies lipids / produces small droplets;
Increases surface area for (action of enzyme) lipase;

Proteases/lipases could digest pancreatic tissue

Move in with sodium (ions);

Carrier/channel proteins / symporters;
Active transport (of ions);

(a) Muscle (in walls);

Circular and longitudinal;
Contraction of circular (muscle pushes food down oesophagus); 2 max

(b) Glandular cells/glands;

Secrete alkali (mucus); 2

(c) Villi/microvilli;
(Many) capillaries/lacteals;
Single cell layer;
Channel/carrier proteins;
Mitochondria;
Enzymes in membrane;
Muscles (in villi); 3 max
(a) Production of fatty acids;
(Fatty) acids (produced) cause fall in pH; 2

(b) Substrate/lipids all used up;

Equilibrium reached;
(pH) denatures enzyme; 1 max

(c) Bile salts produce many small lipid droplets/emulsifies lipid;

Large surface area so more rapid action of lipase/enzyme; 2

(d) To show that lipase has to be present for pH to change/reaction to take

place / to show that bile salts do not digest lipids; 1

(a) (Different) enzymes have different/specific tertiary structure or different/specific active sites;
Active site has shape that fits substrate;
Amino acids (either side of peptide bond) have different shapes;
Due to the R group; 3 max

(b) Action of endopeptidase forms many ends of (peptide) chains;

Exopeptidase removes amino acid at end of chain;
OR
Action of endopeptidase forms more substrate molecules for exopeptidases;
More chance of collision between exopeptidase and substrate; 2

1 Bile emulsifies (triglycerides) / large droplets to smaller droplets;

2 (Smaller droplets) provide large surface area / faster digestion;
3 Lipase (breaks down triglycerides);
4 Into fatty acids and glycerol / monoglycerides;
5 By hydrolysis;
6 Diffusion (facilitated diffusion and active transport neutral); (reject .food. or wrong named
molecule)
7 Recombination (in epithelial cells);
8 Chylomicrons formed / lipid coated by proteins;
9 (Move into) lymph vessels / lacteals;
10 Fatty acids / glycerol move into blood (capillaries);

stomach
1. extra muscle layers;
2. churning action;
3. gastric pits/glands or named cells;
4. mucus to protect stomach wall/ acid/HCl to kill bacteria or optimal pH/ pepsinogen or pepsin or
endopeptidase for (protein) digestion;
Detail mark
5. goblet cells produce mucus;
6. oxyntic cells produce acid;
7. chief or zymogen cells produce pepsinogen/pepsin/endopetidase;

Ileum
8. villi;
9. microvilli on epithelial cells;
10. larger surface area for absorption;
11. single layer of cells / capillary/blood vessels close to surface;
12. short diffusion pathway;
13. (extensive) capillary network / large number of blood vessels/lacteals;
14. maintain diffusion gradient;
15. feature of transmembrane/carrier/transport/intrinsic protein / many mitochondria;
16. active uptake/facilitated diffusion;
17. lacteals (in villi)/lymph vessels;
18. carry away lipids/fats or equivalent;
19. Brunner.s glands;
20. secrete alkaline fluid which neutralises acid (suitable environment for intestinal enzyme
21. correct named enzyme + location e.g. maltase in membrane of epithelial cells;
22. linked function e.g. hydrolyses maltose to glucose;
23. antagonistic / circular and longitudinal muscles;
24. peristalsis;

carbohydrase (zero) only breaks down carbohydrates;

exopeptidase (slow) only taking amino acids/dipeptides off ends;
endopeptidase (slow) only breaking (peptide) bonds inside;
endopeptidase and exopeptidase (fast) because endopeptidases produces more ends
for exopeptidases; 4
 Digestion Quiz

1. What is a polymer? (1)

2. What are the bonds called in, proteins, carbohydrates, lipids? (3)

3. What 4 elements are proteins made from? (1)

4. What are the monomers in Lipids (1)

5. What is the purpose of physical digestion? (1)

6. What scientific term can we use to describe the breakdown of biological molecules? (1)

7. What word describe the movement of material through the digestive system (1)

8. Describe the complete breakdown of starch (5)

9. What are the products of protein digestion (1)

10.Where does most digestion take place and what secretions does it receive (3)

11.What do we call the mulch that is slowly released from the stomach (1)

12.Write three simple equations for the breakdown of, lactose, maltose and sucrose; include the
substrate, the enzyme and products (3)

13.Describe the absorption of glucose (4)

14.Describe how the small intestine is adapted for digestion and absorption? (5)

15.What is the name of the protease in the stomach? (1)

16. In what part of the small intestine does most occur? (1)

17.Suggest how lactose intolerance could lead to diarrhoea? (3)

18.Describe the complete digestion and absorption of fats (6)

1. Long chain of repeating subunits/monomers

2. Peptide, glycosidic, ester

3. C, H, O, N

4. Fatty acids and glycerol

5. Increase the surface area of the food for the digestive enzymes

6. Peristalsis

7. Amylase hydrolyses glycosidic bond in starch producing maltose. Maltase hydrolyses

glycosidic bonds in maltose producing glucose

8. Amino acids

9. duodenum, pancreatic juice containing digestive enzymes and bile to neutralise the stomach
acid and emulsify lipids

10. chyme

11. Lactose  (lactase)  galactose + glucose/ Maltose  (Maltase)  glucose + glucose/

Sucrose  (sucrase)  Fructose + glucose

12. Absorbed with sodium, at a co-transport protein carrier, sodium moves down it’s
concentration gradient, bringing glucose up a concentration gradient. The sodium gradient is
maintained by the sodium potassium pump, actively removing sodium form the cell. Glucose
leaves the cell by facilitated diffusion, carried way in the hepatic portal vein

13. Large surface area provided by Villi and Micro villi. Thin layer of cell gives a short diffusion
pathway, the rich network of blood capillaries (carrying sugar and amino acids) and lacteals
(carrying products of fat digestion) maintain a steep concentration gradient. Presence of
protein carriers and channel in the membrane allow for the uptake of polar molecules. The
enzyme built into the membrane make enzyme substrate complexes more likely.

14. pepsin

15. ileum

16. Lactose lowers the water potential of the intestinal lumen, water leaves the epithelial cells
by osmosis

17. 1 Bile emulsifies (triglycerides) / large droplets to smaller droplets;

2 (Smaller droplets) provide large surface area / faster digestion;
3 Lipase (breaks down triglycerides);
4 Into fatty acids and glycerol / monoglycerides;
5 By hydrolysis;
6 Diffusion (facilitated diffusion and active transport neutral); (reject .food. or wrong named
molecule)
7 Recombination (in epithelial cells);
8 Chylomicrons formed / lipid coated by proteins;
9 (Move into) lymph vessels / lacteals;
10 Fatty acids / glycerol move into blood (capillaries);
Specification: Mass transport in animals: 3.3.4.1
The haemoglobins are a group of chemically similar molecules found in many different organisms.
Haemoglobin is a protein with a quaternary structure.

The role of haemoglobin and red blood cells in the transport of oxygen. The loading, transport and
unloading of oxygen in relation to the oxyhaemoglobin dissociation curve. The cooperative nature of
oxygen binding to show that the change in shape of haemoglobin caused by binding of the first
oxygen makes the binding of further oxygen easier. The effects of carbon dioxide concentration on
the dissociation of oxyhaemoglobin (the Bohr effect).

Many animals are adapted to their environment by possessing different types of haemoglobin with
different oxygen transport properties.

The general pattern of blood circulation in a mammal. Names are required only of the coronary
arteries and of the blood vessels entering and leaving the heart, lungs and kidneys.

The gross structure of the human heart. Pressure and volume changes and associated valve
movements during the cardiac cycle that maintain a unidirectional flow of blood.

The structure of arteries, arterioles and veins in relation to their function.

The structure of capillaries and the importance of capillary beds as exchange surfaces. The formation
of tissue fluid and its return to the circulatory system.

Students should be able to:

•• analyse and interpret data relating to pressure and volume changes during the cardiac cycle
•• analyse and interpret data associated with specific risk factors and the incidence of cardiovascular
disease
•• evaluate conflicting evidence associated with risk factors affecting cardiovascular disease
•• recognise correlations and causal relationships.

Previous knowledge
Protein structure form unit 1 (primary  quaternary)
Surface area to volume ratio relationship

Biofact sheets:

Oxygen dissociation curves: 9 & 175

Tissue fluid: 89 & 171

Heart: 139 & 35 & 37

Haemoglobin structure

It is a protein

It has a quaternary structure, (association of more than one polypeptide); in this case it is 4 polypeptide chains 2α
and 2β

Each polypeptide chain is associated with an iron containing haem group, and each haem group can bind one
oxygen molecule. So a Hb molecules can carry 4 oxygen molecules

Oxygen dissociation curves: A sigmoid curve

Loading
In the lungs Hb has a high affinity for oxygen
PPO2 is high in the lungs
Oxygen diffuses into red blood cells and binds to Hb
Forming oxyhaemoglobin

Unloading/dissociation
Unloading occurs in when PPO2 is low
Such as in respiring tissue
The presence of carbon dioxide produced in respiration
Further reduces the affinity of Hb for oxygen (curve shifts right)
So more oxygen is released for any given PPO2
 A sample of blood can therefore be in any state from completely
deoxygenated (0% saturated) to fully oxygenated (100% saturated).
Since deoxyhaemoglobin and oxyhaemoglobin are different colours, it is easy
to measure the % saturation of a sample of blood in a colorimeter.
As the chemical equation shows, oxygen drives the reaction to the right, so
the more oxygen there is in the surroundings, the more saturated the
haemoglobin will be.
This relation is shown in the oxygen dissociation curve:
Hb shows cooperative bonding, where the attachment of one molecule of
oxygen changes the shape of the Hb and affects the binding of the other
oxygen molecules
This curve has an S (or sigmoid) shape, and shows several features that help in
the transport of oxygen in the blood:
• In the alveoli, ventilation of the lungs oxygen is concentration is kept high, at
around 14 kPa. As blood passes through the capillaries surrounding the alveoli
the haemoglobin binds oxygen to become almost 100% saturated. Even if the
alveolar oxygen concentration falls a little the haemoglobin stays saturated
because the curve is flat here.
• In tissues, like muscle, liver or brain, oxygen is used by respiration, so is low,
typically about 4 kPa. At this PO2 the haemoglobin is only 50% saturated, so it
unloads about half its oxygen (i.e. from about 100% saturated to about 50%
saturated) to the cells, which use it for respiration
• In tissues that are respiring quickly, such as contracting muscle cells, the PO2
drops even lower, to about 2 kPa, so the haemoglobin saturation drops to about
10%, so almost 90% of the oxygen is unloaded, providing more oxygen for the
muscle cells.
• Actively-respiring tissues also produce a lot of CO2, which dissolves in tissue
fluid to make carbonic acid and so lowers the pH. The chemical equation above
shows that hydrogen ions drive the reaction to the left, so low pH reduces the %
saturation of haemoglobin at any PO2.
This is shown on the graph by the dotted line, which is lower than the normal
dissociation curve. This downward shift is called the Bohr effect, after the Danish
scientist who first discovered it. So at a PO2 of 2%, the actual saturation is nearer
5%, so almost all the oxygen loaded in the lungs is unloaded in respiring tissues.
Bohr Effect

The dissociation curve shifts right

Meaning Hb has a lower affinity for oxygen, and that more oxygen
will be unloaded/released from Hb

This is caused by

1) An increase in acidity, as a result of CO2 from respiration

forming carbonic acid, and lactic acid being produced in
anaerobic respiration
2) Increase in temperature: heat energy is released during
respiration

This is beneficial because……….

As tissues/muscles become more active

They require more oxygen

For the increased rate of respiration

So as the curve shifts right, lowering its affinity for oxygen, more
oxygen will be made available to the tissues

The low PPO2 in the tissues causes more oxygen to dissociate at

normal pH values, so the acidity simply means that more oxygen is
released at any given PPO2
Different Haemoglobins
Different animals possess different types of haemoglobin with different oxygen transporting properties. These properties are related to the animal’s way of life, so they are
an adaptation that helps the animal survive in its environment.
A human foetus makes a different kind of
haemoglobin from an adult. Foetal haemoglobin
has a higher affinity for oxygen at low partial
pressures, so its oxygen dissociation curve is
shifted up.
A developing foetus obtains its oxygen, not
through its lungs, but from its mother’s blood in
the placenta. So this different haemoglobin
allows oxygen to diffuse from the mother’s
blood to the foetus, and to be unloaded in the
foetal tissues. Foetal haemoglobin is gradually
replaced by adult haemoglobin during the first
Lugworms live in the mud in estuaries and
Mice lose heat very quickly due to their large surface
seashores. When the tide is out the lugworm area: volume ratio, so they lose a lot of heat and have
stays in a burrow filled with sea water. But the a high metabolic rate t. Their tissues therefore have a
oxygen concentration in this burrow can fall very constant and high demand for oxygen for high
low as the lugworm respires, so the lugworm has respiration rate. The oxygen dissociation curve for
haemoglobin with a very high affinity for oxygen: mouse haemoglobin is shifted right so a has reduced
affinity for oxygen; haemoglobin releases
its oxygen dissociation curve is shifted up. This oxygen more readily to tissues; allowing greater respiration
allows the lugworm to obtain oxygen even when rate;
the PO2 is as low as 2kPa.
Myoglobin is a pigment found in muscles
that are involved in sustained contractions. .
It has a higher affinity for oxygen than Hb. It
can act as an oxygen store only releasing
oxygen when PPo2 is very low, thus it delays
anaerobic respiration as long as possible
Some bacteria require living in plant root nodules require an environment with a very low
concentration of oxygen. The walls of the nodule contain a type of haemoglobin. The oxygen-
haemoglobin dissociation curve of this haemoglobin is far to the left of that for human haemoglobin.
Suggest and explain the role of haemoglobin in the nodule. (3)
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................

DPG is a substance produced in small

amounts in red blood cells. The graph
shows the effects of DPG on the oxygen
haemoglobin dissociation curve.

Anaemia is a condition in which not

enough oxygen is delivered to the tissues.
The red blood cells of people with anaemia
produce large amounts of DPG. Explain the
advantage to people with anaemia of
producing large amounts of DPG.(4)

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................

Explain how oxygen is loaded, transported and unloaded in the blood.(6)

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
The table shows the number of red blood cells in the blood of mammals that spent their life at sea
level or at high altitude. At sea level, the partial pressure of oxygen is 21 kPa and at 4500 m above
sea level it is 11 kPa.

Explain the advantage of the increased number of red cells in mammals living at high altitude.(2)
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................

Suggest which two of the species in the table live naturally at high altitude. Use the data to explain
your answer.(2)

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................

Explain the advantage to the shrew of the oxygen dissociation curve being to the right of that of a
human. (3)
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
Haemoglobin high affinity for oxygen;
Fully saturated/takes up oxygen, at low partial pressures (found in the root cells);
Remove oxygen from cells in nodule/cells containing bacteria

Anaemia leads to reduced (aerobic) respiration;

DPG lowers affinity of haemoglobin for oxygen;
(So) oxygen unloaded more easily / more oxygen unloaded / dissociates more readily;
At higher PO2/same PO2;
More oxygen to respiring tissues;

1) Partial pressure of oxygen is high in lungs;

2) (O2) binds to Hb;
3) forms oxyhaemoglobin(HbO8);
4) in red blood cells;
5) Hb has a high affinity for oxygen;
6) dissociation occurs when partial pressure of O2 is low;
7) dissociation is increased/ faster by high CO2;
8) partial pressure of O2 is low in respiring tissues;

Can carry more oxygen (to (respiring) tissues)/more Hb/more efficient

O2 uptake;
Needed because less oxygen available/at altitude lower ppO2;

Sheep and llama;

Because they produce large numbers of red cells even when raised at sea level;

high respiration rate means high demand for oxygen;

shrew haemoglobin has lower affinity for oxygen / gives up O2 more readily;
shrew Hb lower saturation rate than human Hb at same partial pressure / more O2
released at same pp;
 Mass transport

Diffusion is a slow process so is only effective over short distances

Diffusion is a passive process (does not require energy)

Mass flow: moves materials in a particular direction, usually in bulk using water as a solvent. It
requires a pumping mechanism and it is fast

Humans
We have a double circulatory system

Blood flows through the heart twice for one circuit of the body

Blood flows from the right side of the heart to the lungs and back to the left side of the heart: this is
pulmonary circulation

Blood flows from the left side of the heart around to rest of the body this is systemic flow

Valves in the heart and veins ensures one way flow of blood (valves prevent back flow)
The structure of the heart

4 chambers Right ventricle of the heart: less muscular, blood has shorter distance to go, so needs
2 atria less pressure, and it ensures less fluid is passed to alveoli
2 ventricles
Left ventricle of the heart more muscular, generates a higher pressure to pump the
Between the atria and the ventricles are atrioventricular valves, which blood a greater distance
prevent back-flow of blood from the ventricles to the atria.

The left valve has two flaps and is called the bicuspid (or mitral) valve,
while the right valve has 3 flaps and is called the tricuspid valve.
The valves are held in place by valve tendons (tendinous chords) attached
to papillary muscles, which contract at the same time as the ventricles,
holding the vales closed and stop valves form inverting.
There are also two semi-lunar valves in the arteries (the only examples of
valves in arteries) called the pulmonary and aortic valves.
The heart is made of cardiac muscle, composed of cells called myocytes. When
myocytes receive an electrical impulse they contract together, causing a heartbeat.
Since myocytes are constantly active, they have a great requirement for oxygen, so
are fed by numerous capillaries from two coronary arteries. These arise from the
aorta as it leaves the heart. Blood returns via the coronary sinus, which drains directly
into the right atrium.
 The mechanism of a heartbeat
Heart muscle is myogenic (beats spontaneously without nervous or hormonal
stimulation, but can be altered by these);
SAN initiates heart beat;
Wave of electrical activity passes over atrium;
Triggers contraction of atrium (atrial systole);
Non-conducting tissue prevents immediate contraction of ventricles
Electrical activity can only pass to ventricles along bundle of His by way of AVN
Fibrous tissue prevents passage elsewhere;
this delay at AVN allows ventricles to fill
Electrical impulse spreads up the ventricle wall along purkyne/purkinje fibres
causing ventricles to contract from base up;

Blood flow in the heart is a result of pressure gradients and the presence of valves that prevent
backflow

Unidirectional flow in the heart

1. Atrial systole, atria has higher pressure than ventricle
2. Atrioventricular valve open (blood flows atria  ventricle)
3. Ventricular systole means ventricular pressure is higher than
atrial
4. Atrioventricular valve closes; (bicuspid/tricuspid) lubb
5. Ventricular pressure is higher than pressure in the aorta;
6. Semilunar valve opens;
7. Higher pressure in aorta than ventricle (as heart relaxes);
8. Semilunar valve closes; dubb
Pathway of blood through the heart and lungs
Returns deoxygenated blood to the right atrium
Vena Cava

Contraction in right atrium increases blood pressure above that of the ventricle, blood
RA forced through the tricuspid valve

RV The right ventricle contracts and the tricuspid valve, blood passes into the pulmonary
artery through the semilunar valve

Pulmonary artery Pulmonary artery carries blood to lungs, rare example of artery with
deoxygenated blood

Lungs Gas exchange occurs; look back at notes to explain how this is done efficiently, blood
loses pressure here in narrow capillaries

Pulmonary Vein Carries oxygenated blood back to the left atrium

LA Left atrium contracts and blood passes through the bicuspid/mitral valve into the left
ventricle

Left ventricle contracts and the bicuspid valve shuts and blood moves into the aorta
LV

Aorta carries blood to the rest of the body

Aorta

Body
 16
Delay for depolarisation to spread SAN  AVN  Ventricles. T wave ventricular repolarisation
A o rta

12

L eft
8 v en tricle
P ressu re /
kPa
C u rv e X
4

–2
0 0 .1 0 .2 0 .3 0 .4 0 .5 0 .6 0 .7 0 .8 0 .9 1 .0
Tim e / s

Curve x is the right ventricle, this is clear as the pattern is the same as that of the left ventricle, but
the pressure is lower as a result of the smaller muscle content of the wall.
When the left ventricle pressure crosses the pressure line representing the aorta the blood flows
through the semi-lunar valves. When ventricular pressure drops below the aorta pressure then the
valves shut. This causes the second sound you can hear on a heart beat (dub).

When atrial pressure is greater than

ventricular pressure the
atrioventricular valves are open

When ventricular pressure exceeds

atrial pressure (1) then the
atrioventricular valves close
(tricuspid/bicuspid). The first heart
sound Lub

When ventricular pressure exceeds

arterial pressure (2) the semi lunar
valves open

When ventricular pressure is less

than arterial pressure (3) the semi
lunar valves shut, this is the second
sound of the heart beat (dup)

The QRS wave is associated with the spreading of electrical activity over the ventricles. This is evident as it occurs
before the pressure in the ventricles begins to increase. Pressure increase in the ventricles is due to ventricular
systole. P is the wave of depolarisation for atrial systole. PQ flat line is the time Delay for depolarisation to
spread SAN  AVN  Ventricles. T wave ventricular repolarisation
Cardiac Output
Cardiac Output is the amount of blood flowing through the heart each minute. It is
calculated as the product of the heart rate and the stroke volume:

Cardiac output = heart rate x stroke volume

• The heart rate can be calculated from the pressure graph by measuring the time taken for
one cardiac cycle and using the formula:

• The stroke volume is the volume of blood pumped in each beat.

Both the heart rate and the stroke volume can be varied by the body. When the body
exercises the cardiac output can increase dramatically so that

• oxygen and glucose can get to the muscles faster

• Carbon dioxide and lactate can be carried away from the muscles faster
• heat can be carried away from the muscles faster
Questions
1 For each equation, rearrange to make A the subject.
a C=B–A (1 mark)
b P+Q=A×B (1 mark)
3
2 An individual at rest had a stroke volume of 75 cm and a heart rate
of 60 beats per minute.
a Calculate the cardiac output in dm-3 min-1. (1 mark)
b Calculate the cardiac output when the same individual exercises
with a stroke volume of 98 cm3 and a heart rate of 103 beats per
minute. (1 mark)
c What is the percentage increase in cardiac output? (2 marks)
3 Figure 2 shows the ECG of a healthy person at rest.

Figure 2
a What is the heart rate of the person? (1 mark)
3
b If the stroke volume of the person is 80 cm , what is the cardiac
output in litres per minute? (1 mark)
c What would the heart rate of the person be if their CO rose to 9.6
dm-3 min-1 and their stroke volume increased by 50%? (2 marks)
4 Figure 3 shows the ECG of a person at rest. The same person
measured their blood pressure with a portable meter and found it to
be 123 / 82 mmHg.
a Use the graph to find the person's heart rate. (1 mark)
b Use the following formula to estimate the person's stroke volume
systolic pressure – diastolic pressure = pulse pressure
Assume that pulse pressure = stroke volume in cm3. (1 mark)
c Calculate the cardiac output for this person. (1 mark)
d When exercising, the person's heart rate rose to 105 beats per
minute. What would be the percentage increase in stroke volume
required to give them a cardiac output of 5.6 dm-3 min-1? (2 marks)
Answers
5 a A=B–C (1 mark)

b (1 mark)
-3 -1
6 a 4.5 dm min (1 mark)
b 10.1 dm-3 min-1 (1 mark)
c 124.4% (allow one for the correctly calculated increase but
incorrect %, two for the correct %) (2 marks)
7 a 52.9 beats per minute (1 mark)
b 4.2 dm-3 min-1 (1 mark)
c 80 beats per minute (one mark for the new stroke volume = 120
cm3, one mark for the correct rate) (2 marks)
8 a 56.6 bpm (1 mark)
b 41 cm3 (1 mark)
-3 -1
c 2.3 dm min (1 mark)
d 30% (one mark for the change in stroke volume correctly found 12.3,
one for the correct %) (2 marks)
3 3
9 a 27 dm / 27,000 cm (2 marks if correct, or one mark each correct
step, e.g. muscle mass is 54 kg) (2 marks)
3 3
b 33 750 cm / 33.8 dm (1 mark)
3
c 174.9 cm

Explain how smoking and a high blood cholesterol
concentration increase the risk of developing
coronary heart disease. (6)
CHD = heart muscle receives inadequate amount of
blood or oxygen / (coronary) blood supply reduced;
Smoking:
Raises concentration of fibrinogen (in blood) /
increased risk of clotting;
Increases viscosity of blood;
(Nicotine) causes platelets to stick together / causes
vasoconstriction;
Carbon monoxide associated with plaque formation;
Reduces ability of arteries to dilate / reduces
elasticity;
What is atheroma? (2)
Plaque/ fatty material/ cholesterol/ foam cells/ lipoprotein build up;
In artery/ blood vessel wall;
Describe how atheroma can lead to an aneurysm. (2)
Weakens artery wall;
So that it swells/ bursts;
Describe how atheroma may form and lead to a myocardial infarction.(6)
1 fatty substance / foam cells / cholesterol in artery wall / under endothelium;
2 formation of plaques / atherosclerosis / atheroma narrows lumen of artery;
3 atheroma creates turbulence / damage to lining of artery;
4 (turbulence) increases risk of blood clot / embolus;
5 blood clot / thrombus breaks off;
6 (blood clot) lodges in coronary artery;
7 reduced blood supply to heart muscle;
8 reduced oxygen supply;
9 leads to death of heart muscle;
Cigarette smoking and a diet high in saturated fat increase the risk of myocardial infarction. Explain how.(6)
Carbon monoxide combines with haemoglobin/causes less
oxygen to be transported;
Decreases concentration of antioxidants in blood;
Increases the damage done to artery walls;
Blood clot may occur;*
Blood pressure increased*
Blocks flow of blood to heart/in carotid arteries;*
Saturated fat associated with cholesterol;
Cholesterol deposited in arteries;
Atheroma formation;
Blood clot may occur*;
Blood pressure increased*
Blocks flow of blood to heart/in carotid arteries*;
*Allow reference to these points only once.
Cholesterol / blood clot causes constriction of coronary arteries;
Less oxygen transported to heart muscle tissue;
Cholesterol:
Fatty streaks / deposits adhere to wall of arteries;
Atheroma / atherosclerosis / plaque;
Narrows lumen of artery;
Damages endothelium;
Can lead to formation of thrombus / blood clot;
 Name the structure labelled X.

....................................................................................................................................................................
......... (1 mark)

(ii) Suggest how the structures labelled Y help to maintain the flow of blood in one direction through
the heart.
....................................................................................................................................................................
.........................
....................................................................................................................................................................
......... (2 marks)

(i) Suggest a function of the coronary artery.

...................................................................................................................................
................................................................................................................................... (1 mark)

(ii) From which blood vessel does the coronary artery originate?
...................................................................................................................................
................................................................................................................................... (1 mark)

The table shows some of the events during the cardiac cycle. Complete the table with
ticks to show whether each event occurs when the ventricles are filling or when they
are emptying.(2)
The walls of the left and right ventricles have different thicknesses. Explain the
advantage of this. (1)
...................................................................................................................................
...................................................................................................................................
The left and right ventricles pump the same volume of blood with each beat of
the heart. Explain why.(1)
...................................................................................................................................
...................................................................................................................................

The graphs shows some of the pressure and

volume changes that take place in the left
side of the heart during part of a cardiac
cycle.

Using information from the graphs, describe

the events that produce the changes in the
volume of the left ventricle between times P
and Q.(4)

....................................................................................................................................................................
...................................................
..............................................................................................................................................
....................................................................................................................................................................
....................................................
................................................................................................................................................
The volume of blood pumped out of the left ventricle during one cardiac cycle is
called the stroke volume. The volume of blood pumped out of the left ventricle in one minute
is called the cardiac output. It is calculated using the equation

Cardiac output = stroke volume heart rate

After several months of training, an athlete had the same cardiac output but a lower
resting heart rate than before. Explain this change.(2)
...................................................................................................................................
...................................................................................................................................
(i) atrioventricular valve/(bi)cuspid valve/mitral valve; 1
(ii) (valves close) due to high blood pressure / when ventricles contract;
Y prevent valve from being inverted / restricts/stops valve movement; 2

(i) Supply oxygen/glucose to heart (muscle); 1

(ii) Aorta; 1

Higher pressure in left ventricle/lower pressure in right ventricle (when contracting);

All the blood leaving the right side of the heart returns to the left side / (internal) volume of
heart (chambers) same on both sides;

Ventricle begins to contract/systole;

This increase in pressure closes the atrioventricular
valve/bicuspid valve;
Pressure rises above that in the aorta;
(So) semi-lunar valves open;
Blood moves out of the ventricle so volume decreases;

increase in volume / size of ventricles (accept heart) / hypertrophy of heart / increased

strength of heart muscle / increased strength of contraction;
more blood leaves heart in each contraction / increase in stroke volume;
Key Tissues in blood vessels and their functions
Elastic tissue
Stretches under pressure (heart beats), Recoils and Evens out pressure

Muscle tissue
Muscle contracts; Reduces diameter of lumen (vasoconstriction); helps to maintain pressure; can change the volume of blood
reaching organs, can divert blood to areas it is required

Epithelial tissue: smooth; Reduces friction

Artery: carry blood away from the heart under high pressure.
They have a narrow lumen
No valves
Thickest walls: cope with highest pressure. These walls are rich in
Elastic tissue to cope with pressure surges
Muscle layer to help maintain pressure and change diameter of vessel
Smooth epithelium: reduce friction

Artery
Thickest wall, enabling it to carry blood at high pressure / withstand
pressure surges;
most elastic tissue, which smooth out flow/maintains pressure; it can
distend when ventricles contract and can recoil
most muscle which maintains pressure;
muscle in wall to control blood flow, contracts, vasoconstriction occurs
altering blood flow to organs. The proportion of muscle increases in the
arterioles and elastics tissue declines
The thickness of the aorta wall changes all the time during each cardiac
cycle. Explain why.
1. (Aorta wall) stretches;
2. Because ventricle/heart contracts / systole / pressure increases;
3. (Aorta wall) recoils;
4. Because ventricle relaxes / heart relaxes /diastole / pressure falls;
5. Maintain smooth flow / pressure
 A B

Valve shuts when the pressure at B is higher than at A;

Blood (on B side) pushes against valve, forces flaps shut;

Veins:
Carries blood back to the heart blood under low pressure
Thin walls: due to lower pressure and reduced amount of elastic and muscle tissue.
Wider lumen: reduce friction
Valves to prevent backflow
Blood flow is a result of skeletal muscles and valves as explained in box across the way

How blood flow in the veins is maintained.

Primarily due to
Effect of (skeletal) muscle contraction
Valves prevent backflow and

But also due to

Residual blood pressure from heart;
negative pressure from thorax;
‘suction effect’ from heart;
 The capillary is adapted for the exchange of substances between
blood and the surrounding tissue.
1. Permeable capillary wall/membrane;
2. Single cell thick/thin walls, reduces diffusion distance;
3. Flattened (endothelial) cells, reduces diffusion distance;
4. Fenestrations, allows large molecules through;
5. Small diameter/ narrow, gives a large surface area to volume/
short diffusion distance;
6. Narrow lumen, reduces flow rate of cells through the capillary
giving more time for diffusion;
7. Red blood cells are in close contact with the capillary wall give
short diffusion distance

Describe and explain ways in which a capillary adapts for exchange

Permeable capillary membrane;
Single cell thick, reduces diffusion distance;
Flattened (endothelial) cells, reduces diffusion distance;
Fenestrations, allows large molecules through;
Small diameter/ narrow, gives a large surface area to volume/ short diffusion distance;
Narrow lumen, reduces flow rate giving more time for diffusion;
Red blood cells in contact with wall/ pass singly, gives short diffusion distance / more time for diffusion;

Explain two ways in which the small diameter of the capillaries results in the efficient transfer of oxygen from
the alveoli to the red blood cells.
Red blood cells close to capillary wall/ thin capillary wall;
Short diffusion path/ distance for oxygen to diffuse;
Longer time for diffusion to take place/ diffusion is slow;
 B loo d v essel
A rtery C a p illa ry Vein
M ean d iam eter
4 .0 m m 8 .0 m 5 .0 m m
o f v essel
P rop erty M ean
th ick n ess o f 1 .0 m m 0 .5 m 0 .5 m m
w all
R ela tiv e th ick n ess (sh o w n b y len g th o f b a r)
E n d o th eliu m
T issu es
p resen t in E lastic tissu e
w a ll
M u scle

E lastic
fib res P e rm eab ility

M u sc le
fib res

A orta S m all A rterio les C ap illaries Ven u les Ve in s

arte ries

As you move away from the heart the proportion of elastic

tissues in the vessels decrease and the proportion of muscle
increases. This reflects the decreasing pressure surges and need
for elasticity, but the increased need for maintaining pressure
and controlling the blood flow to different organs.

Permeability increases at the capillaries, the site of exchange,

they are one cell thick

Veins have a lot less muscle and elastic tissue than arteries,
thinner walls as a consequence. A wider lumen helps to reduce
restriction to flow
 At the capillaries fluid is forced out
Tissue fluid/Interstitial fluid along with soluble components.
 Glucose
 Amino acids
 Salts/ions

This fluid bathes the cells and is

called tissue fluid

Hydrostatic pressure forces fluid out

at the arteriole end,

Water enters at the venous end by

osmosis (osmotic effect, OE)

Arteriole end: HP>OE

Venous end: OE>HP

Oedema: build-up of tissue fluid, caused by…..

Tissue fluid formation
Starvation/lack of protein
1. Hydrostatic pressure at arterial end is high (due to ventricular contraction) Starvation linked to low protein content in plasma/blood;
2. Forces water/fluid out (filtration) Water potential of blood higher (less negative)
3. Proteins remain in capillary as they are too large to pass out; less tissue fluid returned to blood by osmosis (forms faster
than returned)
Return of tissue fluid to general circulation
Histamine
4. Loss of fluid and presence of proteins Lower water potential in capillary (water potential of the blood Increases the permeability of capillary walls
becomes more negative) Large molecules can pass through.
5.HP falls due to friction in narrow capillary and due to loss of fluid Proteins can move into tissue fluid;
6. Water enters capillary; Lowers water potential of tissue fluid;
7. By osmosis; Reduces tendency to reabsorb water;
8. Lymph collecting excess fluid returning blood to main circulation
High blood pressure
High blood pressure forces more fluid out;
The plasma proteins are too large to pass out the capillaries, and as water is lost the fluid in the capillary higher pressure reduces reabsorption;
becomes more concentrated and the osmotic pressure increases Fluid formed faster than drained
So as we move along the capillary, arteriole to venous end, HP decreases and osmotic effect increases
Blood vessel Quiz /27 ____% Grade: _____

1. The blood vessel returning blood to the heart? (1)

2. The blood vessel carrying blood to the lungs? (1)
3. The blood vessel carrying blood back to the heart from the lungs? (1)
4. Blood vessel carrying blood to the kidney (1)
5. Blood vessel carrying blood away from the liver (1)
6. Blood vessel carrying blood to the liver form the small intestine (1)
7. The blood vessel carrying blood to the rest of the body (from the heart) (1)
8. What does a double circulatory system mean? (1)
9. What do we call the circulation between the heart and the lungs? (1)
10. What do we call circulation between the heart and the rest of the body (1)
11. The vessels that carry blood way from the heart? (1)
12. The vessels that carry blood to the heart? (1)
13. The vessels where exchange occurs? (1)
14. The purpose of valves in the blood vessels (1)
15. The name of the hollow part of the blood vessel through which the blood moves? (1)
16. The purpose of a smooth endothelium? (1)
17. The role of elastic tissue in blood vessels leaving the heart (3)
18. The role of smooth muscle in vessels bringing blood to the organs (3)
19. Explain two ways in which the small diameter of the capillaries results in the efficient
transfer of oxygen from the alveoli to the red blood cells. (2)

20. Describe two ways by which blood flow in the veins is maintained. (2)

21. Give two ways in which the structure of an artery is different from the structure of a
vein. (2)
 1. The blood vessel returning blood to the heart? (1) vena cava
2. The blood vessel carrying blood to the lungs? (1) pulmonary artery
3. The blood vessel carrying blood back to the heart from the lungs? (1) pulmonary vein
4. Blood vessel carrying blood to the kidney (1) renal artery
5. Blood vessel carrying blood away from the liver (1) hepatic vein
6. Blood vessel carrying blood to the liver form the small intestine (1) hepatic portal vein
7. The blood vessel carrying blood to the rest of the body (from the heart) (1) aorta
8. What does a double circulatory system mean? (1) blood flows through the heart twice for
one circuit of the body
9. What do we call the circulation between the heart and the lungs? (1) pulmonary
10. What do we call circulation between the heart and the rest of the body (1) systemic
11. The vessels that carry blood way from the heart? (1) artery
12. The vessels that carry blood to the heart? (1) vein
13. The vessels where exchange occurs? (1) capillary
14. The purpose of valves in the blood vessels (1) prevent backflow
15. The name of the hollow part of the blood vessel through which the blood moves? (1) lumen
16. The purpose of a smooth endothelium? (1) reduce friction
17. The role of elastic tissue in blood vessels leaving the heart (3) 1 Elastic tissue stretches under
pressure/when heart beats; Recoils/springs back; Evens out pressure/flow;
18. The role of smooth muscle in vessels bringing blood to the organs (2) contracts; Reduces
diameter of lumen/vasoconstriction/constricts vessel;
19. Explain two ways in which the small diameter of the capillaries results in the efficient
transfer of oxygen from the alveoli to the red blood cells.
Red blood cells close to capillary wall/ thin capillary wall; Short diffusion path/ distance for
oxygen to diffuse; Longer time for diffusion to take place/ diffusion is slow;
20. Describe two ways by which blood flow in the veins is maintained.
Valves prevent backflow; residual blood pressure from heart; effect of (skeletal) muscle
contraction negative pressure from thorax; ‘suction effect’ from heart;
21. Give two ways in which the structure of a artery is different from the structure of a
vein.
Thick muscular walls; Greater elastic content; Do not have valves; Small/narrow lumen;
Specification
Xylem as the tissue that transports water in the stem and leaves of plants. The cohesion-tension
theory of water transport in the xylem.

Phloem as the tissue that transports organic substances in plants. The mass flow hypothesis for the
mechanism of translocation in plants. The use of tracers and ringing experiments to investigate
transport in plants.

Students should be able to:

•• recognise correlations and causal relationships
•• interpret evidence from tracer and ringing experiments and to evaluate the evidence for and
against the mass flow hypothesis.

Previous knowledge
Cross section of a leaf and adaptations
Leaf tissues
Role of xylem and phloem

Practicals
Capillarity

Biofactsheets: 64 & 132

Root and stem structure:

Water is carried through the plant in the xylem. The flow is unidirectional, from roots to leaves and out
to the atmosphere via evaporation at the stomata (transpiration). The movement is called the
transpiration stream. Xylem tissue is adapted to facilitate this process of water movement

How Xylem vessels are adapted for their function

Thick cell walls: Withstand tension (negative pressure);

Lignin in cell walls: Walls waterproof & to withstand tension
Xylem cells have no end walls: So a continuous column of water;
Xylem vessels are stacked on top of each other: So a continuous column of water;
Have no cytoplasm: reduces resistance to flow of water / so a continuous column of water;
Nature of cell walls allows adhesion;
Xylem cells have pits (in side walls): Enable sideways (lateral) flow to by-pass blockages & allows entry
or exit of water;
Narrow tubes: Allows capillarity
Cohesion Tension Theory

Te
d

M
So
Ev
cr
th

D
W
Th
Li
C
C
Evidence to support supports cohesion Factors affecting the rate of transpiration
The diameter of a tree is less during the day, when the tree is transpiring, than it Temperature: affects kinetic energy of molecules, so
is at night. Evaporation from leaves during daytime; tension/negative pressure diffusion is faster
(on water) in xylem creates inward pull (on walls of xylem vessel); Humidity: affects water potential gradient
xylem vessels become narrower; due to adhesion of water molecules (to walls of Light: causes stomata to open
xylem vessels); Wind speed: affects water potential gradient
 If air enters the xylem the transpiration stream can cease as cohesion is
disrupted between the water molecules.
 If the xylem breaks air is sucked into the vessel suggesting a negative Q. In dry conditions, the rate of transpiration is affected by
pressure inside an increase in temperature. Describe and explain how.

The argument against is that rot pressure would force the xylem wider and thus A. Increase in transpiration
increase the diameter of the tree Higher kinetic energy of molecules
Steeper water potential gradient;

At 12.00 transpiration is a t it’s highest because this is when water flow is at its maximum. As

Rate of flow increases from a minimum at 00.00 hours to a maximum at 12.00 hours and then decreases to
a minimum again at 24.00 hours.

Evaporation increases during the morning (due to higher temperature & light causing stomata to open)
It pulls water molecules up the xylem because due to cohesion.
This transpiration pull creates a negative pressure (tension) in xylem.
The greater the rate of transpiration, the greater the water flow the greater the tension, and the more the
trunk shrinks

R e serv o ir fo r p u sh in g a ir b u b b le b a ck
R u b b e r sto p p er
to rig h t-h an d e n d o f cap illary tu b e
C ap illary tu b e w ith sca le
A ir bu b b le
The volume of water taken up in a given time
can be calculated using the formula πr2l
(where π = 3.142, r = radius of the capillary
tube, and l = the distance moved by the air
bubble). In an experiment the mean distance
moved by the air bubble in a capillary tube of
radius 0.5 mm during 1 min
was 15.28 mm. Calculate the rate of water
uptake in mm3 h−1. Show your working.
(3.142)(0.5 x0.5)(15.28) = 12.00244mm3
12.00244 x 60 = 720 mm3/hr
Describe how this apparatus could be used to measure the rate of water
uptake by a leafy shoot in cm3 per minute.
Measure time taken;
For bubble to move a given distance;
Calculate cross sectional area of capillary tubing;
Calculate volume of water taken up (and so lost);
Per unit time;
The potometer
This is a bubble potometer: measuring the rate of water uptake by a plant by timing how long it
takes for a bubble to move a certain distance along a capillary tube of known diameter
A mass photometer exists measuring the water loss from the plant by the change in mass over
a given time; accuracy limited by accuracy of balance used (does assume all the loss in mass is
water loss)
Potometer above assumes that all the water taken up is lost in transpiration but some will be
used in….
Photosynthesis, maintaining turgidity of cell, hydrolysis reactions, some of the water
evaporating is form respiration; some may evaporate if apparatus is not sealed
Volume of water up taken by shoot = πr2 × distance travelled (r = radius of capillary tube)
Rate of transpiration = distance moved by bubble ÷ time taken
Rate of water uptake (mm3s-1) = Speed of movement of air bubble (mm s-1) x cross-sectional
area of capillary tube (mm2)
The theory behind this is that as water evaporates from the leaves of the shoot water is moved
up the shoot due to cohesive forces and the air bubble is drawn along the capillary tube at the
same rate thus giving a measure of the transpiration rate. However, it is actually the rate of
water uptake being measured this is not the same as transpiration because….
The cross sectional area of the shoot is not as large as the area of the root hairs that normally
absorb water to supply the leaves so rate of uptake is less than transpiration.
Setting up the potometer
Cut a leafy shoot from the plant and immediately put it under water then cut a small section
from the stem again while it is under water, this prevents air getting into the xylem and breaking
the column of water.
Do not get the leaves wet as this will affect the transpiration rate.
Put the potometer under the water (freshly boiled and cooled water minimises air bubbles) and
move it from side to side to remove the air from the system then attach the leafy shoot into the
potometer under water also.
Seal all joints with water proofing substance like petroleum jelly so that any water loss is from
the leafs only
Ensure the environmental conditions don’t change around the leaves as this will heavily
influence the transpiration rate
The air bubble introduce into the capillary tube can be timed as it moves across a set distance,
thus the rate of water loss can be measured.
 Phloem structure (key components: sieve tube elements, companion cells)

Sieve tube element:

Thin cytoplasm and few organelles: reduces obstruction to flow of materials
Living tubular cells linked end to end through a sieve plate (perforations in the end wall): allows bidirectional
flow of materials
Connected to companion cells by plasmodesmata. This allows control of solutes in the sieve tube element
No lignification in the walls so thewalls are permeable to water and solutes

Companion cells:
Dense cytoplasm containing a nucleus and other organelles like ribosomes to produce enzymes and carriers,
mitochondria to produce ATP for active transport in sieve tube element.

The phloem contains a very concentrated solution of dissolved solutes, mainly sucrose, but also other sugars, amino acids, and minerals like phosphate and potassium and
also plant growth factors like auxin. This solution is called the sap, and the transport of solutes in the phloem is called translocation.

Unlike the water in the xylem, the contents of the phloem can move both up and down a plant stem, often simultaneously. It helps to identify where the sugar is being
transported from (the source: organ producing more sugar than required), and where to (the sink: organ consuming sugars for growth or storage).

• During the summer sugar is mostly transported from the leaves, where it is made by photosynthesis (the source) to the roots, where it is stored (the sink).

• During the spring, sugar is often transported from the underground root store (the source) to the growing leaf buds (the sink).

• Flowers and young buds are not photosynthetic, so sugars can also be transported from leaves or roots (the source) to flowers or buds (sinks).

The exact mechanism of translocation is not known, but is too fast to be simple diffusion. The mechanism is thought to be the mass flow of fluid up the xylem and down
the phloem, carrying dissolved solutes with it. The mass flow is driven by a combination of active transport (energy from ATP) and evaporation (energy from the sun). This
is called the mass flow theory.
How carbohydrate is moved in plants
1. As sucrose (less reactive, less liable for enzymatic breakdown)
2. Sucrose is loaded into sieve tubes by active transport involving
the companion cells
3. This lowers the water potential of the sieve tubes
4. Water enters the sieves tubes by osmosis
5. This increases the pressure in the sieve tubes
6. Fluid is moved from higher pressure at source to lower pressure
at sink
7. Low pressure at the sink is caused by the active transport of
minerals out of the sieve tubes

Evidence against this theory

Sugar travels to many different sinks.

Sieve plates are a barrier to mass flow.

Doesn't require living cells, but phloem

cells are alive
Aphid Stylet Experiments
Aphids have specialised mouthparts
called stylets, which they use to
penetrate phloem tubes and sup of the
sugary sap. If the aphids are
anaesthetised with carbon dioxide and
the body cut off so the stylet remains in
the phloem so pure phloem sap can be
collected through the stylet for
analysis, the aphid’s enzymes ensure
that the stylet doesn’t get blocked.

Analysis of the collected solution

shows it contains sucrose, showing this
travels in the phloem
Puncture Experiments
Phloem is punctured with hollow tube sap oozes out,
showing that there is high pressure inside the
phloem.
If the xylem is punctured then air is sucked in,
showing that there is low pressure (tension) inside
the xylem. This illustrates the main difference
between transport in xylem and phloem: Water is
pulled up the xylem, sap is pushed down in the
phloem.
Radioactive Tracer Experiments
Radioactive isotopes can be used to trace precisely where
different compounds are being transported from and to, and the
rate of transport.
The radioactivity can be traced using photographic film (an
autoradiograph) or a GM tube. These techniques can be used to
trace sugars, ions or even water.
In a typical experiment a plant is grown in the lab and one leaf is
exposed for a short time to carbon dioxide containing the
radioactive isotope 14C. This 14CO2 will be taken up by
photosynthesis and the 14C incorporated into glucose and then
sucrose.

The plant is then frozen in liquid nitrogen to kill and fix it

Ringing Experiments
Phloem vessels are outside the xylem vessels, they
can be removed by cutting a ring in a stem just
deep enough to cut the phloem but not the xylem.
Swelling occurs above the ring, reduced growth
below the ring and the leaves are unaffected. This
was early evidence that sugars were
transported downwards in the phloem.
quickly, and placed onto photographic film in the dark. The
resulting autoradiograph shows the location of compounds
containing 14C. was the phloem This experiment shows that
organic compounds (presumably sugars) are transported
downwards from the leaf to the roots.
More sophisticated experiments using fluorescently labelled
compounds can locate the compound specifically to the phloem
cells.
Questions
1 Humans have a closed double circulation.
a Explain the term closed double circulation. (2 marks)
b Explain why the wall of the left ventricle is thicker than the wall of the right

ventricle. (3 marks)
c The graph shows how blood pressure in different locations changes
through one cardiac cycle.

Give the number from the graph where each of these events occurs:
i atrio-ventricular valves open (1 mark)
ii semilunar valves close. (1 mark)
iii State the time in this cardiac cycle where ventricular systole begins. (1
mark)
iv Use the graph to calculate the heart rate in beats per minute. (1 mark)

2 a Describe how xylem vessels are adapted for transport of water in plants. (4 marks)
b Outline the mass flow hypothesis of transport in phloem. (4 marks)

3 a Describe how the structure of haemoglobin makes it effective in the

transport of oxygen. (4 marks)
b Tobacco smoke contains carbon monoxide, CO, which binds to
haemoglobin in place of oxygen. A heavy smoker can have haemoglobin
with 20% of the oxygen binding sites occupied by CO.
The graph shows the dissociation curves for haemoglobin with no CO and
with 20% CO.
 i Use the graph to describe the effect of CO on haemoglobin saturation.
(3 marks)
ii Use the graph to predict the effect of CO on the circulatory system of
the heavy smoker. (2 marks)
c Describe how the structure of an artery wall differs from that of a capillary
wall in relation to the functions of the two blood vessels. (3 marks)

Answers
1 a blood travels in vessels / arteries veins and capillaries (1 mark)
blood passes twice through the heart in one complete circulation
(1 mark)
b more force (1 mark)
puts blood under higher pressure (1 mark)
to overcome greater resistance (1 mark)
blood travels through whole body (1 mark)
right ventricle only pumps to lungs (1 mark)
(maximum 3 marks)
c i D (1 mark)
ii B (1 mark)
iii 0.2 s (1 mark)
iv 86 / 85.7 bpm (1 mark)

2 a hollow / no (living) contents / dead (1 mark)

long / continuous vessels (1 mark)
lignin in walls to prevent collapse (1 mark)
cellulose in wall for adhesion of water (1 mark)
b sucrose / assimilates / named assimilate loaded into sieve
element (1 mark)
(loading) by active transport (1 mark)
lowers water potential in sieve element (1 mark)
water moves in by osmosis (1 mark)
raising pressure at source (1 mark)
mass flow from source to sink (1 mark)
 pressure lower due to unloading at sink (1 mark)
(maximum 4 marks)

3 a quaternary structure (1 mark)

haem groups bind oxygen (1 mark)
four polypeptide chains so four haem groups (1 mark)
one haemoglobin molecule can bind 4 oxygen molecules / 8
oxygen atoms (1 mark)
reference to allosteric effect / cooperative binding (1 mark)
reference Bohr effect / oxygen release on binding hydrogen ions
(1 mark)
(maximum 4 marks)
b i (CO causes) decrease in maximum saturation (1 mark)
at low partial pressure CO increases saturation (1 mark)
correct data quote e.g. without CO saturation  98% with CO 
78% (1 mark)
ii CO reduces oxygen carrying capacity of blood / haemoglobin
(1 mark)
less oxygen reaching tissues (1 mark)
so heart beats faster (1 mark)
increase in blood pressure (1 mark)
correctly named consequence e.g. heart attack / stroke (1
mark)
c artery has muscle (1 mark)
artery has elastic tissue (1 mark)
to withstand pressure (1 mark)
capillary only one cell thick (1 mark)
with pores for exchange (1 mark)
(maximum 3 marks)

Specification

In prokaryotic cells, DNA molecules are short, circular and not associated with proteins.

In the nucleus of eukaryotic cells, DNA molecules are very long, linear and associated with proteins,
called histones. Together a DNA molecule and its associated proteins form a chromosome.

The mitochondria and chloroplasts of eukaryotic cells also contain DNA which, like the DNA of
prokaryotes, is short, circular and not associated with protein.

A gene is a base sequence of DNA that codes for:

•• the amino acid sequence of a polypeptide
•• a functional RNA (including ribosomal RNA and tRNAs).

A gene occupies a fixed position, called a locus, on a particular DNA molecule.

A sequence of three DNA bases, called a triplet, codes for a specific amino acid. The genetic code is
universal, non-overlapping and degenerate.
In eukaryotes, much of the nuclear DNA does not code for polypeptides. There are, for example,
non-coding multiple repeats of base sequences between genes. Even within a gene only some
sequences, called exons, code for amino acid sequences. Within the gene, these exons are separated
by one or more non-coding sequences, called introns.

Previous knowledge

Define
 Gene
 Allele
 Mutation
Explain how DNA is responsible for the structure of proteins
Structure of DNA/nucleotides……………….DNA structure for function
Define a polymer

Practicals
 Genetic terms

Gene: ...................................................................................................................................
...................................................................................................................................

Locus: ...................................................................................................................................
...................................................................................................................................

Allele: ...................................................................................................................................
...................................................................................................................................

Non-overlapping (genetic code): ...........................................................................................

...................................................................................................................................

Degenerate (genetic code): ..................................................................................................

...................................................................................................................................

Eukaryotic: ...................................................................................................................................
...................................................................................................................................

Prokaryotic: ...................................................................................................................................
...................................................................................................................................

Introns: ...................................................................................................................................
...................................................................................................................................

Exons: ...................................................................................................................................
...................................................................................................................................

Codon: ...................................................................................................................................
...................................................................................................................................

Key fact to learn

Eukaryotic and prokaryotic DNA is different because……

Eukaryotic DNA
Eukaryotic DNA Is associated with histone proteins, prokaryotic DNA is not
Eukaryotic DNA has introns, prokaryotic DNA does not
Eukaryotic DNA is linear, prokaryotic DNA is circular.

DNA + histone proteins = Chromosome

Mitochondria and Chloroplasts contain short, circular DNA not associated with proteins, like that of prokaryotic
cells. They also contain 70s ribosomes that are found in prokaryotic cells.

What is the advantage of the DNA and ribosomes???

Synthesise enzymes for respiration/photosynthesis

What else does this suggest? Look up endosymbiosis for some personal learning
Eukaryotic cells evolved from prokaryotic cells
Describe the molecular structure of DNA
Polymer of nucleotides, formed by condensation reactions between the phosphate
of one nucleotide and the sugar of another nucleotide. This creates a strong sugar
phosphate backbone held by phosphodiester bonds
Nucleotides consist of deoxyribose (pentose) sugar, phosphate and nitrogenous
base
There are 4 possible bases in DNA, Adenine, Thymine, Cytosine, Guanine
These bases are either purines, (double ring structures) like A and G or pyrimidines,
(single ring structures) like T and C
They show complimentary base pairing where
AT always pair held by 2 H-bonds
CG always pair held by 3 H-bonds
Double stranded, with the strands running antiparallel

Describe how the structure of DNA is related to its function

1. Sugar-phosphate backbone: provides stability & protects bases
2. Double stranded: replication can occur semi-conservatively where each strand
can act as template making replication more accurate
3. Complementary base pairing (A-T and G-C) makes replication more accurate
4. Individual hydrogen bonds are weak: easily unzip DNA for replication
5. Many hydrogen bonds in the DNA molecule: stable
6. Long molecule: can store lots of information
7. Helix/coiled: compact;
Describe the features of a gene
Gene is a short (length) of DNA;
Gene is a sequence of bases/chain of nucleotides;
Triplet (base) code (codon)
On sense/coding strand;
Each triplet coding for amino acid;
Degenerate code, where most amino acids have more than one codon. Of
the 64 codons 1 is a start (methionine, which is often removed) and 3 are Genome: the complete set of genes in a cell
stop codes

Non-overlapping where each base is part of one codon

Proteome: full range of proteins a cell can produce
Sequence of triplets/bases code for protein
Genetics quick test 1
1. What do the terms locus/loci refer to on chromosomes
2. What is a homologous pair of chromosomes?
3. What is an allele?
4. What are introns?
5. What are exons?
6. What does diploid mean
7. What does haploid mean
8. What is the function of the histone proteins in DNA?
9. How are complimentary base pairs held together?
10. What are the base pairs?
11. What is the difference between a purine and pyrimidine base
12. How many codons are there?
13. What do these codons mean?
14. How many amino acids are there?
15. What is a codon?
16. How does eukaryotic and prokaryotic DNA differ?
17. What is a gene?
18. What is a mutation?
19. How can a mutation result in a non-functioning enzyme?
20. What are possible types of mutations?
21.What are mutagens and give some examples?
22.What does it mean to say the genetic code is degenerate?
23.What does it mean that the genetic code is non-overlapping?
Answers
1. What do the terms locus/loci refer to on chromosomes: the position of a gene on a chromosome
2. What is a homologous pair of chromosomes? Two chromosomes of the same size and shape, one
originating from each parent. They contain the same genes, but may have different alleles.
3. What is an allele? Alternate form of a gene, red hair, blonde hair, black hair
4. What are introns? Non-coding regions of DNA within a gene are called introns
5. What are exons? While the coding parts of DNA are called exons
6. What does diploid mean? A cell consisting of 2 sets of chromosomes
7. What does haploid mean? A cell consisting of one set of chromosomes
8. What is the function of the histone proteins in DNA? Allow coiling of the DNA (forming
chromatin) so it can fit in nucleus
9. How are complimentary base pairs held together? H-bonds
10. What are the base pairs? AT/CG in DNA AU/CG in RNA
11. What is the difference between a purine and pyrimidine base? Purines are double ring structures
(A and G) while pyrimidine’s are single rings (T, C, U)
12. How many codons are there? 64
13. What do these codons mean? Correspond to amino acids, most amino acids have more than one
codon, one codon is a start codon and also codes for methionine there are also three stop
codons
14. How many amino acids are there? 20
15. What is a codon? A triplet of bases that codes for a particular amino acid
16. How does eukaryotic DNA differ to prokaryotic: larger, linear, associated with histone proteins
17. What is a gene? A short section of DNA, a sequence of bases that determines a particular
arrangement of amino acids during polypeptide synthesis
18. What is a mutation? A change in a gene
19. How can a mutation result in a non-functioning enzyme? Change base sequence, change the
codon, thus changing the amino acid sequence in primary structure, this changes folding in
secondary, but more importantly tertiary structure and may result in an active site that is no
longer complimentary to the substrate so enzyme-substrate complexes cannot form.
20. What are possible types of mutations? Substitution, deletion, addition
21. What are mutagens and give some examples? X-rays, Benzene, Uranium, Gamma Rays, UV light, high
energy radiation
22. What does it mean to say the genetic code is degenerate? More than one codon for most amino
acids
23. What does it mean that the genetic code is non-overlapping? Each base is part of only one codon
Specification
The concept of the genome as the complete set of genes in a cell and of the proteome as the full range
of proteins that a cell is able to produce.

The structure of molecules of messenger RNA (mRNA) and of transfer RNA (tRNA).

Transcription as the production of mRNA from DNA. The role of RNA polymerase in joining mRNA
nucleotides.

•• In prokaryotes, transcription results directly in the production of mRNA from DNA.

•• In eukaryotes, transcription results in the production of pre-mRNA; this is then spliced to form
mRNA.

Translation as the production of polypeptides from the sequence of codons carried by mRNA. The
roles of ribosomes, tRNA and ATP.

Students should be able to:

•• relate the base sequence of nucleic acids to the amino acid sequence of polypeptides, when
provided with suitable data about the genetic code

•• interpret data from experimental work investigating the role of nucleic acids.

Students will not be required to recall in written papers specific codons and the amino acids for which
they code.

Previous knowledge
The role of ribosomes
How replication occurs in DNA
Structure of DNA and the function of these structures
What introns and exons are?
What a codon is
What it means to say the genetic code is non-overlapping and degenerate

Biofact sheets: 22 & 49

RNA
RNA is a nucleic acid like DNA, but with 4 differences:
RNA has the sugar ribose instead of deoxyribose
RNA has the base uracil instead of thymine
RNA is usually single stranded, but can fold into 3-dimentional structures, like proteins.
RNA is usually shorter than DNA

Messenger RNA (mRNA)

mRNA carries the "message" that codes for a particular protein from the nucleus (where the
DNA master copy is) to the cytoplasm (where proteins are synthesised). It is single stranded
and just long enough to contain one gene only. It has a short lifetime and is degraded soon
after it is used.

Ribosomal RNA (rRNA)

rRNA, together with proteins, form ribosomes, which are the site of mRNA translation and
protein synthesis. Ribosomes have two subunits, small and large, and are assembled in the
nucleolus of the nucleus and exported into the cytoplasm. rRNA is coded for by numerous
genes in many different chromosomes. Ribosomes free in the cytoplasm make proteins for
use in the cell, while those attached to the RER make proteins for export.

Transfer RNA (tRNA)

tRNA is an “adapter” that matches amino acids to their codon. tRNA is only about 80
nucleotides long, and it folds up by complementary base pairing to form a looped clover-leaf
structure. At one end of the molecule there is always the base seqence ACC, where the
amino
acid binds. On the middle loop there is a triplet nucleotide sequence called the anticodon.
There are 64 different tRNA molecules, each with a different anticodon sequence
complementary to the 64 different codons. The amino acids are attached to their tRNA
molecule by specific aminoacyl tRNA synthase enzymes. These are highly specific, so that
each amino acid is attached to a tRNA adapter with the appropriate anticodon.
Compare tRNA vs mRNA Compare DNA Vs RNA Compare the structures of RNA and DNA;
1) tRNA Similarities: Alike
Clover shaped Contain phosphate both have phosphate/phosphoric acid/PO4;
Standard length Made up of nucleotides bases/named bases/accept letters;
Has an amino acid binding site Contains organic bases (A, C and G) (not T as it is replaced by U in nucleotides;
Anticodon RNA) pentose sugar;
tRNA has H bonds between complementary base pairs Pentose sugar Different
Limited number of types (64) Differences DNA deoxyribose;
RNA single stranded DNA thymine;
2) mRNA RNA has non-coding strands (introns) removed DNA double stranded;
Linear Ribose sugar in RNA deoxyribose in DNA DNA larger/longer;
Variable length (depends on the length of gene) U in ribose replaces the T DNA one form RNA 3 types;
Many different types (depends on the gene) 3 types of RNA, only one DNA
No H-bonding Smaller than DNA
No base pairs
 Transcription
Production of mRNA from DNA

Transcription (DNA  mRNA)

The start of each gene is marked by a promoter (sequence of bases)
Section of DNA unzips (H-bonds break, DNA helicase)
Free RNA nucleotides line up to complementary bases on the antisense strand
U replaces T in mRNA
RNA polymerase joins the nucleotides
Pre mRNA strand is formed
Pre mRNA is modified, introns removed, exons spliced by enzymes
Mature mRNA leaves the nucleus

Comparison of replication and transcription

Similarities
H bonds break and the DNA unzips
DNA acts as a template for complimentary base
Polymerase enzymes are involved
Differences
U replaces T in RNA
In replication all the DNA is copied, in transcription on sections are copied
•In prokaryotes, transcription directly produces mRNA from DNA. Only one strand is used as a template in transcription (antisense strand), both strands
are used in replication
•In eukaryotes, transcription produces pre-mRNA this is then spliced to RNA polymerase in transcription whereas DNA polymerase is used in replication
form mRNA which has the introns removed and contains only exons. mRNA is produced in transcription, DNA is produced in replication
Translation: production of polypeptides from the sequence of codons carried by mRNA

Mature mRNA moves into cytoplasm through a nuclear pore and to the ribosome here translation occurs;
Each tRNA carries specific amino acid;
mRNA is read in codons (base triplets);
the anticodon of tRNA that is complimentary to the codon of mRNA form base pairs;
A second tRNA with a complimentary anticodon binds to the next codon
ATP used in joining amino acids in condensation polymerisation;
amino acids join by peptide bonds;
tRNA used repeatedly;
the sequence of bases in mRNA determines sequence of amino acids in the polypeptide
Three important things

1. Most amino acids have more than one

codon. In this codon only the first 2 bases
are crucial, the third can change, degeneracy
exists in the 3rd base, building in some
tolerance for mutations in the code. Where
a base change (substitution mutation) still
results in a codon for the same amino acid

2. There are three stop codons, they do not

code for amino acids

3. Methionine codon is a start codon also. This

means that newly synthesised polypeptides
will start with methionine, this is often
removed in processing.
Teacher answers

Q. Complete the table to

show the codes at the
various stages in the
protein synthesis
process

Q. What would be the order of nucleotides in the mRNA produced by this DNA strand?

ACGATTGTGCACGAG
___________________

Q. A polypeptide consists of 145 amino acids. 14 amino acids are in its structure
How many base pairs must there be in the gene for this polypeptide?
How many nucleotides are there in the mRNA transcribed from this gene?
How many different types of tRNA are needed to synthesise this protein?

Q. Look at the table on the previous page giving the mRNA codons for the various amino acids. A
section of mRNA has the following sequence AAG CGC UCU GCA, what will be the order of amino
acids in the polypeptide: Lysine, Arginine, Serine, Alanine

Q. What would the DNA codons have been to generate this mRNA strand? TTC GCG AGA CGT

Q. What anticodons will attach to this sequence of mRNA? UUC GCG AGA CGU
 Q. Complete the table to
show the codes at the
various stages in the
protein synthesis
process

Q. What would be the order of nucleotides in the mRNA produced by this DNA strand?

ACGATTGTGCACGAG
UGCUAACACGUGCUC

Q. A polypeptide consists of 145 amino acids. 14 amino acids are in its structure
How many base pairs must there be in the gene for this polypeptide? 435
How many nucleotides are there in the mRNA transcribed from this gene? 435
How many different types of tRNA are needed to synthesise this protein? 14

Q. Look at the table on the previous page giving the mRNA codons for the various amino acids. A
section of mRNA has the following sequence AAG CGC UCU GCA, what will be the order of amino
acids in the polypeptide

Q. What would the DNA codons have been to generate this mRNA strand

Q. What anticodons will attach to this sequence of mRNA

Questions
1 a State two similarities between the DNA in mitochondria and the DNA in a prokaryotic
cell. (2 marks)

b There are 20 amino acids and four DNA bases. Explain why amino acids need to be
coded by triplets of three bases. (1 mark)

c The DNA triplets for three different amino acids are shown. Write the sequence of
bases that would be present on the tRNA anticodon for each of them.
C C G T A G G T C (3 marks)

d A polypeptide has 120 amino acids. Calculate the minimum number of bases on an
mRNA molecule required to code for this polypeptide. (1 mark)

2 a Name the stages represented by the letters X and Y below:

b Define the terms:

i gene (1 mark)
ii chromosome. (1 mark)

c Describe the role of tRNA in protein synthesis. (3 marks)

d Give the meaning of the following terms in the context of the genetic code:
i redundant (1 mark)
ii universal. (1 mark)

3 a Name the two biological molecules contained in chromosomes. (2 marks)

b Pre-mRNA is formed in the nucleus. Sequences can be cut out from pre-mRNA.
i Name this process. (1 mark)
ii Give the name for the sequences which are cut out. (1 mark)

c The diagram shows part of the translation process at a ribosome.

Use the diagram and the table to answer the following questions.
i Give the sequence of the anticodon on the tRNA leaving the ribosome. (1 mark)

ii Name the amino acid represented by AA3. (1 mark)

iii Predict the next amino acid in the sequence after AA3. (1 mark)

iv The polypeptide in the diagram will be complete after the 45th amino acid.
Mutation is a change in a nucleic acid sequence.
State and explain the consequence of a mutation changing the U G C codon to U G A.
(2 marks)

Answers
1 a circular (1 mark)
not associated with histones / protein / does not exist as a
chromosome (1 mark)
b three is the minimum number to give enough combinations
or
two would give enough for 16 but three gives 64 combinations (1
mark)
c C C G (1 mark)
U A G (1 mark)
G U C (1 mark)
d (120  3  ) 360 (1 mark)

2 a X  transcription (1 mark)
Y  translation (1 mark)
b i a sequence of nucleotides coding for a polypeptide / protein(1
mark)
ii a DNA molecule wound around / associated with histone
proteins (1 mark)
c brings specific amino acid (1 mark)
(amino acid brought) to ribosome (1 mark)
amino acid specified by anticodon (1 mark)
anticodon forms complementary base pairs with codon (1 mark)
holds amino acid in place for peptide bond formation (1 mark)
can be re-used to get another amino acid (1 mark)
maximum 3 marks
d i some amino acids coded by more than one codon
or
64 codons but only 20 amino acids (1 mark)
ii same code used in all organisms (and viruses) (1 mark)

3 a DNA (1 mark)
histone(s) (1 mark)
b i splicing (1 mark)
ii introns (1 mark)
c i CCU (1 mark)
iiproline (1 mark)
iii
cysteine (1 mark)
iv(becomes a) stop codon (1 mark)
translation will stop / polypeptide will be incomplete / only
have 3 amino acids (1 mark)
 Specification Biofact sheets: 76 & 237 & 94

Gene mutations involve a change in the base sequence of chromosomes. They can arise
spontaneously during DNA replication and include base deletion and base substitution. Due to the
degenerate nature of the genetic code, not all base substitutions cause a change in the sequence of
encoded amino acids. Mutagenic agents can increase the rate of gene mutation.

Mutations in the number of chromosomes can arise spontaneously by chromosome non-disjunction

during meiosis.

Meiosis produces daughter cells that are genetically different from each other.

The process of meiosis only in sufficient detail to show how:

• Two nuclear divisions result usually in the formation of four haploid daughter cells from a single
diploid parent cell
• Genetically different daughter cells result from the independent segregation of homologous
chromosomes
• Crossing over between homologous chromosomes results in further genetic variation among
daughter cells.

Students should be able to:

• complete diagrams showing the chromosome content of cells after the first and second meiotic
division, when given the chromosome content of the parent cell

• explain the different outcome of mitosis and meiosis

• recognise where meiosis occurs when given information about an unfamiliar life cycle
• explain how random fertilisation of haploid gametes further increases genetic variation within a
species.

Previous knowledge
Explain what a mutation is
Outline the key steps in meiosis
Explain the steps in the cell cycle (IPMAT)
Explain the key steps in mitosis
Stages in polypeptide formation, primary, secondary, tertiary structure
Mutagens/mutagenic agents
What diploid and haploid means

Write a short explanation of meiosis

2 nuclear divisions, producing four genetically unique haploid daughter cells. It is important as it halves the
chromosome number ensuring that in fertilisation the diploid number is restored. It creates genetic variation in
sexual reproduction and produces gametes

Write a short explanation of mitosis

1 nuclear division producing 2 genetically identical diploid daughter cells. It maintains the chromosome number, it
ensures all cells have the same genetic information and is important for growth and repair.
Mutations: change s in the order or quantity of DNA The genetic code is a blue print for the ribosomes on how to build proteins, when they
read it, in its normal state it make sense and the build functioning proteins.
They can occur as
Imagine that the original genetic code read like the following sentence. It makes sense
Substitutions: where one base is swapped for another

Additions: base(s) are added to the gene sequence, causing a frame shift

Deletions: base(s) are lost form the gene sequence, causing a frame shift THE WEE
SAD LAD
Other types of mutations can be inversion or duplication

Addition: as the genetic code is non-

THE WEE X SAW HIS overlapping, each base can be part of

only one codon. Downstream from the
addition (X) a frame shift occurs to the

THE
SAD LAD OLD DAD right, the genetic code no longer
makes any sense, and the resulting
protein would not work properly

SAW
WEE HIS
OLD DAD Deletion occurs: again a frame shift occurs

XSA DLA
TH_ WEE (to the left) due to the non-overlapping
nature of the code, and again the code make

THW EES ADL ADS AWH ISO LDD AD

no sense
SAD
DSALAD
SAW HIS
WHI Substitution: this affects only one codon in
the chain, and may only change one amino
OLD DAD
THE WEE
acid

THESOL
WEE SAD LAD SAQ HIS OLD DAD
SAD LAD
DDAHIS
SAW D
OLD DAD
A closer look at mutations and their classification
DNA base sequence determines the mRNA sequence; this determines the order of
amino acids assembled at the ribosomes. The primary structure determine how H-
bonds form between the amino acids during folding for the secondary structure,
further folding then ensues to form the tertiary structure of the protein. Mutations
impact mostly on tertiary structure. As secondary folding is between carboxyl and
hydroxyl groups which all amino acids have. Tertiary structure and protein function
involves the R groups which can differ significantly.

Silent mutations: Do not result in a change to the amino acid sequence of a protein.
They may occur in a non-coding region (outside of a gene or within an intron),
They may occur within an exon in a manner that does not alter the final amino acid
sequence. This happens when the change is on the third base of a codon, due to the
degeneracy of the genetic code, most amino acids have more than one codon,
differing only in the third base. So the genetic code is more likely to tolerate
mutations in the third base.

Alters the codon so that when it is transcribed a different amino acid will be put in
place. This can have a big effect if the amino acid is crucial to the bonding in folding
of the protein or if it acts as a part of the active site of an enzyme. However, if an
amino acid with similar properties is coded for, or the amino acid was not involved in
the tertiary folding of the chain or the functioning of the enzyme, then it may not be
a serious mutation, the protein may still function

With a nonsense mutation, the new nucleotide changes a codon that specified an
amino acid to one of the STOP codons (TAA, TAG, or TGA). Therefore, translation of
the messenger RNA transcribed from this mutant gene will stop prematurely. The
earlier in the gene that this occurs, the more truncated the protein product and the
more likely that it will be unable to function.

This is caused by addition or deletion of bases. Changes the way the codons are read
(causes a frame shift) and as such changes the primary sequence of amino acids. This
will affect the folding of the protein and may result in a non-functioning protein. CFTR
protein in cystic fibrosis is a result of deletion of one codon
Mutation Rates and Mutagens

Mutations are normally very rare, which is why members of a species all look alike and can interbreed. However the rate of mutations is increased by
chemicals or by radiation. These are called mutagenic agents or mutagens, and include:

High energy ionising radiation such as x-rays, ultraviolet rays, , , or rays from radioactive sources. These ionise the bases so that they don't form the
correct base pairs.

Intercalating chemicals such as mustard gas (used in World War 1), which bind to DNA separating the two strands.

Chemicals that react with the DNA bases such as benzene, nitrous acid, and tar in cigarette smoke.

Viruses. Some viruses can change the base sequence in DNA causing genetic disease and cancer. During the Earth's early history there were far more of
these mutagens than there are now, so the mutation rate would have been much higher than now, leading to a greater diversity of life. Some of these
mutagens are used today in research, to kill microbes or in warfare. They are often carcinogens since a common result of a mutation is cancer.

The cell cycle
Interphase
Increased in volume of cell
Increase in number of
organelles;
Protein synthesis
DNA replication (S phase)
chromosomes become
chromatids
ATP synthesis
The cell cycle is divided into several stages
Interphase: consisting of the G1, S and G2 phases
This takes up about 90% of the cell cycle
The remaining 10% is the mitotic phase (IPMAT). There are some
distinct activities that can be attributed to the various parts of the
mitotic phase. These are outlined below
Prophase Metaphase Anaphase Telophase
chromosomes
condense; become Chromosomes move to Chromatids separate Chromosomes uncoil
visible equator or centre of cell / (centromeres divide)
attach to spindle; move to poles of cell as New nuclear membrane
forms
spindle fibres contract
 The importance of meiosis: Meiosis halves the number of chromosomes (formation of haploid gametes, eggs and sperm) Restoration of
diploid number at fertilisation; Introduces genetic variation;

A second possible permutation to

The stages of meiosis I illustrate independent assortment

ProI Synapsis & MetI

Crossing over

Cell 1

Cell 2 AnaI
TelI
 The stages of meiosis II

Cell 1

PII MII AII

TII
Independent assortment/segregation is important to provide

Genetic variation
Because homologous chromosomes pairs arrange randomly at
equator/middle of cell
So different combinations of maternal and paternal chromosomes and
the alleles they possess are passed into daughter cells (maternal and
paternal chromosomes are shuffled);

This occurs in meiosis I & II

2n possible permutations for independent assortment.

Where n=haploid number for organism
 Non-disjunction

Is the failure of homologous chromosomes or sister

chromatids to separate properly during cell division.

Most cases of aneuploidy (abnormal chromosome

numbers in a cell) are attributed to female meiotic
process than males

More common as women age

Down syndrome: result of an extra number 21 chromosome. Children with this condition can have
heart defects, short stature, susceptibility to respiratory disease, reduced life span and increased risk
of Alzheimer’s and leukaemia. This is caused by non-disjunction in the fathers chromosome.

Patau Syndrome: extra number 13 chromosome. Symptoms of this condition are eye, brain and
circulatory defects and cleft palate

Edwards’s Syndrome: extra number 18 chromosome. Affects most organ systems

Klinefelter syndrome: (XXY): sterile males with more feminine body characteristics than normal
: (XYY): taller than average, less than average intelligence
Trisomy X (XXX): no obvious effects
Monosomy (X): genetically female but do not mature sexually at puberty and are sterile
Questions
1 What is the possible number of combinations that could be made
from
a 6 pairs (1 mark)
b 8 pairs (1 mark)
c 15 pairs. (1 mark)
2 How many possible combinations of chromosomes could be made from
gametes with
a 3 chromosomes (1 mark)
b 9 chromosomes (1 mark)
c 23 chromosomes. (1 mark)

3 An organism has five pairs of chromosomes (2n =10). Assuming no crossing over
occurs.
a What is the number of possible gametes that can be made by
meiosis? (2 marks)
b What is the number of possible zygotes that can be produced by
a random mating? (1 mark)

4 Human beings have a diploid number 2n = 46.

a What is the possible number of different chromosome
combinations in each gamete? (2 marks)
b What is the number of possible zygotes that can be produced by
a random mating? (1 mark)

5 A horse has a diploid number 2n = 64, while a donkey has 2n = 62.

a Assuming no crossing over occurs, how many different gametes
could be made by each animal? (1 mark)
b How many chromosome combinations would be possible in the
offspring? (1 mark)

Answers
1 a 64 b 256 c 32 768 (1 mark each)
2 a 9 b 81 c 529 (1 mark each)
3 a 32 (allow one mark for correct workings; one mark for the correct answer)
b 1024(1 mark)
4 a 8388608 (allow one mark for correct workings; one mark for the correct answer)
b 7.04  1013. (1 mark)
5 a A horse gives 4.3  10 and a donkey gives 2.2  10 .
9 9
(1 mark)
b 9.5  1018 (1 mark)
Specification

Genetic diversity as the number of different alleles of genes in a population.

Genetic diversity is a factor enabling natural selection to occur.

The principles of natural selection in the evolution of populations.

• Random mutation can result in new alleles of a gene.
• Many mutations are harmful but, in certain environments, the new allele of a gene might
benefit its possessor, leading to increased reproductive success.
• The advantageous allele is inherited by members of the next generation.
• As a result, over many generations, the new allele increases in frequency in the
population.

Directional selection, exemplified by antibiotic resistance in bacteria, and stabilising

selection, exemplified by human birth weights.

Natural selection results in species that are better adapted to their environment. These
adaptations may be anatomical, physiological or behavioural.

Students should be able to:

• use unfamiliar information to explain how selection produces changes within a population
of a species
• interpret data relating to the effect of selection in producing change within populations
• Show understanding that adaptation and selection are major factors in evolution and
contribute to the diversity of living organisms.

Previous knowledge
Explain the terms, mutation, allele, gene,
Understand different types of mutations
Explain how mutations affect protein structure (tertiary development)
Explain how natural selection occurs (using Darwin’s theory)
Explain the steps in speciation
Define a species
Define speciation

Practical work
Aseptic techniques to investigate the effect of antimicrobial substances on microbial
growth.

Biofact sheets: 44 & 142 & 103

 How would Darwin explain how a Giraffe with a long neck evolved from a shorter
neck ancestor?

The vole is a small, mouse-like animal. Voles found on some cold

islands are much larger than voles found in warmer areas.
Explain how natural selection may have caused the northern
voles to be larger in size. (5)
Types of selection
 Stabilising selection

This occurs when the environment doesn't change. Natural selection doesn't
have to cause change, and if an environment doesn't change there is no
y. There is pressure for a well-adapted species to change. Fossils suggest that many
he species remain unchanged for long periods of geological time.

Bacterial resistance to antibiotics, an example of direction selection

Antibiotics kill bacteria, but occasionally a chance mutant appears that is resistant to
that antibiotic. In an environment where the antibiotic is often present, this mutant
has an enormous selective advantage since all the normal (wild type) bacteria are
killed leaving the mutant cell free to reproduce and colonise the whole environment
without any competition. Some farmers routinely feed antibiotics to their animals to
uptive selection prevent infection, but this is a perfect environment for resistant bacteria to thrive.
The best solution is to stop using the antibiotic so that the resistant strain has no
occurs where an environment changes to become two close but distinct environments.
selective advantage, and may die out.
Birth mass of babies as an example of stabilising selection
It is harmful for an infant to be born with a very low birth weight. They are much
more vulnerable to heat loss due to their high surface area to volume ratio and
consequently their respiratory demands are very high. Pre-term babies (which
account for 67% of low-birthweight infants(1)) are particularly susceptible to
respiratory problems (lack of surfactant in the lungs), cardiac problems (Patent
ductus arteriosus - the lungs are still bypassed when the umbilical cord has
been cut) and dangerous intestinal problems (Necrotizing enterocolitis)
amongst many other conditions can all be fatal and are reflected in high
mortality rates at these low birth rates. It is therefore not beneficial to be on
the extremes of birth weight.

Similarly, delivering a child of too high birth weight can cause complications
with delivery if the head and shoulders are too wide to pass through the
mother's hips. Therefore the other extreme of high birth rate is also not
Specification
Two organisms belong to the same species if they are able to produce fertile offspring. Courtship
behaviour as a necessary precursor to successful mating. The role of courtship in species recognition.

A phylogenetic classification system attempts to arrange species into groups based on their
evolutionary origins and relationships. It uses a hierarchy in which smaller groups are placed within
larger groups, with no overlap between groups. Each group is called a taxon (plural taxa).

One hierarchy comprises the taxa: domain, kingdom, phylum, class, order, family, genus and species.

Each species is universally identified by a binomial consisting of the name of its genus and species,
eg, Homo sapiens.

Recall of different taxonomic systems, such as the three domain or five kingdom systems, will not be
required.

Students should be able to appreciate that advances in immunology and genome sequencing help to
clarify evolutionary relationships between organisms.

Previous knowledge
Definition of a species

Biofact sheets: 91 & 170

Courtship

Innate behaviour: Species specific

Courtship involves sign stimuli (usually specific external stimuli like, sound, scent, colour, movements)
The purpose is to make breeding more successful because it allows

 Recognition of members of your own species is possible

 Attracts opposite sex
 Reduces aggression
 It can be an indicator of health/fitness (survival of fittest)
 Identification of sexually mature members of species, or those receptive to reproduction (‘in
heat’)
 Formation of pair bonds (not always) where parents mate for life and work together to raise
young

The courtship process is a ritual relaying on a call and response type of behaviour, in other words…….
The male may perform a specific sign stimulus
This will elicit a response from the female that encourages a further action from the male
The process repeats in the ‘stimulus response chain’

If at any point appropriate responses are not performed then the courtship ritual stops

How have elaborate courtship rituals/displays evolved

Best display/grandest colours are most attractive to
These individuals breed
Pass on alleles for this characteristic

Courtship can be used in classification as it is species specific. Species with similar rituals suggests they are
more closely related to each other.

Duck A and B are same species as they have the same ritual, duck C is only a closely related species
as it is only missing one element of the ritual. F displays quite a different sequence of behaviour and
so is a more distant relative of A.
 Classification/Taxonomy

The art of arranging organisms into groups based on similarities and differences. There are a few
classification systems in use.

The most common system is a hierarchical system.

A hierarchy is defined as

Groups within groups with no overlap between the groups.

Meaning the largest group is the

Kingdom (animal, plant)

Within this the animal kingdom there is the phylum, vertebrates and invertebrate,

Within the vertebrates there are classes, fish, mammals, reptiles, amphibians.

Within the mammals there are orders

This is further divided in to family

Genus and species

K As you move down the hierarchy the

P
__________
groups get smaller and the
similarities between the organisms
increases
__________
C All organisms are assigned a binomial
name which consists of the

__________
O Genus + Species
F
__________
__________
G
__________
S
__________
King kingdom (animal, plant, fungi, protest, moneran)
Phillip Phylum (chordate, arthropod, mollusc,
Came Class (mammal, bird, reptile)
Over Order (carnivore, primate, rodents)
From Family (Canidae: dogs, Felidae: cats, hominidae)
Germany Genus (Acinonyx: cheetah Panthera: lion, tiger)
Swimming  Species (Panthera leo (lion), Panthera tigris (tiger)

The cheetah, Acinonyx

jubatus, and other cat
species belong to the family
Felidae. Complete the table
to show the classification of
the cheetah.
The bobcat and lion share the same
Kingdom: animals Phylum: chordata Class: mammals Order: carnivores Family: felidae

But they belong to a different genus. So they are very closely related as they share so many groups within the
hierarchy, meaning that they have many similar charcateristics.
Bobcat’s binomial name: Lynx Rufus
Lions binomial name: Panthera leo
 Phylogenetics

Studying the evolutionary history of groups of organisms to determine

the point of divergence form a common ancestor.

The theory of evolution suggest that all organisms evolved from simpler
organisms

This reflects classification because members of a particular group (genus)

must be more closely related to each other than they are to organisms in
other groups.

Members of the Hominidae family (great apes and humans) evolved from a common ancestor. First
orang-utans diverged from the common ancestor, followed by gorillas and then humans closely
followed by bonobos and chimp.

Humans and chimps are closely related as they diverged recently. You can see their branches are close
together. Humans and orang-utans are distantly related, diverged longer ago.
Classification can have problems like

Inability to observe reproductive behaviour of living species, of extinct species, of those that
reproduce asexually.

Because of some of the limitations of observable features, behaviour scientists will use molecular
techniques to determine the relationship between organisms

Molecular classification techniques

Some examples of this are discussed below

1) DNA sequencing and comparisons: comparing the base sequences for specific genes in
organisms

Table showing the % similarity of DNA between different

species

Species A and B have a higher similarity than with C or D. A

and B are more closely related

As over time DNA changes, so a smaller difference, means

fewer changes thus the DNA has not had as much time to
change

2) A second way of comparing base sequences

a. ATTGTCTGATTGGTGCTAGTCGTCGATGCTAGGATCG
b. ATTGTATGATTGGTGCTAGTCGGCGATGCTAGGATCG
c. ATTGTTAGATTGAAACTAATCGACGAATATAGGAGTC
There are 13 differences between species a & c and only 2 between species a & b, suggesting
species a & b are more closely related.

3) DNA sequencing is difficult, so we can compare

amino acid sequences in proteins given that
the DNA sequence determines the order of
amino acids in a protein.

No difference sin chimp and humans, suggesting a recent

divergence form a common ancestor. More differences
between human and horse suggesting a more distant
evolutionary relationship.
 DNA hybridisation
DNA samples from different species are
heated

This breaks the H-bonds between

complimentary bases separating the strand

One set of strands are labelled for

identification

Separated strands from different species

are mixed and allowed to cool

The strands will anneal where H-bonds

reform.

The hybrids are separated and heated and

the temperature required to separate the
hybrids is recorded
Immunological comparisons. A proteins form the species we are
interested in is removed, so here it would be species A. this is injected
into a host and antibodies are produced for all antigen binding sites on
The more similar the DNA
the protein.
The more complimentary base pairings there were in
The antibodies are removed
the strands from different species
The same protein is removed from the remaining species and put into
The more H-bonds that formed
test tubes
The greater he temperature required to separate the
The antibody is added and the degree of precipitation is measured.
hybrid
A high precipitation means many similar antigens and thus the DNA
A low separation temperature suggests a distant
which determines the shape of these antigens must be more similar
evolutionary relationship, as there were few H-bonds
and thus the base sequences were very different.
Evolutionary relationships between different primates can be found by comparing their proteins and
DNA. All primates produce a species-specific type of haemoglobin. An antibody against human
haemoglobin could be used to compare the evolutionary relationships between different primates.
Describe and explain how. (3)

............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................

Scientists used DNA hybridisation to determine the evolutionary relationships between five species of
primate. The temperature at which a molecule of double-stranded DNA separates into two single
strands is the separation temperature.
The scientists recorded the mean separation temperature of DNA in which both strands were from the
same species. The scientists then recorded the mean decrease in separation temperature of DNA in
which one of the strands was from another species.

These data suggest that gibbons are the most distantly related to humans. Explain how. (2)
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................

There were differences in separation temperature of DNA formed from single-stranded DNA of the
same species of primate. Suggest why. (1)

............................................................................................................................................
............................................................................................................................................
............................................................................................................................................

The scientists assumed that the decreases in separation temperatures are directly proportional to the
time since the evolutionary lines of these primates separated. Gorillas are thought to have separated
from orang-utans 20 million years ago. Use this information to calculate how long ago the
evolutionary lines of humans and chimpanzees separated. Show your working. (2)

________________________ million years

1. Antibody and haemoglobin/blood (of different primates) mixed/added/bind;

2. Precipitate/complex/band formed;
3. Amount of precipitate/complex/ thickness of band shows relationship/similarity
(in protein/DNA);;

(Largest decrease in separation temperature) – no mark

1. (So) few(er) hydrogen/H bonds;
2. (So) few(er) complementary bases/ few(er) base pairs;

(Same species) have different alleles/different base sequences/ (different) mutations/introns/

non-coding DNA/multiple repeats;

Correct answer in range of 9.69 to 9.71(4286) = 2 marks;;

One mark for incorrect answers that show any of the following:
(1oC =) 5.7(14286) (million years)
OR:
20 000 000 ÷ 3.5
OR:
20 ÷ 3.5
Questions
1 The olinguito is an animal newly discovered in 2014.

The olinguito lives in trees in the Andes mountains. It is a carnivore.

a In the currently accepted classification system, one of the groups
is class. Give one piece of evidence from the information given,
that the olinguito should be placed in the mammal class. (1 mark)
b The olinguito is similar in appearance to a type of racoon that has
already been classified.
Describe how biologists could determine whether the olinguito
was in the same species as the racoon. (2 marks)
c The sloth is another animal that lives in trees. Describe how
biological molecules could be used to determine how closely
related the sloth and the olinguito are in evolutionary terms. (4
marks)

2 The diagram shows part of the phylogenetic, or evolutionary, tree for fish. The closer
to the top of the tree, the more recent the timescale.

a Name the
most recent
common ancestor
for:
i the
tuna and the
halibut(1
mark)
ii the cod
and the
squirrelfish. (1
mark)
b Name the fish that share the most recent common ancestor. (1
mark)
c The Teleostei first evolved around 200 – 250 million years ago. How do
we know this? (2 marks)

3 a A group of students carried out an investigation into the variety of

plant species in a field.
i State what is meant by the term species richness. (1 mark)
ii They decide to use a quadrat to sample the species.
One of the students decides to place the quadrat alternately in
areas where there is first high and then low diversity of plants.
Explain whether this is a reliable strategy. (2 marks)
iii Suggest how they could identify unfamiliar plants. (1 mark)

b Their results are shown in the table.

plant species number of plants
 daisy 39
plantain 24
clover 248
buttercup 17
i Use the formula
N (N – 1)
d=
Σn(n – 1)
to calculate the diversity index for the plants in this field.
Show your working. (3 marks)
ii The students compared their results with another group who
did the same investigation six months previously.
The way the field was used had not changed in that time, yet
their results were very different.
Suggest reasons for the differences. (2 marks)
c Explain why using land for intensive crop culture reduces
biodiversity. (3 marks)

Answers
1 a it has hair / fur (1 mark)
b allow to mate with racoon (1 mark)
if offspring are fertile then they are same species (1 mark)
c compare DNA nucleotide / base sequences (1 mark)
compare RNA nucleotide / base sequences (1 mark)
compare amino acid sequences of proteins / cytochrome C (1
mark)
greater similarity means more closely related (1 mark)
greater similarity means more recent common ancestor (1 mark)
maximum 4 marks

2 a i Acanthopterygii / phonetic spellings that obviously refer to this

group (1 mark)
ii Euteleost (1 mark)
b pike salmon trout smelt (1 mark)
c fossils (1 mark)
some described way of dating fossils e.g. depth in rock / use of
isotope decay (1 mark)

3 a i the number of different species present (1 mark)

ii not a reliable strategy (no mark) because:
idea that method implies bias / decision / looking where to put
it (1 mark)
quadrat should be placed randomly (1 mark)
if answer suggests strategy is reliable, then total this part  0
marks
iii use of key / book / internet (1 mark)
b i d  1.69 (3 marks)
if incorrect answer given allow:
N(N – 1)  107 256 (1 mark)
Σn(n – 1)  63 562 (1 mark)
ii (six month interval is) a different season / different time of year
(1 mark)
some plants may not have been present then / present then
but not now (1 mark)
c use of pesticides kills other organisms (1 mark)
use of insecticides kills insects (1 mark)
weed killers kill other plants (1 mark)
removal of hedges (1 mark)
eutrophication / consequence described (1 mark)
the crop is all one species / can be genetically identical (1 mark)
maximum 3 marks
Specification Biofact sheets: 65

Biodiversity can relate to a range of habitats, from a small local habitat to the Earth.

Species richness is a measure of the number of different species in a community.

An index of diversity describes the relationship between the number of species in a community and
the number of individuals in each species.

Calculation of an index of diversity (d) from the formula

N = total number of organisms of all species

n = total number of organisms of each species.

Farming techniques reduce biodiversity. The balance between conservation and farming.

Previous knowledge
Define a habitat...................................................................................................................
............................................................................................................................................
............................................................................................................................................

Define a population...........................................................................................................
............................................................................................................................................
............................................................................................................................................

Define a species................................................................................................................
............................................................................................................................................
............................................................................................................................................

Define a community.............................................................................................................
............................................................................................................................................
............................................................................................................................................

Weeds....................................................................................................................
............................................................................................................................................

Pesticides...................................................................................................................
............................................................................................................................................

Herbicide..................................................................................................................
............................................................................................................................................

Insecticide..................................................................................................................
............................................................................................................................................

Fungicide......................................................................................................................
............................................................................................................................................
 Biodiversity is the variety of life

It has 3 levels: genetic, species and ecosystem

Genetic diversity: differences in alleles

Suggest some factors that can increase genetic diversity?

Meiosis: crossing over, independent assortment

Random fertilisation

Mutations (crucial in bacterial populations as they reproduce asexually, but also conjugation helps increase
genetic diversity in bacteria)

Environmental influence

Species diversity: the number of different species in a habitat

This can give an indication of the complexity, quality and stability of a habitat but does not take account of
organisms present in low/high numbers

To get a true picture of biodiversity we need to know

Species richness: number of different types of species,

Species abundance: number of each population

To get accurate estimations of these figures we need to sample the population in such a way to avoid bias (use
random sampling methods, this will also allow statistical analysis of data) and to ensure that the sample is
representative (large samples)

The Simplon Diversity Index can be used to calculate the biological diversity in a habitat. It is useful as it
measures the number of individuals and the number of species taking account of those present in low numbers

N = total number of individuals

n = number of each species

 Area A Area B
Species Abundance Species Abundance
A 90 A 34
B 5 B 33
C 5 C 33
Total

Two fields were sampled one and agricultural field and one a field that has been left unmanaged for many
years. The results are shown in the table above.

Calculate the index of diversity for both areas. Show your working below

If provided with some basic information from the investigation it would seem the fields were both similar
and that land management had no impact, there were 3 different species present; there were a total of 100
organisms present. However, when provided with more detailed data we can see that area A is dominated
by one species, possibly a field with a particular crop being grown and the others in low numbers typically
being controlled by herbicides. The diversity index for A is much lower than that of B. B is a more balanced
habitat, and likely to be a lot more stable as a result.
 Calculate the index of diversity of plants in the forest (2)

The forest was cleared to make more land available for agriculture. After the forest was
cleared the species diversity of insects in the area decreased. Explain why. (3)
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................
............................................................................................................................................

6.97 to 7

1. Decrease in variety of plants / fewer plant species;

1. Accept: reference to monoculture or description
1. Neutral: fewer plants

Fewer habitats / niches;

2. Neutral: fewer homes / less shelter

Decrease in variety of food / fewer food sources;

3. Neutral: less food
3. Accept: less variety of prey

Aspect of clearing forest (killing insects) eg machinery, pesticides

4. Neutral: clearing forest unqualified
 The scientists collected insects at sites chosen at random. Explain
the importance of the sites being chosen at random. (1)
Removes bias;

Calculate the index of diversity (2)

1.28 / 1.29 / 1.285 / 1.3

Without carrying out any further calculations, estimate

whether the index of diversity for the wheat field would be
higher or lower than the index of diversity for the wood.
Explain how you arrived at your answer.

Diversity index would be lower (NO MARK)

Assume wheat field if site unspecified
Fewer species / Beech aphid/Large white butterfly / 7-
spot ladybird
absent / only three species / species diversity lower;
1. Allow species richness in context of
few species
2. Mostly one species / mostly bird-cherry aphid;
A journalist concluded that this investigation showed that farming reduces species diversity. Fewer plant species;
Evaluate this conclusion. (2) 3. Allow one type of food source if clearly
plant
For: Data support the claim / evidence supports claim;
Ignore reference to correlation / causation

Against: Only wheat field / only comparing with wood / one type of habitat / only
insects considered;

Farmers were offered grants by the government to plant hedges around their fields. Explain the effect
planting hedges could have on the index of diversity for animals. (2)

1. Greater variety of plants;

2. Another habitat / more habitats / places to live / niches;

3. Another food source / more food types;

 Costa Rica is a Central American country. It has a high level of species diversity. There are over 12 000 species of plants in Costa Rica. Explain how
this has resulted in a high species diversity of animals. (2)

Greater variety / different foods;

More habitats/niches;

The number of species present is one way to measure biodiversity. Explain why an index of diversity may be a more useful measure of biodiversity.
(2)

Also measures number of individuals in a species / different proportions of species;

Some species may be present in low/high numbers;

Crops grown in Costa Rica are sprayed with pesticides. Pesticides are substances that kill pests. Scientists think that pollution of water by pesticides
has reduced the number of species of frog.

Frogs lay their eggs in pools of water. These eggs are small. Use this information to explain why frogs’ eggs are very likely to be affected by pesticides
in the water. (2)

Large surface area to volume (ratio);

Correct reference to diffusion;
(Eggs) cannot move (out of water);
Permeable/thin (outer layer);

An increase in temperature leads to evaporation of water. Suggest how evaporation may increase the effect of pesticides on frogs’ eggs. (1)

Concentration (of pesticide) is increased;

 Factors reducing biodiversity Forests have a high biodiversity because a mature forest has
many different species of plants in several layers; each adapted
to their own conditions of light and nutrient availability. The
different plants have different animals feeding on them and
living in them; and the different primary consumers have
different secondary consumers feeding on the. So forests
contain complex food webs with high diversity.

By contrast, a field of crops has very low diversity (particularly

with tendency for monoculture) with very few plants (often just
the crop and a few weeds) and so few animals. Use of pesticides
(herbicide and insecticide) will reduce biodiversity further. Use
of fertilisers can lead to leeching and eutrophication in ponds
and lakes which kills living organisms
Agriculture
Deforestation therefore reduces biodiversity.
1. Selective breeding: done to select for certain favourable characteristics
reduces genetic diversity.
2. Destruction of hedgerows: Makes large farms with large fields are cheaper
and more efficient to run by easing the moving machinery and harvesting.
Hedgerows provide habitats for at least 30 species of trees and shrubs, 65
species of nesting birds, 1500 species of insects and 600 species of
wildflowers. These in turn provide food for small mammals. Hedgerows
also act as wildlife corridors, allowing animals to move safely between
woodlands.
3. Monoculture: increases the productivity by growing the best crops, which
can be sowed and harvested quickly using dedicated machinery. This
increases yield and reduces labour costs. It reduces genetic diversity and
renders all crops in a region susceptible to disease. Reduces animal species
diversity, because there are few niches and limited food sources.
4. Fertilisers: maintain soil fertility, but they can pollute surrounding
groundwater causing eutrophication and killing aquatic animals.
5. Pesticides: are sprayed on crops to prevent attack by insects and other
invertebrate animals, but many pesticides have a broad spectrum, killing a
wide range of animals and so reducing diversity.
6. Herbicides: kill competing plants (“weeds”) that might reduce crop yield.
Deforestation

Suggest reasons why deforestation occurs

Land for agriculture, building materials, urbanisation, fuel

Consequences of deforestation (including large scale)

Deforestation therefore reduces biodiversity

Less plant diversity, means less habitats and less food sources
and so a reduction in animal diversity

Less carbon dioxide stored: leading to climate change

Possible sources of medicines (often found in rain forest) are lost
Natural beauty lost

Forests have a deeper and more extensive root system, so

binding the soil together. Soil erosion, flooding and leeching of
nutrients in to water systems causing eutrophication.

Loss of pharmaceuticals / ‘medicines’ / timber / ‘wood’;

Concept of preservation/maintenance – e.g.
sustainable management/sustainable use of
resources/management to maintain
diversity/maintain forest;
(Allow ref. To ‘keeping’ / ‘saving’ / ‘non-
destruction’)
1. Protection of habitat;
2. Legal measures, e.g. quotas, hunting bans;
3. Capture/culling of non-native species;
4. Captive breeding;
5. Surrogacy / artificial insemination / genetic manipulation
techniques;
6. Ethical / aesthetic reasons for conservation / tourism;
7. Possible undiscovered benefits, e.g. crop plants, drug
sources;
8. Maintaining genetic diversity for future breeding
programmes;
9. Avoid damage to food webs / control local pests;
To maintain diversity;
to maintain organisms’ habitats/ecosystem;
Explain the advantages of conserving a forest
ecosystem.
Trees available as a sustainable resource;
Maintain habitats / niches / shelter;
Maintain diversity / avoid loss of species / protect
endangered species.
Maintain stability (of ecosystem);
Maintain food chains / webs / supply of food;
Reduced loss of soil / erosion;
Reduced flooding;
Act as carbon sink / maintain O2and C02 balance
reduce greenhouse effect
Reduce global warming;
Source of medicines;
Loss of species / decrease in diversity / loss of habitat / loss of
niche / disruption of food chain;
Loss of pharmaceuticals / ‘medicines’ / timber / ‘wood’;
CO2 build-up in atmosphere / global warming / trees take in
CO2 /
trees = carbon sink (described) / to maintain CO2 in air; (NOT
just ‘carbon’ in air)
Leaching of ions / mud slides / flooding / desertification;
[ALLOW converse of above – e.g. ‘Rainforest is a habitat for
(various) species’]
 Species richness
This is a measure of the number or different species in a particular
ecosystem.
It takes no account of the relative numbers of each species or where
they are distributed.

Questions
4 Three examples of data are shown in the table below.
Moorland Rocky shore Potato field
Mean % Mean Mean %
Species cover per Species number per Species cover per
quadrat quadrat quadrat
Milkwort 5 Limpet 82 Potato 89
Carnation grass 16 Grey top shell 12 Dandelion 8
Purple moor
29 Toothed top shell 36 Clover 13
grass
Bell heather 6 Edible periwinkle 35 Nettle 7
Starry sedge 5 Chiton 4 Dock 14
Common heather 48 Beadlet anemone 23
Snakelocks
Tormentil 13 7
anemone
Sheep's fescue 82 Dog whelk 34
Sheep's sorrel 11 Barnacle 197
Mat grass 23
a Calculate the species diversity for each site. (6 marks)
b Comment on the diversity of the three sites. (3 marks)

5 Samples were taken from three randomly located positions in a

freshwater pond. The results are shown in the table below.
Number of specimens of each species found in freshwater pond samples
Sample number
Species
1 2 3
Water boatman 12 9 5
Great diving beetle 4 0 5
Water flea 56 78 36
Freshwater shrimp 35 12 24
Ramshorn pond snail 0 11 2
Dragonfly nymphs 9 10 7
a Calculate the mean number of each species present. (3 marks)
 b Calculate the value of D for this pond by using the formula

(2 marks)
c Suggest how the random sampling positions might have been
determined. (2 marks)
d Discuss how the data might have been different had the sampling
not been random. (3 marks)
e Dragonfly nymphs were counted together and not as separate
species. Suggest how this might have influenced the value of D
that you have calculated. (3 marks)

Answers
6 2 marks per correct value. Allow one for a correct intermediate stage
if not, e.g. N = 238 in the moorland.
a Moorland D = 0.81; Rocky shore D = 0.73; Potato field D = 0.51
b Any three of the following:
Moorland in the most diverse. Potato field is the least diverse;
balance of species is more even in the moorland and shore
samples;
moorland and shore likely to be more stable communities/later in
the succession;
potato field is least stable/most likely to change. (max 3 marks)
7 a water boatman 9, diving beetle 3, flea 57, shrimp 24, snail 4,
dragonfly nymphs 9. Lose one mark per wrong answer.
b 0.64 (1 mark for correct workings; 1 mark for correct answer)
c Any two of the following:
A grid or system of tapes laid out; reference to some kind of laser
range finder system
random coordinates generated;
samples taken at those coordinates. (max 2 marks)
d May have sampled only species from one part of the pond;
e.g. only the edge/only the deep water;
species from some parts of the pond would not be collected/ORA;
species richness may have been lower. (max 3 marks)
e D would be inaccurate/unrepresentative;
might have reduced the value of D;
because lumping would give a bigger (n/N)2 value;
would not allow comparison between this and other sites. (max 3
marks)
Specification
Genetic diversity within, or between species, can be made by comparing:

• The frequency of measurable or observable characteristics

• The base sequence of DNA
• The base sequence of mRNA
• The amino acid sequence of the proteins encoded by DNA and mRNA.

Students should be able to:

• interpret data relating to similarities and differences in the base sequences of DNA and in the amino
acid sequences of proteins to suggest relationships between different organisms within a species and
between species

• appreciate that gene technology has caused a change in the methods of investigating genetic
diversity; inferring DNA differences from measurable or observable characteristics has been replaced
by direct investigation of DNA sequences.

Knowledge of gene technologies will not be tested.

Quantitative investigations of variation within a species involve:

• collecting data from random samples
• calculating a mean value of the collected data and the standard deviation of that mean
• interpreting mean values and their standard deviations. Students will not be required to calculate
standard deviations in written papers.

Previous knowledge
Structure of DNA related to function
How DNA codes for proteins
Protein structure (primary, secondary, tertiary)
mRNA structure and production in transcription
Molecular techniques for classification (DNA, amino acids sequencing, DNA hybridisation,
immunological techniques
Explain crossing over
Independent assortment
Discuss mutations
Sampling techniques (random and transect)

Practical
Factor affecting leaf size

Biofact sheets: 68 & 50

 Water: needed by all organisms for chemical
Temperature: affects enzyme reactions
activity

Carbon dioxide: limiting factor in

Nutrients: like nitrates and
photosynthesis
magnesium that plants need

Light: a limiting factor for pH: affects enzyme activity

photosynthesis
 Oxygen: needed for respiration
Variation: differences between organisms. Intraspecific: within a species, interspecific: between species (often much greater). This is caused by genes inherited,
environment or a combination of both
Genetic diversity: the different alleles in a population Factors affecting
Gene pool: all the alleles of all the genes in a population
distribution of
Genetic variation is the basis of survival and evolution. It provides a range of phenotypes some better suited to the environment than others. Those best suited will
survive, reproduce and pass on alleles. Allele frequencies may change over time, as advantageous alleles become more prevalent in the gene pool
organisms

HOW DO WE MEASURE DISTRIBUTION

Random sampling Systematic sampling
Describe how to estimate the
number of daisies growing in a
Transects
Genetic bottle necks: catastrophic event causes a large
reduction in population, and thus a large loss in alleles.
field The population recovers over time from a reduced
Mutations: creates new alleles, not always beneficial, not always number Describe how
of alleles you wouldofinvestigate
(a selection how the in
what was available
1. Divide
useful, but if environment changes it mayarea into advantageous,
become a grid species change across the stream, from
the previous population, so there is less geneticone bank
2. Use a calculator
particularly with bacterial antibiotic resistance. to generate to the
variation other
in the population
random numbers (avoid bias)
3. Use
Conjugation (in bacteria): horizontal these as coordinates to
transmission FounderCreate a transect
effect: by…..
similar to the above scenario, except a
place quatdrats small section of the populationacross
Stretch a tape measure the stream
is isolated and they
Other genetic factors 4. Count the number of Place quadrats at regular intervals along
increase in numbers using only a selection of the thealleles
tape
organisms present in the Count the number of species in each quadrat
from the original population
Meiosis: crossing over (explain), independent
quadrats assortment (explain) Repeat with several transects along the stream
5. Use a large sample to be
Random fertilisation
Selective breeding: Humans breed) organisms
representative with certain desirable characteristics/alleles;
 Types of variation

Discontinuous/discrete

Organisms are put into distinct categories, like blood group, A, B, AB, O.
This provides a few distinct phenotypes
Such characteristics are controlled by a single gene or a few genes
And are not heavily influenced by the environment
The data tends to be qualitative data.

Continuous variation

This occurs when characteristics display a continuum, like height or

mass, we get a range of phenotypes from one extreme to the other.
These characteristics tend to be controlled by numerous genes
(polygenic) and as such they are heavily affected by the environment.
The data in this case is quantitative. This produces a normal distribution
curve.

Standard deviation shows the spread of the results around the mean value.

Standard deviation is a useful measurement when comparing variation in a population

because unlike range and mean, it is not affected by a single outlier. Furthermore, the
standard deviation can be used in statistical analysis to look for significant differences.

From a sample of data

68% of the data values will lie 1Standard Deviation either side of the mean

99% of the data values will lie within 2 standard deviations of the mean
 Two scientists propose two methods for
measuring the rate of a chemical reaction. They
both get an average rate of 44, and so we may
assume that both methods are adequate.
However, when we look more closely at the
data and do some mathematical analysis we
can see that this assumption is incorrect, as
method B generates results with a lot of
variation.

Both sets of data produce the same mean value of

44, so on the surface it may seem that both methods
are adequate for collecting data in this investigation.
However, when provided with the SD, we can see
that data set B has a large spread of results around
the mean
Hypotheses: south facing leaves are smaller than north facing leaves

Results:
Mean surface area of south facing leaves 50mm2
Mean surface area of north facing leaves 70mm2

On this basis you would probably accept that the hypothesis was correct.

However, what happens when we add in the SD, the spread of the results around the mean

Results ± standard deviation

South leaves =50mm2 ± 14

North leaves = 70mm2 ± 17

We can see there is an overlap in standard deviations

The maximum size of south leaves was 64mm2, and the minimum size of north leaves was 53
mm2, so sometimes south leaves are bigger than north leaves so the difference in length may not
be a significant difference all the time.
 Heritability is a measure of how much of the variation in a
population is due to genetic factors. Values for the heritability of a
feature range from 0 to 1. A value of 0 means that there is no
influence of genetic factors. A value of 1 means that the feature is
completely due to genetic factors. The Large Munsterlander and
Pudelpointer are two breeds of hunting dog. Table 1 shows the
mean heritability values and standard deviations for two features of
these two breeds of hunting dog.

If a dog breeder wishes to use selective breeding for one of these features, which one should he choose? Use information in Table 1 to explain your answer. [2 marks]

1. Select tracking/(Large) Munsterlander;

2. (As) high (heritability) value/0.8/ closer to 1/ mainly due to genetic factors;

What do the standard deviations suggest about the differences in heritability values for searching between the two breeds of hunting dog? (2 marks)

1. (SDs) overlap / values shared;

2. (So difference between means) is not significant/is due to chance;

Do these data support the conclusion that hypochlorite was the most effective at killing this
bacterium? Explain your answer. (3)

(Yes)
Ignore references to methodology
Largest clear zone / diameter / mean (so more bacteria killed);

(No)
Standard deviations of chlorhexidene overlap / share values;
2. Neutral: diameters overlap / share values
(Overlap means difference) is not significant / is due to chance;
3. Can still be awarded if SD overlap or non-overlap is correctly
interpreted
3. Accept: (difference) is not real / not reliable
3. Neutral: spread is not reliable
 (2)

The scientists measured the forced expiratory volume (FEV1 ) of each patient at regular intervals.
The forced expiratory volume (FEV1 ) is the volume of air forced out of the lungs in the first second
when breathing out. The scientists recorded each patient’s FEV 1 before treatment started and after
60 days of treatment. They then calculated the mean increase in FEV1 for each group. Their results
are shown in the graph. The bars show the standard deviation.

What do the standard deviation bars suggest about the difference in the mean increase in FEV 1
between Group 1 and the other groups? Explain your answer. (2)

1. (Differences) are real / significant / not due to chance;

It = the difference

2. (As) bars / SDs do not overlap;

2. Accept: ‘standard errors do not overlap’ as told
‘standard deviation’ in the question stem

What do the data suggest about the ‘placebo effect’ in this investigation? Explain your answer. (2)

1. No / slight (placebo) effect;

2. Group 2 and 3 results are similar/the same / SDs / bars overlap;

2. Accept: other descriptions of Groups 2 and 3
2. Accept: that Groups 2 and 3 are not significantly
different
On each occasion that a patient’s FEV1 was measured, a doctor repeated the measurement several
times. Explain why. (2)

1. (Allows) anomalies to be identified / ignored / effect of anomalies to be

reduced / effect of variation in data to be minimised / concordant results;

2. (Makes) average / mean (more) reliable;

 A Sri Lankan scientist investigated the effect of human
disturbance on the organisms living on a rocky
seashore. He chose three areas for the study. These
areas had different amounts of human disturbance.

The scientist measured human disturbance by walking

from one end of the beach to the other. He recorded the
number of people he encountered. Figure 1 shows his
What conclusions can you draw about the number of people visiting Site R compared with the number results.
of people visiting the other two sites? Give evidence from Figure 1 to support your answer. (2)

Fewest people at site R as mean is lowest;

Accept use of mean values to show 2.2 is the lowest

Standard deviations do not overlap so significant/not due to chance;

The crimson topaz and the fiery topaz are

hummingbirds.
Biologists investigated whether the crimson topaz and
the fiery topaz are different species of hummingbird,
or different forms of the same species.
They caught large numbers of each type of
hummingbird. For each bird they
• recorded its sex
• recorded its mass
• recorded the colour of its throat feathers
• took a sample of a blood protein.

The table shows some of their results.

Explain how the standard deviation helps in the interpretation of these data.(2)
) 1. Shows the spread of the data / how data varies;
1. Reject range.
In hummingbirds throat colour is important in courtship.
Accept varies from the mean
Explain the evidence in the table that shows that the
2. Overlap = no difference / due to chance / not significant;
crimson topaz and the fiery topaz may be different
2. Allow converse
species of hummingbird. (2)
3. Low SD means results more reliable / repeatable;
Different colour / different feathers / different throat;
3. Ignore accurate / valid
Birds don’t mate / pair bond with / recognise other
species;
2. Reference to courtship alone is not sufficient