% Chapter 27: Molecular Genetics

New Senior Secondary Mastering Biology (Second Edition) Chapter 27
Question Bank Multiple-choice questions
% Chapter 27 Molecular genetics
Multiple-choice questions
[10163069]
**The amino acid sequence in a certain part of a polypeptide is shown below.
Met–Lys–Pro– …
The table below shows the codons for some amino acids.
Amino acid Codon
Lysine (Lys) AAA AAG
Methionine (Met) AUG
Proline (Pro) CCU CCC CCA CCG
Which of the following is a possible base sequence on the template strand of

DNA coding for this part of the polypeptide?
A ATGAAGCCA
B AUGAAGCCA
C TACTTCGGT
D UACUUCGGU
C
---------------------------------------------------
[10163072]
* Which of the following shows the codon and the anticodon for the base sequence
TAC on the template strand of DNA?
Codon Anticodon
A ATG UAC
B AUG AUG
C AUG UAC
D UAC AUG
C
---------------------------------------------------
© Oxford University Press 27-1

[10163083]
**Directions: The following two questions refer to the base sequence on the coding
strand of a segment of DNA at the beginning of a gene shown below.
ATGTATCGCACG …
Which of the following is/are the anticodon(s) in the tRNA involved in the
translation of mRNA synthesized from this segment of DNA?
(1) AUA
(2) AUG
(3) GCG
A (1) only
B (2) only
C (1) and (3) only
D (1), (2) and (3)
C
---------------------------------------------------
[10163094]
**Which of the following mutations probably causes the greatest change in the
structure of the protein synthesized from the above gene?
A deletion of the 4th base
B deletion of the 4th to 6th bases
C substitution of the 6th base
D inversion of the 4th and 5th bases
A
---------------------------------------------------
[10163105]
* The base sequence CAT on the coding strand of DNA codes for the amino acid
histidine. Which of the following is the anticodon in the tRNA that carries
histidine during translation?
A CAT
B CAU
C GUA
D GTA
C
---------------------------------------------------

[10163110]
 The diagram below shows a mutation occurring in a chromosome.
Which type of chromosome mutation is shown?

A deletion
B duplication
C inversion
D translocation
A
---------------------------------------------------
[10163114]
* The base sequence at the beginning of an mRNA molecule which codes for a
polypeptide is shown below.
AUGCAUGUUAUUACCG …
Which of the following shows the first three bases on the template strand of the
segment of DNA from which this mRNA molecule is synthesized?
A ATG
B AUG
C TAC
D UAC
C
---------------------------------------------------

[10163124]
 Directions: The following two questions refer to the diagram below, which
shows some processes occurring in a cell. The diagram is not drawn to scale.
What are nucleic acids X and Y?

X Y
A DNA mRNA
B mRNA DNA
C mRNA tRNA
D rRNA mRNA
A
---------------------------------------------------
[10163165]
 Which of the following processes occur(s) at structure Z?
(1) transcription
(2) translation
(3) translocation
A (1) only
B (2) only
C (1) and (2) only
D (2) and (3) only
B
---------------------------------------------------

[10163177]
 Which of the following statements about the genetic code is not correct?
A There are more than one codes for most amino acids.
B All organisms use different sets of genetic code.
C The bases of one code are not shared with other codes.
D A code consists of three bases.
B
---------------------------------------------------
[10163180]
* The ratio (A + T / C + G) differs in samples of DNA from different species,
e.g. 1.00 in E. coli and 1.79 in yeast. This indicates that
A A pairs with T and C pairs with G.
B the same triplet code codes for different amino acids in different species.
C the number of particular base pairs differs in different species.
D there is less DNA in simpler organisms.
C
---------------------------------------------------
[10163193]
 Mutations that are not induced by external agents are called
A gene mutations.
B inborn mutations.
C induced mutations.
D spontaneous mutations.
D
---------------------------------------------------
[10163198]
 Down syndrome is due to a mutation in which
A a segment of chromosome is reversed.
B segments of two non-homologous chromosomes are attached together.
C the total number of chromosomes is increased.
D the number of chromosome sets is increased.
C
---------------------------------------------------

[10163202]
 Which of the following statements about mRNA are correct?
(1) The nucleotides in it do not contain base T.
(2) It is single-stranded.
(3) It does not replicate by itself.
A (1) and (2) only
B (1) and (3) only
C (2) and (3) only
D (1), (2) and (3)
D
---------------------------------------------------
[10163207]
* The base sequence on one of the strands of a segment of DNA in a cell is shown
below.
… ATTGGCC …
A scientist treated this cell with a mutagen. He found that the structure of a base
A in the above segment of DNA is changed. It paired with another base in the
same way as a base G. What would be the base sequence of the corresponding
segment on the DNA strand synthesized during replication?
A CAACCGG
B CTTGGCC
C GAACCGG
D TAACCGG
A
---------------------------------------------------
[10163208]
 Which of the following statements about gene mutations is/are correct?
(1) They are sudden changes in DNA.
(2) They alter only one amino acid in the polypeptide synthesized.
(3) All gene mutations cause genetic diseases.
A (1) only
B (2) only
C (3) only
D (1) and (2) only
A
---------------------------------------------------

[10163213]
**Directions: The following three questions refer to the base sequence on the
template strand of a segment of DNA.
… CGACAAAGC …
The table below shows some codons and the amino acids they code for.
Codon Amino acid
AGC Serine (Ser)
UCC Serine (Ser)
UCG Serine (Ser)
GUU Valine (Val)
GCU Alanine (Ala)
CAA Glutamine (Gln)
CGA Arginine (Arg)
Which of the following is the amino acid sequence of the polypeptide

synthesized from the above segment of DNA?
A Ala–Gln–Ser
B Ala–Val–Ser
C Arg–Gln–Ser
D Arg–Val–Ser
B
---------------------------------------------------
[10163219]
**If a mutation occurs in the above segment of DNA such that the last base C is
replaced by a base G, how will the polypeptide be affected?
A One of the amino acids will be altered.
B The whole amino acid sequence will be altered.
C No polypeptide will be synthesized.
D No change will occur in the polypeptide.
D
---------------------------------------------------

[10163223]
**If a mutation occurs such that the base sequence of the segment of DNA becomes
‘CGAGAAACC’, which type of mutation has occurred?
A deletion
B insertion
C substitution
D inversion
D
---------------------------------------------------
[10163229]
 Which of the following statements about people with Down syndrome is correct?
A They have an extra chromosome 21 in their cells.
B They have an extra chromosome 23 in their cells.
C They have a defect in the X chromosome.
D They have a defect in the Y chromosome.
A
---------------------------------------------------
[10163230]
 Which of the following is not a genetic disease?
A AIDS
B haemophilia
C red-green colour blindness
D sickle-cell anaemia
A
---------------------------------------------------
[10163242]
* Which of the following statements about mutations is not correct?
A Mutations can occur naturally.
B The changes in the DNA resulting from mutations are permanent.
C All mutations occurring in the parents can be passed on to the offspring.
D The rate of mutations increases when an organism is exposed to high-energy
radiations.
C
---------------------------------------------------

Question Bank Short questions
Short questions
[10163356]
 The diagram below is a drawing that represents molecules of DNA and
messenger RNA (mRNA).
The mRNA molecule is shorter than the DNA molecule.

a State, using only the information in the diagram, one other way to
distinguish between DNA and mRNA. (1 mark)
b Give one further difference in structure between DNA and RNA.
(1 mark)
DNA and mRNA are both involved in protein synthesis. The mRNA molecule,
carrying the code for protein, leaves the nucleus and attaches to a ribosome. The
ribosome is the site where a protein molecule is formed.
c Suggest why DNA is not able to leave the nucleus. (1 mark)
d Explain why the mRNA molecule is shorter than a DNA molecule.
(2 marks)
OCR GCE (AS) Molecules, Biodiversity, Food and Health Jun 2010 Q4a i, ii, iv, v
-- answer --
a DNA is double-stranded while mRNA is single-stranded. 1m
b DNA contains deoxyribose while RNA contains ribose. /
DNA contains thymine (T) while RNA contains uracil (U). 1m
c DNA is too big to pass through the pores in the nuclear membrane. 1m
d The genetic information of only one gene / a part of a DNA molecule is copied to
the mRNA molecule. 1m
A DNA molecule is comprised of many genes. 1m
---------------------------------------------------

[10163383]
 Research into the causes of genetic diseases is developing fast. Many of these
diseases are caused by mutations.
a Define the term mutation. (2 marks)
b A mutation in a somatic cell, such as a skin cell, may not be as serious as a
mutation in a germ cell, such as primary oocyte (an immature ovum).
Suggest why this is so. (3 marks)
OCR GCE (A) Human Biology Genetics, Homeostasis and Ageing Jan 2008 Q2a
-- answer --
a It is a random change 1m
in the genetic material / DNA / chromosomes. 1m
b A mutation in a skin cell only affects the individual whose DNA mutates. 1m
A mutation in a primary oocyte can be passed on as the primary oocyte develops
into a gamete. 1m
It may affect the offspring. 1m
---------------------------------------------------
[10163400]
* a It is possible to measure the proportions of different bases in a sample of
DNA. Using the symbols specified below, construct a formula to show the
relationship between the quantity of the four bases in a sample of DNA.
T = thymine C = cytosine A = adenine G = guanine
(1 mark)
b A scientist isolated a previously unknown virus. Analysis of its genetic
material revealed that it is composed of a double-stranded DNA molecule
containing 14% thymine. Based on this information, calculate the
percentage of cytosine in the DNA molecule of this virus. Show your
working. (1 mark)
-- answer --
a A + C = T + G or A + G = T + C 1m
b [100 – (14 × 2)] / 2 = 36% 1m
---------------------------------------------------

[10163417]
* The base sequence on the template strand of a segment of DNA is shown below.
… TACCGAGTA …
a Write down the base sequence on the coding strand of the same segment of
DNA. (1 mark)
b Write down the base sequence of the mRNA molecule produced from this
segment of DNA. (1 mark)
c The table below shows the codons and the amino acids they code for. The
amino acids are represented by their short forms.
Using the table, write down the amino acid sequence of the polypeptide
synthesized from the above segment of DNA. (1 mark)
-- answer --
a ATGGCTCAT 1m
b AUGGCUCAU 1m
c Met–Ala–His 1m
---------------------------------------------------

[10163439]
* The base sequence of a segment of mRNA is shown below.
… AAGAGUCCAUCACUUAAUGCC …
a The table below shows the codons and the amino acids they code for. The
amino acids are represented by their short forms.
Using the table, write down the amino acid sequence of the polypeptide
synthesized from the above segment of mRNA. (2 marks)
b A single base deletion and a single base insertion occurred in the segment of
DNA from which the mRNA is produced. The two mutations were 15 bases
apart. The amino acid sequence of the polypeptide synthesized became:
… –Lys–Val–His–His–Leu–Met–Ala– …
Write down the base sequence of the segment of mRNA after the mutations.
Specify in the sequence the precise locations where the deletion and the
insertion have occurred. (4 marks)
-- answer --

a Lys–Ser–Pro–Ser–Leu–Asn–Ala 2m
b AAG  GUC CAU CAC UUA AUG GCC 2m
 = a base A has been deleted 1m
G = a base G has been inserted 1m
---------------------------------------------------
[10163445]
 Complete the following paragraph with suitable words selected from the list
below. (5 marks)
polypeptide ribosome anticodons codons
transcription translation stop start
mRNA tRNA rRNA
After transcription, a molecule of mRNA moves from the nucleus to the
cytoplasm and attaches to a a . The codons at one end of the mRNA
attract the complementary b in the
c molecules with their attached amino acids. The ribosome brings
the attached amino acids into a position where a peptide bond can form between
them. The ribosome moves along the mRNA and adds one amino acid at a time
to the growing chain until a d codon is reached. The completed e
is then released from the ribosome.
-- answer --
a ribosome 1m
b anticodons 1m
c tRNA 1m
d stop 1m
e polypeptide 1m
---------------------------------------------------
[10163454]
 Transcription and translation are the two main stages of protein synthesis in the
cells.
a State where transcription takes place in the cells. (1 mark)
b What is the molecule that acts as template during transcription? (1 mark)
c What molecule is produced during transcription? (1 mark)
d State where translation takes place in the cells. (1 mark)
e Describe the fate of the molecule produced during translation. (3 marks)
-- answer --

a In the nucleus 1m
b DNA 1m
c Messenger RNA / mRNA 1m
d At the ribosomes / on the rough endoplasmic reticulum / in the cytoplasm
1m
e The polypeptide chain coils and folds into a protein. Some polypeptide chains
combine together to form a protein. 1m
Some proteins are secreted from the cells. /
Some proteins are embedded in the cell membrane. /
Some proteins remain in the cytoplasm and are used by the cells. (any 2)
1m x 2
---------------------------------------------------
[10163465]
* A group of scientists performed an experiment to study the effect of X-ray on
bacteria. They prepared two agar plates (P and Q) with bacteria growing on
them. They put P under X-ray for a few seconds, and then added an antibiotic to
both agar plates and incubated them for 2 days. The diagram below shows the
results.
a Explain the results of the experiment. (3 marks)

b With reference to the results of this experiment, explain why scientists must
develop new antibiotics continuously. (3 marks)
-- answer --
a X-ray is a mutagen. It induced mutations in bacteria on P. 1m
An antibiotic resistance gene / allele was formed in the bacteria on P due to
mutations, thus the bacteria on P survived. 1m
Bacteria on Q did not carry an antibiotic resistance gene / allele, thus they were
killed by the antibiotic. 1m

b Bacteria mutate frequently. 1m

Mutations can lead to the development of antibiotic resistant strains. 1m
New antibiotics are needed to treat the diseases caused by these new strains of
bacteria. 1m
---------------------------------------------------
[10163468]
* The photomicrograph below shows a karyotype of a boy. The boy is suffering
from a disorder caused by a chromosome mutation.
a Distinguish between a gene mutation and a chromosome mutation.

(2 marks)
b Name the disorder from which the boy is suffering. (1 mark)
c Turner’s syndrome is another disorder caused by a chromosome mutation.
Females with Turner’s syndrome have one X chromosome missing in their
cells. State two differences between this chromosome mutation and that
causes the disorder from which the boy is suffering. (4 marks)
-- answer --
a A chromosome mutation is a change in the structure or number of chromosomes,
1m
while a gene mutation is a change in the base sequence of the DNA in a gene.
1m
b Down syndrome 1m
c The chromosome mutation that causes Turner’s syndrome occurs in sex
chromosomes, 1m
while the chromosome mutation that causes Down syndrome occurs in
autosomes. 1m

The chromosome mutation that causes Turner’s syndrome leads to the absence
of one chromosome in the cells 1m
while the chromosome mutation that causes Down syndrome leads to the addition
of one chromosome in the cells. 1m
---------------------------------------------------
[10163485]
* The diagram below illustrates a biochemical process that occurs in the cytoplasm
of a human cell.
a Identify structures X and Y. (2 marks)

b What is the function of structure Y in the process? (1 mark)
c Using the information in the diagram, fill in the following table. (3 marks)
Amino acid Leucine (Leu) Glycine (Gly) Glutamine (Gln)
Codon
Anticodon
d Using the information in the diagram, state the triplet code on the template
strand of DNA that marks the beginning of a gene. (1 mark)
-- answer --
a X: ribosome 1m
Y: transfer RNA / tRNA 1m
b It carries a specific amino acid to the ribosome. 1m
c
Amino acid Leucine (Leu) Glycine (Gly) Glutamine (Gln)
Codon CUC GGA CAG
Anticodon GAG CCU GUC
1m for each correct column 1m x 3
d TAC 1m

---------------------------------------------------

[10163487]
 The diagram below illustrates the processes of protein synthesis.
a Identify molecules X and Y. (2 marks)

b Describe the events that occur on Y before translation. (2 marks)
c Describe the relationship between molecules X and Y. (2 marks)
-- answer --
a X: DNA 1m
Y: messenger RNA / mRNA 1m
b Y leaves the nucleus through the pores on the nuclear membrane 1m
and enters the cytoplasm. 1m
c Y is produced using one of the strands of X as a template. 1m
The base sequence of Y is complementary to the template strand of X / is the
same as the coding strand of X except having base U instead of base T. 1m
---------------------------------------------------
[10163490]
 The base sequence on the template strand of a segment of DNA is shown below.
… AATTCGCGATTC …
If a gene mutation occurs in the above segment of DNA such that the base
sequence becomes:
a … ATTCGCGATTC …
b … AATTCGAGCTTC …
Describe the change in the base sequence and state the type of gene mutation in
each of the above cases. (4 marks)

-- answer --
a The 1st / 2nd base A is lost. 1m
This is a deletion. 1m
b A segment of DNA (the 7th to 9th bases, CGA) is inversed. 1m
This is an inversion. 1m
---------------------------------------------------
[10163500]
* The diagram below shows a polypeptide consisting of 10 amino acids.
a Name the segment of DNA that codes for a polypeptide. (1 mark)

b Name the two processes that lead to the formation of a polypeptide
according to the genetic information in DNA. (1 mark)
c A gene mutation has occurred. The polypeptide synthesized after mutation
is shown below.
i State the possible type(s) of gene mutation that has occurred.

(1 mark)
ii Explain why the protein formed from the polypeptide after mutation
may still function. (2 marks)
-- answer --
a A gene / an allele 1m
b Transcription and translation 1m
c i Substitution, inversion 1m
ii Only one amino acid has been altered. 1m
If the amino acid altered is not at a site important for the function of the
protein / change of this amino acid does not affect the conformation of the
protein, the protein can still function. 1m
---------------------------------------------------

[10163528]
 a State the components of ribosomes. (2 marks)
b Where in the cells are ribosomes located? (2 marks)
c What is the function of ribosomes? (1 mark)
-- answer --
a Ribosomal RNA / rRNA 1m
Proteins 1m
b Some ribosomes are on the rough endoplasmic reticulum. 1m
Some are floating free in the cytoplasm. 1m
c Ribosomes are involved in protein synthesis / translation. 1m
---------------------------------------------------
[10163530]
* Complete the following paragraph with suitable words. (4 marks)
Some mutations occur naturally and randomly. They are called
a mutations. Others are induced by
b such as mustard gas and ultraviolet light. They are called induced
mutations. Only mutations occurring in gametes or gamete-producing cells are c
. They provide a source of d in a population.
-- answer --
a spontaneous 1m
b mutagens 1m
c inheritable 1m
d variations 1m
---------------------------------------------------

Question Bank Structured questions
Structured questions
[10163724]
* The diagram below shows a step in the synthesis of a polypeptide during
translation.
a Name molecule X. (1 mark)

b Using the information in the diagram, describe precisely what happens in
the next step of polypeptide synthesis. (4 marks)
c The genetic code is described as degenerate. Explain what is meant by the
term ‘degenerate’ and identify where in the diagram a degenerate code is
illustrated. (2 marks)
d Different types of mutation can arise which cause a change in the genetic
code. A base deletion can have much more significant consequences in
terms of the final protein produced than a base substitution which may have
little or no effect. Explain the reasons for this. (3 marks)
CCEA GCE (A) Biology Module 2 May 2011 Q4
-- answer --
a Transfer RNA / tRNA 1m
b The tRNA that carries an amino acid Lys leaves the ribosome. 1m
The ribosome moves along the mRNA by the length of one codon. 1m
The tRNA having an anticodon AGC enters the ribosome. 1m
A peptide bond forms between amino acids (Thr and Ser). 1m
c It means there are more than one codes coding for a particular amino acid.

1m
In the diagram, there are two codes coding for the amino acid Phe (mRNA codons UUC
and UUU). 1m
d A base deletion shifts the reading frame / affects all the subsequent codes. /
Therefore, all amino acids after the point of mutation are affected. /
A base substitution affects only one code / one amino acid. /
If the third base in a code that is degenerate is substituted, there is no change in the
polypeptide produced. (any 3) 1m x 3
---------------------------------------------------
[10163726]
**a DRD4 is a dopamine receptor in humans. The DRD4 receptor gene has a
large number of alleles, of which a single individual can only have two.
i Explain why one individual can only have two of the different alleles
of the DRD4 gene. (2 marks)
ii Name a technique that would reveal differences in the lengths of the
different forms of the DRD4 receptor gene. (1 mark)
b Three alleles of DRD4 have the following alterations:
• a single base-pair substitution
• a 21 base-pair deletion
• a 13 base-pair deletion
Suggest which of the three mutations will have the most serious
consequences for the structure of the protein receptor. Give a reason for
your choice. (3 marks)
c One allele of DRD4 has been found more frequently amongst individuals
whose personality is described as ‘novelty-seeking’ and whose behaviour
tends to be exploratory and impulsive.
Suggest how this particular allele of the DRD4 receptor could have become
common in the human population. (4 marks)
OCR GCE (A) Control, Genomes and Environment Jun 2010 Q4c–e
-- answer --
a i Humans have two sets of chromosomes in their cells. 1m
There is one allele on each chromosome of a pair. 1m
ii Gel electrophoresis 1m
b The 13 base-pair deletion will have the most serious consequences. /

It will alter the reading frame as the genetic code is triplet / reads in groups of 3
bases. /
It will alter all the amino acids after the point of mutation. /
The 21 base-pair deletion will cause 7 amino acids to be lost. /
The single base-pair substitution will change one amino acid / cause no change in
the polypeptide. (any 3) 1m x 3
c The allele / behaviour increased the chance of survival / breeding of the
individuals carrying this allele.
1m
The allele / behaviour helped the individuals carrying it to find food / find new
resources / make new tools / get mates. 1m
The allele was passed on to the next generation. 1m
The frequency of the allele in the population increased over generations.
1m
---------------------------------------------------
[10163732]
* a What are mutations? (1 mark)
b If a mutation is not spontaneous, what does this imply about the cause of the
mutation? (1 mark)
c Name two kinds of radiations that may cause mutations. (1 mark)
d The graph below shows the number of lethal mutations per 10000 gametes
in fruit flies when they are exposed to different dosage of ionizing
radiations.

Answer the questions below with reference to the graph.

i What is the number of lethal mutations per 10000 gametes when the
fruit flies are exposed to 3000 arbitrary units of ionizing radiations?
(1 mark)
ii What dosage of ionizing radiations is considered safe for the fruit
flies? Give one reason for your answer. (2 marks)
e Why do mutations occur much more easily in actively dividing cells?
(1 mark)
f Mutations occurring in gametes have much greater effects on the population
than those occurring in body cells. Give one reason. (2 marks)
-- answer --
a Mutations are sudden and permanent changes in the DNA / genetic material of an
organism. 1m
b The mutation is induced by mutagens. 1m
c Ultraviolet light / X-rays / gamma rays (any 2) 1m
d i 750 lethal mutations per 10000 gametes 1m
ii There is no safe dosage of ionizing radiations 1m
because any dosage of ionizing radiations can cause mutations that are
harmful to the fruit flies. 1m
e DNA replicates before cell division. Mistakes may arise more easily during DNA
replication. 1m
f Mutations occurring in gametes affect not only the individual. 1m
They can also affect the subsequent generations since these mutations are
inheritable. 1m
---------------------------------------------------
[10163736]
 The diagram below shows an animal cell.

a Name structures X, Y and Z. (3 marks)

b Name the particles attached to Y. (1 mark)
c Both Y and Z are involved in protein synthesis. Describe the role of each of
them in the process of protein synthesis. (4 marks)
d What happens to the proteins synthesized on Y? (2 marks)
-- answer --
a X: mitochondrion 1m
Y: rough endoplasmic reticulum 1m
Z: nucleus 1m
b Ribosomes 1m
c Z contains DNA. 1m
DNA acts as a template for the synthesis of messenger RNA / mRNA in
transcription. 1m
The mRNA then leaves Z and attaches to ribosomes on Y. 1m
On Y, the mRNA is translated into a polypeptide. 1m
d Some proteins are secreted from the cell. 1m
Some are embedded in the cell membrane. 1m
---------------------------------------------------
[10163740]
* The table below shows the codons and the amino acids they code for. The amino
acids are represented by their short forms.

a The base sequence on the template strand of a segment of DNA is shown

below.
… TGCGGGGCGACA …
Write down the amino acid sequence of the polypeptide synthesized from
the above segment of DNA. (2 marks)
b In a mutation, a base is inserted into the above segment of DNA. The amino
acid sequence of the polypeptide synthesized becomes
… –Thr–Pro–Thr–Leu– …
Is this mutation a gene mutation or a chromosome mutation? Write down

the new base sequence of the segment of DNA. (2 marks)
c Describe the fate of the proteins synthesized in the cells. (3 marks)
d Name one mutagen. State two ways in which mutagens cause mutations.
(3 marks)
-- answer --
a Thr–Pro–Arg–Cys 2m
b Gene mutation 1m
TGCGGGTGCGACA 1m
c Some proteins are secreted from the cells. 1m
Some are embedded in the cell membrane. 1m
Some remain in the cytoplasm and are used by the cells. 1m
d Nitrous acid / tar / asbestos / mustard gas / ultraviolet light / X-rays / gamma rays
1m
They change the chemical structure of DNA. /
They insert themselves between the bases and cause errors during DNA
replication. /
They ionize water or other molecules to form free radicals, which are highly
reactive and can damage DNA.
(any 2) 1m x 2
---------------------------------------------------

[10163743]
* The diagram below illustrates a biochemical process which occurs in a human
cell. Only some of the bases on molecules X and Y are shown.
a Name the biochemical process. Give one reason to support your answer.
(3 marks)
b Describe how molecule Y is produced from molecule X. (4 marks)
c State the relationship between strand P and molecule Y. (2 marks)
d State two differences between the structure of molecules X and Y.
(2 marks)
-- answer --
a Transcription 1m
The product produced in the process (Y) is a RNA molecule 1m
since it contains U as one of its bases. 1m
b The hydrogen bonds that hold the two strands of X break. The two strands of X
unwind. 1m
One of the strands acts as a template. 1m
Free ribonucleotides with bases complementary to the template strand are
attracted to the template strand. 1m
RNA polymerase catalyses the joining of the adjacent ribonucleotides to form a
molecule of Y. 1m
c The base sequence of strand P is the same as that of Y 1m
except having base T instead of base U. 1m
d X is double-stranded, while Y is single-stranded. /
X contains deoxyribose, while Y contains ribose. /
X contains bases A, T, C and G, while Y contains bases A, U, C and G.
(any 2) 1m x 2
---------------------------------------------------

[10163749]
* A boy is suffering from sickle-cell anaemia. The photomicrograph below shows
the appearance of his red blood cells at low oxygen levels.
a i Explain why many red blood cells become sickle-shaped at low

oxygen levels. (2 marks)
ii State one harmful effect of the sickle-shaped red blood cells to the
patient. (1 mark)
b Sickle-cell anaemia is a genetic disease caused by a mutated allele. The
diagram below shows several bases on the template strand of DNA in the
normal allele and the corresponding bases in the mutated allele. How
normal and abnormal haemoglobin are synthesized from these alleles are
also shown.
i Explain how the mutated allele is formed from the normal allele.
(3 marks)
ii State codons X and Y. (2 marks)
iii State the anticodons in the tRNA molecules that carry the amino acids
glutamic acid (Glu) and valine (Val). (2 marks)

-- answer --
a i The haemoglobin in the red blood cells of the boy is abnormal. 1m
At low oxygen levels, the abnormal haemoglobin molecules form long fibres
which cause the red blood cells to become sickle-shaped. 1m
ii The oxygen-carrying capacity of the blood is greatly reduced. /
The sickle-shaped cells may block blood vessels. 1m
b i A base substitution occurs in the normal allele that codes for haemoglobin
1m
in a gamete or a gamete-producing cell. 1m
Base T is replaced by base A at one position. 1m
ii X: GAA 1m
Y: GUA 1m
iii Glutamic acid: CUU 1m
Valine: CAU 1m
---------------------------------------------------
[10163760]
* The diagram below illustrates the process of translation.
a How many amino acids are coded by the segment of mRNA shown in the
diagram? With reference to the features of the genetic code, explain your
answer. (3 marks)
b The last three bases on the mRNA is UGA.
i Write down the corresponding bases on the template strand of DNA.
(1 mark)
ii Explain why there is no tRNA corresponding to the codon UGA.
(2 marks)

c Both the codons CGG and CGU code for the amino acid arginine (Arg).
i Write down the corresponding bases on the template strand of DNA.
(2 marks)
ii Suggest a term that can be used to describe the genetic code for this
feature. (1 mark)
d In genetic engineering, a plasmid (a ring of DNA in bacteria) is extracted
from a bacterium and a human gene is inserted in the plasmid. The plasmid
is then introduced into a bacterium for the synthesis of human proteins.
With reference to the feature of genetic code, explain why expression of
human genes in bacteria is possible. (2 marks)
-- answer --
a Four amino acids are coded by the segment of mRNA shown. 1m
The genetic code is a triplet code 1m
that reads in a non-overlapping manner. 1m
b i ACT 1m
ii UGA is a stop codon. It marks the end of a gene. 1m
It does not code for any amino acid. 1m
c i GCC 1m
GCA 1m
ii Degenerate 1m
d The genetic code is universal. 1m
The same triplet code codes for the same amino acid in humans and bacteria.
1m
---------------------------------------------------
[10163766]
* The diagram below shows a DNA molecule and the products it produces in two
different processes.

a Name processes X and Y. (2 marks)

b Give three differences between processes X and Y. (6 marks)
c State the significance of processes X and Y to an organism. (4 marks)
-- answer --
a Process X: DNA replication 1m
Process Y: transcription 1m
b The product of process X is a double-stranded DNA molecule while the product of
process Y is a single-stranded RNA molecule. /
Process X involves the enzyme DNA polymerase while process Y involves the
enzyme RNA polymerase. /
The free nucleotides used in process X contain deoxyribose while the free
nucleotides used in process Y contain ribose. / The free nucleotides used in
process X contain bases A, T, C and G while the free nucleotides used in process
Y contain bases A, U, C and G. /
In process X, each strand of DNA acts as a template for the synthesis of a new
polynucleotide strand, while in process Y, only one of the strands acts as a
template. /
The whole DNA molecule is involved in process X, while only part of the DNA
molecule (that corresponds to a gene) is involved in process Y.
(any 3) 2m x 3
c Process X produces new DNA molecules which carry the same genetic
information as the original one. 1m
This allows the same genetic information to be replicated to the daughter cells
during mitotic cell division / to be passed on to the offspring. 1m
Process Y produces mRNA molecules complementary to one of the strand of the
DNA, which are then transported out of the nucleus to the cytoplasm for
translation. 1m
This allows proteins to be synthesized according to the genetic information in the
DNA molecules. 1m
---------------------------------------------------

[10163775]
* Read the following article and answer the questions.
Variations found within a species can be a result of mutations.
Spontaneous mutations are rare. Most mutations are induced by some agents.
A change in only a single base of a gene may cause a great functional
abnormality in the organism. Although mutations involve changes in genetic
material, they are not always inheritable.
a Besides mutations, state one other cause of variations in humans.

(1 mark)
b Mutations can be induced by radiations.
i State one kind of radiation that can induce mutations. (1 mark)
ii Describe how radiations cause mutations. (2 marks)
c Explain why not all mutations are inheritable. (2 marks)
d Explain why mutations can be beneficial to the continuity of the species.
(2 marks)
-- answer --
a Independent assortment of chromosomes at meiosis /
Crossing over at meiosis /
Random combination of gametes during fertilization /
Environment 1m
b i Ultraviolet light / X-rays / gamma rays 1m
ii Radiations ionize water or other molecules to form free radicals. 1m
Free radicals are highly reactive. They can damage DNA molecules. 1m
c Only mutations that occur in gametes or gamete-producing cells are inheritable.
1m
Some mutations cause sterility / immediate death of the individual. 1m
d Mutations provide a source of variations in a population and may give rise to new
characters. 1m
Individuals with new characters may survive better in a certain environment. 1m
---------------------------------------------------

[10163802]
**Normal human cells contain proto-oncogenes which control division and
differentiation of the cells. Mutations in these genes may turn the genes into
oncogenes. Oncogenes can make the cells become cancerous.
a Explain why mutations in proto-oncogenes may lead to cancer. (2 marks)
b A base substitution occurs in a proto-oncogene so that the 19th amino acid
in the resulting polypeptide changes from proline to histidine. The codons
coding for these two amino acids are shown in the table below.
Amino acid Codon
Proline CCA CGU CCC CCG
Histidine CAU CAC
i Explain why it is possible for some amino acids to be coded by two or

more codons. (2 marks)
ii State all the possible changes in the codon that result in the
replacement of proline by histidine. (2 marks)
iii State the position of the nucleotide in the mRNA at which the base
substitution occurs. Explain how you arrive at your answer with
reference to the features of genetic code. (4 marks)
-- answer --
a Proto-oncogenes control cell division. 1m
Mutations in these genes may lead to uncontrolled cell division, causing cancer.
1m
b i There are only 20 amino acids but there are 43 = 64 different codons. 1m
The number of codons is larger than the number of amino acids. 1m
ii CCC → CAC 1m
CGU → CAU 1m
iii As three bases on the mRNA code for one amino acid, 1m
and there are no gaps between the codons and the codons are read in a
non-overlapping manner, 1m
the 19th amino acid is coded by the 55th to 57th bases on the mRNA. 1m
Therefore, the base substitution occurs at the 56th nucleotide. 1m
---------------------------------------------------

[10163816]
* The diagram below shows a segment of a DNA molecule.
a Describe briefly the DNA model proposed by Watson and Crick.

(3 marks)
b It is known that the base sequence of a segment of DNA on strand X is
‘… ACGTGCTG …’. What is the base sequence of the corresponding
segment on strand Y? (1 mark)
c State how the double helix of DNA molecule is maintained. (1 mark)
d Where exactly do replication of DNA, transcription and translation take
place in the cells? (3 marks)
-- answer --
a Two polynucleotide chains run in opposite directions and twist around each other
to form a double helix. 1m
A of one chain pairs only with T of another chain by hydrogen bonds, 1m
C of one chain pairs only with G of another chain. 1m
b TGCACGAC 1m
c It is maintained by many hydrogen bonds between base pairs of the two strands.
1m
d Replication of DNA: nucleus 1m
Transcription: nucleus 1m
Translation: cytoplasm / rough endoplasmic reticulum / ribosome 1m
---------------------------------------------------

[10163821]
 The diagram below shows an animal cell.
X, Y and Z are involved in an important process in the cell in which a material

essential to the cell is synthesized.
a Name structures X, Y and Z. (3 marks)
b Describe the roles of X and Z in this process. (2 marks)
c Some Z are attached to Y and some are floating free in the cytoplasm. State
the fate of the products synthesized by Z in different locations. (2 marks)
d The diagram below shows a molecule found in the cytoplasm. The molecule
is also involved in the process.
i What is this molecule? (1 mark)

ii State how the structure of this molecule can help ensure the accuracy
of the process. (3 marks)
-- answer --
a X: nucleus 1m
Y: rough endoplasmic reticulum 1m
Z: ribosome 1m

b X is the site of transcription during which mRNA is produced. / DNA which carries
genetic information for the synthesis of a polypeptide is stored in X. 1m
Z attaches to the mRNA and tRNA during translation. 1m
c Proteins synthesized by those Z attached to Y are secreted from the cell or
embedded in the cell membrane. 1m
Proteins synthesized by those Z floating free in the cytoplasm are used by the cell
itself. 1m
d i Transfer RNA / tRNA 1m
ii Each tRNA has an anticodon which is specific to the amino acid it carries.
1m
This anticodon is complementary to the codon on the mRNA that codes for
that amino acid. 1m
In the process, tRNA binds to the corresponding codon on mRNA by
hydrogen bonds to ensure that the correct amino acid is added to the
polypeptide chain. 1m
---------------------------------------------------
[10163839]
* The photomicrograph below is a karyotype of a baby, which shows the structure
and number of chromosomes in its cell.
a i Both P and Q are chromosome 1. In relation to the genes they carry,

give one similarity and one difference between them. (2 marks)
ii What is the term used to describe P and Q? (1 mark)

b By looking at the karyotype, the doctor diagnosed that the baby suffers from
a disease.
i What disease does the baby suffer from? Give one reason for your
answer. (2 marks)
ii State two features of the people with this disease. (2 marks)
iii Suggest how this disease is developed. (4 marks)
-- answer --
a i Similarity:
The genes they carry are the same / are in the same sequence / control the
same traits of the body. 1m
Difference:
The genes they carry are in different forms (alleles) / come from different
parents. 1m
ii Homologous chromosomes 1m
b i Down syndrome 1m
The karyotype shows the baby has an extra chromosome 21 in its cells.
1m
ii They are shorter than average / have a distinctive round face / have smaller
ears / have some degree of mental retardation. (any 2) 1m x 2
iii Homologous chromosomes or sister chromatids of chromosome 21 fail to
separate 1m
and go to the same daughter cell during meiotic cell division. 1m
Some of the gametes produced have an extra chromosome 21. 1m
If one of these gametes fuses with a normal gamete, a zygote with three
chromosome 21 will be formed. The individual that develops from this zygote
will have Down syndrome. 1m
---------------------------------------------------
[10163848]
* Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a disease
caused by a mutation occurring in a segment of DNA which codes for the
enzyme glucose-6-phosphate dehydrogenase. The resulting protein becomes non-
functional.
a In one type of G6PD deficiency, base G on the template strand of DNA is
replaced by base T at one position.
i Name this type of gene mutation. (1 mark)
ii State how the mRNA produced will change due to the mutation.
(1 mark)

iii Explain why the change of only one base can make the enzyme G6PD
become non-functional. (3 marks)
b G6PD deficiency is an X-linked disease caused by a recessive allele.
Explain why G6PD deficiency is more commonly found in males than in
females. (3 marks)
-- answer --
a i Substitution 1m
ii Base C will be replaced by base A at one position. 1m
iii The base substitution may result in one different amino acid in the
polypeptide. 1m
If this amino acid is at the active site / the change of this amino acid affects
the conformation of the protein, the shape of the active site will be altered.
1m
The enzyme will not be able to bind to the substrate, thus it becomes non-
functional. 1m
b G6PD gene is located on the X chromosome. 1m
Since females have two X chromosomes, a female will have G6PD deficiency
only if she has the recessive allele on both X chromosomes.
1m
Males have only one X chromosome, a male will have G6PD deficiency if he has
one recessive allele. 1m
---------------------------------------------------

Question Bank Essay
Essay
[10163985]
* Describe the structure of RNA and its role in the process of protein synthesis.
(12 marks)
-- answer --
Structure of RNA:
It is a single-stranded polynucleotide. /
Each nucleotide consists of a phosphate group, a ribose and a nitrogenous base. /
The bases in nucleotides include adenine (A), uracil (U), cytosine (C) and guanine (G).
(any 2) 1m x 2
Role in protein synthesis:
Messenger RNA (mRNA) is produced in the nucleus in transcription. /
Its base sequence of mRNA is complementary to the template strand of DNA / the
same as the coding strand of DNA except having base U instead of base T. /
It carries genetic information in the DNA from the nucleus to the cytoplasm for
translation. /
Transfer RNA (tRNA) has an anticodon which is specific to a particular amino acid. /
It carries a specific amino acid to the ribosomes during translation. /
Anticodon pairs with the complementary codon on the mRNA to ensure the correct
amino acid is added to the polypeptide. /
Ribosomal RNA (rRNA) is a component of ribosome. /
Translation occurs at ribosomes. (any 7) 1m x 7
Communication 3m
---------------------------------------------------

% Chapter 27: Molecular Genetics

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

% Chapter 27: Molecular Genetics

Uploaded by

Copyright:

Available Formats

New Senior Secondary Mastering Biology (Second Edition) Chapter 27

Question Bank Multiple-choice questions

% Chapter 27 Molecular genetics

Which of the following is a possible base sequence on the template strand of

© Oxford University Press 27-1

© Oxford University Press 27-2

Which type of chromosome mutation is shown?

© Oxford University Press 27-3

What are nucleic acids X and Y?

© Oxford University Press 27-4

© Oxford University Press 27-5

© Oxford University Press 27-6

Which of the following is the amino acid sequence of the polypeptide

© Oxford University Press 27-7

© Oxford University Press 27-8

The mRNA molecule is shorter than the DNA molecule.

© Oxford University Press 27-9

© Oxford University Press 27-10

© Oxford University Press 27-11

© Oxford University Press 27-12

© Oxford University Press 27-13

a Explain the results of the experiment. (3 marks)

© Oxford University Press 27-14

b Bacteria mutate frequently. 1m

a Distinguish between a gene mutation and a chromosome mutation.

© Oxford University Press 27-15

a Identify structures X and Y. (2 marks)

© Oxford University Press 27-16

© Oxford University Press 27-17

a Identify molecules X and Y. (2 marks)

© Oxford University Press 27-18

a Name the segment of DNA that codes for a polypeptide. (1 mark)

i State the possible type(s) of gene mutation that has occurred.

© Oxford University Press 27-19

© Oxford University Press 27-20

a Name molecule X. (1 mark)

© Oxford University Press 27-21

b The 13 base-pair deletion will have the most serious consequences. /

© Oxford University Press 27-22

© Oxford University Press 27-23

Answer the questions below with reference to the graph.

© Oxford University Press 27-24

a Name structures X, Y and Z. (3 marks)

© Oxford University Press 27-25

a The base sequence on the template strand of a segment of DNA is shown

Is this mutation a gene mutation or a chromosome mutation? Write down

© Oxford University Press 27-26

© Oxford University Press 27-27

a i Explain why many red blood cells become sickle-shaped at low

© Oxford University Press 27-28

© Oxford University Press 27-29

© Oxford University Press 27-30

a Name processes X and Y. (2 marks)

© Oxford University Press 27-31

a Besides mutations, state one other cause of variations in humans.

© Oxford University Press 27-32

i Explain why it is possible for some amino acids to be coded by two or

© Oxford University Press 27-33

a Describe briefly the DNA model proposed by Watson and Crick.

© Oxford University Press 27-34

X, Y and Z are involved in an important process in the cell in which a material

i What is this molecule? (1 mark)

© Oxford University Press 27-35