Vicenin-2 and Scolymoside Inhibit High Glucose-Induced Vascular Inflammation in Vitro and in Vivo

Page 1 of 31
For personal use only. This Just-IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official version of record.
Vicenin-2 and scolymoside inhibit high glucose-induced vascular inflammation in vitro and in vivo
Sae-Kwang Ku1 and Jong-Sup Bae2*

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Waterloo on 11/03/15
From 1Department of Anatomy and Histology, College of Korean Medicine, Daegu Haany University,
Gyeongsan 712-715 Republic of Korea; 2College of Pharmacy, CMRI, Research Institute of Pharmaceutical
Sciences, Kyungpook National University, Daegu 702-701 Republic of Korea
Running title: Effect of vicenin-2 and scolymoside on diabetes
* Corresponding Author:
College of Pharmacy, Research Institute of Pharmaceutical Sciences, Kyungpook National University
80 Dahak-ro, Buk-gu, Daegu 702-701, Republic of Korea
Phone, 82-53-950-8570; Fax, 82-53-950-8557; E-mail, baejs@knu.ac.kr;
Conflict of interest statement
The authors declare no conflicts of interest.
Acknowledgements
This study was supported by the National Research Foundation of Korea (NRF) funded by the Korea
government [MSIP] (Grant No. 2012R1A5A2A42671316).

For personal use only. This Just-IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official version of record. Page 2 of 31
Abstract
The vascular inflammatory process has been suggested to play a key role in the initiation and progression of
atherosclerosis, a major complication of diabetes mellitus. Thus, in this study, we attempted to determine
whether 2 structurally related flavonoids found in Cyclopia subternata, vicenin-2 and scolymoside, can suppress
high-glucose (HG)-induced vascular inflammatory processes in human umbilical vein endothelial cells
(HUVECs) and mice. The effects of vicenin-2 and scolymoside on HG-induced vascular inflammation were
determined by measuring vascular permeability, leukocyte adhesion and migration, cell adhesion molecule
(CAM) expression levels, and reactive oxygen species (ROS) formation. In addition, the anti-inflammation
mechanism was investigated using immunofluorescence staining and western blotting. The data showed that HG
markedly increased vascular permeability, monocyte adhesion, expression of cell adhesion molecules (CAMs),
formation of reactive oxygen species (ROS), and activation of nuclear factor (NF)- κB. Remarkably,
pretreatment with vicenin-2 and scolymoside attenuated all of the above-mentioned vascular inflammatory
effects of HG. HG-induced vascular inflammatory responses are critical events underlying the development of
various diabetic complications; therefore, our results suggest that vicenin-2 and scolymoside have significant
therapeutic benefits against diabetic complications and atherosclerosis.
Keywords: vicenin-2, scolymoside, high glucose, diabetes mellitus
2
Page 3 of 31
Introduction
Diabetes mellitus is a common metabolic disorder associated with various diseases such as
atherosclerosis, nephritis, and hypertension (Grundy et al. 1999; Whiting et al. 2011). This widespread disorder
is a major threat to global public health that is rapidly worsening, and its biggest impact is on adults of working
age in developing countries (Thomas and Foody 2007). Although diabetes is often not recorded as the cause of
death, it is believed to have been the fifth leading cause of death globally in 2000 after transmissible diseases,
cardiovascular disease, cancer, and injuries (Roglic et al. 2005). In modern medicine, no satisfactory effective
therapy is available thus far to cure diabetes mellitus (Rubino and Gagner 2002). Therefore, the search for more
effective and safer hypoglycemic agents has continued to be an area of active research. Many indigenous
medicinal plants have been found to be useful for successful management of diabetes and some of these plants
have been evaluated experimentally and their active ingredients have been isolated (Li et al. 2012). The World
Health Organization (WHO) has also recommended that these plants be evaluated for their effectiveness and
optimal dosing conditions for diseases/disorders for which safe modern drugs are lacking (Day 1998).
Teas and herbal infusions are natural beverages containing compounds that are of particular interest to
the health sciences owing to their potential in vivo biological properties (Prior and Cao 1999; Warren 1999).
Health-promoting properties such as antioxidant, anti-inflammatory, and enhancement of recognition memory
have been documented for the active compounds in Cyclopia subternata, Peperomia blanda, Ocimum sanctum,
Perilla frutescens, Urtica circularis, and Potentilla discolor (Islam et al. 2014; Joubert et al. 2011; Leiro et al.
2003; Pardo Andreu et al. 2010; Sanchez et al. 2000). C. subternata is known to contain abundant flavonoids,
particularly, vicenin-2 (VCN) and scolymoside (SCL) (Kazuno et al. 2005). Further, previous reports showed
3
that VCN has anti-diabetic, anti-glycation, and anti-inflammatory activities (Islam et al. 2014; Marrassini et al.
2011). However, the effects of vicenin-2 (VCN) and scolymoside (SCL) on high-glucose (HG)-induced
inflammatory responses have not been reported. Therefore, in the current study, we attempted to determine
whether VCN or its structural analogue, SCL, could suppress the vascular inflammatory responses induced by
HG in human endothelial cells and in mice.
Materials and methods
Reagents
VCN, SCL, D-glucose, L-glucose, D-mannitol, Evans blue, 2-mercaptoethanol, and antibiotics
(penicillin G and streptomycin) were purchased from Sigma (St. Louis, MO). Fetal bovine serum (FBS) and
Vybrant DiD were purchased from Invitrogen (Carlsbad, CA).
Cell culture
Primary human umbilical vein endothelial cells (HUVECs) were obtained from Cambrex Bio Science
(Charles City, IA) and were maintained as described previously (Bae et al. 2014; Ku and Bae 2014; Ku et al.
2014; Ku et al. 2015). Briefly, the cells were cultured to confluency at 37°C and 5% CO2 in EBM-2 basal media
supplemented with growth supplements (Cambrex Bio Science). Human neutrophils were freshly isolated from
whole blood (15 mL) obtained by venipuncture from 5 healthy volunteers and were maintained as previously
described (Bae and Rezaie 2013; Hofbauer et al. 1998).
4
Page 5 of 31
Animals and husbandry
Male C57BL/6 mice (6–7-wk old; average weight, 27 g) purchased from Orient Bio Co. (Sungnam,
KyungKiDo, Republic of Korea) were used in this study after a 12-day acclimatization period. The animals were
housed at 5 per polycarbonate cage under controlled temperature (20–25°C) and humidity (40%–45%) and a
12:12-hour light/dark cycle. A normal rodent pellet diet and water ad libitum was provided for the animals
during acclimatization. All animals were treated in accordance with the Guidelines for the Care and Use of
Laboratory Animals issued by Kyungpook National University (KNU 2012-13).
Cell viability assay
MTT was used as an indicator of cell viability. The cells were grown in 96-well plates at a density of 5
× 103 cells/well. After 24 h, the cells were washed with fresh medium and were subsequently treated with each
compound. The cells were washed after a 48-h incubation period and 100 µl of MTT (1 mg/ml) was added,
followed by incubation for 4 h. Finally, DMSO (150 µl) was added in order to solubilize the formazan salt
formed; the amount of formazan salt was determined by measuring the OD at 540 nm using a microplate reader
(Tecan Austria GmbH, Austria).
In vitro permeability assay
Endothelial cell permeability in response to increasing concentrations of each compound was
quantified by spectrophotometric measurement of the flux of Evans blue-bound albumin across functional cell
monolayers by using a modified 2-compartment chamber model, as previously described (Kim et al. 2012).
5
HUVECs were plated (5 × 104/well) in 3-µm pore size, 12-mm diameter transwells for 3 days. Confluent
monolayers were incubated with increasing concentrations of each compound for 6 h, followed by incubation
with the indicated HG concentrations for 24 h. Then, the transwell inserts were washed with PBS (pH 7.4) and
0.5 ml of Evans blue (0.67 mg/ml) diluted in growth medium containing 4% BSA was added. Fresh growth
medium was then added to the lower chamber and the medium in the upper chamber was replaced with Evans
blue/BSA. Ten minutes later, the optical density was measured at 650 nm in the lower chamber.
In vivo permeability and the leukocyte migration assay
For the in vivo study, male mice were anesthetized with 2% isoflurane (Forane, JW Pharmaceutical,
South Korea) in oxygen delivered via a small rodent gas anesthesia machine (RC2, VetEquip, Pleasanton, CA);
the anesthesia was first delivered in a breathing chamber and subsequently via facemask. The mice were allowed
to breath spontaneously during the procedure. Cervical dislocation was used for euthanasia. The mice were
intravenously administered each compound; after 6 h, 1% Evans blue dye solution in normal saline was
administered to each mouse by intravenous injection, immediately followed by intravenous injection of HG (9
mg/kg). The average circulating blood volume for mice is 72 mL/kg (Diehl et al. 2001); thus, because the
average weight of the mice was 27 g and the average blood volume was 2 ml, the injected VCN or SCL (11.9 or
23.8 µg per mouse, respectively) produced a maximum concentration of 10 or 20 µM in the peripheral blood,
respectively. The mice were sacrificed 30 minutes later and the peritoneal exudates were collected after being
washed with 5 ml of normal saline and centrifuged at 200 × g for 10 min. The absorbance of the supernatant was
read at 650 nm. Vascular permeability was expressed in terms of dye (µg/mouse), which represents leakage into
6
Page 7 of 31
the peritoneal cavity according to the standard curve of Evans blue dye, as previously described (Bae et al. 2012;
Lee et al. 2009).

For assessment of leukocyte migration, the mice were euthanized and the peritoneal cavities were
washed with 5 mL of normal saline. Samples (20 µl) of peritoneal fluid were mixed with 0.38 mL of Turk's
solution (0.01% crystal violet in 3% acetic acid), and the leukocytes were counted under a light microscope.
Expression of cell adhesion molecules (CAMs)
Expression of vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-
1), and E-selectin was determined by using whole-cell ELISA. Briefly, HUVEC monolayers were treated with
each compound at the indicated concentrations for 6 h, followed by treatment with HG (25 mM) for 24 h; the
monolayers were subsequently fixed in 1% paraformaldehyde. After 3 washes, mouse anti-human monoclonal
antibodies (VCAM-1, ICAM-1, or E-selectin; Temecula, CA; 1:50 each) were added, and the cells were
incubated for 1 h (37 °C, 5% CO2). The cells were then washed, treated with peroxidase-conjugated anti-mouse
IgG antibody (Sigma, St. Louis, MO) for 1 h, and washed 3 times; development was performed by using o-
phenylenediamine substrate (Sigma, St. Louis, MO). All measurements were performed in triplicate wells.
Cell-cell adhesion assay
Adherence of monocytes to endothelial cells was evaluated by using fluorescent labeling of monocytes.
Briefly, monocytes were labeled with 5 µM Vybrant DiD for 20 min at 37°C in phenol red-free RPMI containing
5% fetal bovine serum. After 2 washings, the cells (1.5 × 106/ml, 200 µl/well) were resuspended in adhesion
7
medium (RPMI containing 2% fetal bovine serum and 20 mM HEPES) and were added to confluent monolayers
of HUVECs in 96-well plates. These cells were treated for 6 h with each compound followed by HG (25 mM for
24 h). The fluorescence of the labeled cells was measured (total signal) by using a fluorescence microplate
reader (Tecan Austria GmbH, Austria). After incubation for 1 hour at 37°C, the non-adherent cells were removed
by washing 4 times with pre-warmed RPMI, and the fluorescent signals of the adherent cells were measured by
using previously described methods. The percentage of adherent monocytes was calculated by using the
following formula, as described (Akeson and Woods 1993; Kim et al. 2001): % adherence = (adherent
signal/total signal) × 100.
RNA preparation and real-time qRT-PCR
HUVECs were grown in 6-well plates and were incubated with each compound for 6 h, followed by
HG 25 mM for 24 h. The High Pure RNA Isolation Kit (Roche Diagnostics) was used to isolate RNA from cell
cultures, and RNA quality was tested by measuring the ratio 260/280 nm in a UV spectrophotometer. For each
sample, 0.5 µg of total RNA was reverse transcribed into cDNA by using the Transcriptor First Strand cDNA
Synthesis Kit (Roche Diagnostics). Real-time PCR analysis was performed by using the
LightCycler® 96 System (Roche Diagnostics, Mannheim, Germany) with FastStart Essential DNA Green Master
(Roche Diagnostics) according to the manufacturer’s instructions. GAPDH was used as an internal control. The
relative quantification of mRNA expression was calculated as the ratio of the target gene to GAPDH. Specific
sense and anti-sense primers used were as follows: MCP-1, sense: 5′- TGCAGAGGCTCGCGAGCTA- 3′; anti-
sense: 5′- CAGGTGGTCCATGGAATCCTGA -3′; IL-8, sense: 5′- ACTGAGAGTGATTGAGAGTGGAC -3′;
8
Page 9 of 31
antisense: 5′- AACCCTCTGCACCCAGTTTTC -3′; superoxide dismutase (SOD), sense: 5′-
GTTGGGGTTGGCTTGGTTTC-3′; anti-sense: 5′- ATAAGGCCTGTTGTTCCTTGC-3′; catalase (CAT),

sense: 5′-AGGGGCCTTTGGCTACTTTG-3′; anti-sense: 5′-ACCCGATTCTCCAGCAACAG-3′; GAPDH,
sense: 5′- GTCTTCACTACCATGGAGAAGG -3′; antisense: 5′- TCATGGATGACCTTGGCCAG -3′.
SOD and CAT activity assays
Confluent monolayers were incubated with increasing concentrations of each compound for 6 h,
followed by incubation with the indicated concentrations of HG for 24 h. SOD and CAT activities were
measured using spectrophotometric assays. The extraction medium for the measurement of the enzyme activities
was 10 mM sodium phosphate buffer at pH 7.4. Total SOD activity was measured by superoxide anion-induced
inhibition of the cytochrome c reduction rate, monitored at 550 nm at 25°C; the xanthine/xanthine oxidase
system was utilized as the source of O2-. SOD competes for superoxide and decreases the reduction rate of
cytochrome c (Flohe and Otting 1984). One unit of SOD is defined as the amount of enzyme that inhibits the rate
of cytochrome c reduction by 50% under specified conditions. The CAT activity levels in cell supernatants were
measured by using the CAT Assay Kit (Cayman Chemical, Ann Arbor, MI).
H2O2 release assay
Extracellular production of H2O2 was quantified by using the Amplex Red Hydrogen Peroxide Assay
Kit (Molecular Probes; Eugene, OR) according to the manufacturer's recommendations. HUVECs were grown in
6-well plates and were incubated with each compound for 6 h, followed by incubation with HG (25 mM) for 0 to
9
120 min. The cells were washed twice with ice-cold PBS, harvested by microcentrifugation, and resuspended in
a Krebs-Ringer phosphate (KRPG) solution; 100 µL of the reaction mixture (50 µM Amplex Red reagent
containing 0.1 U/mL HRP in KRPG) was added to each microplate well and was prewarmed at 37 °C for 10 min.
The reaction was initiated by adding the resuspended cells in 20 µL of KRPG. Fluorescence readings became
stable within 30 min of starting the reaction equipped for absorbance at ∼560 nm (Multiskan, Thermo
Labsystems Inc., Franklin, MA). A reagent H2O2 standard curve was used to calculate the H2O2 concentration.
Preparation of cytoplasmic and nuclear extracts
The cells were harvested rapidly by sedimentation and nuclear and cytoplasmic extracts were prepared
on ice, as previously described (Mackman et al. 1991). Briefly, the cells were harvested and were washed with 1
ml of buffer A (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 19 mM KCl) for 5 min at 600 × g. Subsequently, the
cells were resuspended in buffer A, centrifuged at 600 × g for 3 min, resuspended in 30 µl of buffer B (20 mM
HEPES, pH 7.9, 25% glycerol, 0.42M NaCl, 1.5mM MgCl2, 0.2 mM EDTA), rotated for 30 min at 4°C, and
centrifuged at 13,000 × g for 20 min. The supernatant was used as the nuclear extract. The nuclear and cytosolic
extracts were analyzed for protein content by using the Bradford assay.
Western blotting
Total cell extracts were prepared by lysing the cells, and the protein concentration was determined by
using the Bradford assay. Equal amounts of protein were separated by SDS-PAGE (10%) and were
electroblotted overnight onto an Immobilon membrane (Millipore, Billerica, MA). The membranes were blocked
10
Page 11 of 31
for 1 h with 5% low-fat milk-powder TBS (50 mM Tris-HCl, pH 7.5, 150 mM NaCl) containing 0.05% Tween
20 and were then incubated with NF-κB p65 for 1.5 h at room temperature (1:1000, Santa Cruz, CA).
Subsequently, the membranes were incubated with horseradish-peroxidase-conjugated secondary antibody, and
ECL detection was performed according to the manufacturer's instructions. β-actin (1:1000, Santa Cruz) or lamin
A/C (1:1000, Santa Cruz) was used as a loading control for cytoplasmic or nuclear extracts, respectively.
Densitometry analysis was performed by using ImageJ Gel Analysis software.
Immunofluorescence staining
HUVECs were grown to confluence on glass cover slips coated with 0.05% poly-L-lysine in complete
media containing 10% FBS and were maintained for 48 h. The cells were then stimulated with HG (25 mM) for
24 h with or without prior treatment with each compound for 6 h. After several washes with PBS, the cells were
fixed in 4% formaldehyde in PBS (v/v) for 15 min at room temperature. For immunostaining, the cells were
permeabilized in 0.05% Triton X-100 in PBS for 15 min and were blocked in blocking buffer (5% BSA in PBS)
overnight at 4°C. The cells were incubated with F-actin labeled fluorescein phalloidin (F 432; Molecular Probes,
Invitrogen) or primary rabbit monoclonal NF-κB p65 antibody, anti-rabbit Alexa 488, overnight at 4°C. The
nuclei were counterstained with 4,6-diamidino-2-phenylindole dihydrochloride (DAPI). The cells were then
visualized by using confocal microscopy at 63× magnification (TCS-Sp5, Leica Microsystems, Germany).
Statistical Analysis
The results are expressed as the mean ± standard error of mean (SEM) of at least 3 independent
11
experiments. Statistical significance was determined by using analysis of variance (ANOVA; SPSS, version 14.0,
SPSS Science, Chicago, Il), and p-values less than 0.05 (p < 0.05) were considered significant.
Results
VCN (apigenin-6,8-di-C-glucoside) and SCL (luteolin-7-O-rutinoside), which are compounds found in
C. subternata plants, are traditionally used for the production of South African herbal tea, honeybush, and,
recently, as aqueous extracts for the food industry (Joubert et al. 2011). In this study, we determined the effects
of these 2 active flavones, VCN and SCL (Fig. 1), on high-glucose (HG)-induced vascular inflammation in vitro
and in vivo.
Effects of VCN and SCL on HG-induced disruption of the endothelial barrier function in HUVECs and mice
First, we investigated the effects of glucose on the albumin permeability of endothelial cells. Treatment
with HG (25 and 50 mM) led to a rapid increase in endothelial cell permeability, with the effect beginning at 12
h after incubation and reaching a maximum at 24 h (data not shown). A significant increase was observed at a
glucose concentration of 10 mM. Concentrations above 50 mM did not further increase the glucose-induced
permeability (data not shown). L-glucose and D-Mannose (25 mM), which were used as osmotic controls, had
no significant effect on endothelial cell permeability (data not shown).
Next, we investigated whether VCN or SCL could alter HG-induced hyperpermeability. Treatment
with 20 µM of each compound alone did not result in alteration of barrier integrity; further, treatment with VCN
12
Page 13 of 31
or SCL resulted in a dose-dependent decrease in HG-mediated membrane disruption (Fig. 1B). To confirm this
vascular barrier protective effect in vivo, HG-mediated vascular permeability was assessed in mice. Treatment
with VCN or SCL resulted in marked inhibition of HG-induced peritoneal leakage of dye (Fig. 1C).
Because cytoskeletal proteins are important for the maintenance of cell integrity and shape, we next
examined the effects of VCN or SCL on actin cytoskeletal arrangement in HUVECs by immunofluorescence
staining of HUVEC monolayers with F-actin-labeled fluorescein phalloidin. Control HUVECs exhibited a
random distribution of F-actin throughout the cells, with some localization of actin filament bundles at the cell
boundaries (Fig. 1D). Barrier disruption in HUVECs induced by HG treatment (25 mM) was accompanied by
the formation of paracellular gaps (indicated by arrows). In addition, treatment with VCN or SCL (20 µM)
inhibited the formation of HG-induced paracellular gaps, with the formation of dense F-actin rings (Fig. 1D).
These results suggest that VCN or SCL treatment inhibited the HG-mediated morphological changes and gap
formation in endothelial cells that are associated with F-actin redistribution, thereby increasing vascular barrier
integrity. To test the effects of VCN or SCL on cellular viability, MTT assays were performed in HUVECs
treated with each compound for 24 h. VCN or SCL did not affect cell viability at concentrations up to 50 µM
(Fig. 1E).
Effects of VCN and SCL on HG-mediated expression of CAMs and neutrophil adhesion
We determined the effects of HG on the expression of CAMs and the adhesion of monocytes to
HUVECs in response to HG. ELISA was used to determine the expression of CAMs, such as VCAM-1, ICAM-1,
and E-selectin, according to the HG concentration. Exposure of the primary cultured HUVECs to HG resulted in
13
significantly increased expression of VCAM-1, ICAM-1, and E-selectin after incubation with 25 mM D-glucose;
the maximum inhibitory effect of VCN or SCL (Fig. 2A) was observed at 20 µM.
In addition, in order to explore the effect of VCN or SCL on endothelial cell-leukocyte interaction, we
examined the adhesion of human neutrophils to high glucose-activated HUVECs and the migration of leukocytes
in vivo. Control HUVECs showed minimal binding to human neutrophils; however, adhesion markedly
increased upon treatment with HG. Pretreatment with VCN or SCL (20 µM) resulted in a decrease in the number
of human neutrophils adhering to HG-induced HUVECs (Fig. 2B and 2C). These results were corroborated in
vivo by inhibition of HG-induced migration of leukocytes in the peritoneal space (Fig. 2D). Thus, VCN or SCL
is a therapeutic drug candidate for targeting the expression of CAMs in diabetic vascular inflammation in order
to prevent atherosclerotic lesions.
Next, we measured the effect of VCN or SCL on HG-induced changes on MCP-1 and IL-8 mRNA
levels by using real time qRT-PCR. HG induced an increase in the expression of MCP-1 (up to 4.9-fold) and IL-
8 (up to 5.3-fold) mRNAs, whereas pretreatment with VCN or SCL decreased the inductions in MCP-1 and IL-8
mRNAs by HG (Fig. 3A and 3B). These results suggest that VCN or SCL would be useful for preventing the
vascular inflammatory process.
Effect of VCN and SCL on HG-induced oxidative stress
To determine whether VCN or SCL have a protective effect on HG-induced oxidative stress, we first
measured the effect of HG on the cellular H2O2 concentration. The H2O2 level significantly increased after
incubation for 10 min with 25 mM glucose, and a maximal increase was observed at 1 h (Fig. 3C). Pretreatment
14
Page 15 of 31
with 20 µM VCN or SCL significantly inhibited the HG-induced increase in the H2O2 level (Fig. 3C). In addition,
VCN or SCL alone did not induce oxidative stress, suggesting the importance of utilizing HG to induce
oxidative stress in HUVECs when determining the character of the diabetic complication as well as vascular
inflammation. Because a high concentration of glucose causes overexpression of SOD and CAT in cultured
human endothelial cells, we determined the effects of VCN or SCL on the HG-induced expression and activity of
SOD and CAT. The data revealed that pretreatment with 20 µM of VCN or SCL significantly inhibited HG-
induced expression of SOD and CAT (Fig. 3D) and HG-induced increases in the activity of SOD and CAT (Fig.
3E).
Effect of VCN and SCL on HG-induced activation of NF-κB
To determine the effects of VCN and SCL on NF-κB activation, we measured HG-induced
translocation of NF-κB from the cytosol to the nucleus. Western blotting analysis revealed that the level of the
active subunit of the NF-κB complex, p65, was increased in the nuclear extracts of HUVECs treated with HG,
and the cytosolic extracts exhibited an appreciable loss of p65 protein content (Figs. 4A and 4B). In addition,
pretreatment with VCN or SCL resulted in inhibition of the HG-induced increase of p65 NF-κB expression
levels (Figs. 4A and 4B). Immunocytochemistry was performed by using p65 NF-κB and fluorescein
isothiocyanate (FITC)-conjugated antibody to confirm the results from western blotting. HG induced an increase
in the expression of p65 NF-κB in the nucleus, whereas this was not elevated under normal conditions. In
addition, treatment with 20 µM VCN or SCL resulted in a decrease in HG-induced expression of p65 NF-κB in
the nucleus (Figs. 4C). These results are consistent with those of the western blotting experiments (Figs. 4A and
15
4B). These findings demonstrate that VCN or SCL inhibits HG-induced activation of NF-κB, indicating that
VCN or SCL has an inhibitory effect on the NF-κB pathway specific to HG induction of adhesion molecules in
HUVECs.
Discussion
Diabetes mellitus is associated with increased endothelial dysfunction and the development of
atherosclerotic vascular diseases (Grundy et al. 1999; Whiting et al. 2011). HG is known to induce the
expression of CAMs and to promote the hyperpermeability and the adhesion and migration of leukocytes.
Further, flavonoids such as saponarin (Seo et al. 2014), orientin and isoorientin (Lee et al. 2014; Yoo et al. 2014),
vitexin (Borghi et al. 2013), and isovitexin (Lin et al. 2005) are structural analogues of VCN or SCL with
significant anti-inflammatory activities. Therefore, in this study, we determined the anti-inflammatory responses
of VCN and SCL on HG-induced vascular responses in vitro and in vivo.
Endothelial dysfunction and damage are early steps in the pathophysiology of diabetes-associated
vascular complications (Laakso 1999). Hyperglycemia is the central initiating factor for all types of diabetic
microvascular disease, and it may be involved in the pathogenesis of macrovascular complications (Kannel and
McGee 1979; Laakso 1999; Nannipieri et al. 1995). In addition, endothelial cell permeability, which is altered in
diabetes mellitus, may be enhanced by high concentrations of extracellular glucose (Wardle 1994). Leakage of
serum proteins, particularly albumin, through the endothelium is observed in the retinal vessels early in diabetes
mellitus (Tooke 1995; Wardle 1994). Increased endothelial cell permeability in larger vessels can also lead to the
16
Page 17 of 31
development of interstitial edema, possibly resulting in enhanced cell proliferation and matrix production
(Nannipieri et al. 1995). Based on the current finding that VCN and SCL inhibited HG-mediated endothelial
disruption and maintained endothelial cell barrier integrity in mice and human endothelial cells treated with HG,
we conclude that VCN and SCL may be useful for the treatment of vascular inflammatory diseases.
Two key events in the pathogenesis of atherosclerosis are adhesion of monocytes to the endothelium,
followed by transmigration into the subendothelial space and enhanced vascular cellular permeability (Gerrity
1981; Wardle 1994). Enhanced monocyte-endothelial interactions in vivo and in vitro have been demonstrated in
diabetes models (Esposito et al. 2001; Gerrity 1981). Of particular importance, hyperglycemia/HG-induced
augmentation of leukocyte adhesion to the endothelium has been reported to occur through the upregulation of
CAMs, and transendothelial migration (TEM) has been reported to be dependent on NF-κB activation (Hamuro
et al. 2002; Morigi et al. 1998). In addition, CAMs are believed to participate in the pathogenesis of
atherosclerosis (Lopes-Virella and Virella 1992). These proteins regulate the interactions between the
endothelium and leukocytes, and an increase in their expression on the endothelial surface causes increased
adhesion of leukocytes, particularly monocytes, which is one of the first steps in the process leading to atheroma
(Lopes-Virella and Virella 1992). In particular, over-expression of ICAM-1, VCAM-1, and E-selectin in the
endothelial cells of human atherosclerotic lesions has been reported (Bae 2012). The effects of HG
concentrations on the expression of CAMs in endothelial cells have been widely investigated. Increased
expression of ICAM-1 has been reported in human aortic endothelial cells cultured in HG (Kado et al. 2001).
These data are consistent with the finding that HG is a potent promoter of leukocyte adhesion to endothelial cells
under flow conditions, and that this process is dependent upon upregulation of E-selectin, ICAM-1, and VCAM-
17
1 (Morigi et al. 1998). Furthermore, adhesion of monocytes to the endothelium is one of the earliest events in the
vascular inflammation process, which is followed by their infiltration and differentiation into macrophages
(Hansson and Libby 2006). This key step is mediated by an interaction between monocytes and molecules
expressed on the surface of endothelial cells (Hansson and Libby 2006). In this study, VCN and SCL inhibited
the expression of CAMs and the adhesion of monocytes in HG-treated human endothelial cells.
Inflammatory responses have been mechanistically linked to the production of ROS (Inoguchi et al.
2000). Previous observations have indicated that hyperglycemia triggers the generation of free radicals, and that
oxidative stress and ROS production are considered important mediators of several biologic responses, including
cell proliferation and extracellular matrix deposition (Dunlop 2000; Han et al. 2005). The antioxidative activity
of VCN and SCL is related to their ability to scavenge superoxide radicals via endogenous antioxidant enzymes
such as SOD and CAT, suggesting that the capacity of VCN and SCL to inhibit ROS formation is partly owing
to the modulation of a key gene that regulates mediators of intracellular antioxidant capacity, i.e., SOD and CAT.
Therefore, it is possible that VCN and SCL have intracellular antioxidant activities in endothelial cells.
Importantly, activation of transcription factors such as NF-κB is known to affect CAM expression and to induce
coordinated up-regulation of other pro-inflammatory cytokines and chemoattractants, which may provide the
molecular link between the cell redox state and endothelial cell dysfunction (Rimbach et al. 2000). In addition,
ROS have been shown to activate various transcription factors, including NF-κB, in cultured endothelial cells,
leading to enhanced expression of MCP-1 and IL-8, which are chemokines strongly implicated in the
atherogenesis process (Uemura et al. 2001). Specifically, MCP-1 is a key mediator of monocyte trafficking and
IL-8 promotes neutrophil chemotaxis (Boisvert 2004). We demonstrated that HG induced MCP-1 and IL-8
18
Page 19 of 31
transcription and enhanced the production of ROS and the translocation of NF-κB into the nucleus in human
endothelial cells. Importantly, all of these effects were significantly attenuated by VCN and SCL, indicating that
VCN and SCL may prevent diabetic complications, such as arteriosclerotic vascular disorder and vascular
inflammation, through the regulation of MCP-1, IL8, ROS, and NF-κB.
In this study, we showed that intravenously injected VCN or SCL at 23.8 µg/mouse (equal to 20 µM in
peripheral blood) showed anti-inflammatory responses against HG-induced responses. Given that the average
weight of the mice used in this study was 27 g and the average weight of an adult human is 70 kg, we would
require 61.7 µg of VCN or SCL to achieve anti-diabetic effects if the compound was administrated intravenously
in humans. However, if the compounds are ingested as herbal tea, an amount greater than the calculated amounts
of these compounds is needed for the following reasons: 1) large differences exist between intravenous injection
and the oral route; 2) after ingesting the tea, several pharmacological processes are required for the compound
(VCN or SCL) to reach the blood stream, such as absorption, distribution, metabolism, and excretion; and 3) the
entire content of the compound in the herbal tea is not absorbed. In order for a consumed compound to be
utilized by the body's vascular system, the following 4 criteria, which represent the disposition of a
pharmaceutical compound within an organism, should be met: absorption, distribution, metabolism, and
excretion (ADME). These 4 criteria influence the compound levels and the kinetics of exposure of the tissues to
the compound; hence, these criteria influence the performance and pharmacological activity of the compound.
Our data demonstrate that treatment with VCN or SCL resulted in blockade of HG-induced vascular
inflammation via inhibition of NF-κB in primary human endothelial cells. These results suggest that VCN or
SCL has significant therapeutic benefits against diabetic complications and atherosclerosis by attenuating HG-
19
induced generation of H2O2, increasing activation of NF-κB, upregulating adhesion molecules, influencing
monocyte-endothelial adhesion/migration, and disrupting endothelial barrier function. Our findings indicate that
VCN or SCL can be regarded as a candidate for use in treatment of diabetic vascular inflammatory diseases.
References
Akeson, A.L., and Woods, C.W. 1993. A fluorometric assay for the quantitation of cell adherence to
endothelial cells. J. Immunol. Methods, 163(2): 181-185. DOI: 10.1016/0022-1759(93)90121-M.
PubMed ID: 8354887.
Bae, J.S. 2012. Role of high mobility group box 1 in inflammatory disease: Focus on sepsis. Arch.
Pharm. Res, 35(9): 1511-1523. DOIi: 10.1007/s12272-012-0901-5. PubMed ID: 23054707.
Bae, J.S., Lee, W., Nam, J.O., Kim, J.E., Kim, S.W., and Kim, I.S. 2014. Transforming Growth Factor
beta-induced Protein Promotes Severe Vascular Inflammatory Responses. Am. J. Respir. Crit.
Care. Med, 189(7): 779-786. DOI: 10.1164/rccm.201311-2033OC. PubMed ID: 24506343.
Bae, J.S., Lee, W., and Rezaie, A.R. 2012. Polyphosphate elicits pro-inflammatory responses that are
counteracted by activated protein C in both cellular and animal models. J. Thromb. Haemost,
10(6): 1145-1151. DOI: 10.1111/j.1538-7836.2012.04671.x. PubMed ID: 22372856.
Bae, J.S., and Rezaie, A.R. 2013. Thrombin inhibits HMGB1-mediated proinflammatory signaling
responses when endothelial protein C receptor is occupied by its natural ligand. BMB. Rep,
46(11): 544-549. DOI: 10.5483/BMBRep.2013.46.11.056. PubMed ID: 24152910
Boisvert, W.A. 2004. Modulation of atherogenesis by chemokines. Trends. Cardiovasc. Med, 14(4):
161-165. DOI: 10.1016/j.tcm.2004.02.006. PubMed ID: 15177267.
Borghi, S.M., Carvalho, T.T., Staurengo-Ferrari, L., Hohmann, M.S., Pinge-Filho, P., Casagrande, R.,
and Verri, W.A., Jr. 2013. Vitexin inhibits inflammatory pain in mice by targeting TRPV1,
oxidative stress, and cytokines. J. Nat. Prod, 76(6): 1141-1149. DOI: 10.1021/np400222v.
PubMed ID: 23742617
Day, C. 1998. Traditional plant treatments for diabetes mellitus: pharmaceutical foods. Br. J. Nutr,
80(1): 5-6. DOI: 10.1017/S0007114598001718. PubMed ID: 9797638.
Diehl, K.H., Hull, R., Morton, D., Pfister, R., Rabemampianina, Y., Smith, D., Vidal, J.M., and van de
Vorstenbosch, C. 2001. A good practice guide to the administration of substances and removal
of blood, including routes and volumes. J. Appl. Toxicol, 21(1): 15-23. DOI: 10.1002/jat.727.
PubMed ID: 11180276
Dunlop, M. 2000. Aldose reductase and the role of the polyol pathway in diabetic nephropathy. Kidney.
Int. Suppl, 77: S3-12. PubMed ID: 10997684.
Esposito, C., Fasoli, G., Plati, A.R., Bellotti, N., Conte, M.M., Cornacchia, F., Foschi, A., Mazzullo, T.,
20
Page 21 of 31
Semeraro, L., and Dal Canton, A. 2001. Long-term exposure to high glucose up-regulates
VCAM-induced endothelial cell adhesiveness to PBMC. Kidney. Int, 59(5): 1842-1849. DOI:
10.1046/j.1523-1755.2001.0590051842.x. PubMed ID: 11318955.
Flohe, L., and Otting, F. 1984. Superoxide dismutase assays. Methods Enzymol, 105: 93-104.PubMed
ID: 6328209.
Gerrity, R.G. 1981. The role of the monocyte in atherogenesis: I. Transition of blood-borne monocytes
into foam cells in fatty lesions. Am. J. Pathol, 103(2): 181-190.PubMed iD: 7234961.
Grundy, S.M., Benjamin, I.J., Burke, G.L., Chait, A., Eckel, R.H., Howard, B.V., Mitch, W., Smith, S.C.,
Jr., and Sowers, J.R. 1999. Diabetes and cardiovascular disease: a statement for healthcare
professionals from the American Heart Association. Circulation, 100(10): 1134-1146.Pubmed
ID: 10477542.
Hamuro, M., Polan, J., Natarajan, M., and Mohan, S. 2002. High glucose induced nuclear factor kappa
B mediated inhibition of endothelial cell migration. Atherosclerosis, 162(2): 277-287. DOI:
10.1016/S0021-9150(01)00719-5. PubMed ID: 11996947.
Han, H.J., Lee, Y.J., Park, S.H., Lee, J.H., and Taub, M. 2005. High glucose-induced oxidative stress
inhibits Na+/glucose cotransporter activity in renal proximal tubule cells. Am. J. Physiol. Renal.
Physiol, 288(5): F988-996. DOI: 10.1152/ajprenal.00327.2004. PubMed ID: 15598843
Hansson, G.K., and Libby, P. 2006. The immune response in atherosclerosis: a double-edged sword.
Nat. Rev. Immunol, 6(7): 508-519. DOI: 10.1038/nri1882. PubMed ID: 16778830.
Hofbauer, R., Moser, D., Salfinger, H., Frass, M., and Kapiotis, S. 1998. Sufentanil inhibits migration of
human leukocytes through human endothelial cell monolayers. Anesth. Analg, 87(5): 1181-
1185. DOI: 10.1097/00000539-199811000-00038. PubMed ID: 9806705.
Inoguchi, T., Li, P., Umeda, F., Yu, H.Y., Kakimoto, M., Imamura, M., Aoki, T., Etoh, T., Hashimoto, T.,
Naruse, M., Sano, H., Utsumi, H., and Nawata, H. 2000. High glucose level and free fatty acid
stimulate reactive oxygen species production through protein kinase C--dependent activation
of NAD(P)H oxidase in cultured vascular cells. Diabetes. 49(11): 1939-1945. DOI:
10.2337/diabetes.49.11.1939. PubMed ID: 11078463.
Islam, M.N., Ishita, I.J., Jung, H.A., and Choi, J.S. 2014. Vicenin 2 isolated from Artemisia capillaris
exhibited potent anti-glycation properties. Food. Chem. Toxicol, 69: 55-62. DOI:
10.1016/j.fct.2014.03.042. PubMed ID: 24713265.
Joubert, E., Joubert, M.E., Bester, C., De Beer, D., and De Lange, J.H. 2011. Honeybush (Cyclopia
spp.): From local cottage industry to global markets — The catalytic and supporting role of
research. S. Afr. J. Bot, 77(4): 889-907. DOI: 10.1016/j.sajb.2011.05.014.
Kado, S., Wakatsuki, T., Yamamoto, M., and Nagata, N. 2001. Expression of intercellular adhesion
molecule-1 induced by high glucose concentrations in human aortic endothelial cells. Life Sci,
68(7): 727-737. DOI: 10.1016/S0024-3205(00)00968-1. PubMed ID: 11205865.
Kannel, W.B., and McGee, D.L. 1979. Diabetes and cardiovascular disease. The Framingham study.
JAMA, 241(19): 2035-2038.PubMed ID: 430798.
Kazuno, S., Yanagida, M., Shindo, N., and Murayama, K. 2005. Mass spectrometric identification and
quantification of glycosyl flavonoids, including dihydrochalcones with neutral loss scan mode.
21
Anal. Biochem, 347(2): 182-192. DOI: 10.1016/j.ab.2005.09.020. PubMed ID: 16269127

Kim, I., Moon, S.O., Kim, S.H., Kim, H.J., Koh, Y.S., and Koh, G.Y. 2001. Vascular endothelial growth
factor expression of intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion
molecule 1 (VCAM-1), and E-selectin through nuclear factor-kappa B activation in endothelial
cells. J. Biol. Chem, 276(10): 7614-7620. DOI: 10.1074/jbc.M009705200. PubMed ID:
11108718.
Kim, T.H., Ku, S.K., Lee, I.C., and Bae, J.S. 2012. Anti-inflammatory functions of purpurogallin in LPS-
activated human endothelial cells. BMB. Rep, 45(3): 200-205. DOI:
10.5483/BMBRep.2012.45.3.200. PubMed ID: 22449709.
Ku, S.K., and Bae, J.S. 2014. Antithrombotic activities of sulforaphane via inhibiting platelet
aggregation and FIIa/FXa. Arch. Pharm. Res, 37(11): 1454-1463. DOI: 10.1007/s12272-014-
0403-8. PubMed ID: 24817443.
Ku, S.K., Han, M.S., Lee, M.Y., Lee, Y.M., and Bae, J.S. 2014. Inhibitory effects of oroxylin A on
endothelial protein C receptor shedding in vitro and in vivo. BMB. Rep, 47(6): 336-341. DOI:
10.5483/BMBRep.2014.47.6.198. PubMed ID: 24286327.
Ku, S.K., Lee, W., Kang, M., and Bae, J.S. 2015. Antithrombotic activities of aspalathin and nothofagin
via inhibiting platelet aggregation and FIIa/FXa. Arch. Pharm. Res, 38(6): 1080-1089. DOI:
10.1007/s12272-014-0501-7. PubMed ID: 25325928.
Laakso, M. 1999. Hyperglycemia and cardiovascular disease in type 2 diabetes. Diabetes 48(5): 937-
942. DOI: 10.1016/S0095-4543(05)70133-0. PubMed ID: 10523462.
Lee, J.D., Huh, J.E., Jeon, G., Yang, H.R., Woo, H.S., Choi, D.Y., and Park, D.S. 2009. Flavonol-rich
RVHxR from Rhus verniciflua Stokes and its major compound fisetin inhibits inflammation-
related cytokines and angiogenic factor in rheumatoid arthritic fibroblast-like synovial cells and
in vivo models. Int. Immunopharmacol, 9(3): 268-276. DOI: 10.1016/j.intimp.2008.11.005.
PubMed ID: 19111632.
Lee, W., Ku, S.K., and Bae, J.S. 2014. Vascular barrier protective effects of orientin and isoorientin in
LPS-induced inflammation in vitro and in vivo. Vascul. Pharmacol, 62(1): 3-14. DOI:
10.1016/j.vph.2014.04.006. PubMed ID: 24792192.
Leiro, J.M., Alvarez, E., Arranz, J.A., Siso, I.G., and Orallo, F. 2003. In vitro effects of mangiferin on
superoxide concentrations and expression of the inducible nitric oxide synthase, tumour
necrosis factor-alpha and transforming growth factor-beta genes. Biochem. Pharmacol, 65(8):
1361-1371. DOI: 10.1016/j.vph.2014.04.006. PubMed ID: 24792192.
Li, G.Q., Kam, A., Wong, K.H., Zhou, X., Omar, E.A., Alqahtani, A., Li, K.M., Razmovski-Naumovski, V.,
and Chan, K. 2012. Herbal medicines for the management of diabetes. Adv. Exp. Med. Biol,
771: 396-413.Pudmed ID: 23393692.
Lin, C.M., Huang, S.T., Liang, Y.C., Lin, M.S., Shih, C.M., Chang, Y.C., Chen, T.Y., and Chen, C.T.
2005. Isovitexin suppresses lipopolysaccharide-mediated inducible nitric oxide synthase
through inhibition of NF-kappa B in mouse macrophages. Planta. Med, 71(8): 748-753. DOI:
10.1055/s-2005-871287. PubMed ID: 16142640.
Lopes-Virella, M.F., and Virella, G. 1992. Immune mechanisms of atherosclerosis in diabetes mellitus.
22
Page 23 of 31
Diabetes, 41 Suppl 2: 86-91.PudMed ID: 1526343.

Mackman, N., Brand, K., and Edgington, T.S. 1991. Lipopolysaccharide-mediated transcriptional
activation of the human tissue factor gene in THP-1 monocytic cells requires both activator
protein 1 and nuclear factor kappa B binding sites. J. Exp. Med, 174(6): 1517-1526.PudMed
ID: 1744583.
Marrassini, C., Davicino, R., Acevedo, C., Anesini, C., Gorzalczany, S., and Ferraro, G. 2011. Vicenin-
2, a potential anti-inflammatory constituent of Urtica circularis. J. Nat. Prod, 74(6): 1503-1507.
DOI: 10.1021/np100937e. PubMed ID: 21608987.
Morigi, M., Angioletti, S., Imberti, B., Donadelli, R., Micheletti, G., Figliuzzi, M., Remuzzi, A., Zoja, C.,
and Remuzzi, G. 1998. Leukocyte-endothelial interaction is augmented by high glucose
concentrations and hyperglycemia in a NF-kB-dependent fashion. J. Clin. Invest, 101(9): 1905-
1915. DOI: 10.1172/JCI656. PubMed ID: 9576755.
Nannipieri, M., Rizzo, L., Rapuano, A., Pilo, A., Penno, G., and Navalesi, R. 1995. Increased
transcapillary escape rate of albumin in microalbuminuric type II diabetic patients. Diabetes
Care, 18(1): 1-9. DOI: 10.2337/diacare.18.1.1. PubMed ID: 7698029.
Pardo Andreu, G.L., Maurmann, N., Reolon, G.K., de Farias, C.B., Schwartsmann, G., Delgado, R.,
and Roesler, R. 2010. Mangiferin, a naturally occurring glucoxilxanthone improves long-term
object recognition memory in rats. Eur. J. Pharmacol, 635(1-3): 124-128. DOI:
10.1016/j.ejphar.2010.03.011.
Prior, R.L., and Cao, G. 1999. Antioxidant capacity and polyphenolic components of teas: implications
for altering in vivo antioxidant status. Proc. Soc. Exp. Biol. Med, 220(4): 255-261. DOI:
10.1046/j.1525-1373.1999.d01-44.x. PubMed ID: 10202399.
Rimbach, G., Valacchi, G., Canali, R., and Virgili, F. 2000. Macrophages stimulated with IFN-gamma
activate NF-kappa B and induce MCP-1 gene expression in primary human endothelial cells.
Mol. Cell. Biol. Res. Commun, 3(4): 238-242. PubMed ID: 10891398
Roglic, G., Unwin, N., Bennett, P.H., Mathers, C., Tuomilehto, J., Nag, S., Connolly, V., and King, H.
2005. The burden of mortality attributable to diabetes: realistic estimates for the year 2000.
Diabetes Care, 28(9): 2130-2135. DOI: 10.2337/diacare.28.9.2130. PubMed ID: 16123478 .
Rubino, F., and Gagner, M. 2002. Potential of surgery for curing type 2 diabetes mellitus. Ann. Surg,
236(5): 554-559. DOI: 10.1097/01.SLA.0000032951.37471.80. PubMed ID: 12409659.
Sanchez, G.M., Re, L., Giuliani, A., Nunez-Selles, A.J., Davison, G.P., and Leon-Fernandez, O.S. 2000.
Protective effects of Mangifera indica L. extract, mangiferin and selected antioxidants against
TPA-induced biomolecules oxidation and peritoneal macrophage activation in mice. Pharmacol.
Res, 42(6): 565-573. DOI: 10.1006/phrs.2000.0727. PubMed ID: 11058410.
Seo, K.H., Park, M.J., Ra, J.E., Han, S.I., Nam, M.H., Kim, J.H., Lee, J.H., and Seo, W.D. 2014.
Saponarin from barley sprouts inhibits NF-kappaB and MAPK on LPS-induced RAW 264.7
cells. Food. Funct, 5(11): 3005-3013. DOI: 10.1039/c4fo00612g. PebMed ID: 25238253.
Thomas, J.E., and Foody, J.M. 2007. The pathophysiology of cardiovascular disease in diabetes
mellitus and the future of therapy. J. Cardiometab. Syndr, 2(2): 108-113. PubMed ID:17684463
Tooke, J.E. 1995. Microvascular function in human diabetes. A physiological perspective. Diabetes,
23
44(7): 721-726. DOI: 10.2337/diabetes.44.7.721. PubMed ID: 7789639.

Uemura, S., Matsushita, H., Li, W., Glassford, A.J., Asagami, T., Lee, K.H., Harrison, D.G., and Tsao,
P.S. 2001. Diabetes mellitus enhances vascular matrix metalloproteinase activity: role of
oxidative stress. Circ. Res, 88(12): 1291-1298. DOI: 10.1161/hh1201.092042. PubMed ID:
11420306.
Wardle, E.N. 1994. Vascular permeability in diabetics and implications for therapy. Diabetes. Res. Clin.
Pract, 23(3): 135-139. DOI: 10.1016/0168-8227(94)90096-5. PubMed ID: 7924872.
Warren, C.P. 1999. Antioxidant effects of herbs. Lancet. 353(9153): 676. DOI: 10.1016/S0140-
6736(05)75477-5. PubMed ID: 10030367.
Whiting, D.R., Guariguata, L., Weil, C., and Shaw, J. 2011. IDF diabetes atlas: global estimates of the
prevalence of diabetes for 2011 and 2030. Diabetes Res. Clin. Pract, 94(3): 311-321. DOI:
10.1016/j.diabres.2011.10.029. PubMed ID: 22079683.
Yoo, H., Ku, S.K., Lee, T., and Bae, J.S. 2014. Orientin inhibits HMGB1-induced inflammatory
responses in HUVECs and in murine polymicrobial sepsis. Inflammation. 37(5): 1705-1717.
DOI: 10.1007/s10753-014-9899-9. PubMed ID: 24771074.
24
Page 25 of 31
Figure Legends
Figure 1. Effects of vicenin-2 (VCN) and scolymoside (SCL) on high glucose (HG)-mediated permeability
in vitro and in vivo. (A) Chemical structures of VCN and SCL. (B) The effects of pretreatment with different
concentrations of VCN (white bar) or SCL (gray bar) for 6 h on barrier disruption caused by 25 mM (HG) for 24
h. (C) The effects of VCN (white bar) or SCL (gray bar) injected intravenously (i.v.) on HG-induced (9
mg/mouse, i.v.) vascular permeability in mice were determined by measuring the levels of Evans blue dye in
peritoneal washings (expressed as µg/mouse, n = 5). (D) Staining for F-actin. Human umbilical vein endothelial
cell (HUVEC) monolayers grown on glass coverslips were stimulated with HG (25 mM) for 24 h, treated with
each compound (20 µM) for 6 h, and stained for F-actin. The arrows indicate intercellular gaps. (E) The effects
of VCN (white bar) or SCL (gray bar) on cellular viability were measured by using MTT assays. The results are
expressed as the mean ± standard error of the mean of at least 3 independent experiments. *P < 0.05 vs. HG
alone (B, C).
Figure 2. Effects of vicenin-2 (VCN) and scolymoside (SCL) on high glucose (HG)-mediated pro-
inflammatory responses. HG-induced (25 mM, for 24 h) expression of cell adhesion molecules on human
umbilical vein endothelial cells (HUVECs) was determined after treating cells with VCN or SCL (20 µM each)
for 6 h. VCAM-1 (white bar), ICAM-1 (gray bar), and E-Selectin (black bar) were detected by using ELISA. (B,
C) HG-induced (25 mM, for 24 h) adherence of human neutrophils to HUVEC monolayers was assessed after
pretreating cells with VCN or SCL for 6 h. The amounts of adherent human neutrophils were monitored by using
(B) the cell-cell adhesion assay and (C) fluorescence microscopy. (D) As described for Fig. 1C, except that
25
leukocyte migration into the peritoneal cavities of mice was analyzed. The data are expressed as the mean ±
standard error of the mean of 3 independent experiments. *P < 0.05 vs. HG alone.
Figure 3. Effects of vicenin-2 (VCN) and scolymoside (SCL) on high glucose (HG)-induced expression of
MCP-1 and IL-8 mRNA and ROS formation. (A, B) The cells were pretreated with VCN or SCL for 6 h and
were subsequently incubated with HG (25 mM) for 24 h. mRNA was extracted, and real time qRT-PCR analysis
was performed by using specific primers for MCP-1 (A), IL-8 (B), and GAPDH, as described in the Materials
and methods. (C) Cells were pretreated with VCN or SCL for 6 h and were then stimulated with HG for 0 to 120
min; H2O2 assays were performed as described in the Materials and methods. (D, E) The same as (A, B), except
that expression of SOD and CAT (D) and the activities of SOD and CAT (E) were measured, as described in the
Materials and methods. The data are expressed as the mean ± standard error of the mean of 3 independent
experiments. *P < 0.05 vs. HG alone.
Figure 4. Effects of vicenin-2 (VCN) and scolymoside (SCL) on high glucose (HG)-induced activation of
κB. The cells were pretreated with VCN or SCL for 6 h and were subsequently stimulated
nuclear factor (NF)-κ
with HG for 24 h. (A) The expression levels of NF-κB in nuclear or cytoplasmic extracts were evaluated by
using western blotting. β-actin and lamin A/C were used as the loading controls for cytoplasmic and nuclear
extracts, respectively. (B) The graphs show the densitometric intensities of NF-κB normalized to lamin A/C for
nuclear extracts or β-actin for cytoplasmic extracts (N = 3 blots). (C) NF-κΒ p65 was visualized by using rabbit
anti-p65 monoclonal antibody (1:100 dilution), which only recognized NF-κB p65. Goat anti-rabbit antibody
26
Page 27 of 31
(1:100 dilution) conjugated to fluorescein isothiocyanate was used. The subcellular localization of NF-κB p65
was examined by using immunofluorescence staining, with visualization under an immunofluorescence

microscope. The images are representative of 3 independent experiments. * P < 0.05 as compared to HG only.
27
101x102mm (300 x 300 DPI)

Page 28 of 31
420x380mm (300 x 300 DPI)

504x336mm (300 x 300 DPI)

Page 30 of 31
484x339mm (300 x 300 DPI)

Vicenin-2 and Scolymoside Inhibit High Glucose-Induced Vascular Inflammation in Vitro and in Vivo

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Vicenin-2 and Scolymoside Inhibit High Glucose-Induced Vascular Inflammation in Vitro and in Vivo

Uploaded by

Copyright:

Available Formats

Page 1 of 31

Sae-Kwang Ku1 and Jong-Sup Bae2*

Sciences, Kyungpook National University, Daegu 702-701 Republic of Korea

Running title: Effect of vicenin-2 and scolymoside on diabetes

College of Pharmacy, Research Institute of Pharmaceutical Sciences, Kyungpook National University

80 Dahak-ro, Buk-gu, Daegu 702-701, Republic of Korea

Phone, 82-53-950-8570; Fax, 82-53-950-8557; E-mail, baejs@knu.ac.kr;

Conflict of interest statement

The authors declare no conflicts of interest.

government [MSIP] (Grant No. 2012R1A5A2A42671316).

therapeutic benefits against diabetic complications and atherosclerosis.

Keywords: vicenin-2, scolymoside, high glucose, diabetes mellitus

Health-promoting properties such as antioxidant, anti-inflammatory, and enhancement of recognition memory

HG in human endothelial cells and in mice.

Materials and methods

Vybrant DiD were purchased from Invitrogen (Carlsbad, CA).

described (Bae and Rezaie 2013; Hofbauer et al. 1998).

Animals and husbandry

Laboratory Animals issued by Kyungpook National University (KNU 2012-13).

Cell viability assay

(Tecan Austria GmbH, Austria).

In vitro permeability assay

Endothelial cell permeability in response to increasing concentrations of each compound was

In vivo permeability and the leukocyte migration assay

administered to each mouse by intravenous injection, immediately followed by intravenous injection of HG (9

Lee et al. 2009).

Expression of cell adhesion molecules (CAMs)

Cell-cell adhesion assay

signal/total signal) × 100.

RNA preparation and real-time qRT-PCR

sense: 5′- CAGGTGGTCCATGGAATCCTGA -3′; IL-8, sense: 5′- ACTGAGAGTGATTGAGAGTGGAC -3′;

antisense: 5′- AACCCTCTGCACCCAGTTTTC -3′; superoxide dismutase (SOD), sense: 5′-

GTTGGGGTTGGCTTGGTTTC-3′; anti-sense: 5′- ATAAGGCCTGTTGTTCCTTGC-3′; catalase (CAT),

sense: 5′-AGGGGCCTTTGGCTACTTTG-3′; anti-sense: 5′-ACCCGATTCTCCAGCAACAG-3′; GAPDH,

sense: 5′- GTCTTCACTACCATGGAGAAGG -3′; antisense: 5′- TCATGGATGACCTTGGCCAG -3′.

SOD and CAT activity assays

H2O2 release assay

Preparation of cytoplasmic and nuclear extracts

Densitometry analysis was performed by using ImageJ Gel Analysis software.

VCN (apigenin-6,8-di-C-glucoside) and SCL (luteolin-7-O-rutinoside), which are compounds found in

no significant effect on endothelial cell permeability (data not shown).

to prevent atherosclerotic lesions.

vascular inflammatory process.

Effect of VCN and SCL on HG-induced oxidative stress

Effect of VCN and SCL on HG-induced activation of NF-κB

of VCN and SCL on HG-induced vascular responses in vitro and in vivo.

inflammation, through the regulation of MCP-1, IL8, ROS, and NF-κB.

Anal. Biochem, 347(2): 182-192. DOI: 10.1016/j.ab.2005.09.020. PubMed ID: 16269127

Diabetes, 41 Suppl 2: 86-91.PudMed ID: 1526343.

44(7): 721-726. DOI: 10.2337/diabetes.44.7.721. PubMed ID: 7789639.

alone (B, C).

experiments. *P < 0.05 vs. HG alone.

was examined by using immunofluorescence staining, with visualization under an immunofluorescence

101x102mm (300 x 300 DPI)

420x380mm (300 x 300 DPI)

504x336mm (300 x 300 DPI)

484x339mm (300 x 300 DPI)

You might also like