Biology Lecture L3

Summary
• Genetic information in organisms is made up of nucleotide sequences consisting of
A T G and C nucleotides ie ATGCCCGGTTAATTAGCCCCC
• Genetic information, made up of nucleotide sequences that are located in DNA
molecules.
• Collection of DNA molecules in a organism is called a Genome.
• Rice genome (haploid) has 12 chromosomes and Humans have 23(Haploid)
chromosomes.
• Genetic information made up of ATGC nucleotide sequences is universal!!!
• Nucleotide sequences organized on DNA as information(language of DNA) packets
are called GENES.
• Genes provide information to synthesise proteins and RNA (3 types of RNA which are
nucleic acids).
Genetic Information in GENES

DNA in each cell of an organism contain all the genetic information

needed to build, grow, develop, survive, maintain, reproduce and
death of a single celled or multicellular organism.
DNA Sequence Data Bases
1-Human Genome Sequence Data Base (http://www.ensembl.org/) &
Several more
2- Rice Genome Sequence Data Base ?  International Rice
Genome Sequencing Project (IRGSP). The database can be
accessed at http://www. dna.affrc.go.jp:82/giot/INE.html or
its mirror site at http://www.staff.or.jp/giot/INE.html
What are GENES ?
Simply genes can be considered as sections of DNA that holds the
instructions/information as Units or Packets of Genetic Information
that are organized on DNA strands and they instruct cells to make
specific functional gene products.
Genes contains genetic information for making 2 types specific functional
gene products ie RNA and Proteins. (for the moment we will focus on genes
that give instructions to make proteins)
DNA language is universal among organisms irrespective whether you are a
bacterium ,a plant, an animal or a extinct Dinosaur ( Jurassic park ????)
DNA can be considered as the “genetic code of life” – a molecular instruction
manual with instructions  on how to build, develop, survive, maintain life,
function, reproduce and death for microbes to plants to humans.
DNA is called the blueprint of life because it contains the instructions needed to
build living organisms
This instruction manual is accurately copied by DNA Replication and passed on
from mother to daughter cells.(Later discussed)
Why DNA Replication is important ?
Genes to Proteins
Cells in all organisms possesses a full set of DNA sequences
organized as GENES that carry and store genetic information
as instructions required for all the proteins the organism will
ever synthesize.
How can one kind of molecule contain all the instructions for
making complicated living beings like ourselves?
Genes, to synthesize proteins undergo gene expression.
During gene expression sequence of nucleotides in Genes is
converted to a sequence of amino acids in protein via
transcription and translation.(Details Later)
How do Genes Direct the Production of Proteins?

Genes contain the information needed to make

proteins. The journey from gene to protein is complex .
It consists of two major steps: transcription and
translation. Together, transcription and translation are
known as gene expression.
GENE GENE EXPRESSION PROTEINS
DNA, RNA, and the Flow of Information –
(What Information?)
Replication

Transcription Translation
Through the processes of transcription and translation
genetic information organized as DNA nucleotide sequence
of genes is used to make proteins.
Computers and DNA
DNA’s coded instructions can be considered as molecular “software”
that runs the “hardware” of life. Just as word processing program tells
the computer hardware what to do, DNA’s coded instructions on
cellular proteins controls life machinery

The main difference between computer hardware and software is that

hardware is a physical component of a computer, whereas software is a
program that relies on the hardware to function
Proteins-Play an Essential Role in LIFE

Proteins play a essential role in cellular activities involved in LIFE of cells in

organisms and are the basic unit of structure and function in the cells of
organisms and deserve serious consideration.
Since Proteins are not heritable, genes made up of DNA can be considered as
the permanent form of proteins which get transmitted from one generation
to the next generation.
•Since 1971, the Protein Data Bank archive (PDB) has served as the single
repository of information about the 3D structures of proteins, nucleic acids, and complex assemblies.
•The Worldwide PDB (wwPDB) organization manages the PDB archive and ensures that the PDB is freely and publicly available to the
global community. Since 1971, the Protein Data Bank archive (PDB) has served as the single repository of information about the 3D
structures of proteins, nucleic acids, aSince The Worldwide PDB (wwPDB) organization manages the PDB archive and ensures that the
PDB is freely and publicly available to the global community.
Some proteins Function as Single Proteins example
Some proteins Function as Complex of Proteins for
example
a)  H+/K+ ATPase is b) Na+/K+ ATPase/
the proton pump of the Stomach. Na+/K+
Pump
We know that almost all cellular activities are carried out by proteins.
For accurate activity or functions of cellular proteins, its 3D structure or
shape is very important.
3D structure of proteins is determined
by the linear amino acid sequence
(primary structure of a protein).
For this reason assembly of amino
acids in their correct order as encoded in
nucleotide sequence of genes is absolutely critical to
the synthesis of functional proteins.
The Protein Data Bank archive (PDB) has served as the single repository of information about the 3D structures of
proteins, nucleic acids, and complex assemblies.
The Worldwide PDB (wwPDB) organization manages the PDB archive and ensures that the PDB is freely and publicly
available to the global community.
DNA, RNA, and the Flow of Information –
(What Information?)
Replication

Transcription Translation
Classification of Genes
Genes can be classified according to the type of gene products. There
are 3 kinds of genes based on the type of RNA produced following
transcription;
1) tRNA genes undergo transcription to produce tRNA molecules
2) rRNA genes undergo transcription to produce rRNA molecules
3) MicroRNA (miRNA) genes undergo transcription to produce
miRNAs
There is 1 kind of gene based not on the type of RNA but on Protein
4) Protein coding genes undergo transcription to produce mRNA molecules
that undergo translation to synthesize proteins.
All together there are 4 kinds of genes
These 3 kinds of RNA molecules are absolutely essential for synthesis
of Proteins

If you don’t remember what tRNA, rRNA and mRNA synthesize

proteins A very brief look at
Protein Coding Genes and Non –Protein Coding Genes
• Some genes contain instructions for making Proteins. These genes at first
undergo transcription to make messenger RNA (mRNA) ,which undergo
translation to synthesize Proteins.
• The DNA sequences which are organized as genes to encode for proteins are
known as coding DNA and the genes are referred to as protein coding genes.
Protein gene Transcription mRNA Translation Polypeptide
Non –Protein Coding Genes

• Some genes contain instructions for making RNA molecules such

transfer RNA (tRNA), and ribosomal RNA (rRNA) that are essential
for synthesis of proteins and
• Some specialized genes contain instructions for making functional
RNA molecules i.e. MicroRNAs (miRNA) and these RNA molecules
function by affecting cellular processes directly regulate (control) the
expression of mRNA.
• The DNA sequences which do not encode for proteins are known as
non-coding DNA and the tRNA, rRNA and miRNA genes are referred
to as non-protein coding genes.
Sequencing of Rice Genomes-
Why??
In order to determine the nucleotide sequence of the 12 DNA molecules in 12 chromosomes of
in a Rice Genome Several countries got together to complete the project.

• 1 Japan, Korea
• 2 United Kingdom (EU), Canada
• 3 USA
• 4 China (indica variety Guang Lu Ai 4)
• 5 Taiwan
• 6 Japan
• 7 (Yet to be claimed)
• 8 (Yet to be claimed)
• 9 Thailand
• 10 USA
• 11 India, USA
• 12 France