3.2.

DNA Structure

•DNA = Deoxyribose nucleic acid

•Made out of sugars (deoxyribose), phosphates
and nitrogen bases
Chemical properties of Bases that affect the structure and
the function of nucleic acids.

Purines and Pyrimidines common in DNA and RNA

1) Are Highly conjugate molecules

Consequences for-Structure
- Electron distribution
- Light absorption of NAs

-Resonance among atoms in the ring gives most of the

bonds partial double-bond character
2) Bases may exist in two or more Tautomeric forms

E.G., Uracil - Lactam, Lactim and Double Lactim

Effect- Absorption of UV-light as a result of
resonance
- NAs absorption wavelength= 260nm.

3) Bases are hydrophobic & relatively insoluble in water

at near-neutral PH

-At acidic or alkaline PH  Charged Bases Solubility 

Two Mode of Interaction between Bases in NAs:
1) Hydrophobic stacking Interaction
Positioning of two or more bases parallel
to the plane of their ring.
Importance of base stacking:
To minimize contact of the bases with
water
 To stabilize the three-dimensional
structure of nucleic acids.

2) Hydrogen bonds -involving the amino and carboxyl groups of

bases.

Functional groups of Pyrimidines and purines are-

. Ring nitrogen
. Carboxyl
. Amino
Importance of H-bonds:

Complementary association of two strands of NAs

Common H-bonding patterns

 A bonds specifically with T
 G bonds with C

- Predominant base pairs in double stranded DNA and RNA

-What is the use of specific base pairing ?

 It permits the duplication of the genetic material.
A:T and G:C pairing
Types of NA structure

a) Primary structure
- Covalent structure of NAs & the nucleotide
sequence.
b) Secondary structure
- Any regular & stable structure in some
or all of the nucleotides in NAs.
c) Tertiary structure
- Complex folding of large chromosomes
within eukaryotic chromatin &bacterial
nucleoside.
Base composition of DNA molecule

 Early physical and chemical studies of DNA

X-Ray Diffraction
The spacing of atoms in a crystal lattice can be determined by
measuring the locations and intensities of spots produced on
photographic film by a beam of x rays of given wavelength, after the
beam has been diffracted by the electrons of the atoms.
X-ray diffraction pattern of DNA.
- The spots forming across in the center denote a helical structure.
- The heavy bands at the left and right arise from the recurring bases.
Cont’d
“Chargaff’s rules” of DNA Molecule

Earlier thought of tetranucleotide DNA structure

Guanine Thymine

Sugar P Sugar

P P

Sugar P Sugar

Cytosine Adenine
Determination of the relative amount of each bases in various
samples
(Molar content=Base composition)
Hydrolysis of the bases from the attached sugar 
Separation of the hydrolysate by paper chromatography
Determination of the amount of material in each of 4
spots
Result of Chargaff experiment:
. Disproval of the 1:1:1:1 ratio of tetranucleotide
Theory
E.G., A:G ratio of DNA
- Tubercle bacillus = 0.4
- Human DNA = 1.56
It is constant for the species
Discovery of Chargaff′s rule of molecular equivalence between
Purines and Pyrimidine in DNA

Conclusions:

1) The base composition of DNA generally various from one species to

another.

2) DNA specimens isolated from different tissues of the same species have the
same base composition

3) The base composition of DNA in a given species does not change with a
organism's age, nutritional state, or changing environment.

4) In all cellular DNAs, regardless of the species, the number of A residues is

equal to the number of T (i.e., A=T) and G=C.

 The sum of Purine residues is equal to the sum of pyrimidine residues

i.e., A+G = T+C .
 “Chargaff’s rule”
cont'd A=T & C=G
CONT′D
Base composition of DNA in various species

Species Base composition (mol %)

G A C T

E. coli 24.9 26.0 25.2 23.9

Wheat germ 22.7 27.3 22.8 27.1

Human liver 19.5 30.3 19.9 30.3
Saccharomyces cerevisiae 18.3 31.7 17.4 32.6
Clostridium perfringens 14.0 36.9 12.8 36.3
Double helical structure of DNA

Background data to postulate that DNA is a double helix

1) X-ray diffraction Pattern of DNA Molecule

Result: DNA-molecules are helical with two

periodicities along their axis.
- Primary =0.34nm (3.4 Ȧ)
- Secondary =3.4nm (34 Ȧ).

2) Specific A=T G=C base equivalence

Schematic drawing of DNA's two strands.
 Due to the specific base pairing, DNA's two strands are complementary to each
other. Hence, the nucleotide sequence of one strand determine the sequence of
another strand.

• E.g.,
5' -ACT- 3'
3' -TGA- 5'

- Note that they obey the (A:T) and (C:G) pairing rule.
- If we know the sequence of one strand, we can deduce the
sequence of another strand.
- For this reason, a DNA database needs to store only the sequence of
one strand.
- By convention, the sequence in a DNA database refers to the sequence
of the 5' to 3' strand (left to right).
A DNA sequence is called "sense" if its sequence is the same as that of a

messenger RNA copy that is translated into protein. The sequence on the

opposite strand is complementary to the sense sequence and is therefore

called the "antisense" sequence.

Since RNA polymerases work by making a complementary copy of their
templates, it is this antisense strand that is the template for producing
the sense messenger RNA.

DNA Molecule
The Watson and Crick Model for DNA Structure:
1) The molecule is composed of two chains of nucleotides.

2) The two chains spiral around each other to form a pair of right-
handed helices.
3)The two strands comprising one double helix run in opposite
direction, i.e., they are antiparellel.(5'3′ and 3′  5‘)
• The normal right-handed "double helix" structure of DNA, also
known as the B form.
The double helix
Cont’d

4) The Sugar –phosphate back bone is located in the out side of the
molecule with the two set of bases projecting towards the center.
( Negatively Charged)

5) The bases occupy planes that are approximately perpendicular to

the long axis of the molecule- hence- the terminology –Base
stacking
 Hydrophobic interactions & Van der Waals forces
Stability of DNA molecule

6)The two strands are held together by hydrogen bonds of each bases.
Note: A═T G C
7)The distance from the phosphorus atom of the backbone to the center of the
axis is 1nm.

8) A pyramidine in one strand is always paired with a purine in the other stand.
This arrangement produces a molecule that is 2nm wide along its entire
length.

9) The nitrogen atoms are linked to C6 of A and C4 of C predominantly by

amino group( NH2) rather than imino (NH) and Oxygen atoms linked to C6
of G and C4 of T by keto (C=O) configuration than enol
(COOH) form.

10)The space between adjacent turns of the helix form two grooves of different
width.
Major (wider) and minor (narrow) grooves- spiral around the outer
surface of the double helix.
 Proteins with their domain fit into these grooves.
11) The double helix makes one complete turn every 10 base pairs
(3.4nm, 34 Armstrong) and each base pair is placed at a distance
of 0.34nm.

12) Complementarity of the double helix because always A bonded to T

and G to C

e.g., 5‘ ─AGG ─ 3‘ is complementary to 3‘─TCC ─ 5‘ .

Important in all activities and mechanisms involving NAs.

Cont’d
Importance of the Watson and Crick proposal:
Their model of DNA structure supported:

1) Information content of DNA resides in linear sequence of its bases.

2) During replication –the H-bonds break like the separation of two

halves of a zipper.

3) Remained a mystery how the DNA governs the assembly of a

specific protein.
 Different forms of DNA Double Helix:

Structural variation in DNA reflects three things:

1) the different possible conformations of the deoxyribose

2) rotation about the contiguous bonds that make up the

phosphodeoxyribose backbone

3) Free rotation about the C-1′–N-glycosyl bond

Thermal fluctuation –Producing

. Bending
. Stretching
. Unpairing (melting)
For purine bases in nucleotides, only two conformations with respect to the attached
ribose units are sterically permitted, anti or syn.
- Pyrimidines generally occur in the anti conformation.

syn Adenosine anti Adenosine anti Cytidine

 Possible conformations of DNA:
• Three major forms
– B-DNA
– A-DNA
– Z-DNA
 Others- C-, D,- H-, and P-DNA- not observed in naturally occurring biological
system

1) B-DNA
- Sodium salt of DNA fiber formed at 92% relative humidity
- Predominant in cells under physiological conditions
- Right handed helix
 -The axis of the helix passes through the center of the base pairs

- Each base pair is rotated by 36º from the adjacent base pair.
- The base-pairs are stacked 0.34nm apart from one another.
i.e. Aromatic rings with 3.4 Å base thickness to the rings

- The double helix repeats every 3.4nm (PITCH)

Pitch = 10 x 3.4 = 34 a per complete turn
- The minor groove is narrow and deep & the major groove is wide and
deep
- Ideal B-DNA has 10 base pairs per turn
2) A-DNA

- Formed at high salt concentration or during dehydration of double stranded

DNA (dsDNA) - ( RH < 75%)
B-DNA  A-DNA (Reversible)

- Right-handed helix
- Predominant in ds RNA and DNA-RNA hybrid.
- Short, wide and flat
- Base planes are tilted 20 degrees with respect to helical axis
 Helix axis passes “above” major groove
 Deep major and shallow minor groove
- The A-helix packs 11 bp per helical turn
- Each bp is rotated by 31º from the adjacent base pair.
- Helical pitch 28 angstrom (Å)
3) Z-DNA
• Seen in conditions of high salt concentrations
– Reduces repulsion between closest phosphate groups on
opposite strands
– Formed during methylation of cell's DNA for regulatory purpose

• A left-handed helix

• In DNA with complementary polyneucleotides with alternating

purines and Pyrimidines
– POLY d(GC) · POLY d(GC)
– POLY d(AC)  POLY d(GT)
Cont’d

- 12 Base Pairs per turn

- Has a Helical PITCH of 45 degrees
- A deep and narrow Minor groove
- No discernible Major groove
- Reversible change from B-DNA to Z-DNA in localized regions
may act as a “SWITCH” to regulate GENE EXPRESSION
- Thinner and longer than B-DNA
Forms of the DNA double helix
B DNA A T Z DNA
C G A DNA
G C
T A
3.9 nm
Minor 1 nm
0.9 nm
groove Minor 1.2 nm 2.8 nm
G C
T A groove
6.8 nm
C G
A T
Major Major
groove groove
A T
0.57 nm
C G
0.26 nm
G C
T A 0.34 nm

10.4 Bp/turn 11 Bp/turn 12 Bp/turn

+34.6o Rotation/Bp +34.7o Rotation/Bp -30.0o Rotation/Bp
 Alternative forms of DNA
• C-DNA:
– Exists only under high dehydration conditions
– 9.3 bp/turn, 0.19 nm diameter and tilted bases
• D-DNA:
– Occurs in helices lacking guanine
– 8 bp/turn B-DNA appears to be the
• E-DNA: most common form in vivo.
– Like D-DNA lack guanine However, under some
– 7.5 bp/turn circumstances, alternative
forms of DNA may play a
biologically significant role.
• P-DNA:
– Artificially stretched DNA with phosphate groups found inside the long
thin molecule and bases closer to the outside surface of the helix
– 2.62 bp/turn
 Comparison of A, B, and Z forms of DNA.
FORMS A B Z

Helical Sense Rt. handed Rt.handed Left-handed

Shape Short, broad Medium solid Longer, thin &solid
Hollow inside
Diameter ~ 26 A 20A 18 A

Bp/ helical turn 11 10 12

Helical twist/bp 31º 36º 60º
Helical pitch 28 A 34 A 45A
Rise/turn
Base tilt to helix axis 20º 6º 7º

Major groove Narrow &deep Wide &deep Flat

Unusual Structures of DNA
Palindrome-A palindrome is a word, phrase, or sentence that is
spelled identically read either forward or backward.
E.g. ROTATOR and NURSES RUN
• Applied to regions of DNA with inverted repeats of base sequence
having twofold symmetry over two strands of DNA (sequences of
double-stranded nucleic acids with twofold symmetry)
• Superimpose one repeat (shaded sequence) on the other, rotate 180º
about the horizontal axis then 180º about the vertical axis.
Self-complementary within each strand :
Form hairpin or cruciform (cross-shaped) structures

• With intrastrand base pairing (Both in Palindromic DNA(RNA) sequences)

When only a single DNA (or RNA) strand is involved, the structure is called a
hairpin.
When both strands of a duplex DNA are involved, it is called a
cruciform.

• Shaded highlights asymmetry sequences - pair with the complementary

sequence either in the same strand or in the complementary strand.
Mirror repeat
The inverted repeat occurs within each individual strand of the DNA
Do not have complementary sequences within the same strand and cannot
form hairpin or cruciform structures

 symmetric sequence within each strand. Superimposing one repeat on

the other requires only a single 180 rotation about the vertical axis
Triplex DNAs
Formed by - the hydrogen bonding of the N-7 and N6 of purines,
 Hoogsteen positions Hoogsteen pairing(Karst Hoogsteen, 1963)
 Triplex DNAs contain two pyrimidine strands and one
purine strand and vice versa.
A sequence of alternating T and C residues can be considered a mirror repeat.
The strands in one half of the mirror repeat are separated and the pyrimidine
containing strand (alternating T and C residues) folds back on the other
half of the repeat to form a triple helix.

• The purine strand (alternating A and G residues) is left unpaired.

This structure produces a sharp bend in the DNA
Supercoiled or superhelical DNA
• Circular DNA incorporated one or more twists to increase the number of
times one strand crosses the other.
• A superhelical turn is defined as a 180° twist in the super helix
• Supercoiling= Additional twisting- “tightening” or “loosening”
- Positive – increasing Rt-handed twist
- Negative- decreasing the number of twist
 Important properties of DNA

1) Denaturation of DNA
- Heating at a temperature of 85-100°C for 5 min.
-  T°C- disruption of the 3D-dimensional structure of DNA and
results in a single stranded DNA (ssDNA)
- Ordered state Present in Nature = Native
- Transition from native to denatured = Denaturation

Other denaturing agents:

. Extreme pH-ionizing-interrupts H-bonding-
destabilize base pairing
. Formamide and urea
2) Renaturation of DNA (Reannealing)

 Re-formations of native DNA from denatured DNA

= Renatured DNA

Requirements of Renaturation:

- High salt concentration to eliminate electrostatic repulsion b/n

phosphates in ds (Conc. 0.15 – 0.5 M Sodium chloride)
-High T°C to disrupt random intrastrand H-bonds in ssDNA (Not too
high- otherwise Inhibition of base-bairing)
Renaturation T°C= 20 to 25° below melting temperature (Tm).
Cont’d

• Heating double stranded DNA can overcome the hydrogen bonds

holding it together and cause the strands to separate resulting in
denaturation of the DNA
• When cooled relatively weak hydrogen bonds between bases can
reform and the DNA renatures

Denatured DNA
ATGAGCTGTACGATCGTG

ATGAGCTGTACGATCGTG ATGAGCTGTACGATCGTG
TACTCGACATGCTAGCAC TACTCGACATGCTAGCAC

Double stranded DNA Double stranded DNA

TACTCGACATGCTAGCAC
Single stranded DNA
Use of Renaturation:

- To demonstrate genetic relatedness b/n different organisms

- To detect particular species of RNA

- To determine whether certain sequences occur more than once in

the DNA of a particular organism

- To locate specific sequences in a DNA molecule

 Renaturation decreases the optical density value ( A260)

3) Melting temperature (Tm)
• DNA melting is the process by which the hydrogen bonds between
the strands of the double helix are broken, separating the two
strands of DNA .
• Ds DNA Gentle heating ssDNA
Tm – A temperature by which 50% of the DNA is denatured –
based on G+C content (%age)
T and A rich sequences are more easily melted
• Higher G+C %age (25% - 75%)- Tm (more energy)

• Only H-bonds and stacking interaction are disrupted

• All covalent bonds & phosphodiester bond remain intact

- Optical density (A260)

-ds DNA= 1.00
- ss DNA = 1.37
- Free base= 1.60
 Heated ds DNA becomes hyperchromic.
Determination of GC Content

• Comparison of melting temperatures can be used to determine the GC

content of an organisms genome

• To do this it is necessary to be able to detect whether DNA is melted or not

• Absorbance at 260 nm of DNA in solution provides a means of determining

how much is single stranded

• Single stranded DNA absorbs 260 nm ultraviolet light more strongly than
double stranded DNA does although both absorb at this wavelength

• Thus, increasing absorbance at 260 nm during heating indicates increasing

concentration of single stranded DNA
Determination of GC Content

1.0 Single
Tm is the stranded
DNA
temperature
at which half
Relatively Relatively
the DNA is
low GC high GC
melted
OD260 content content
Tm = 75 oC Tm = 85 oC

Double
stranded
DNA

0
65 70 75 80 85 90 95
Temperature (oC)
• Thus higher GC content is reflected in higher melting or
denaturation temperature

ACGAGCTGCACGAGC ATGATCTGTAAGATC
TGCTCGACGTGCTCG TACTAGACATTCTAG
67 % GC content - 33 % GC content -
High melting temperature Low melting temperature

ATGAGCTGTCCGATC
TACTCGACAGGCTAG
50 % GC content -
Intermediate melting temperature
Relative G+C Contents of Various Genomes
Source of DNA Percent (G+C)

Slime mold 22

Vaccinia virus 36
Streptococcus pyogenes 34

Saccharomyces cerevisiae 39
Rat liver 40

E.coli 51
Wheat germ 43

Haemophilus influenza 39
Mouse spleen 44

Calf thymus 40
Chicken liver 43

Pseudomonas aeroginosa 68
Cont’d
Organism % GC

Homo sapiens 39.7 %

Sheep 42.4 %

Hen 42.0 %

Turtle 43.3 %

Salmon 41.2 %

Sea urchin 35.0 %

Staphylococcus aureus 50.0 %

Phage l 55.8 %

Phage T7 48.0 %
Size of DNA in various organisms
• Source Base pair Length
SV-40(Mammalian 5226 1.7 µm
tumor virus)

-Bacteriphage 5 X 105 13 µm
Lambda( λ)

-Human mitochondria 16,596 5 µm

-Yeast 13500 4.1mm

-E.coli 4.65X106 1.6mm

 Hybridization

• The bases in DNA will only pair in very specific ways,

• In short DNA sequences, imprecise base pairing will not be tolerated

• Long sequences can tolerate some mispairing only if the energy the
majority of bases in a sequence exceeds the energy required to keep
mispaired bases together

• Because the source of any single strand of DNA is irrelevant, merely the
sequence is important, DNA from different sources can form double helix as
long as their sequences are compatible

• Thus, this phenomenon of base pairing of single stranded DNA strands to

form a double helix is called hybridization as it may be used to make hybrid
DNA composed of strands which came from different sources
Cont’d

DNA from source “X”

CTGATGGTCATGAGCTGTCCGATCGATCA
TACTCGACAGGCTAG

Hybridization

TACTCGACAGGCTAG
DNA from source “Y”
Why hybridization is useful?

• Because DNA sequences will seek out and hybridize with other sequences
with which they base pair in a specific way much information can be gained
about unknown DNA using single stranded DNA of known sequence

• Short sequences of single stranded DNA can be used as “probes” to detect

the presence of their complimentary sequence in any number of
applications including:
– Southern blots
– Northern blots (in which RNA is probed)
– In situ hybridization
– Dot blots . . .

• In addition, the renaturation or hybridization of DNA in solution can tell

much about the nature of organism’s genomes