Colloids and Surfaces B: Biointerfaces 182 (2019) 110352

Contents lists available at ScienceDirect

Colloids and Surfaces B: Biointerfaces

journal homepage: www.elsevier.com/locate/colsurfb

Loading of water-insoluble celastrol into niosome hydrogels for improved T

topical permeation and anti-psoriasis activity
Shikang Menga, Lin Sunb, Lun Wanga, Zibei Lina, Zeyu Liua, Long Xia, Zhenping Wangc,
⁎
Ying Zhenga,
a
State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences, University of Macau, Macau, China
b
Zhuhai Campus of Zunyi Medical University, Department of Pharmaceutical Sciences, China
c
Department of Dermatology, School of Medicine, University of California, San Diego, La Jolla, CA, USA

A R T I C LE I N FO A B S T R A C T

Keywords: Psoriasis is a severe disfiguring skin disease affecting approximately 3% of people worldwide and negatively
Celastrol affecting their daily lives. The pathogenesis of psoriasis is complicated, and typical therapeutic strategies for
Niosomes psoriasis mainly focus on anti-inflammation. Considering the side effects, withdrawal rebound, high cost, and
Psoriasis many other disadvantages of existing treatments, we developed a new topical therapeutic formulation consisting
Topical permeation
of niosomes loaded with celastrol, a triterpenoid extracted from Tripterygium. Celastrol niosomes were prepared
by the thin film hydration method and probe sonication. The niosomes were composed of Span 20, Span 60, and
cholesterol at a weight ratio of 3:1:1. The particle size of the niosomes was approximately 147 nm, with yield of
up to 90%. Celastrol niosomes showed improved in vitro permeation ability compared to the raw drug. In our in
vivo study, celastrol niosomes effectively alleviated erythema and scaling on the dorsal skin of psoriasis mouse
models. Spleen weight and the levels of cytokines, including IL-22, IL-23, and IL-17, decreased after the treat-
ment, indicating the high therapeutic potential of this formulation for psoriasis. In conclusion, encapsulation of
celastrol by niosomes increased the water-solubility and permeation of celastrol into the skin, significantly
improving its anti-psoriasis activity in mice.

1. Background countries of different latitudes. Thus, it is now believed that a dry-cold

1.1. Psoriasis
Psoriasis, a chronic non-infectious disease, has been reported
worldwide. Because registration of psoriasis cases is not compulsory,
there are few studies about the onset of psoriasis and these studies are
not very reliable [1]. It is roughly estimated that 3% of people world-
wide have psoriasis [2,3]. Psoriasis could be divided into five types
according to its pathological manifestation, and the most common type
being plaque psoriasis, which causes pain and itching in affected pa-
tients. In addition, it also causes large areas of erythema or scaling on
the skin, resulting in severe disfigurement [4]. All these symptoms
might cause huge negative impacts on patients’ daily lives, such as
difficulties in choosing clothing, taking a shower, and performing out-
door activities.
The incidence of psoriasis was found not to be significantly asso-
ciated with gender, age, or race; however, its incidence is different in
climate might be a major environmental factor inducing psoriasis [5].
Moreover, bacterial infections, injury, mental pressure, and heredity
are considered to be related to psoriasis development [6]. The patho-
genesis of psoriasis is still not completely clear, but it has been found to
be closely related to the IL-17/IL-23 axis [7,8]. It was reported that only
approximately 40% of psoriasis patients are satisfied with the treatment
prescribed by their dermatologist and that approximately over 70% of
patients report low satisfaction regarding treatment [4]. Therefore, to
overcome these unmet clinical needs, it is important to develop new
effective anti-psoriasis drugs.
1.2. Anti-psoriasis treatment
For mild or moderate psoriasis, topical treatments are usually ad-
ministered. UVB treatment and combination medication are adminis-
tered concomitantly to increase the therapeutic efficacy and improve
patient satisfaction [9]. Severe psoriasis is usually treated with oral

⁎
Corresponding author.
E-mail addresses: mb65807@umac.mo (S. Meng), sakura528@126.com (L. Sun), kenwanglun668@gmail.com (L. Wang), mb75810@umac.mo (Z. Lin),
liuzeyujoey@163.com (Z. Liu), xl281213606@163.com (L. Xi), z7wang@ucsd.edu (Z. Wang), yzheng@umac.mo (Y. Zheng).

https://doi.org/10.1016/j.colsurfb.2019.110352
Received 13 March 2019; Received in revised form 15 June 2019; Accepted 6 July 2019
Available online 08 July 2019
0927-7765/ © 2019 Elsevier B.V. All rights reserved.
S. Meng, et al. Colloids and Surfaces B: Biointerfaces 182 (2019) 110352

systemic drugs, such as methotrexate, acitretin, and cyclosporine. Most Table 1

of these chemical drugs have side effects, and their therapeutic effects Primer sequences of mouse genes used in qPCR analysis.
are not always satisfactory [10]. Recent biologics, which are mainly Primer Base sequence (5’ to 3’)
monoclonal antibodies targeting cytokines such as IL-17, IL-23, and
TNF-α, have higher therapeutic effect than the chemical drugs [11]. IL-1β (forward) CCCTGCAGCTGGAGAGTGTGGA
IL-1β (reverse) TGTGCTCTGCTTGTGAGGTGCTG
These biologics are suitable for all types of psoriasis, but owing to high
IL-6 (forward) CCTCTCTGCAAGAGACTTCCAT
price and drug withdrawal rebound, biologics are currently only used IL-6 (reverse) AGTCTCCTCTCCGGACTTGT
for treating moderate-to-severe psoriasis [9]. IL-17 F (forward) ACCCGTGAAACAGCCATGGTCAAG
Tripterygium wilfordii Hook f. has a long history as a traditional IL-17 F (reverse) CCCATGGGGAACTGGAGCGG
Chinese herbal medicine, and it is mainly used for treating rheumatoid IL-22 (forward) CAGCTCCTGTCACATCAGCGGT
IL-22 (reverse) AGGTCCAGTTCCCCAATCGCCT
arthritis and psoriasis [12,13]. Celastrol (Cel), a pentacyclic triterpene
IL-23 (forward) TCCTCCAGCCAGAGGATCACCC
isolated from Tripterygium wilfordii Hook f., had been widely reported IL-23 (reverse) AGAGTTGCTGCTCCGTGGGC
to have antioxidant, anti-inflammatory, and antitumor activity [14]. It IFN-γ (forward) TAACTCAAGTGGCATAGATGTGGAAG
is suspected that Cel exerts its anti-inflammatory activity by inhibiting IFN-γ (reverse) GACGCTTATGTTGTTGCTGATGG
STAT3 (forward) GAAGCCGACCCAGGTGC
the differentiation of Th17 cells through the blockage of pSTAT3 acti-
STAT3 (reverse) GTCACGTCTCTGCAGCTTCT
vation and the induction of microphage apoptosis by downregulating GAPDH (forward) GGGCTCTCTGCTCCTCCCTGT
the NF-kB pathway [15–18]. However, the solubility of Cel in water is GAPDH (reverse) CGGCCAAATCCGTTCACACCG
extremely poor [19]. As there were few literatures reporting topical
delivery systems for Cel, it is necessary to investigate a topical delivery
system which can enhance the solubility, skin permeation, and bioac- 2.2. Animals
tivity of Cel.
Female C57/BL6 mice (18˜22 g) aged 7–9 weeks were provided
1.3. Transdermal formulations from the FHS faculty of the University of Macau and then housed under
specific pathogen-free conditions. All experimental protocols using
Compared to other routes of administration, non-invasive adminis- animals were ratified by the Animal Ethics Committee of University of
tration through the skin allows drugs to avoid the extreme environment Macau, and all experiments shown below were performed according to
in the gastrointestinal tract and the first-pass metabolism of the liver, as the NIH Guidelines for the Care and Use of Laboratory Animals.
well as prevents systemic toxicity by the drugs. Dosing time and ad-
ministration site can also be accurately regulated [20]. The skin consists 2.3. Formula screening
of epidermis, dermis, and subcutaneous tissue. The stratum corneum, the
outermost layer of the epidermis consists of multilayers of dead kera- Cel Nio were prepared by the thin film hydration method with so-
tinocytes and intercellular lipids [21]. The stratum corneum protects the nication. Briefly, a mixture of a nonionic surfactant, cholesterol, and Cel
tissue from dehydration and resists external bacterial invasion, thereby at a specific weight was dissolved in a 2:1 chloroform:methanol solu-
functioning as a strong barrier protecting the internal environment tion (3 mL) in a flask. The organic solvent was removed using a rotary
[22]. Vesicles are a common lipid-based transdermal formulation, evaporator, leaving a layer of membrane material on the wall of the
which include liposomes and niosomes etc. Compared with other flask. The dried surfactant film was then hydrated with 5 mL of water at
transdermal agents, lipid-based nanoparticles may enhance the trans- 60 °C for 30 min with gentle spinning. After that, the suspension was
dermal permeation ability of drugs by changing the structure of the probe-sonicated (125 W, 3 mm probe, 0.5 s/0.5 s) for 4 min to obtain
stratum corneum lipids based on the Like Dissolves Like Theory. These Cel Nio. To increase the elasticity of Nio, Span 20 was used in combi-
nanoparticles may also function as a drug reservoir that can release a nation with Span 60 at a weight ratio of 1/3 to 3/1, and cholesterol was
drug at a steady rate, allowing prolonged release and activity of the used at a weight proportion of 1/2 to 1/5. The hydration period was
drug [23]. Niosomes (Nio), a type of vesicle whose bilayer membrane is screened from 10 to 60 min. The hydration volume was decided ac-
mainly made of nonionic surfactant incorporating cholesterol, have cording to the model of the sonication probe. The probe sonication
higher chemical stability than liposomes because of the surfactants period was screened from 1 to 10 min. All screenings were single-factor
used. Nio also contain a larger amount of surfactant than liposomes, screenings, and the screening parameters were size distribution, poly-
which may also offer a stronger penetration ability [24]. In the devel- dispersity index (PDI), and drug loading.
opment of new formulations, both hydrophilic and lipophilic drugs
could be loaded into Nio. 2.4. Characterization of Cel Nio

2. Materials and methods
2.1. Materials
Cel were obtained from Chengdu Pufei De Biotech Co., Ltd.
(Chengdu, China). Span 20, Span 60, and cholesterol were all pur-
chased from Aladdin Industrial Corporation (Shanghai, China).
Carbopol 974 powder was obtained from Chineway (Shanghai, China).
Imiquimod cream (IMQ; 5%) as Aldara and tacrolimus ointment (0.1%)
as Protopic were purchased from Kangaiduo Drug Store (Guangzhou,
China). Paraformaldehyde (4%) was purchased from Phygene (Fuzhou,
China). High-performance liquid chromatography (HPLC) and LC/MS/
MS systems using acetonitrile and methanol were purchased from
Merck (Darmstadt, Germany). Absolute ethanol and chloroform were
purchased from Damao Chemical Reagent Factory (Tianjin, China).
Hair remover spray foam (Linco Care Ltd, Manchester, England) was
purchased from Sasa (Macau, China).
2.4.1. Size distribution, zeta potential, and yield
The size distribution and zeta potential of Cel Nio was measured by
using a Zetasizer Nano-Series (Malvern, United Kingdom). The samples
for particle size measurement were diluted approximately five fold with
water. Size distribution was expressed as percentage of intensity. The
PDI value was determined to evaluate the quality of size distribution.
For yield measurement, samples were prepared by diluting Cel Nio
by 10 fold with absolute ethanol. Next, the Cel concentration in the
preparation was measured by HPLC according to the method mentioned
above. Yield (Y%) was then calculated using the following formula:
W
Y%= × 100%
Wtotal
where, W and Wtotal are the amount of Cel measured with HPLC and the
total amount of Cel put into the preparation, respectively. Settled Nio
were stored under 4 °C.
Yield (Y%) of Cel Nio was measured with an Agilent 1200 Series

2
S. Meng, et al.
Fig. 1. Particle size distribution (A) and TEM image of Cel Nio (B, C). Bar, 100 nm.
HPLC-DAD system (Agilent Technologies, Santa Clara, USA). A C18
column (Agilent Zorbax; 4.6 mm × 250 mm, 5 μm) equipped with a
guard column was used for the separation at room temperature. The
mobile phase consisted of methanol-0.4% H3PO4 solution (85:15, v/v),
and the elution rate was 1 mL/min. All samples were injected into the
column at a volume of 10 μL. The detection wavelength of Cel was
430 nm.
2.4.2. Morphology
Transmission electron microscopy (TEM) was performed to in-
vestigate the morphology of Cel Nio. A few drops of the diluted Nio
were dried on a carbon-coated copper grid for approximately 1 min.
The free Nio particles were absorbed by a piece of filter paper beneath
the mesh. Phosphotungstic acid (2%) was used for negative staining.
The sample was observed with a Hitachi H-7650 electron microscope
(Hitachi, Tokyo, Japan) at an accelerating voltage of 80 kV.
2.5. In vitro permeation studies
2.5.1. Preparation of psoriatic skin
The dorsal hair of C57BL/6 mice was removed using a razor com-
bined with a depilatory cream. To prevent the depilatory cream from
affecting the anti-psoriasis effect of Cel, the back of the mice was wa-
shed with water after hair removal, and the treatment was administered
three days after hair removal. Cream containing 3 mg of IMQ was ap-
plied topically every day in the morning. After five days of adminis-
tration, all mice were sacrificed using CO2, and the entire back skin was
isolated as psoriatic skin. All subcutaneous tissues were carefully re-
moved using a tweezer.
3
Colloids and Surfaces B: Biointerfaces 182 (2019) 110352
2.5.2. In vitro permeation studies
In vitro permeation studies were performed using a vertical Franz
diffusion cell and a 1-cm2 permeation square (PermeGear, USA). Skin
tissues were prepared according to the method described above. The
receiving medium consisted of 20% ethanol in phosphate buffered so-
lution (PBS) to maintain sink conditions [25]. The skin was paved and
sandwiched between two glass containers with the stratum corneum
facing upwards. Next, 8 mL of ethanol solution was added to the re-
ceiving cells, which were then stirred at a steady rate at 32 °C in a water
bath. Subsequently, 0.4 g of Cel Nio gels (0.02%, w/w) or Cel gels
(0.02%, w/w) were loaded into the donor cells and sealed. At each time
point of 6, 12, 14, 16, 18, 20, 22, and 24 h, 1.5 mL of receiving medium
was collected from the receiving cells and the same volume of fresh
receiving medium was added to the receiving cells.
At the end of the permeation test, psoriatic skin was washed care-
fully, submerged and chopped in a certain amount of dry ethanol, and
then subjected to bath sonication to extract Cel from the skin. LCeMS/
MS was used to quantify Cel content in the skin and receiving medium.
Each group was tested thrice.
LC–MS/MS quantitative analysis was performed with an ABI 4000
Q-Trap™ hybrid triple quadrupole linear ion trap mass spectrometer
(Applied Biosystems, Foster City, CA) used in the positive ion mode,
accompanied by an Agilent 1100 HPLC system (Agilent Technologies,
Santa Clara, USA). The separation was performed using a C18 column
(Agilent Zorbax; 4.6 mm × 250 mm, 5 μm) with a guard column
(Agilent Zorbax) at 30 °C. The mobile phase was run at 1.0 mL/min, and
it consisted of 90% acetonitrile in 5% water and 10% aqueous formic
acid (0.1%), both containing 2 mM ammonium acetate. The multiple
reaction monitoring mode was used for quantification. The iron tran-
sition of Cel was 451.3 → 201.1 m/z, whereas that of hydrocortisone,
S. Meng, et al.
Fig. 2. Psoriatic symptoms in the dorsal skin of mice induced by topical application of IMQ. On the sixth day, photos of the dorsal skin were taken (A). H & E staining
(B, bar =200 μm) was performed to show changes in the inner skin after treatment with Blank Nio gel, Cel gel, Cel Nio gel, and tacrolimus ointment (positive
control). Enlarged figure of the normal (left) and IMQ model (right) groups are also presented for detail (C, Bar =100 μm).
an internal standard, was 363.1→ 121.2 m/z [26–28]. The analysis
conditions were as follows: DP, 50 V; CE, 30 V; ion-spray voltage,
4500 V; ion source temperature, 350 °C; detecting time, 200 ms.
2.6. In vivo study of Cel Nio gels in psoriasis mouse models
2.6.1. Preparation of formulation
To increase the retention time of the topical agents on the skin,
adequate viscosity is needed. Briefly, 0.8% (w/w) Carbopol 974 was
dissolved in a certain amount of water with stirring overnight. A certain
amount of Cel Nio was added to the Carbopol 974 solution, and the
mixture was stirred for 15 min until homogenized. The pH of the gels
was then adjusted to 7 by the dropwise addition of triethanolamine. To
prepare drug suspension gels, Cel was ground and added to blank
Carbopol 974 gels using the same method of preparation.
2.6.2. Establishment of imiquimod-induced psoriatic mouse models
IMQ, a potent immune activator and an TLR7/8 ligand, was re-
ported to induce and exacerbate psoriasis [29]. Thus, it was used to as a
model drug in this study. Briefly, female C57BL/6 mice were allocated
at random into six groups of six mice each. IMQ (active compound
dosage: 3.125 mg per day) was applied to 6 cm2 of the dorsal skin. Four
hours after IMQ administration, 0.4 g of Cel Nio gel, Cel gel, or 0.3 g of
tacrolimus ointment (a positive control) was applied topically to the
dorsal skin on the back of the mice of the respective treatment groups. A
group of mice administered only IMQ at the same dosage served as the
model group. Each group was administered its respective treatment
once a day for five days. The theoretical dosage was 0.08 mg/day/
4
Colloids and Surfaces B: Biointerfaces 182 (2019) 110352
mouse (4 mg/kg) for Cel and 0.1 mg/day/mouse for tacrolimus [30].
2.6.3. Histological evaluation
Animal skin samples were collected, fixed with 4% paraformalde-
hyde, and embedded in paraffin. After deparaffinization and rehydra-
tion, the sections were stained with hematoxylin and eosin (H & E). A
microscope (BDS 200; Aote, China) was used to observe the sections.
2.6.4. Psoriasis Area Severity Index (PASI) evaluation
PASI value was evaluated before each IMQ administration to assess
the severity of inflammation of the skin [31]. The severity of erythema
was scored from 0 to 4 (0, none; 4, severe). The overall score was the
sum of two scores. PASI evaluation lasted for six days.
2.6.5. Weight ratio of spleen to body (spleen/body wt%)
The spleen is the largest immune-related organ in the human body
[32]. Its main function is to participate in immune reactions, phago-
cytosis, and the elimination of aging red blood cells, bacteria, or foreign
antigens; produce lymphocytes and monocytes; and store blood. Spleen
weight is considered an indicator of immune stimulation, and an in-
crease in spleen/body weight ratio may indicate proliferation of im-
mune cells in the spleen, which probably reflects the activation of the
immune system [33]. Mouse spleens were isolated after sacrifice and
quickly weighed to avoid errors due to dehydration.
2.6.6. Measurement of Cel content in the skin and blood using LC–MS/MS
After five days of administration, the mice were sacrificed using
CO2, and total blood samples were collected via the ophthalmic artery,
S. Meng, et al.
Fig. 3. PASI scores of skin lesions in all groups including erythema and scaling were recorded for six days; each score ranged from 0 to 4, and the overall score ranged
from 0 to 8. *Significantly different compared with the IMQ model group (p < 0.05), (n = 6). Cel, celastrol; Nio, niosomes.
Fig. 4. Spleen/body weight ratio was calculated after the mice were sacrificed.
*
Significantly different compared with the IMQ model group (p < 0.05), Cel,
celastrol; Nio, niosomes.
and the dorsal skin was isolated. Plasma samples were obtained im-
mediately by centrifugation at 2000 ×g for 10 min and then stored at
−20 °C until analysis. Skin samples were washed with PBS and cut into
small pieces; each 100 mg of the skin was placed in 1 mL of dry ethanol.
Next, the skin samples were homogenized using a Tissuelyser II
(Qiagen, CA, USA) combined with grinding beads at a frequency of 30/s
for 15 min. Subsequently, the samples were centrifuged at 10,000 rpm
5
Colloids and Surfaces B: Biointerfaces 182 (2019) 110352
Table 2
Cel content in the skin and blood following application of Cel formulation
(0.08 mg/day/mouse) on IMQ-induced psoriatic mouse models.
Groups CCel in skin (ng/mg) CCel in blood (ng/mL)
0.02% Cel gel 0.86 ± 0.03 ND
0.02% Cel Nio gel 1.67 ± 0.05* ND
Data are shown as mean ± SD (n = 6). *Significantly different compared with
the Cel gel group (p < 0.05). ND, not detected; Cel, celastrol; Nio, niosomes;
CCel in skin, Cel concentration in the skin; CCel in blood, Cel concentration in blood.
and 4 °C for 5 min, and 200 μL of the supernatant was filtered using a
0.22-μm filter to obtain skin samples. Before the determination of Cel
content, internal standard solution (50 μg/mL hydrocortisone in me-
thanol) was mixed with blood samples at a ratio of 1:5 (v/v)”, Next,
300 μL of ethyl acetate was added to the mixture, which was then ex-
tracted by vortex mixing for 2 min [34]. After centrifuging the mixture
at 12,500 rpm for 15 min, 200 μL of the supernatant was collected and
evaporated. The remaining solids were dissolved in 100 μL of acetoni-
trile, and all samples were analyzed for Cel content with LC–MS/MS.
2.6.7. Cytokine level evaluation
RIPA Lysis Buffer (Beyotime, China) containing 1 mM of phe-
nylmethanesulfonyl fluoride was used to extract total protein from the
skin tissue homogenate. Total protein concentration was determined
using a BCA Protein Assay Kit (Tiangen Biotech, China). Total protein
was diluted to approximately 500 μg/mL before the IL-23P40, IL-22, IL-
17A, and IFN-γ levels were analyzed using a Bio-Plex™ 200 system (Bio-
Rad, USA) according to the manufacturer’s instructions.
2.6.8. Quantitative PCR (qPCR)
Total RNA was extracted by homogenizing 100 mg of mice skin in
1 mL of RNAiso Plus (TaKaRa, Korea Biomedical Inc.). The isolated total
S. Meng, et al.
Fig. 5. Inflammatory cytokine content in the skin of mice from all groups. A. IL-22; B. IL-23p40; C. IL-17; D. IFN-γ. *Significantly different compared with the IMQ
model group, p < 0.05. #Significantly different compared with the Cel gel group, p < 0.05. (n = 6). Values are shown as mean and SD. Cel, celastrol; Nio,
niosomes.
RNA was then reverse-transcribed into cDNA using a PrimeScript RT
Reagent Kit (TaKaRa, Bio Inc.) on a C1000 touch thermal cycler system
(Bio-Rad). Afterwards, qPCR was conducted using SYBR Premix Ex Taq
II (TaKaRa, Bio Inc.) and a Mx3005 P qPCR System (Agilent
Technologies, USA). The primer sequences used are shown in Table 1.
We used the comparative ΔΔCT method to quantify gene expression.
Target gene expression levels in the test samples were normalized to
endogenous GAPDH levels and expressed as fold differences relative to
GAPDH gene expression in the untreated baseline controls. All assays
were performed in triplicate, and the experiments were repeated at
least three times.
Data are showed as mean ± SD. Significant differences between
different groups were determined by repeated measures or one-way
ANOVA using GraphPad Prism 7, and p < 0.05 was considered sig-
nificant.
6
Colloids and Surfaces B: Biointerfaces 182 (2019) 110352
3. Results and discussion
3.1. Characterization of Cel Nio
After preliminary screening of the formulation (data not shown), a
Span 20, Span 60, and cholesterol ratio of 3:1:1 (w/w/w), hydration
time of 30 min, and sonication time of 2 min were selected. This opti-
mized formulation had a smaller particle size and higher drug loading
ability. Therefore, this formulation was selected to be used in the
subsequent experiment. A graph of size distribution is shown in
Fig. 1(A). The particle size of Cel Nio was approximately 147.4 nm ±
5.6 nm with a PDI of 0.258 ± 0.02, indicating a homogenous popu-
lation for a colloidal system [35]. The zeta potential was -48.9 mV ±
1.1 mV, indicating a good colloidal stability [36]. The Y% was
90.42% ± 3.38%. TEM results of Cel Nio are shown in Fig. 1(B, C). The
results showed that numerous Nio fused in the absence of water, and all
single Nio had spherical shape. Cel crystals were not observed in the
TEM results. These size analysis results correlated well with the results
of size distribution analysis.
S. Meng, et al.
Fig. 6. The mRNA levels of cytokines in the skin of mice after administration of the different formulations. A, IL-22; B, IL-23; C, IL-1β; D, IL-6; E, IFN-γ; F, IL-17; G,
STAT3. *Significantly different compared with the IMQ only group, p < 0.05. #Significantly different compared with the Cel gel group, p < 0.05, (n = 6). Values
are shown as mean and SD. Cel, celastrol; Nio, niosomes.
The permeation mechanism of formulations containing nonionic-
surfactant, such as Nio, was reported previously [37]. Briefly, surfac-
tant can penetrate into intercellular spaces and increase the fluidity of
the lipid. The penetrating surfactant can also bind with keratin fila-
ments and disrupt the intercellular structure. In addition, nonionic
surfactants are reported to emulsify sebum, thereby raising the ther-
modynamic coefficient of drugs and improving their permeation ability.
3.2. In vitro permeation study
Drug content in the skin was measured by HPLC. For the Cel Nio gel
group, the Cel content was 465.3 ± 84.1 ng/cm2. For the Cel gel
group, only 35.5 ± 1.6 ng/cm2 of Cel was detected, indicating that the
enhanced solubility of Cel in Nio may enhance its skin permeation.
However, Cel was not detected in the receiving medium even at the 24-
h time point.
7
Colloids and Surfaces B: Biointerfaces 182 (2019) 110352
3.3. Histology evaluation
Histology evaluation results are shown in Fig. 2. Compared to the
normal group, the IMQ model group showed obviously thickened skin
covered with white desquamation. After treatment with different for-
mulations, white scales and erythema were apparently reduced in the
Cel Nio gel-treated groups and tacrolimus-treated group. H & E-stained
skin sections showed that inflammatory cells, hyperkeratosis and
parakeratosis were reduced in the Cel Nio gel group compared with the
IMQ model group.
3.4. PASI evaluation
Skin erythema and scaling condition in all groups were scored, and
the results are shown in Fig. 3. The skin condition of mice in the Blank
Nio gel and Cel gel groups were slightly better than that in the IMQ
model group, suggesting that Blank Nio gel and Cel gel had a slight
positive effect against inflammation in psoriatic skin, possibly a
cleaning or moisturizing effect. However, the Cel Nio gel group showed
S. Meng, et al.
a much lower scaling and erythema score than the Blank Nio gel and
Cel gel groups. After six days, the least and most severe pathological
skin conditions were observed in the positive control and IMQ model
groups, respectively.
3.5. Spleen/body weight ratio evaluation
As shown in Fig. 4, after five-day administration of IMQ, the average
spleen/weight ratio in the IMQ model group was approximately three
times that of the normal group, indicating a higher level of immune
cells in the spleen. Compared to the normal group, the Cel Nio gel-
treated and tacrolimus-treated groups both showed a significant de-
crease in spleen weight ratio, which was more obvious than that shown
by the group treated with Blank gel or Cel gel.
3.6. Measurement of Cel content in the skin and blood
Cel content in mouse skin and blood was measured in the groups
treated with Cel gel and Cel Nio gel. As shown in Table 2, Cel Nio gel-
treated mice showed higher drug content in the skin than the Cel gel
groups, Furthermore, combined with the results of the in vitro per-
meation test, it was indicated that incorporation of Cel into Nio im-
proved the permeation of Cel. While no blood Cel content was detected
in the Cel gel and Cel Nio gel group. Therefore, more studies need to be
performed to explain how does Cel take effect in vivo.
3.7. Cytokine level measurement
The levels of IL-22, IL-23p40, IL-17, and IFN-γ were measured, and
the results are shown in Fig. 5. Compared with those in the normal
group, IL-17, IL-23p40, IFN-γ, and IL-22 levels were significantly higher
after administration of IMQ, indicating that topical administration of
IMQ induced the secretion of IL-23p40, IL-17, IFN-γ, and IL-22. The Cel
Nio gel and tacrolimus groups both showed obvious inhibition of IL-
23p40, IL-17, IFN-γ, and IL-22 release. Moreover, the levels of these
cytokines in the Cel gel and Blank Nio gel groups were significantly
higher than those in the Cel Nio gel group, indicating that Cel Nio gel
formulation had a good anti-inflammatory effect.
3.8. qPCR analysis
qPCR was used to quantify the mRNA levels of inflammatory cyto-
kine genes, which represent the severity of psoriasis. The results are
shown in Fig. 6. Compared with the normal group, the mRNA levels of
IL-22, IL-23, IL-1β, IL-6, IFN-γ, and IL-17 F significantly increased in the
IMQ model group. However, the mRNA levels of these cytokines de-
creased in both Cel gel and Cel Nio gel groups. These results indicated
that Cel possessed a good anti-inflammatory effect and that this effect
was improved by the incorporation of Cel into Nio. Compared with
those in the IMQ model group, the levels of IL-1β, IL-6, etc. in the Cel
gel group also decreased, probably because the Cel dose was much
higher than the minimum effective dose and the amount of drug par-
ticles that were in direct contact with the skin was sufficient to exert a
therapeutic effect on the immune system.
4. Conclusion
In this study, Nio hydrogels loaded with Cel were developed as an
effective treatment of psoriasis-like mouse model induced by IMQ. Cel
Nio had an average particle size of approximately147 nm with small
PDI. Encapsulation of Cel into Nio increased the water-solubility and
permeation of Cel in the skin, significantly improving its anti-psoriasis
activity in the mice model. Thus, the results indicated the potential
application of Cel Nio hydrogel in psoriasis therapy.
8
Colloids and Surfaces B: Biointerfaces 182 (2019) 110352
Acknowledgement
This study was financially supported by the Macao Science and
Technology Development Fund (0013/2018/A1).
References
[1] W.H. Organization, Global Report on Psoriasis. 2016, WHO Library Cataloguing-in-
Publication Data, 2016.
[2] J. Kim, J.G. Krueger, Psoriasis and Other Skin Inflammatory Diseases,
Inflammation: From Molecular and Cellular Mechanisms to the Clinic, (2018), pp.
1091–1104.
[3] J.M. Crow, Psoriasis uncovered: science is finally getting to grips with this enig-
matic autoimmune disease, Nature 492 (2012) S50–S50.
[4] L. Dubertret, U. Mrowietz, A. Ranki, P. Van De Kerkhof, S. Chimenti, T. Lotti,
G. Schäfer, European patient perspectives on the impact of psoriasis: the EUROPSO
patient membership survey, Br. J. Dermatol. 155 (2006) 729–736.
[5] C. Ferrándiz, S. Puig, R. Pujol, A. Smandía, Prevalence of psoriasis in Spain
(Epiderma Project: phase I), J. Eur. Acad. Dermatol. Venereol. 15 (2001) 20–23.
[6] N. Baumgarth, C.L. Bevins, Autoimmune disease: skin deep but complex, Nature
449 (2007) 551.
[7] P. Mudigonda, T. Mudigonda, A.N. Feneran, H.S. Alamdari, L. Sandoval,
S.R. Feldman, Interleukin-23 and interleukin-17: importance in pathogenesis and
therapy of psoriasis, Dermatol. Online J. 18 (2012) 1.
[8] L. Grine, L. Dejager, C. Libert, R.E. Vandenbroucke, An inflammatory triangle in
psoriasis: TNF, type I IFNs and IL-17, Cytokine Growth Factor Rev. 26 (2015)
25–33.
[9] S. Rizvi, K. Chaudhari, B.A. Syed, The Psoriasis Drugs Market, Nature Publishing
Group, 2015.
[10] J.M. Crow, Silencing psoriasis, Nature 492 (2012) S58.
[11] D.B. Dubin, W. Tanner, R. Ellis, Biologics for Psoriasis, Nature Publishing Group,
2003.
[12] C. Wu, H.-Z. Jin, D. Shu, F. Li, C.-X. He, J. Qiao, X.-L. Yu, Y. Zhang, Y.-B. He, T.-
J. Liu, Efficacy and safety of Tripterygium wilfordii Hook F versus acitretin in
moderate to severe psoriasis vulgaris: a randomized clinical trial, Chin. Med. J. 128
(2015) 443.
[13] S. Meng, Z. Lin, Y. Wang, Z. Wang, P. Li, Y. Zheng, Psoriasis therapy by Chinese
medicine and modern agents, Chin. Med. 13 (2018) 16.
[14] S.H. Venkatesha, K.D. Moudgil, Celastrol and Its Role in Controlling Chronic
Diseases, Anti-Inflammatory Nutraceuticals and Chronic Diseases, Springer, 2016,
pp. 267–289.
[15] S.-R. Chen, Y. Dai, J. Zhao, L. Lin, Y. Wang, Y. Wang, A mechanistic overview of
triptolide and celastrol, natural products from Tripterygium wilfordii hook F, Front.
Pharmacol. 9 (2018) 104.
[16] B. Astry, S.H. Venkatesha, A. Laurence, A. Christensen-Quick, A. Garzino-demo,
M.B. Frieman, J.J. O’Shea, K.D. Moudgil, Celastrol, a Chinese herbal compound,
controls autoimmune inflammation by altering the balance of pathogenic and
regulatory T cells in the target organ, Clin. Immunol. 157 (2015) 228–238.
[17] L. Hong, Establishment of a Mouse Model of Lupus-like Syndrome and Anti-in-
flammatory Immunosuppressive Effect of Tripterine, Shanghai: PhD thesis of Fudan
University (2006).
[18] C. Mingxiang, F. Yujing, W. Dingyong, Y. Wen, Research progress of tripterine,
Chin. Patent Med. 32 (2010) 473–476.
[19] ChemSpider, Royal Society of Chemistry, 2015.
[20] G. Verma, Transdermal drug delivery system, advance development and evaluation-
a review, Int. J. Pharm. Sci. Res. 8 (2017) 385.
[21] L. Norlén, Update of technologies for examining the stratum corneum at the mo-
lecular level, Br. J. Dermatol. 171 (2014) 13–18.
[22] M.B. Brown, G.P. Martin, S.A. Jones, F.K. Akomeah, Dermal and transdermal drug
delivery systems: current and future prospects, Drug Deliv. 13 (2006) 175–187.
[23] P.L. Honeywell-Nguyen, J.A. Bouwstra, Vesicles as a tool for transdermal and
dermal delivery, Drug Discov. Today Technol. 2 (2005) 67–74.
[24] R. Sharma, R. Mahatma, M. Bharkatiya, A. Goyal, Niosomes -as potential drug
delivery system, Int. J. Drug Res. Technol. 2 (2017) 8.
[25] Y. Chen, L. Zhou, L. Yuan, Z.-h. Zhang, X. Liu, Q. Wu, Formulation, characteriza-
tion, and evaluation of in vitro skin permeation and in vivo pharmacodynamics of
surface-charged tripterine-loaded nanostructured lipid carriers, Int. J.
Nanomedicine 7 (2012) 3023.
[26] X.-k. OuYang, M.-q. Cai, X.-h. Chen, M.-c. Jin, Development and validation of a
liquid chromatography coupled with atmospheric-pressure chemical ionization ion
trap mass spectrometric method for the simultaneous determination of triptolide,
tripdiolide, and tripterine in human serum, J. Anal. Toxicol. 32 (2008) 737–743.
[27] Y. Huang, D. Zhou, T. Hang, Z. Wu, J. Liu, Q. Xu, X. Xie, J. Zuo, Z. Wang, Y. Zhou,
Preparation, characterization, and assessment of the antiglioma effects of liposomal
celastrol, Anticancer Drugs 23 (2012) 515–524.
[28] S. Wu, W. Li, T. Mujamdar, T. Smith, M. Bryant, F.L. Tse, Supported liquid ex-
traction in combination with LC‐MS/MS for high‐throughput quantitative analysis
of hydrocortisone in mouse serum, Biomed. Chromatogr. 24 (2010) 632–638.
[29] J.K. Wu, G. Siller, G. Strutton, Psoriasis induced by topical imiquimod, Australas. J.
Dermatol. 45 (2004) 47–50.
[30] L. Sun, Z. Liu, L. Wang, D. Cun, H.H. Tong, R. Yan, X. Chen, R. Wang, Y. Zheng,
Enhanced topical penetration, system exposure and anti-psoriasis activity of two
particle-sized, curcumin-loaded PLGA nanoparticles in hydrogel, J. Control. Release
254 (2017) 44–54.
S. Meng, et al.
[31] L. van der Fits, S. Mourits, J.S. Voerman, M. Kant, L. Boon, J.D. Laman,
F. Cornelissen, A.-M. Mus, E. Florencia, E.P. Prens, Imiquimod-induced psoriasis-
like skin inflammation in mice is mediated via the IL-23/IL-17 axis, J. Immunol.
182 (2009) 5836–5845.
[32] A. De Porto, A. Lammers, R. Bennink, I. Ten Berge, P. Speelman, J. Hoekstra,
Assessment of splenic function, Eur. J. Clin. Microbiol. Infect. Dis. 29 (2010)
1465–1473.
[33] M.F. Cesta, Normal structure, function, and histology of the spleen, Toxicol. Pathol.
34 (2006) 455–465.
Colloids and Surfaces B: Biointerfaces 182 (2019) 110352
[34] Q. Xu, M. Huang, M. Jin, Q. Ren, LC–APCI–MS–MS for the determination of ce-
lastrol in human whole blood, Chromatographia 66 (2007) 735–739.
[35] S. Singh, P. Parashar, J. Kanoujia, I. Singh, S. Saha, S.A. Saraf, Transdermal po-
tential and anti-gout efficacy of Febuxostat from niosomal gel, J. Drug Deliv. Sci.
Technol. 39 (2017) 348–361.
[36] T.M. Riddick, Control of colloid stability through zeta potential, Blood 10 (1968).
[37] I. Som, K. Bhatia, M. Yasir, Status of surfactants as penetration enhancers in
transdermal drug delivery, J. Pharm. Bioallied Sci. 4 (2012) 2.