VELAMMAL NEXUS SCHOOLS

STD: XII UNIT TEST-III QUESTIONS TO PRACTICE

SUBJECT: BIOLOGY
_________________________________________________________________________________
CH 6 MOLECULAR BASIS OF INHERITANCE

2 MARKS
1. Draw a schematic representation of dinucleotide. Label the following:
(i) The components of a nucleotide
(ii) 5′ end
(iii) N-glycosidic linkage
(iv) Phosphodiester linkage.
2. A DNA segment has a total of 1500 nucleotides, out of which 410 are
Guanine containing nucleotides. How many pyrimidines bases this DNA
segment possesses?
3. State the dual role of deoxyribonucleoside triphosphates during DNA
replication.
4. State the functions of the following in a prokaryote: (i) tRNA (ii) rRNA
5.Mention the role of ribosomes in peptide bond formation. How does ATP
facilitate it?
6. A template strand is given below. Write down the corresponding coding
strand and the mRNA strand that can be formed, along with their polarity.
3′ ATGCATGCATGCATGCATGCATGC 5′
7.One of the salient features of the genetic code is that it is nearly universal
from bacteria to humans. Mention two exceptions to this rule. Why are some
codes said to be degenerate?
8. Explain the role of 35S and32P in the experiments conducted by Hershey and
Chase.
9.Protein synthesis machinery revolves around RNA but in the course of
evolution it was replaced by DNA. Justify.
10. How are the structural genes activated in the lac operon in E. coli?
11.Why is DNA molecule considered as a better hereditary material than RNA
molecule? 
12.a.Name the negatively charged and positively charged components of a
nucleosome.
b.Name the transcriptionally active region of chromatin in a nucleus.
13.Which one of an intron and an exon is reminiscent of antiquity?
14.Explain the two factors responsible for conferring stability to double helix
structure of DNA.
15.What is aminoacylation? State its significance.
3 MARKS
1. (i) Name the enzyme that catalyses the transcription of hnRNA.
(ii) Why does the hnRNA need to undergo changes? List the changes that hnRNA
undergoes and where in the cell such changes take place.
2. (a) List the two methodologies which were involved in human genome project.
Mention how they were used.
(b) Expand ‘YAC’ and mention what was it used for.
3.What are satellite DNA in a genome? Explain their role in DNA fingerprinting.
4.Describe the structure of a RNA polynucleotide chain having four different types of
nucleotides.
5. Describe briefly the origin of replication.
6.Write the full form of VNTR. How is VNTR different from a probe?
7.The base sequence in one of the strands of DNA is TAGCATGAT.
(i) Give the base sequence of its complementary strand.
(ii) How are these base pairs held together in a DNA molecule?
(iii) Explain the base complementarity rules. Name the scientist who framed this
rule.
8.a. Draw a schematic representation of the structure of a transcription unit and
show the following in it:
(i) Direction in which the transcription occurs
(ii) Polarity of the two strands involved
(iii) Template strand
(iv) Terminator gene
(b) Mention the function of promoter gene in transcription.
9.How is hnRNA processed to form mRNA?
10.(a) Draw a labelled schematic diagram of a replication fork showing continuous
and discontinuous replication of DNA strands.
(b) State a reason why is the replication continuous and discontinuous in the
diagram drawn.
11.(a) Expand VNTR and describe its role in DNA fingerprinting.
(b) List any two applications of DNA fingerprinting technique.
12.Summarize the process by which the sequence of DNA bases in Human Genome
Project was determined using the method developed by Frederick Sanger. Name
a free-living non-pathogenic nematode whose DNA has been completely
sequenced.
13.a. How does mutation occur?
b. Differentiate between point mutation and frameshift mutation.
14.a. Mention the application of DNA finger printing
b. Mention the contribution of genetic maps in human genome project?
c. State which chromosome has
(i) Maximum number of genes.
(ii) The one which has the least number of genes.
15.a. Explain the two major approaches of HGP.
b. Write any two goals of HGP

5 MARKS
1. Describe the experiment with Streptococcus pneumoniae that demonstrated the
existence of some “transforming principle”.
2.(a)State the reasons for which Hershey and Chase carried out their experiments.
(b)Answer the following questions based on the experiments of Hershey and
Chase:
(i) Name the different radioactive isotopes they used, and explain how they used
them.
(ii) Why did they need to agitate and spin their culture?
(iii) Write their observations and the conclusions they arrived at.
3.(a) State the 'Central dogma' as proposed by Francis Crick. Are there any exceptions to
it? Support your answer with a reason and an example.
(b) Explain how the biochemical characterization(nature) of "Transforming Principle" was
determined, which was not defined from Griffith's experiments.
4.Explain the process of transcription in prokaryotes. How is the process different
in eukaryotes?
5.Explain the role of regulatory gene in a lac operon. Why is regulation of lac operon
called as negative regulation?
6.(a) Write the contributions of the following scientists in deciphering the genetic
code. George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
(b) State the importance of a Genetic code in protein synthesis.
7. a.Write any two different levels at which regulation of Gene Expression could be
exerted in Eukaryotes.
b.Draw a Schematic labelledsketch of lac operon in a 'switched on' state.
8.(a) Study the table given below and identify (i), (ii), (iii) and (iv)
Aminoacid Phe Val
DNA Code in gene AAA CAC
Codon in mRNA (i) (ii)
Anticodon in tRNA (iii) (iv)

(b) A polypeptide consists of 14 different amino acids. 

(i)   How many base pairs must be there in the processed mRNA that codes for this
polypeptide? 
(ii)  How many different types of tRNA are needed for thesynthesis of this
polypeptide? 

9.a. Mention the role of codons AUG and UGA during protein synthesis.
b.Differentiate between the genetic codes given below:
(i) Unambiguous and Universal (ii)Degenerate and initiator
c. What is called Anticodon?
10. Explain the steps of DNA Fingerprinting.
*********************************************************************************************