Bioresource Technology 294 (2019) 122165

Contents lists available at ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Influence of matured compost inoculation on sewage sludge composting: T

Enzyme activity, bacterial and fungal community succession
Chuang Maa,b, Bin Hua, Ming-Bao Weia,b, Ji-Hong Zhaob, Hong-Zhong Zhangb,
⁎

a
School of Materials and Chemical Engineering, Zhengzhou University of Light Industry, Zhengzhou, China
b
Henan Collaborative Innovation Center of Environmental Pollution Control and Ecological Restoration, Zhengzhou University of Light Industry, Zhengzhou, China

GRAPHICAL ABSTRACT

ARTICLE INFO ABSTRACT

Keywords: The influence of matured compost inoculation during sewage sludge with sawdust composting was assessed.
Sewage sludge Mature compost reduced the heating rate, thermophilic phase, peak temperature, and volatile solid degradation
Composting rate, with no significant effect on pH and germination index. Matured compost addition also increased the
Matured compost cellulase, peroxidase, arylsulfatase, and urease contents during the mesophilic phase, and increased the urease
Enzyme activity
content but decreased the cellulase, peroxidase, protease, and arylsulfatase contents during the cooling phase,
Bacteria
Fungi
with no significant effect on enzyme activities at the thermophilic phase. Matured compost increased the di-
versity of bacteria during the mesophilic and thermophilic phases, but reduced the fungal diversity throughout
composting. Matured compost significantly improved uniformity of the bacterial community and affected the
structure of the bacterial and fungal communities, while changing the correlation between some functional
microorganisms and enzyme activities. These results provide guidance for optimizing the composting process
when matured compost as bulking agent.

1. Introduction
Sewage sludge (SS) is the by-product of municipal wastewater
treatment, and aerobic composting has been globally applied as an ef-
fective and cost-efficient process for its management and reuse (Wang
et al., 2019a). However, SS cannot be composted alone owing to its
high moisture content (about 80%) and poor air permeability (Zhou
et al., 2014), and therefore must be mixed with bulking agents to re-
duce the moisture content and improve the free air space of composting
materials (Ma et al., 2019). Numerous studies have evaluated the effect
of these bulking agents such as sawdust, straw, cotton waste, and ma-
tured compost to regulate the physicochemical properties of the matrix

⁎
Corresponding author: School of Materials and Chemical Engineering, Zhengzhou University of Light Industry, Zhengzhou 450001, China.
E-mail address: zhz@zzuli.edu.cn (H.-Z. Zhang).

https://doi.org/10.1016/j.biortech.2019.122165
Received 17 August 2019; Received in revised form 17 September 2019; Accepted 18 September 2019
Available online 20 September 2019
0960-8524/ © 2019 Elsevier Ltd. All rights reserved.
C. Ma, et al.
during composting (Fan et al., 2019; Nie et al., 2019; Wang et al.,
2019b; Zhou et al., 2014). Among them, mature compost has attracted
substantial attention as a readily available material with porous, low
moisture content, and cost-efficient features, along with a certain vac-
cination effect (Maeda et al., 2018; Wang et al., 2018a). More im-
portantly, mature compost recycling is widely used to reduce the do-
sage of organic bulking agents in practical composting processes (Wang
et al.,2018a; Wang et al., 2018b), which can significantly reduce the
cost of SS composting (Zhou et al., 2014).
Mature compost can conserve nutrients, reduce total greenhouse gas
emissions (Yang et al., 2019; Maeda et al., 2018), and accelerate mi-
crobial succession to consequently shorten the composting period (Iqbal
et al., 2010). Further, Yang et al. (2019) found that mature compost did
not significantly affect the composting process, and the total green-
house gas emissions during kitchen waste composting were reduced by
692%. Since microorganisms are key players in the composting process
(Wang et al., 2018a) and affect the degradation of specific substrates by
secreting extracapsular enzymes (Du et al., 2019), understanding the
detailed dynamics of the microbial community specific to these sub-
strates is crucial for achieving process optimization (Sundberg et al.,
2013). However, knowledge regarding the microbial communities in-
volved in the effects of mature compost addition during sludge com-
posting is comparatively limited (Akyol et al., 2019). In particular,
there is minimal information as to how mature compost inoculation
affects microbial community succession and enzyme activity.
Accordingly, in this study, the influence of matured compost addi-
tion on microbial communities and corresponding enzyme activities
was assessed. In practical production, matured compost is only used as
an amendment for SS composting, which often results in a large amount
of nitrogen loss and substantial NH3 pollution due to the low C/N ratio
of matured compost (Karak et al., 2014). Therefore, we replaced 50%
sawdust by matured compost to reduce the cost of composting acces-
sories and regulate the physicochemical properties of the matrix in
practical application. The specific objectives of this study were to: 1)
investigate the effect of matured compost on the composting process,
and the feasibility of replace the current use of 50% sawdust as a
bulking agent. 2) determine the effect of matured compost on enzyme
activities during composting, including aryl-sulfatase, urease, protease,
cellulase, and peroxidase, and 3) confirm the influence of inoculation of
matured compost on bacterial and fungal diversity and community
structure. These results will provide a better understanding of the un-
derlying mechanisms responsible for the variation in microbial func-
tions in compost amended with matured compost.
2. Materials and methods
2.1. Compost materials
Dewatered SS was collected from the Shuangqiao municipal was-
tewater treatment plant (Zhengzhou, China). The sawdust comprised
pine wood particles (1–2 mm). Matured compost was collected from
compost products fermented with sawdust and sludge (weight:weight
3:1) for > 180 days. The germination index (GI) and C/N ratio of the
matured compost were 93.12% and 17.51 (Table 1), which implies that
Table 1
Physicochemical properties of the raw materials.
Parameters Sewage Sawdust Matured Pile A Pile B
sludge Compost
pH 8.32 8.55 7.51 8.50 7.85
Moisture content 80.52 7.23 27.21 61.44 63.19
(%)
C/N ratio 13.32 140.30 17.51 34.23 30.77
Weight (kg) – – – 120.00 120.00
GI (%) 13.22 – 93.12 33.61 35.20
2
Bioresource Technology 294 (2019) 122165
the compost was matured (Bernal et al., 2009; Hussain et al., 2018;
Wang et al., 2016; Wang et al., 2019a).
Experiments were performed with two composting mixtures, with
one reactor for each mixture:
Pile A: SS (75%) + Sawdust (25%)
Pile B: SS (75%) + Sawdust (12.5%) + Matured compost (12.5%)
The physicochemical properties of the experimental materials are
shown in Table 1.
2.2. Composting process
Composting was conducted in two separate but identical reactors for
10 days (Fig. 1). The reactors had a height of 120 cm, an inner diameter
of 60 cm, and an effective volume of 280 L. They were made from
polyethylene and covered with a 3-cm-thick rubber board for thermal
insulation. A removable lid with a small hole (2 cm diameter) was
placed on the top of each reactor, with uniformly distributed holes
(1 cm diameter) made at the bottom of each reactor. Temperature
sensors were embedded in a metal bar placed at heights of 20, 40, and
60 cm. A blower was installed at the bottom of the reactor, and aeration
was provided at 0.5 L/min−1·kg−1 (0–2 d) and 1.87 L/min−1·kg−1 (dry
weight basis, 3–10 d); the ventilator was run for 3 min and then stopped
for the next 17 min.
The present study focused on the first fermentation stage of aerobic
composting, which reflects the microbial metabolic process and usually
took 10–12 days. Therefore, sampling was scheduled on days 0, 3, 5, 7,
and 10 after installation. Triplicate samples were collected from each
pile at a depth of about 50 cm and stored at −4 °C immediately until
used for analysis.
2.3. Physicochemical analysis
The moisture content of composting materials was determined by
drying the samples at 105 °C for 24 h (Tiquia and Tam, 1998). The
volatile solids (VS) content was determined by measuring the loss of
dry-solid mass after ignition at 550 °C in a muffle furnace for 24 h
(Awasthi et al., 2015). The pH was measured at a ratio of 1:5 (wet
weight of composting sample:moisture volume) after shaking equili-
bration for approximately 30 min using a combination pH meter (E-
201-C, Lei-ci, Shanghai, China). The germination index (GI) was de-
termined using Brassica chinensis according to the method of Ouyang
et al. (2014).
The activities of five microbial enzymes (cellulase, urease, protease,
arylsulfatase, and peroxidase) were determined at each sampling time.
Protease activity was measured according to the method of Cai & Shen
(2005). Urease activity was determined using the procedure described
by Nannipieri et al. (2002). The activities of arylsulfatase and perox-
idase were measured by Thermo Scientific multiskan (FC, Thermo
Fisher Scientific, Waltham, MA, USA) according to methods detailed by
The Allison Lab (1994). The cellulase activity was measured according
to the method of Ghose (1987).
To determine the bacterial and fungal diversity during the com-
posting process, microbial DNA was extracted from each pile in the
mesophilic phase (day 3), thermophilic phase (day 5), and cooling
phase (day 10) using FastDNA soil rotation kit (MPBIO, USA) according
to the changes of pile temperature. The final DNA was purified and the
concentration was determined by a NanoDrop 2000 UV–vis spectro-
photometer (Thermo Scientific, Wilmington, DE, USA). The V3-V4 hy-
pervariable regions of the bacterial 16S rRNA gene were amplified with
primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACH-
VGGGTWTCTAAT) and the V5-V7 regions of the fungal 18S rRNA gene
were amplified with primers SSU0817F (TTAGCATGGAATAATRRAA-
TAGGA) and 1196R (TCTGGACCTGGTGAGTTTCC).
C. Ma, et al.
Fig. 1. Schematic diagram of the composting reactor.
2.4. Statistical analysis
The data are presented as the mean values and standard deviations
calculated using Microsoft Excel software (Version 2016, USA) and
figures were generated using OriginPro (Version 9.4, USA). The least
significant differences among the mean values during composting were
calculated at a probability level of P < 0.05 using SPSS software
(Version 24.0, USA). A large proportion of carbon is lost due to the
release of CO2 during the degradation of VS (Awasthi et al., 2016). The
degradation rate of VS was calculated as follows (Wang et al., 2019a):
(Ai × C0 A 0 × Ci)
Degradationrate = × 100%
(Ai × C0)
where A0 is the ash content of the original compost material, Ai is the
ash content of the compost on day i, C0 is the VS content of the original
compost material, and Ci is the VS content of the compost on day i.
3. Results and discussion
3.1. Dynamics of physicochemical parameters
3.1.1. Changes in temperature
Temperature has been widely recognized as one of the most im-
portant parameters in the composting process (Zhou, 2017), which can
directly reflect the composting efficiency and microbial activity (Wang
et al., 2019b). As shown in Fig. 2a, Pile A and Pile B reached the highest
temperatures on day 4 and day 5 at 72.23 °C and 57.95 °C, respectively.
The peak temperature, or heating rate, of pile A was clearly higher than
that of pile B. This may be due to the addition of the matured compost
in Pile B, which would result in a lower content of easily degradable
organic matter (Iqbal et al., 2010). In addition, both Pile A and Pile B
had a long high thermophilic duration of 9 days and 7 days (≤50 °C),
which could meet the hygienic index of composting, while effectively
killing pathogenic bacteria and weed seeds in the compost (Wang et al.,
2019b), respectively.
3.1.2. Changes in pH
The pH also strongly affects microbial activity during composting
(Bareither et al., 2013), and the degradation process can be enhanced
3
Bioresource Technology 294 (2019) 122165
by appropriate pH control (Gajalakshmi and Abbasi, 2008). As shown in
Fig. 2b, the trend of the two piles was similar, with an overall trend of a
gradual increase in the pH with ultimate stabilization at an alkaline pH
(8.87 and 8.92), which is consistent with previous results (Chang et al.,
2019). During the mesophilic phase, the pH in both Pile A and Pile B
decreased slightly. This may be because the sawdust contained a large
amount of easily degradable organic matter, which was rapidly de-
composed by microorganisms to produce organic acids (Gajalakshmi
and Abbasi, 2008; Sharma et al., 1997). Moreover, the addition of
matured compost significantly reduced the pH in the mesophilic phase,
and significantly increased the pH of thermophilic phase (P < 0.05).
However, there was no significant difference in the pH between the two
piles during the cooling phase of composting.
3.1.3. Changes in volatile solids
The changes in the VS content of the two piles were consistent with
a decreasing trend (Fig. 2c), in line with previous studies (Huang et al.,
2004; Liu et al., 2019). The VS content of Pile A and Pile B decreased
from 85.50% and 75.03% at the beginning to the lowest contents of
75.71% and 71.22% on day 10, representing a reduction of 11.45% and
5.07%, respectively, indicating that the degradation rate of VS de-
creased with the addition of matured compost. This can be attributed to
the fact that most of the easily degradable organic matter contained in
the matured compost of Pile B had been degraded in the previous
composting process (Sanchez-Monedero et al., 2001), whereas the ea-
sily degradable organic matter contained in the sawdust of Pile A was
still present in large quantities (Rihani et al., 2010; Jain et al., 2015).
3.1.4. Changes in germination index
GI is important parameter to determine the compost maturity be-
cause it’s directly confirmed whether the end product is inhibitory to
plant growth or not (Wang et al., 2016; Hussain et al., 2018). The GI is
an important indicator that is routinely adopted to evaluate the ma-
turity of a compost (Wang et al., 2019a; Bernal et al., 2009) and the
phytotoxic substances of compost products (Zhou et al., 2014): the
larger the GI value, the smaller the toxicity of the compost to plants,
representing higher quality products (Ouyang et al., 2014). The GI of
Pile A and Pile B increased gradually from 33.6% and 35.2% at day 0 to
78.2% and 76.5% at day 10, respectively (Fig. 2d). Thus, the addition of
C. Ma, et al.
Fig. 2. Changes of temperature (a), volatile solids (VS) content (b), pH values (c), and germination index (GI) (d) during composting. The same letter (a, b) are not
significantly different at P < 0.05 level.
matured compost did not have a significant impact on GI of the final
compost.
3.2. Dynamics of microbial metabolic activities
3.2.1. Cellulase activity
Cellulase catalyzes the hydrolysis of cellulose to D-glucose, and its
activity is dependent on the types of cellulolytic microorganisms pre-
sent in the mixture (Castaldi et al., 2008). As shown in Fig. 3a, the
changes in the cellulase content of the two piles were consistent, de-
monstrating a gradual upward trend, which can be attributed to the
optimal degradation temperature of cellulose at about 65 °C (Tiquia,
2002a,b). The cellulase content of the two piles increased from
11.73 μg/(g × min) and 13.95 μg/(g × min) on day 0 to the maximum
of 70.29 μg/(g × min) and 50.19 μg/(g × min) on day 10. This is also
consistent with the fact that cellulose is a relatively refractory organic
matter, and its degradation process mainly occurs in the middle and
late stages of composting (Gabhane et al., 2012; Becarelli et al., 2019).
During the thermophilic phase, the cellulase content in Pile A was si-
milar to that in Pile B, whereas the addition of matured compost in-
creased the cellulase content during the mesophilic phase and de-
creased the cellulase content during the cooling phase.
3.2.2. Activities of peroxidase
Peroxidase is the most intensively studied extracellular enzyme of
white-rot fungi, which can oxidize the lignin polymer (Wu et al., 2017).
As shown in Fig. 3b, the change trend of peroxidase content in the two
piles was similar, with an initial rise and subsequent decline. The per-
oxidase content in Pile A and Pile B increased from 30.97 mol/(h × g)
and 42.58 mol/(h × g) on day 0 to 93.86 mol/(h × g) and 78.18 mol/
(h × g) on day 10 during the composting. The downward trend of
peroxidase content in Pile B occurred significantly earlier than that of
Pile A (P < 0.05). This may indicate that some of the lignin fraction in
4
Bioresource Technology 294 (2019) 122165
Pile B had been degraded, resulting in a low lignin content. These re-
sults indicated that the addition of matured compost will increase the
peroxidase content during the mesophilic phase and decrease the per-
oxidase content during the cooling phase. This is because lignin de-
gradation usually occurs during the secondary decomposition stages
(Du et al., 2019); however, the microorganisms were inoculated during
the mesophilic phase at the time of adding the matured compost.
3.2.3. Activities of protease
Proteases mediate the first steps of mineralization, which is often
the rate-limiting step for the nitrogen cycle (Sakurai et al., 2007). Thus,
protease, along with urase, are closely related to nitrogen cycling in the
composting process and are important functional enzymes. As shown in
Fig. 3c, the trends of protease content in the two piles were consistent
with an initial increase followed by a decrease, from the minimum of
1.11 mg/g and 0.97 mg/g on day 0 to the maximum of 4.15 mg/g and
4.58 mg/g on day 5, with a subsequent decrease to 2.24 mg/g and
1.87 mg/g on day 10, respectively. The protease content of the two piles
increased during the thermophilic phase of composting, which in-
dicated that protease plays an important role in the thermophilic phase,
in line with the findings of Du et al. (2019). The content of protease
increased with the addition of matured compost during the cooling
phase (P < 0.05).
3.2.4. Activities of arylsulphatase
Arylsulfatase stimulates the removal of sulfate radicals from organic
compounds, and its activity is related to the production of humus
(Mondini et al., 2004; Tejada et al., 2006). Arylsulfatase is also an im-
portant enzyme involved in the sulfur cycle of compost materials (Tejada
et al., 2006). As shown in Fig. 3d, the change trend of arylsulfatase ac-
tivity was clearly different between the two piles, with the arylsulfatase
content in Pile A showing a trend of an initial increase and subsequent
decrease from the initial rate of 10.05 μmol/(h × g) to 15.51 μmol/
C. Ma, et al. Bioresource Technology 294 (2019) 122165

Fig. 3. Evolution of enzyme activities of different piles during the composting process: (a) cellulase, (b) peroxidase, (c) protease, (d) arylsulfatase, (e) urease. The
same letter (a, b) are not significantly different at P < 0.05 level.

Table 2
Bacterial alpha diversity indices.
Fermentation stage Sobs Shannon Ace Chao Coverage

Pile A Pile B Pile A Pile B Pile A Pile B Pile A Pile B Pile A Pile B

Mesophilic phase 385 683 1.87 4.25 514.02 788.30 493.35 783.71 0.995335 0.994564
Thermophilic phase 556 557 3.35 3.54 937.26 758.11 789.34 751.93 0.992212 0.993214
Cooling phase 382 327 2.90 1.99 483.15 405.33 475.96 398.94 0.99599 0.996646

(h × g) at the end of composting. By contrast, the content of arylsulfatase
in Pile B decreased continuously from the initial 15.51 μmol/(h × g) to
11.96 μmol/(h × g) at the end of composting. The content of arylsulfatase
in Pile B was significantly higher than that in Pile A at the mesophilic
phase. After entering the thermophilic phase, the content of arylsulfatase
in Pile B was significantly higher than that in Pile A, and this difference
was maintained until the end of composting (P < 0.05). Therefore, the
content of arylsulfatase increased during the mesophilic phase and de-
creased during the cooling phase when the matured compost was added.
This may be due to the gradual release of organic sulfur from straw with
the degradation of cellulose and other refractory organic matter, resulting
in the increase of arylsulfatase content after entering the thermophilic
phase (Tejada et al., 2006).
3.2.5. Activities of urease
Urease catalyzes the hydrolysis of urea to ammonium and carbon
dioxide (Castaldi et al., 2008). As shown in Fig. 3e, the change trend of
urease in the two piles was the same, with an initial decrease and
subsequent increase. The urease content of Pile A and Pile B reached the
maximum of 0.56 mg/g and 2.38 mg/g at the end of composting,
respectively, and the urease content of Pile B was significantly higher
than that of Pile A at the cooling phase of composting. The addition of
the matured compost could cause an increase of urease content during
the mesophilic and cooling phases to promote the degradation of or-
ganic matter.
3.3. Evolution of the bacterial community
3.3.1. Effects of matured compost on bacterial diversity
As shown in Table 2, the coverage index (> 0.99) indicated that
most of the microorganisms had been detected in the samples. The ACE,
Chao, Shannon, and Simpson indices were calculated as measures of the
richness and diversity of bacterial community in the piles. In particular,
the Shannon index is suggested to be a crucial indicator of species
richness and distribution patterns in composting (Huang et al., 2013),
which demonstrated that the bacterial diversity of the compost during
the mesophilic phase could be effectively improved by adding matured
compost owing to its significant inoculation effect. At the same time,
the bacterial diversity of the compost during the cooling phase could
also be reduced by adding matured compost.

5
C. Ma, et al. Bioresource Technology 294 (2019) 122165

Fig. 4. Changes of (a) bacterial and (b) fungal community composition in different piles at the genus level during the composting process.

6
C. Ma, et al.
3.3.2. Effects of matured compost ratio on bacterial community structure
The presence or absence of particular microbial taxa is mainly de-
pendent on distinctive influencing factors such as physical position and
conditions, ambience diversification, and the initial characteristics of
the material and microbes used for composting (Langarica-Fuentes
et al., 2014). The dynamics of the bacterial community at the genus
level are shown in Fig. 4a. During the mesophilic phase, the dominant
bacterial genera of Pile A were Psychrobacter (68.2%), Ureibacillus
(3.5%), and Sporosarcina (8.0%). The addition of the matured compost
resulted in a decrease of 64.8% and 5.8% in Psychrobacter and Spor-
osarcina, respectively, which could increase acid tolerance by pre-
venting the relative entry of protons into the cytoplasm at low pH
(Priyodip and Balaji, 2019). By contrast, the proportion of Ureibacillus
increased by 18.4% after the addition of matured compost, which is the
dominant genus during the thermophilic composting of sludge (Wang
et al., 2018a). In the thermophilic phase, the dominant bacterial genera
in Pile A were Sporosarcina (51.5%), Bacillus (10.6%), and Candida-
tus_Microthrix (5.6%). The addition of the matured compost resulted in
a decrease of 36.2% in Sporosarcina and 0.2% in Candidatus_Microthrix,
while the proportion of Bacillus increased by 24.3%, which was the
dominant genus reported in the thermophilic composting of SS and
sawdust (Wang et al., 2018a). During the cooling phase, the dominant
bacteria of Pile A were Sporosarcina (64.9%) and Bacillus (4.0%), and
the addition of the matured compost increased these proportions by
8.4% and 0.7%, respectively.
These results showed a clear difference in the bacterial composition
between the two piles during the mesophilic phase. During the com-
posting process, the difference between the two piles gradually de-
creased until the cooling phase when the bacterial composition of the
two piles was basically the same. Thus, the addition of matured com-
post affected the composition of bacterial communities, effectively
improved uniformity of the bacterial community, and had obvious in-
oculation significance.
3.3.3. Relationship between enzyme activity and the bacterial community
composition
There is scare information on the relationship between enzymatic
Fig. 5. Correlation heat map of the top ten genera in (a) Pile A and (b) Pile B with enzyme activities. Correlation coefficient (r) values are indicated in different colors;
the right side of the legend shows the color range. *P < 0.05, **P < 0.01, ***P < 0.001.
7
Bioresource Technology 294 (2019) 122165
activities and various bacterial communities (Du et al., 2019). Here, we
observed that addition of matured compost changed the functional
bacteria contributing to composting (Fig. 5). The correlation heat map
showed that the matured compost influenced the functional bacterial
community and further affected the microbial metabolic activity during
composting (Fig. 5). In Pile A, the abundance of Tetrasphaera was
strongly negatively correlated with urease activity (r = −1, P = 0),
and unclassified_o_Bacillales, Candidatus_Microthrix, and Bacillus were
strongly positively correlated with arylsulfatase and protease activities
(r = 1, P = 0). Norank_f_Bacillaceae, Sporosarcina and norank_o_PeM15
were strongly positively correlated with peroxidase and cellulase ac-
tivities (r = 1, P = 0), whereas Trichococcus, Psychrobacter, and Ur-
eibacillus were strongly negatively correlated with peroxidase and cel-
lulase activities (r = −1, P = 0). In Pile B, Norank_o_Pem15, Bacillus,
and Tepidimicrobium were strongly positively correlated with perox-
idase activity (r = 1, P = 0), but strongly negatively correlated with
cellulase and urease activities (r = −1, P = 0). Unclassified_o_Bacillales,
Sporosarcina, and norank_f_Bacillaceae were strongly negatively corre-
lated with arylsulfatase activity (r = −1, P = 0), but Tetrasphaera,
Peptostreptococcus, Ureibacillus, and Candidatus_Microthrix were strongly
positively correlated with arylsulfatase activity (r = 1, P = 0). These
findings suggest that the addition of matured compost would change
the correlation between dominant bacteria such as Sporosarcina, Ba-
cillus, and Ureibacillus and their corresponding functional enzyme ac-
tivities.
3.4. Evolution of the fungal community
3.4.1. Effects of matured compost on fungal diversity
As shown in Table 3, the coverage index (> 0.99) indicated that
most of the fungi had been detected in the samples. The Shannon index
changes slightly differed between the two piles. During the mesophilic
phase, the Shannon index in Pile A was significantly higher than that in
Pile B. However, the Shannon index increased during the thermophilic
phase in both piles. This occurred because of the rapid rate of de-
gradation of organic matter when the temperature rises so that fungi
become the main decomposers of the refractory organic matter
C. Ma, et al. Bioresource Technology 294 (2019) 122165

Table 3
Fungal alpha diversity indices.
Fermentation stage Sobs Shannon Ace Chao Coverage

Pile A Pile B Pile A Pile B Pile A Pile B Pile A Pile B Pile A Pile B

Mesophilic phase 104 78 1.73 1.34 112.52 83.16 111.09 81.27 0.999669 0.999771
Thermophilic phase 86 84 2.32 1.58 86.708 91.00 86.33 96 0.999949 0.999771
Cooling phase 72 98 2.38 1.13 73.49 101.02 72.50 99.90 0.999924 0.999822

Fig. 6. Correlation heat map of the top ten genera in (a) Pile A and (b) Pile B with enzyme activities. Correlation coefficients (r) are indicated in different colors; the
right side of the legend shows the color range. *P < 0.05, **P < 0.01, ***P < 0.001.

(Gajalakshmi and Abbasi, 2008). During the cooling phase, the composts (Awasthi et al., 2017; Bonito et al., 2010; Gu et al., 2017).
Shannon index in Pile B began to decrease gradually, while that in Pile Addition of the matured compost increased the proportion of Scedos-
A did not change significantly. This suggests that matured compost porium by 71.8%, but decreased the proportions of Mrakia and Asper-
could reduce the diversity of fungi in the composting process. gillus by 29.6% and 10.7%, respectively.

3.4.2. Effects of matured compost on the fungal community structure

The dynamics of the fungal community at the genus level are shown
in Fig. 4b. The addition of matured compost clearly changed the com-
position of the fungal community and reduced the diversity of fungi;
however, the difference in fungal composition between the two piles
did not change throughout the composting process. During the meso-
philic phase, the dominant fungal genera in Pile A were Scedosporium
(1.8%), Candida_glaebosa_clade (55.0%), and Mrakia (21.9%). The ad-
dition of the matured compost resulted in a 67.5% increase in Scedos-
porium, which is a saprophytic fungus in soil and sewage (Gu et al.,
2017). However, the abundance of Candida_glaebosa_clade decreased by
45.7%, which can degrade endocrine disruptors, alkylbenzenes, non-
ylphenol, and polycyclic aromatic hydrocarbons (Liu et al., 2013a).
Moreover, Mrakia decreased by 16.5%. During the thermophilic phase,
the dominant fungi in Pile A were Scedosporium (2.2%), Mrakia
(31.1%), and Candida_glaebosa_clade (31.4%), and the addition of ma-
tured compost resulted in a 64.5% increase in Scedosporium, whereas
the proportion of Mrakia decreased by 23.3% and that of Candi-
da_glaebosa_clade decreased by 27.4%. During the cooling period, the
dominant fungi in Pile A were Sedosporium (4.9%), Mrakia (39.0%), and
Aspergillus (13.5%), with the latter reported as the dominant functional
fungal genus during lignocellulose degradation in maize straw
3.4.3. Relationship between enzyme activity and the fungal community
Fungi have been reported to be more sensitive to changes in phy-
sicochemical parameters (Zhang et al., 2011). The correlation heat map
showed that addition of matured compost influenced the functional
fungal community and further affected microbial metabolic activity in
composting (Fig. 6). In Pile A, the abundance of Candida_glaebosa_clade
and Leucosporidium were negatively correlated with peroxidase and
cellulase activities (r = −1, P = 0), while Fusarium, Herpotrichiellaceae,
Scedosporium, Plectosphaera, Mrakia, and Aspergillus were positively
correlated with peroxidase and cellulase activities (r = 1, P = 0) (Hu
et al., 2011). Ascomycota was negatively correlated with urease activity
(r = −1, P = 0), whereas Arachnida was positively correlated with
urease activity (r = 1, P = 0). In Pile B, Leucosporidium, Candida_glae-
bosa_clade, and Acomycota were positively correlated with arylsulfatase
activity (r = 1, P = 0), while Mrakia was negatively correlated with
arylsulfatase activity (r = −1, P = 0). Roussoella was negatively cor-
related with protease activity (r = −1, P = 0), but Aspergillus and Hy-
pocreaceae were positively correlated with protease activity (r = 1,
P = 0). Scedosporium and unclassified_k_Fungi were negatively correlated
with peroxidase activity (r = −1, P = 0), but positively correlated with
urease and cellulase activities (r = 1, P = 0).

8
C. Ma, et al.
4. Conclusion
During aerobic composting of SS, addition of matured compost
enhanced the activities of most functional enzymes (cellulase, perox-
idase, arylsulfatase, and urease) during the mesophilic phase, but re-
duced the peak temperature, shortened the thermophilic phase, and
inhibited the degradation of organic matter. Bacteria were inoculated in
the early stage of composting with the addition of the matured compost,
which increased the diversity of bacteria in the mesophilic phase but
decreased the diversity of fungi throughout the composting process.
These effects further changed the correlation between some functional
microorganisms and enzyme activities. Matured compost replace use of
50% sawdust as a bulking agent is feasibility.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influ-
ence the work reported in this paper.
Acknowledgements
This work was supported by grants from the National Natural
Science Foundation of China (41501527) and Research Fund for the
Doctoral Program of Zhengzhou University of Light Industry
(2013BSJJ022).
References
Akyol, C., Ince, O., Ince, B., 2019. Crop-based composting of lignocellulosic digestates:
focus on bacterial and fungal diversity. Bioresour. Technol. 288.
Awasthi, M.K., Li, J., Kumar, S., Awasthi, S.K., Wang, Q., Chen, H., Wang, M., Ren, X.,
Zhang, Z., 2017. Effects of biochar amendment on bacterial and fungal diversity for
co-composting of gelatin industry sludge mixed with organic fraction of municipal
solid waste. Bioresour. Technol. 246, 214–223.
Awasthi, M.K., Pandey, A.K., Bundela, P.S., Khan, J., 2015. Co-composting of organic
fraction of municipal solid waste mixed with different bulking waste: characteriza-
tion of physicochemical parameters and microbial enzymatic dynamic. Bioresour.
Technol. 182, 200–207.
Awasthi, M.K., Wang, Q., Huang, H., Ren, X., Lahori, A.H., Mahar, A., Ali, A., Shen, F., Li,
R., Zhang, Z., 2016. Influence of zeolite and lime as additives on greenhouse gas
emissions and maturity evolution during sewage sludge composting. Bioresour.
Technol. 216, 172–181.
Bareither, C.A., Wolfe, G.L., McMahon, K.D., Benson, C.H., 2013. Microbial diversity and
dynamics during methane production from municipal solid waste. Waste Manage. 33
(10), 1982–1992.
Becarelli, S., Chicca, I., Siracusa, G., La China, S., Gentini, A., Lorenzi, R., Munz, G.,
Petroni, G., Levin, D.B., Di Gregorio, S., 2019. Hydrocarbonoclastic Ascomycetes to
enhance co-composting of total petroleum hydrocarbon (TPH) contaminated dredged
sediments and lignocellulosic matrices. New Biotechnol. 50, 27–36.
Bernal, M.P., Alburquerque, J.A., Moral, R., 2009. Composting of animal manures and
chemical criteria for compost maturity assessment. A review. Bioresour. Technol. 100
(22), 5444–5453.
Bonito, G., Isikhuemhen, O.S., Vilgalys, R., 2010. Identification of fungi associated with
municipal compost using DNA-based techniques. Bioresour. Technol. 101 (3),
1021–1027.
Cai, H., Shen, R.F., 2005. Determination of soil protease activity with modified ninhydrin
colorimetry. Acta Pedol. Sin. 42 (2), 306–313.
Castaldi, P., Garau, G., Melis, P., 2008. Maturity assessment of compost from municipal
solid waste through the study of enzyme activities and water-soluble fractions. Waste
Manage. 28 (3), 534–540.
Chang, R., Li, Y., Chen, Q., Guo, Q., Jia, J., 2019. Comparing the effects of three in situ
methods on nitrogen loss control, temperature dynamics and maturity during com-
posting of agricultural wastes with a stage of temperatures over 70 degrees C. J.
Environ. Manage. 230, 119–127.
Du, J., Zhang, Y., Qu, M., Yin, Y., Fan, K., Hu, B., Zhang, H., Wei, M., Ma, C., 2019. Effects
of biochar on the microbial activity and community structure during sewage sludge
composting. Bioresour. Technol. 272, 171–179.
Fan, H., Liao, J., Abass, O.K., Liu, L., Huang, X., Wei, L., Xie, W., Yu, H., Liu, C., 2019.
Effects of bulking material types on water consumption and pollutant degradation in
composting process with controlled addition of different liquid manures. Bioresour.
Technol. 288.
Gabhane, J., William, S.P.M.P., Bidyadhar, R., Bhilawe, P., Anand, D., Vaidya, A.N., Wate,
S.R., 2012. Additives aided composting of green waste: effects on organic matter
degradation, compost maturity, and quality of the finished compost. Bioresour.
Technol. 114, 382–388.
Gajalakshmi, S., Abbasi, S.A., 2008. Solid waste management by composting: state of the
9
Bioresource Technology 294 (2019) 122165
art. Crit. Rev. Environ. Sci. Technol. 38 (5), 311–400.
Ghose, T.K., 1987. Measurement of cellulase activities. Pure Appl. Chem. 59 (2),
257–268.
Gu, W., Lu, Y., Tan, Z., Xu, P., Xie, K., Li, X., Sun, L., 2017. Fungi diversity from different
depths and times in chicken manure waste static aerobic composting. Bioresour.
Technol. 239, 447–453.
Hu, H.L., van den Brink, J., Gruben, B.S., Wosten, H.A.B., Gu, J.D., de Vries, R.P., 2011.
Improved enzyme production by co-cultivation of Aspergillus niger and Aspergillus
oryzae and with other fungi. Int. Biodeterior. Biodegrad. 65 (1), 248–252.
Huang, G.F., Wong, J.W.C., Wu, Q.T., Nagar, B.B., 2004. Effect of C/N on composting of
pig manure with sawdust. Waste Manage. 24 (8), 805–813.
Huang, K., Li, F., Wei, Y., Chen, X., Fu, X., 2013. Changes of bacterial and fungal com-
munity compositions during vermicomposting of vegetable wastes by Eisenia foetida.
Bioresour. Technol. 150, 235–241.
Hussain, N., Das, S., Goswami, L., Das, P., Sahariah, B., Bhattacharya, S.S., 2018.
Intensification of vermitechnology for kitchen vegetable waste and paddy straw
employing earthworm consortium: assessment of maturity time, microbial commu-
nity structure, and economic benefit. J. Clean. Prod. 182, 414–426.
Iqbal, M.K., Shafiq, T., Ahmed, K., 2010. Characterization of bulking agents and its effects
on physical properties of compost. Bioresour. Technol. 101 (6), 1913–1919.
Jain, S., Jain, S., Wolf, I.T., Lee, J., Tong, Y.W., 2015. A comprehensive review on op-
erating parameters and different pretreatment methodologies for anaerobic digestion
of municipal solid waste. Renew. Sustain. Energy Rev. 52, 142–154.
Karak, T., Sonar, I., Paul, R.K., Das, S., Boruah, R.K., Dutta, A.K., Das, D.K., 2014.
Composting of cow dung and crop residues using termite mounds as bulking agent.
Bioresour. Technol. 169, 731–741.
Langarica-Fuentes, A., Zafar, U., Heyworth, A., Brown, T., Fox, G., Robson, G.D., 2014.
Fungal succession in an in-vessel composting system characterized using 454 pyr-
osequencing. FEMS Microbiol. Ecol. 88 (2), 296–308.
Liu, C.-G., Xue, C., Lin, Y.-H., Bai, F.-W., 2013a. Redox potential control and applications
in microaerobic and anaerobic fermentations. Biotechnol. Adv. 31 (2), 257–265.
Liu, C., Liu, J., Li, J., He, H., Peng, S., Li, C., Chen, Y., 2013b. Removal of H2S by
coimmobilized bacteria and fungi biocatalysts in a bio-trickling filter. Process Saf.
Environ. 91, 145–152.
Liu, H., Wang, L., Lei, M., 2019. Positive impact of biochar amendment on thermal bal-
ance during swine manure composting at relatively low ambient temperature.
Bioresour. Technol. 273, 25–33.
Maeda, K., Miyatake, F., Asano, R., Nakajima, K.-I., Maeda, T., Iwabuchi, K., 2018.
Response of the denitrifier community and its relationship with multiple N2O emis-
sion peaks after mature compost addition into dairy manure compost with forced
aeration. Chemosphere 206, 310–319.
Ma, J., Zhang, L., Mu, L., Zhu, K., Li, A., 2019. Multivariate insights of bulking agents
influence on co-biodrying of sewage sludge and food waste: process performance,
organics degradation and microbial community. Sci. Total Environ. 681, 18–27.
Mondini, C., Fornasier, F., Sinicco, T., 2004. Enzymatic activity as a parameter for the
characterization of the composting process. Soil Biol. Biochem. 36 (10), 1587–1594.
Nannipieri, P., Kandeler, E., Ruggiero, P., Burns, R.G., Dick, R.P., 2002. Enzyme activities
and microbiological and biochemical processes in soil. In: Enzymes in the
Environment. Marcel Dekker, New York, pp. 1–33.
Nie, E., Zheng, G., Gao, D., Chen, T., Yang, J., Wang, Y., Wang, X., 2019. Emission
characteristics of VOCs and potential ozone formation from a full-scale sewage sludge
composting plant. Sci. Total Environ. 659, 664–672.
Ouyang, J.-X., Shi, Z., Zhong, H., Liu, W., Chai, Q., Yuan, X.-Z., 2014. Static aerobic
composting of municipal sewage sludge with forced ventilation: using matured
compost as bulking conditioner. J. Central South Univers. 21 (1), 303–309.
Priyodip, P., Balaji, S., 2019. A preliminary study on probiotic characteristics of
Sporosarcina spp. For poultry applications. Curr. Microbiol. 76 (4), 448–461.
Rihani, M., Malamis, D., Bihaoui, B., Etahiri, S., Loizidou, M., Assobhei, O., 2010. In-
vessel treatment of urban primary sludge by aerobic composting. Bioresour. Technol.
101 (15), 5988–5995.
Sakurai, M., Suzuki, K., Onodera, M., Shinano, T., Osaki, M., 2007. Analysis of bacterial
communities in soil by PCR-DGGE targeting protease genes. Soil Biol. Biochem. 39
(11), 2777–2784.
Sanchez-Monedero, M.A., Roig, A., Paredes, C., Bernal, M.P., 2001. Nitrogen transfor-
mation during organic waste composting by the Rutgers system and its effects on pH,
EC and maturity of the composting mixtures. Bioresour. Technol. 78 (3), 301–308.
Sharma, V.K., Canditelli, M., Fortuna, F., Cornacchia, G., 1997. Processing of urban and
agro-industrial residues by aerobic composting: review. Energy Convers. Manage. 38
(5), 453–478.
Sundberg, C., Al-Soud, W.A., Larsson, M., Alm, E., Yekta, S.S., Svensson, B.H., Sorensen,
S.J., Karlsson, A., 2013. 454 pyrosequencing analyses of bacterial and archaeal
richness in 21 full-scale biogas digesters. FEMS Microbiol. Ecol. 85 (3), 612–626.
Tejada, M., Garcia, C., Gonzalez, J.L., Hernandez, M.T., 2006. Use of organic amendment
as a strategy for saline soil remediation: influence on the physical, chemical and
biological properties of soil. Soil Biol. Biochem. 38 (6), 1413–1421.
The Allison Lab, 1994. Colorimetric Enzyme Assays. Available at: http://allison.bio.uci.
edu/protocols/.
Tiquia, S.M., 2002a. Evolution of extracellular enzyme activities during manure com-
posting. J. Appl. Microbiol. 92, 764–775.
Tiquia, S.M., 2002b. Evolution of extracellular enzyme activities during manure com-
posting. J. Appl. Microbiol. 92 (4), 764–775.
Tiquia, S.M., Tam, N.F., 1998. Composting of spent pig litter in turned and forced-aerated
piles. Environ. Pollut. (Barking, Essex : 1987) 99 (3), 329–337.
Wang, K., Mao, H., Li, X., 2018a. Functional characteristics and influence factors of mi-
crobial community in sewage sludge composting with inorganic bulking agent.
Bioresour. Technol. 249, 527–535.
C. Ma, et al.
Wang, K., Wu, Y., Li, W., Wu, C., Chen, Z., 2018b. Insight into effects of mature compost
recycling on N2O emission and denitrification genes in sludge composting. Bioresour.
Technol. 251, 320–326.
Wang, Q., Wang, Z., Awasthi, M.K., Jiang, Y., Li, R., Ren, X., Zhao, J., Shen, F., Wang, M.,
Zhang, Z., 2016. Evaluation of medical stone amendment for the reduction of ni-
trogen loss and bioavailability of heavy metals during pig manure composting.
Bioresour. Technol. 220, 297–304.
Wang, X., Zheng, G., Chen, T., Shi, X., Wang, Y., Nie, E., Liu, J., 2019a. Effect of phos-
phate amendments on improving the fertilizer efficiency and reducing the mobility of
heavy metals during sewage sludge composting. J. Environ. Manage. 235, 124–132.
Wang, Y., Bi, L., Liao, Y., Lu, D., Zhang, H., Liao, X., Liang, J.B., Wu, Y., 2019b. Influence
and characteristics of Bacillus stearothermophilus in ammonia reduction during layer
manure composting. Ecotoxicol. Environ. Saf. 180, 80–87.
Wu, J., He, S., Liang, Y., Li, G., Li, S., Chen, S., Nadeem, F., Hu, J., 2017. Effect of
10
Bioresource Technology 294 (2019) 122165
phosphate additive on the nitrogen transformation during pig manure composting.
Environ. Sci. Pollut. Res. 24 (21), 17760–17768.
Yang, F., Li, Y., Han, Y., Qian, W., Li, G., Luo, W., 2019. Performance of mature compost
to control gaseous emissions in kitchen waste composting. Sci. Total Environ. 657,
262–269.
Zhang, J., Zeng, G., Chen, Y., Yu, M., Yu, Z., Li, H., Yu, Y., Huang, H., 2011. Effects of
physico-chemical parameters on the bacterial and fungal communities during agri-
cultural waste composting. Bioresour. Technol. 102 (3), 2950–2956.
Zhou, H.-B., Ma, C., Gao, D., Chen, T.-B., Zheng, G.-D., Chen, J., Pan, T.-H., 2014.
Application of a recyclable plastic bulking agent for sewage sludge composting.
Bioresour. Technol. 152, 329–336.
Zhou, J.-M., 2017. The effect of different C/N Ratios on the composting of pig manure and
edible fungus residue with rice bran. Compost Sci. Util. 25 (2), 120–129.