Saint George University of Beirut BIOL 201 Print Name ________________________________________

SIGN NAME ______________________________________

INSTRUCTIONS: First sign your name on the top of the first page and print your name at the top of each page.
Point values of the questions are given in brackets. Only use the box (and the lines inside) provided for your
written answers, except when asked to complete existing diagrams. Written answers outside the box will be
ignored. Write legibly or you will not get any credit for the answer. Points will be taken off for irrelevant
information. Only answers written in ink will be considered for regrades!

1. You do conventional immunofluorescence (fix, permeabilize, then add antibody) using two
different antibodies (Ab) that recognize two different epitopes on a Protein X, and you see
(dashed line indicates the fluorescence you see):
ANTIBODY 1 ANTIBODY 2
NO ANTIBODY (PLASMA MEMBRANE AND (PLASMA MEMBRANE AND
(NO STAINING) VESICLES STAINED) VESICLES STAINED)

You repeat the immunofluorescence experiment but this time incubating with the antibodies
before fixing the cells, and you see:
ANTIBODY 1
NO ANTIBODY (PLASMA MEMBRANE ANTIBODY 2
(NO STAINING) STAINED) (NO STAINING)

A. Is protein X an integral membrane protein or is it a soluble cytoplasmic protein. Briefly

explain. [5 points]

Protein X likely spans the membrane because it binds to Antibody 1 even without

permeabilization.

B. Why doesn’t Antibody 2 work in the second experiment? [5 points]

Antibody 2 binds to the intracellular portion of Protein X that it cannot reach without

permeabilization.

Fares-Exam 2 Fall 2021 1

Saint George University of Beirut BIOL 201 Print Name ________________________________________

2. Protein X has three predicted domains called A, B, and C (in that order). To determine the
functions of these domains, you fuse each of these domains to the NH2 terminus of GFP and you
assay their localization in cells.

A-GFP localizes extracellularly.

B-GFP localizes to the cytoplasm.
C-GFP localizes to the cytoplasm.

A. Why does A-GFP localize extracellularly? [5 points]

Domain B functions as a signal sequence that targets GFP to the secretory pathway.

B. Where do you think Protein X normally localizes (cytoplasm, extracellular, or inserted into
membranes)? [5 points]

Likely extracellularly since Domain A functions as a signal sequence.

3. Protein X normally localizes to the nucleus. Protein X has three domains A-B-C. To
determine which one of these three domains regulates nuclear localization, you fuse each of
these to GFP and you visualize the localization of GFP. You get the following results:

Protein Localization
GFP cytoplasm and nucleus
A-GFP nucleus
B-GFP cytoplasm
C-GFP nucleus

A. If you delete domain A in Protein X, where would this Protein X lacking domain A localize?
Briefly explain. [5 points]

Nucleus because domain C can also mediate nuclear localization.

Fares-Exam 2 Fall 2021 2

Saint George University of Beirut BIOL 201 Print Name ________________________________________

B. If you delete domain B in Protein X, where would this Protein X lacking domain B localize?
Briefly explain. [5 points]

Nucleus because domain A and C mediate nuclear localization.

C. If you delete domain C in Protein X, where would this Protein X lacking domain C localize?
Briefly explain. [5 points]

Nucleus because domain A can also mediate nuclear localization.

D. Why does GFP localize to the cytoplasm and nucleus, while B-GFP localize to the cytoplasm?
[5 points]

Two possibilities (either one is fine). 1) GFP is small and diffuses in and out of the nucleus
while B-GFP is bigger and cannot enter through nuclear pores. 2) B has a nuclear export
signal that when fused to GFP drives it out of the nucleus.

4. You visualize two molecules, Molecule A (light grey; left) and Molecule B (dark grey, right),
when they are in the extracellular medium and after they enter a eukaryotic cell.

IN THE MEDIUM AFTER ENTERING

CELLS

A. Propose a possible nature for Molecule A (size, type, …) and the mechanism for its entry. [5
points]

Two possibilities (either one is fine). 1) Small, charged molecule (like an ion, glucose, …) that
is transported across the membrane by a channel or transporter. 2) Hydrophobic molecule
(like steroid hormone) that diffuses across the membrane.

Fares-Exam 2 Fall 2021 3

Saint George University of Beirut BIOL 201 Print Name ________________________________________

B. Propose a possible nature for Molecule B (size, type, …) and the mechanism for its entry. [5
points]

Large molecule that is endocytosed by cells.

5. You measure using FRAP the rate of lateral diffusion in the plasma membrane of two
molecularly unrelated integral membrane proteins, EGF Receptor (EGFR) and Transferrin
Receptor (TfR); you do this either in the absence of drug X or in the presence of drug X. You get
the following results:

RATE OF LATERAL DIFFUSION

MINUS DRUG X PLUS DRUG X

EGFR 2 µm2/sec 4 µm2/sec

TfR 1.5 µm2/sec 3 µm2/sec

How could the drug be affecting the integral membrane proteins and/or the cells? Briefly
explain. [5 points]

Since the rates of both membrane proteins has increased two-fold, the drug is likely

Increasing the fluidity of the plasma membrane.

6. You discover a living and thriving new species. You find that in this species, the
chromosomes are made up of DNA and that replication of this DNA utilizes the same
mechanisms used by all other organisms. The lengths of the chromosomes of this species
remain the same in successive generations. However, you discover that this new species does
not have telomerase activity. What can you conclude about the chromosomes/DNA of this
species? Briefly explain. [5 points]

Chromosome is circular and not linear since replication of circular DNA does not

require telomerase. No ends to worry about.

Fares-Exam 2 Fall 2021 4

Saint George University of Beirut BIOL 201 Print Name ________________________________________

7. Shown is a DNA molecule that you want to replicate in a test-tube. You therefore denature
this DNA molecule (separate the two strands) and add the indicated primer, dNTPs, and DNA
Polymerase. Write the sequence of the resulting DNA molecules following one round of
replication. [5 points]

5’ GACTTGCAAAGTCGGGAGCTAGTCAGCTAGTCGATGGGAC 3’
3’ CTGAACGTTTCAGCCCTCGATCAGTCGATCAGCTACCCTG 5’

PRIMER: 5’ GTCGGGAGCTAG 3’
5’ GTCGGGAGCTAGTCAGCTAGTCGATGGGAC 3’
3’ CTGAACGTTTCAGCCCTCGATCAGTCGATCAGCTACCCTG 5’

8. Shown is part of a bacterial chromosome (indicated by the box) that contains one gene (gene
A) that encodes a protein. To find where gene A is, you make different bacterial strains. Each
strain contains one of the indicated deletions of the chromosome. In each of these strains, you
analyze the mRNA made from gene A. Each deletion is 200 base pairs.

Δ1 Δ2 Δ3 Δ4 Δ5

For each of these deletions, you get the following results for the gene of interest:

Δ1: No effect on mRNA.

Δ2: mRNA is 1000 bp longer.
Δ3: mRNA is shorter by 200 bases.
Δ4: No mRNA is made.
Δ5: No effect on mRNA.

A. Why do Δ1 and Δ5 have no effect on mRNA? Briefly explain. [4 points]

Deletions are outside of gene limits, meaning after terminator (for Δ1) and before

promoter (for Δ5).

Fares-Exam 2 Fall 2021 5

Saint George University of Beirut BIOL 201 Print Name ________________________________________

B. Why does Δ2 give a longer mRNA? Briefly explain. [4 points]

Terminator is deleted, so transcription does not end where it should.

C. Why does Δ3 give a shorter mRNA? Briefly explain. [4 points]

Part of the DNA that is transcribed is deleted.

D. Why does Δ4 result in no mRNA made? Briefly explain. [4 points]

Promoter is deleted.

E. Draw above the diagram of the chromosome a line that shows, as accurately as possible the
limits of the mRNA that is made. Indicate with an arrow the direction of transcription. [4
points]

9. Shown is a drawing of a gene:

PROMOTER

OA TERMINATOR EB

Within the promoter of this gene is an operator sequence OA that influences whether the gene
is transcribed. Transcription of the gene is also dependent on an enhancer sequence EB.

-Protein “A” binds to OA. This binding is regulated by compound “a”. Gene expression is
negatively regulated by this system and shows repressible transcription. That is, protein A is an
aporepressor.

-Protein “B” binds to EB. This binding is regulated by compound “b”. Compound b must bind to
protein B to activate transcription. That is, protein B is a transcriptional activator.

Fares-Exam 2 Fall 2021 6

Saint George University of Beirut BIOL 201 Print Name ________________________________________

Circle the appropriate word (shown in bold) indicating whether protein A and/or protein B are
bound to their respective sequences, and whether the gene is turned on, meaning transcribed
under the following conditions:

A. “a” is present and “b” is absent: [2.5 pts]

Protein A is / isn’t bound to OA.
Protein B is / isn’t bound to EB.
Transcription is ON / OFF

B. “a” is absent and “b” is present: [2.5 pts]

Protein A is / isn’t bound to OA.
Protein B is / isn’t bound to EB.
Transcription is ON / OFF

C. “a” and “b” are both absent: [2.5 pts]

Protein A is / isn’t bound to OA.
Protein B is / isn’t bound to EB.
Transcription is ON / OFF

D. “a” and “b” are both present: [2.5 pts]

Protein A is / isn’t bound to OA.
Protein B is / isn’t bound to EB.
Transcription is ON / OFF

10. You discover a new unicellular organism, and you want to determine whether it is a
prokaryote or eukaryote. You therefore measure the sizes of the genes and their
corresponding RNAs and get the following results:

GENE SIZE OF GENE (DNA) SIZE OF RNA

1 1 kb 1 kb
2 2 kb 2 kb
3 3 kb 2.5 kb
4 5 kb 5 kb
5 4 kb 3 kb
6 1.5 kb 1.5 kb

Assuming the size of the transcriptional promoter and terminator sequences are negligible, is
this organism likely a prokaryote or eukaryote? Briefly explain. [5 points]

Eukaryote since genes 3 and 5 have shorter RNAs than genes/DNA; this suggests that

this organism has introns that are spliced out.

Fares-Exam 2 Fall 2021 7