Midterm exam for BIOLOGY

Please Follow Instruction

No Erasures
Time for exam is only 2hours
Best of Luck
Challenge yourself by not opening your notes or slides, How can you be a nurse if you rely on open
notes all the time we exam, but yeah it’s up to you follow your brain  go future nurses

IDENTIFICATION and DEFINE

Use Red, Blue and Black Pen alternately for every 3 answers
(don’t use bookish definition, make your own)

1. DNA Polymerase: _____________________________________

2. ___________: known to breath to their skins
3. Number of Essential AA, ____________ Conditional Non Essential Amino Acids has?
____________
4. Glycoclyx: _______________________
5. Leading Strands: _____________________________
6. RNA Polymerase; _______________________
7. Diatoms; ______________________________
8. Achaebacteria; _____________________________________
9. Lammarck;______________________________________
10. Traits; ______________________________________
11. Natural Selection; ________________________________________
12. Darwin vs Lammark?, _____________________________________
13. Gene Regulator, _______________________________
14. mRNA functions, _______________________________________
15. Pandemic, _________________________
16. Autotrophic in nature______________________________
17. Oviparous
18. What is my current CI full name, ____________________________?

Enumeration with explanation,

Use Black and Blue alternately every word but all vowel must be red
(NO BOOKISH ANSWERS>> YOU’RE NOT A ROBOT got it?)

5 Enzymes for DNA Replication

5 Plant like Fungi and their functions
5 Classification of Vertebrates and their examples
6 Classification of under Invertebrates and their examples
2 Classification of bacteria and explaination
Explanation (use red , blue and black pen alternate on every word)
1. How DNA replication works on your own words (Bookish answers will be counted as 0, same
answer with a person will result in 2points only)
2. Why some bacteria and Protista Benefit us
3. How would you explain the concept of natural selection?

DNA and RNA Coding

Red for T , Blue for A , Black for C, Red for G and Blue for U
3’ – Blue , 5’ Red

5’ GGTATTACCGGATTACCGGACCAAATTAAAGGCCAGGACCCAGGAAAGGGGAAAGGAATTAAAAACGCG 3’

If This is your tRNA

3’ UAU 5’ – 5’ AAC 3’ – 3’ AUG 5’ –3’ GCC 5’ – 3’ UGG 5’ –5’ CAC 3’ – 5’ AAA 3’ –5’GAU 3’ – 5’ UAA 3’

1. What would be your mRNA?

2. Kindly form the amino acid chain of the given tRNA above according to the amino acids it
represents. Write the full amino acid (color coding, red for essential, blue for conditionally non-
essential and black for nonessential)

Locate all the Bold letters/words to reveal a secret message 5pts