From rNa to protein 259

(A) (B) Figure 7–39 The proteasome degrades

short-lived and misfolded proteins.
(a) a cutaway view of the structure of
the central cylinder of the proteasome,
determined by X-ray crystallography, with
the active sites of the proteases indicated
by red dots. (B) the structure of the entire
proteasome, in which the central cylinder
(yellow) is topped by a stopper (purple) at
each end. (B, from W. Baumeister et al.,
Cell 92:367–380, 1998. With permission from
elsevier.)

ments in eucaryotic cells, such as lysosomes (discussed in Chapter 15).

In eucaryotic cells, most proteins are broken down by machines called
proteasomes. A proteasome contains a central cylinder formed from
proteases whose active sites ECB3
face m6.89/7.39
into an inner chamber. Each end of the
cylinder is stoppered by a large protein complex formed from at least 10
different types of protein subunits (Figure 7–39). These protein stoppers
bind the proteins destined for digestion and then—using ATP hydrolysis
to fuel their activity—feed the doomed molecules into the inner chamber
of the cylinder; there the proteases chop the proteins into short peptides,
which are then released from the end of the proteasome. Housing pro-
teases inside this molecular chamber of destruction makes sense, as it
prevents them from running rampant throughout the cell.
How does the proteasome select which proteins in the cell should enter
the cylinder and be degraded? Proteasomes act primarily on proteins that
have been marked for destruction by the covalent attachment of a small
protein called ubiquitin. Specialized enzymes tag selected proteins with
one or more ubiquitin molecules; these ubiquitylated proteins are then
recognized and sucked into the proteasome by proteins in the stopper.
Proteins that are meant to be short-lived often sport a short amino acid
sequence that identifies the protein as one to be ubiquitylated and ulti-
mately degraded by the proteasome. Denatured or misfolded proteins, as
well as proteins containing oxidized or otherwise abnormal amino acids,
are also recognized and degraded by this ubiquitin-dependent proteolytic
system. The enzymes that add ubiquitin to such proteins recognize sig-
nals that become exposed on these proteins as a result of the misfolding
or chemical damage—for example, amino acid sequences or conforma-
tional motifs that are normally buried and inaccessible.

There Are Many steps between DNA and protein

We have seen so far in this chapter that many different types of chemical
reactions are required to produce a protein from the information con-
tained in a gene (Figure 7–40). The final concentration of a protein in
a cell therefore depends on the efficiency with which each of the many
steps is carried out. In addition, many proteins—once they leave the
ribosome—require further attention before they are useful to the cell. For
example, covalent modification (such as phosphorylation), the binding of
small-molecule cofactors, or association with other protein subunits are
often needed to activate a newly synthesized protein (Figure 7–41).
260 Chapter 7 From DNa to protein: how Cells read the Genome

Figure 7–40 Protein production in a

eucaryotic cell requires many steps. the
final concentration of each protein depends introns exons
on the efficiency of each step depicted. 5¢
DNA
even after a protein has been translated, 3¢
its concentration can be regulated by
INITIATION OF TRANSCRIPTION
degradation, and its activity regulated by
the binding of small molecules and other
post-translational modifications (see
Figure 7–41).

CAPPING,
ELONGATION,
AND SPLICING

cap

CLEAVAGE,
POLYADENYLATION,
AND TERMINATION
AAAA mRNA
EXPORT poly-A tail
NUCLEUS

CYTOSOL
AAAA mRNA

mRNA DEGRADATION

INITIATION OF PROTEIN SYNTHESIS (TRANSLATION)

AAAA

COMPLETION OF PROTEIN SYNTHESIS

AND PROTEIN FOLDING
H 2N
COOH
PROTEIN DEGRADATION
nascent polypeptide chain H 2N
COOH

FOLDING AND
COFACTOR BINDING We will see in the next chapter that cells have the ability to change the
(NONCOVALENT concentrations of most of their proteins according to their needs. In prin-
INTERACTIONS)
ciple, all of the steps in Figure 7–40 can be regulated by the cell. However,
as we shall see in the next chapter, the initiation of transcription is the
most common point for a cell ECB3 to regulate the expression of each of its
m6.97/7.40
genes.

COVALENT MODIFICATION Transcription and translation are universal processes that lie at the heart
BY, FOR EXAMPLE, of life. However, when scientists came to consider how the flow of infor-
PHOSPHORYLATION
mation from DNA to protein might have originated, they came to some
unexpected conclusions.
P

Figure 7–41 many proteins require additional modification to

BINDING TO OTHER become fully functional. to be useful to the cell, a completed
PROTEIN SUBUNITS polypeptide must fold correctly into its three-dimensional
conformation, bind any cofactors required, and assemble with any
protein partners. Noncovalent bond formation drives these changes.
P Many proteins also require covalent modification to become active.
although phosphorylation and glycosylation are the most common,
more than 100 different types of covalent modifications of proteins
mature functional protein are known.
 rNa and the Origins of Life 261

RNA AND The ORigiNs OF liFe

To understand fully the processes occurring in present-day cells, we
need to consider how cells evolved. But one key process—that of gene
expression—presents a particular challenge: if nucleic acids are required
to direct the synthesis of proteins, and proteins are required to synthesize
nucleic acids, how could this system of interdependent components have
arisen? One view is that an RNA world existed on Earth before modern
cells appeared (Figure 7–42). According to this hypothesis, RNA—which
today serves as an intermediate between genes and proteins—both stored
genetic information and catalyzed chemical reactions in primitive cells.
Only later in evolutionary time did DNA take over as the genetic material
and proteins become the major catalysts and structural components of
cells. If this idea is correct, then the transition out of the RNA world was
never completed; as we have seen in this chapter, RNA still catalyzes
several fundamental reactions in modern cells. These RNA catalysts,
including the ribosome and RNA-splicing machinery, can thus be viewed
as molecular fossils of an earlier world.

life Requires Autocatalysis

The origin of life requires molecules that possess, if only to a small extent,
one crucial property: the ability to catalyze reactions that lead—directly
or indirectly—to the production of more molecules like themselves.
Catalysts with this special self-promoting property, once they had arisen
by chance, would reproduce themselves and would therefore divert raw
materials from the production of other substances. In this way one can
envisage the gradual development of an increasingly complex chemical
system of organic monomers and polymers that function together to gen-
erate more molecules of the same types, fueled by a supply of simple
raw materials in the environment. Such an autocatalytic system would
have many of the properties we think of as characteristic of living mat-
ter: the system would contain a far from random selection of interacting
molecules; it would tend to reproduce itself; it would compete with other
systems dependent on the same raw materials; and, if deprived of its raw
materials or maintained at a temperature that upset the balance of reac-
tion rates, it would decay toward chemical equilibrium and ‘die.’
But what molecules could have had such autocatalytic properties? In
present-day living cells the most versatile catalysts are proteins, which
are able to adopt diverse three-dimensional forms that bristle with chem-
ically reactive sites. However, there is no known way in which a protein
can reproduce itself directly. Nucleic acids, however, can do both of these
things.

RNA Can both store information and Catalyze Chemical

Reactions
We have seen that complementary base-pairing enables one nucleic acid
to act as a template for the formation of another. Thus, a single strand

RNA
WORLD

~15 billion years ago 10 5 present

solar first first

system cells mammals
big bang Figure 7–42 An RNA world may have
formed with
DNA existed before modern cells arose.
262 Chapter 7 From DNa to protein: how Cells read the Genome

Figure 7–43 An RNA molecule can in A G G

U C C U C C U
principle guide the formation of an exact A G G A
copy of itself. In the first step the original
rNa molecule acts as a template to form an ORIGINAL SEQUENCE COMPLEMENTARY
SERVES AS A TEMPLATE SEQUENCE SERVES AS
rNa molecule of complementary sequence. FOR COMPLEMENTARY A TEMPLATE FOR
In the second step this complementary rNa SEQUENCE ORIGINAL SEQUENCE
molecule itself acts as a template, forming
rNa molecules of the original sequence.
A G G U C C A A G G U C C A
Since each templating molecule can
produce many copies of the complementary A G G A G G
U C C U U C C U
strand, these reactions can result in the
“multiplication” of the original sequence.

of RNA or DNA can specify the sequence of a complementary polynucle-

otide, which, in turn, can specify the sequence of the original molecule,
allowing the original nucleic acid to be replicated (Figure 7–43). Such
complementary templating mechanisms lie at the heart of DNA replica-
tion and transcription in modern-day cells.
But the efficient synthesis of polynucleotides by such complementary
5¢ templating mechanisms also requires catalysts to promote the polymeri-
ECB3 E7.39/7.43
zation reaction: without catalysts, polymer formation is slow, error-prone,
and inefficient. Today, nucleotide polymerization is rapidly catalyzed by
ribozyme protein enzymes—such as the DNA and RNA polymerases. But how could
this reaction be catalyzed before proteins with the appropriate cata-
3¢ lytic ability existed? The beginnings of an answer to this question were
5¢ +
obtained in 1982, when it was discovered that RNA molecules themselves
3¢
can act as catalysts. We have already seen in this chapter, for example,
substrate that a molecule of RNA catalyses the peptidyl transferase reaction that
RNA takes place on the ribosome. The unique potential of RNA molecules to
BASE-PAIRING BETWEEN act both as information carriers and as catalysts is thought to have ena-
RIBOZYME AND SUBSTRATE
bled them to play the central role in the origin of life.
In present-day cells, RNA is synthesized as a single-stranded molecule,
and we have seen that complementary base-pairing can occur between
nucleotides in the same chain (see Figure 7–5). This base-pairing, along
5¢ with “nonconventional” hydrogen bonds, can cause each RNA molecule
5¢ to fold up in a unique way that is determined by its nucleotide sequence.
3¢
Such associations produce complex three-dimensional patterns of fold-
3¢
ing, where the molecule as a whole adopts a unique shape.

SUBSTRATE CLEAVAGE
As we saw in Chapter 4, protein enzymes are able to catalyze biochemical
reactions because they have surfaces with unique contours and chemi-
cal properties on which a given substrate can react. In the same way,
RNA molecules, with their unique folded shapes, can serve as enzymes
(Figure 7–44), although the fact that they are constructed of only four dif-
5¢ ferent subunits limits their catalytic efficiency and their range of chemical
5¢
reactions compared with proteins. Nonetheless, ribozymes can catalyze
3¢
many types of chemical reactions. Most of the ribozymes that have been
3¢
studied were constructed in the laboratory (Table 7–4); relatively few cat-
alytic RNAs exist in present-day cells. But the processes in which catalytic
PRODUCT RELEASE RNAs still seem to have major roles include some of the most fundamen-

Figure 7–44 A ribozyme is an RNA molecule that possesses

catalytic activity. the simple rNa molecule shown catalyzes the
cleavage of a second rNa at a specific site. this ribozyme is found
embedded in larger rNa genomes—called viroids—that infect plants.
the cleavage, which occurs in nature at a distant location on the same
+ rNa molecule that contains the ribozyme, is a step in the replication
cleaved of the rNa genome. this reaction also requires a magnesium ion (not
RNA ribozyme shown), which is brought next to the site of cleavage on the substrate.
(adapted from t.r. Cech and O.C. Uhlenbeck, Nature 372:39–40, 1994.
With permission from Macmillan publishers Ltd.)
 rNa and the Origins of Life 263

TAblE 7–4 bioCHEmiCAl REACTioNS THAT CAN bE CATAlyzED

by RibozymES
ACTiviTy RibOzyMes
rNa cleavage, rNa ligation self-splicing rNas
DNa cleavage self-splicing rNas
peptide bond formation in ribosomal rNa
protein synthesis
DNa ligation in vitro selected rNa
rNa splicing self-splicing rNas, rNas of the spliceosome (?)
rNa polymerization in vitro selected rNa
rNa phosphorylation in vitro selected rNa
rNa aminoacylation in vitro selected rNa
rNa alkylation in vitro selected rNa
C–C bond rotation in vitro selected rNa
(isomerization)

tal steps in the expression of genetic information—especially those steps

where RNA molecules themselves are spliced or translated into protein.
RNA, therefore, has all the properties required of a molecule that could
catalyze its own synthesis (Figure 7–45). Although self-replicating sys-
tems of RNA molecules have not been found in nature, scientists appear
to be well on the way to constructing them in the laboratory. Although
this demonstration would not prove that self-replicating RNA molecules
were essential in the origin of life on Earth, it would demonstrate that
such a scenario is possible.

RNA is Thought to predate DNA in evolution

The first cells on Earth would presumably have been much less com-
plex and less efficient in reproducing themselves than even the simplest
present-day cells. They would have consisted of little more than a simple
membrane enclosing a set of self-replicating molecules and a few other
components required to provide the materials and energy for their rep-
lication. If the evolutionary speculations about RNA outlined above are
correct, these earliest cells would also have differed fundamentally from
the cells we know today in having their hereditary information stored in
RNA rather than DNA.
Evidence that RNA arose before DNA in evolution can be found in the
chemical differences between them. Ribose (see Figure 7–3A), like glu-
cose and other simple carbohydrates, is readily formed from formaldehyde
(HCHO), which is one of the principal products of experiments simulat-
ing conditions on the primitive Earth. The sugar deoxyribose is harder to
make, and in present-day cells it is produced from ribose in a reaction
catalyzed by a protein enzyme, suggesting that ribose predates deoxy-

Figure 7–45 Could an RNA molecule

catalysis catalyze its own synthesis? this
hypothetical process would require the
catalysis of both steps shown in Figure 7–43.
the red rays represent the active site of this
rNa enzyme.
264 Chapter 7 From DNa to protein: how Cells read the Genome

Figure 7–46 RNA may have preceded DNA and proteins in

RNA-based systems
evolution. according to this idea, rNa molecules provided genetic,
structural, and catalytic functions in the earliest cells. DNa is now the
repository of genetic information, and proteins carry out almost all
RNA
catalysis in cells. rNa now functions mainly as a go-between in protein
synthesis, while remaining a catalyst for a few crucial reactions.

EVOLUTION OF RNAs THAT

CAN DIRECT PROTEIN SYNTHESIS
ribose in cells. Presumably, DNA appeared on the scene later, and then
proved more suited than RNA as a permanent repository of genetic infor-
RNA and protein-based systems
mation. In particular, the deoxyribose in its sugar–phosphate backbone
makes chains of DNA chemically much more stable than chains of RNA,
so that greater lengths of DNA can be maintained without breakage.
RNA protein
The other differences between RNA and DNA—the double-helical struc-
ture of DNA and the use of thymine rather than uracil—further enhance
DNA stability by making the molecule easier to repair. We saw in Chapter
EVOLUTION OF NEW ENZYMES 6 that a damaged nucleotide on one strand of the double helix can be
THAT SYNTHESIZE DNA AND
MAKE RNA COPIES FROM IT repaired by using the other strand as a template. Furthermore, deamina-
tion, one of the most common unwanted chemical changes occurring in
present-day cells polynucleotides, is easier to detect and repair in DNA than in RNA (see
Figure 6–23). This is because the product of the deamination of cytosine
DNA protein
is, by chance, uracil, which already exists in RNA, so that such damage
RNA
would be impossible for repair enzymes to detect in an RNA molecule.
However, in DNA, which has thymine rather than uracil, any uracil pro-
duced by the accidental deamination of cytosine is easily detected and
repaired.
Taken together, the evidence we have discussed points to the idea that
RNA, having both genetic and catalytic properties, preceded DNA in evo-
ECB3 e7.42/7.46 lution. As cells more closely resembling present-day cells appeared, it is
believed that many of the functions originally performed by RNA were
taken over by molecules more specifically fitted to the tasks required.
Eventually DNA took over the primary genetic function, and proteins
Question 7–6 became the major catalysts, while RNA remained primarily as the inter-

?
Discuss the following: “During
arth, RNA
the evolution of life on earth,
lost its glorious position as the
first self-replicating catalyst. its
its
role now is as a mere messenger in
the information flow from DNA to
protein.”
mediary connecting the two (Figure 7–46). With the advent of DNA, cells
were able to become more complex, for they could then carry and trans-
mit more genetic information than could be stably maintained in an
RNA molecule. Because of the greater chemical complexity of proteins
and the variety of chemical reactions they can catalyze, the shift (albeit
incomplete) from RNA to proteins also provided a much richer source
of structural components and enzymes. This enabled cells to evolve the
great diversity of structure and function that we see in life today.

esseNTiAl CONCepTs
• The flow of genetic information in all living cells is DNA Æ RNA Æ
protein. The conversion of the genetic instructions in DNA into RNAs
and proteins is termed gene expression.
• To express the genetic information carried in DNA, the nucleotide
sequence of a gene is first transcribed into RNA. Transcription is cat-
alyzed by the enzyme RNA polymerase. Nucleotide sequences in the
DNA molecule indicate to the RNA polymerase where to start and
stop transcribing.
• RNA differs in several respects from DNA. It contains the sugar ribose
instead of deoxyribose and the base uracil (U) instead of thymine (T).
RNAs in cells are synthesized as single-stranded molecules, which
often fold up into precise three-dimensional shapes.
• Cells make several different functional types of RNAs, including
messenger RNA (mRNA), which carries the instructions for making
 essential Concepts 265

proteins; ribosomal RNA (rRNA), which is a component of ribosomes;

and transfer RNA (tRNA), which acts as an adaptor molecule in pro-
tein synthesis.
• Transcription begins at DNA sites called promoters. To initiate tran-
scription, eucaryotic RNA polymerases require the assembly of a
complex of general transcription factors at the promoter, whereas
bacterial RNA polymerase requires only an additional subunit, called
sigma factor.
• In eucaryotic DNA, most genes are composed of a number of smaller
coding regions (exons) interspersed with noncoding regions (introns).
When a eucaryotic gene is transcribed from DNA into RNA, both the
exons and introns are copied.
• Introns are removed from the RNA transcripts in the nucleus by the
process of RNA splicing. In a reaction catalyzed by small ribonucleo-
protein complexes known as snRNPs, the introns are excised from
the RNA and the exons are joined together.
• Eucaryotic mRNAs go through several additional RNA processing
steps before they leave the nucleus, including RNA capping and poly-
adenylation. These reactions, along with splicing, take place as the
RNA is being transcribed. The mature mRNA is then transported to
the cytoplasm.
• Translation of the nucleotide sequence of mRNA into a protein takes
place in the cytoplasm on large ribonucleoprotein assemblies called
ribosomes. As the mRNA is threaded through a ribosome, its mes-
sage is translated into protein.
• The nucleotide sequence in mRNA is read in sets of three nucleotides
(codons), each codon corresponding to one amino acid.
• The correspondence between amino acids and codons is specified
by the genetic code. The possible combinations of the 4 different
nucleotides in RNA give 64 different codons in the genetic code. Most
amino acids are specified by more than one codon.
• tRNA acts as an adaptor molecule in protein synthesis. Enzymes
called aminoacyl-tRNA synthetases link amino acids to their appro-
priate tRNAs. Each tRNA contains a sequence of three nucleotides,
the anticodon, which matches a codon in mRNA by complementary
base-pairing between codon and anticodon.
• Protein synthesis begins when a ribosome assembles at an initia-
tion codon (AUG) in mRNA, a process that is regulated by proteins
called translation initiation factors. The completed protein chain is
released from the ribosome when a stop codon (UAA, UAG, or UGA)
is reached.
• The stepwise linking of amino acids into a polypeptide chain is cata-
lyzed by an rRNA molecule in the large ribosomal subunit. Thus, the
ribosome is an example of a ribozyme, an RNA molecule that can
catalyze a chemical reaction.
• The degradation of proteins in the cell is carefully controlled. Some
proteins are degraded in the cytosol by large protein complexes
called proteasomes.
• From our knowledge of present-day organisms and the molecules
they contain, it seems likely that living systems began with the evolu-
tion of RNA molecules that could catalyze their own replication.
• It has been proposed that, as cells evolved, the DNA double helix
replaced RNA as a more stable molecule for storing genetic informa-
tion, and proteins replaced RNAs as major catalytic and structural
components. However, important reactions such as peptide bond
formation are still catalyzed by RNA; these are thought to provide a
glimpse into an ancient, RNA-based world.
266 Chapter 7 From DNa to protein: how Cells read the Genome

Key terms
alternative splicing reading frame
aminoacyl-tRNA synthetase ribosomal RNA (rRNA)
anticodon ribosome
codon ribozyme
exon RNA
gene expression RNA polymerase
genetic code RNA processing
general transcription factors RNA splicing
initiator tRNA small nuclear RNA (snRNA)
intron spliceosome
messenger RNA (mRNA) transcription
promoter transfer RNA (tRNA)
protease translation
proteasome translation initiation factor

QuesTiONs is internal to the mRNA. [2] Assuming the 173 base-pair

deletion removes coding sequences from the lacheinmal
QuesTiON 7–7 mRNA, how would the lacheinmal protein differ between
the happy and unhappy people?)
Which of the following statements are correct? explain your
answers. QuesTiON 7–9
A. An individual ribosome can make only one type of use the genetic code shown in Figure 7–24 to identify
protein. which of the following nucleotide sequences would code
b. All mRNAs fold into particular three-dimensional for the polypeptide sequence arginine-glycine-aspartate:
structures that are required for their translation. 1. 5¢-AgA-ggA-gAu-3¢
C. The large and small subunits of an individual ribosome 2. 5¢-ACA-CCC-ACu-3¢
always stay together and never exchange partners.
3. 5¢-ggg-AAA-uuu-3¢
D. Ribosomes are cytoplasmic organelles that are
encapsulated by a single membrane. 4. 5¢-Cgg-ggu-gAC-3¢

e. because the two strands of DNA are complementary,

the mRNA of a given gene can be synthesized using either
strand as a template.
F. An mRNA may contain the sequence
ATTgACCCCggTCAA.
g. The amount of a protein present in the cell depends
on its rate of synthesis, its catalytic activity, and its rate of
degradation.
QuesTiON 7–8
The lacheinmal protein is a hypothetical protein that
causes people to smile more often. it is inactive in many
chronically unhappy people. The mRNA isolated from a
number of different unhappy persons in the same family
was found to lack an internal stretch of 173 nucleotides
that is present in the lacheinmal mRNA isolated from a
control group of happy people. The DNA sequences of the
Lacheinmal genes from the happy and unhappy families
were determined and compared. They differed by a single
nucleotide substitution, which lay in an intron. What can
you say about the molecular basis of unhappiness in this
family?
(hints: [1] Can you hypothesize a molecular mechanism by
which a single nucleotide substitution in a gene could cause
the observed deletion in the mRNA? Note that the deletion
QuesTiON 7–10
“The bonds that form between the anticodon of a tRNA
molecule and the three nucleotides of a codon in mRNA are
_____.” Complete this sentence with each of the following
options and explain why each of the resulting statements is
correct or incorrect.
A. Covalent bonds formed by gTp hydrolysis
b. hydrogen bonds that form when the tRNA is at the
A-site
C. broken by the translocation of the ribosome along the
mRNA
QuesTiON 7–11
list the ordinary, dictionary definitions of the terms
replication, transcription, and translation. by their side, list
the special meaning each term has when applied to the
living cell.
QuesTiON 7–12
in an alien world, the genetic code is written in pairs of
nucleotides. how many amino acids could such a code
specify? in a different world a triplet code is used but the
sequence of nucleotides is not important. it only matters

which nucleotides are present. how many amino acids
could this code specify? Would you expect to encounter
any problems translating these codes?
QuesTiON 7–13
One remarkable feature of the genetic code is that amino
acids with similar chemical properties often have similar
codons. Thus, codons with u or C as the second nucleotide
tend to specify hydrophobic amino acids. Can you suggest
a possible explanation for this phenomenon in terms of the
early evolution of the protein synthesis machinery?
QuesTiON 7–14
A mutation in DNA generates a ugA stop codon in the
middle of the RNA coding for a particular protein. A second
mutation in the cell leads to a single nucleotide change in
a tRNA that allows the correct translation of the protein;
that is, the second mutation “suppresses” the defect
caused by the first. The altered tRNA translates the ugA as
tryptophan. What nucleotide change has probably occurred
in the mutant tRNA molecule? What consequences
would the presence of such a mutant tRNA have for the
translation of the normal genes in this cell?
QuesTiON 7–15
The charging of a tRNA with an amino acid can be
represented by the following equation:
amino acid + tRNA + ATp Æ aminoacyl-tRNA + AMp + ppi
where ppi is pyrophosphate (see Figure 3–40). in the
aminoacyl-tRNA, the amino acid and tRNA are linked with
a high-energy bond; a large portion of the energy derived
from the hydrolysis of ATp is thus stored in this bond and
is available to drive peptide-bond formation at the later
stages of protein synthesis. The free-energy change of the
charging reaction shown in the equation is close to zero
and therefore would not be expected to favor attachment
of the amino acid to tRNA. Can you suggest a further step
that could drive the reaction to completion?
end-of-Chapter Questions 267
QuesTiON 7–16
A. The average molecular weight of a protein in the cell is
about 30,000 daltons. A few proteins, however, are much
larger. The largest known polypeptide chain made by any
cell is a protein called titin (made by mammalian muscle
cells), and it has a molecular weight of 3,000,000 daltons.
estimate how long it will take a muscle cell to translate
an mRNA coding for titin (assume the average molecular
weight of an amino acid to be 120, and a translation rate of
two amino acids per second for eucaryotic cells).
b. protein synthesis is very accurate: for every 10,000
amino acids joined together, only one mistake is made.
What is the fraction of average-sized protein molecules and
of titin molecules that are synthesized without any errors?
(hint: the probability P of obtaining an error-free protein is
given by P = (1 – E)n, where E is the error frequency and n
the number of amino acids.)
C. The molecular weight of all eucaryotic ribosomal
proteins combined is about 2.5 ¥ 106 daltons. Would it be
advantageous to synthesize them as a single protein?
D. Transcription occurs at a rate of about 30 nucleotides
per second. is it possible to calculate the time required to
synthesize a titin mRNA from the information given here?
QuesTiON 7–17
Which of the following types of mutations would be
predicted to harm an organism? explain your answers.
A. insertion of a single nucleotide near the end of the
coding sequence
b. Removal of a single nucleotide near the beginning of
the coding sequence
C. Deletion of three consecutive nucleotides in the middle
of the coding sequence
D. Deletion of four consecutive nucleotides in the middle
of the coding sequence
e. substitution of one nucleotide for another in the middle
of the coding sequence
This page is intentionally left blank.
Chapter EIGHT 8
Control of Gene Expression

An organism’s DNA encodes all of the RNA and protein molecules that are AN OVERVIEW OF GENE
needed to make its cells. Yet a complete description of the DNA sequence EXPRESSION
of an organism—be it the few million nucleotides of a bacterium or the
few billion nucleotides in each human cell—does not enable us to recon-
struct the organism any more than a list of all the English words in a HOW TRANSCRIPTIONAL
dictionary enables us to reconstruct a play by Shakespeare. We need to SWITCHES WORK
know how the elements in the DNA sequence or the words on a list work
together to make the masterpiece.
THE mOLECuLAR
In cell biology, the question comes down to gene expression. Even the
mECHANISmS THAT CREATE
simplest single-celled bacterium can use its genes selectively—for exam-
ple, switching genes on and off to make the enzymes needed to digest
SPECIALIzEd CELL TyPES
whatever food sources are available. And, in multicellular plants and ani-
mals, gene expression is under even more elaborate control. Over the POST-TRANSCRIPTIONAL
course of embryonic development, a fertilized egg cell gives rise to many CONTROLS
cell types that differ dramatically in both structure and function. The dif-
ferences between a mammalian neuron and a lymphocyte, for example,
are so extreme that it is difficult to imagine that the two cells contain the
same DNA (Figure 8–1). For this reason, and because cells in an adult
organism rarely lose their distinctive characteristics, biologists origi-
nally suspected that genes might be selectively lost when a cell becomes
specialized. We now know, however, that nearly all the cells of a multi-
cellular organism contain the same genome. Cell differentiation is instead
achieved by changes in gene expression.
Hundreds of different cell types carry out a range of specialized functions
that depend upon genes that are only switched on in that cell type: for
270 Chapter 8 Control of Gene expression
25 mm
neuron
lymphocyte
Figure 8–1 A neuron and a lymphocyte
share the same genome. the long
branches of this neuron from the retina
enable it to receive electrical signals
from many cells and carry them to many
neighboring cells. the lymphocyte, a white
blood cell involved in the immune response
ECB3 m7.01/8.01
to infection (drawn to scale), moves freely
through the body. Both of these mammalian
cells contain the same genome, but they
express different rNas and proteins.
(Neuron from B.B. Boycott in essays on the
Nervous System [r. Bellairs and e.G. Gray,
eds.]. Oxford, U.K.: Clarendon press, 1974.
With permission from Oxford University
press.)
example, the b cells of the pancreas make the protein hormone insulin,
while the a cells of the pancreas make the hormone glucagon; the lym-
phocytes of the immune system are the only cells in the body to make
antibodies, while developing red blood cells are the only cells that make
the oxygen-transport protein hemoglobin. The differences between a
neuron, a lymphocyte, a liver cell, and a red blood cell depend upon the
precise control of gene expression. In each case the cell is using only
some of the genes in its total repertoire.
In this chapter, we shall discuss the main ways in which gene expression
is controlled in bacterial and eucaryotic cells. Although some mecha-
nisms of control apply to both sorts of cells, eucaryotic cells, through
their more complex chromosomal structure, have ways of controlling
gene expression that are not available to bacteria.
AN OVERVIEW OF GENE EXPRESSION
How does an individual cell specify which of its many thousands of genes
to express? This decision is an especially important problem for multi-
cellular organisms because, as the animal develops, cell types such as
muscle, nerve, and blood cells become different from one another, even-
tually leading to the wide variety of cell types seen in the adult. Such
differentiation arises because cells make and accumulate different sets
of RNA and protein molecules: that is, they express different genes.
The different Cell Types of a multicellular Organism
Contain the Same dNA
As discussed above, cells have the ability to change which genes they
express without altering the nucleotide sequence of their DNA. But how
do we know this? If DNA were altered irreversibly during development,
the chromosomes of a differentiated cell would be incapable of guid-
ing the development of the whole organism. To test this idea, a nucleus
from a skin cell of an adult frog was injected into a frog egg whose own
nucleus had been removed. In at least some cases the egg developed
normally into a tadpole, indicating that the transplanted skin cell nucleus
cannot have lost any critical DNA sequences (Figure 8–2). Such nuclear
transplantation experiments have also been carried out successfully
using differentiated cells taken from adult mammals, including sheep,
cows, pigs, goats, and mice. And in plants, individual cells removed from
a carrot, for example, can be shown to regenerate an entire adult carrot
plant. These experiments all show that the DNA in specialized cell types
still contains the entire set of instructions needed to form a whole organ-
ism. The cells of an organism therefore differ not because they contain
different genes, but because they express them differently.
different Cell Types Produce different Sets of Proteins
The extent of the differences in gene expression between different cell
types may be roughly gauged by comparing the protein composition of
cells in liver, heart, brain, and so on using the technique of two-dimen-
sional gel electrophoresis (see Panel 4–6, p. 167). Experiments of this
kind reveal that many proteins are common to all the cells of a mul-
ticellular organism. These housekeeping proteins include the structural
proteins of chromosomes, RNA polymerases, DNA repair enzymes, ribo-
somal proteins, enzymes involved in glycolysis and other basic metabolic
processes, and many of the proteins that form the cytoskeleton. Each dif-
ferent cell type also produces specialized proteins that are responsible for
the cell’s distinctive properties. In mammals, for example, hemoglobin is
 an Overview of Gene expression 271

(A)

nucleus in
pipette

skin cells in
culture dish

adult frog
tadpole

nucleus normal embryo

injected
into egg

unfertilized egg nucleus destroyed

by UV light

(B)

section proliferating separated single organized young young carrot

of carrot cell mass cells in rich cell clone of embryo plant
liquid dividing
medium cells

(C)

epithelial cells
from oviduct
cows
meiotic ELECTRIC CELL
spindle PULSE CAUSES DIVISION
donor cell DONOR CELL reconstructed embryo embryo placed in calf
placed TO FUSE WITH zygote foster mother
next to ENUCLEATED
egg EGG CELL
unfertilized meiotic spindle
egg cell and associated Figure 8–2 Differentiated cells contain all
chromosomes
removed
the genetic instructions necessary to direct
the formation of a complete organism.
(a) the nucleus of a skin cell from an adult
frog transplanted into an egg whose nucleus
has been removed can give rise to an entire
tadpole. the broken arrow indicates that to
made in reticulocytes, the cells that develop into red blood cells, but it give the transplanted genome time to adjust
cannot be detected in any other cell type. to an embryonic environment, a further
transfer step is required in which one of the
Many proteins in a cell are produced in such small numbers that they nuclei is taken from the early embryo that
cannot be detected by the technique of gel electrophoresis. A more sen- begins to develop and is put back into a
sitive technique, called mass spectrometry (see Figure 4–45) can be used second enucleated egg. (B) In many types of
to detect even rare proteins, and can also provide information about plants, differentiated cells retain the ability
whether the proteins are covalently modified (for example by phos- to “dedifferentiate,” so that a single cell can
form a clone of progeny cells that later give
phorylation). Gene expression can also be studied by monitoring the
MBoC5 7.02/8.02 rise to an entire plant. (C) a differentiated
mRNAs that encode proteins, rather than the proteins themselves. cell from an adult cow introduced into an
Estimates of the number of different mRNA sequences in human cells sug- enucleated egg from a different cow can
gest that, at any one time, a typical differentiated human cell expresses give rise to a calf. Different calves produced
perhaps 5000–15,000 genes from a repertoire of about 25,000. It is the from the same differentiated cell donor are
genetically identical and are therefore
expression of a different collection of genes in each cell type that causes clones of one another. (a, modified from
the large variations seen in the size, shape, behavior, and function of dif- J.B. Gurdon, Sci. Am. 219(6):24–35, 1968. With
ferentiated cells. permission from the estate of Bunji tagawa.)
272 Chapter 8 Control of Gene expression

A Cell Can Change the Expression of Its Genes in

Response to External Signals
Most of the specialized cells in a multicellular organism are capable of
altering their patterns of gene expression in response to extracellular
cues. For example, if a liver cell is exposed to a glucocorticoid hormone (a
type of steroid), the production of several specific proteins is dramatically
increased. Released in the body during periods of starvation or intense
exercise, glucocorticoids signal the liver to increase the production of
glucose from amino acids and other small molecules. The set of proteins
whose production is induced by glucocorticoids includes enzymes such
as tyrosine aminotransferase, which helps to convert tyrosine to glucose.
When the hormone is no longer present, the production of these proteins
drops to its normal level.
Other cell types respond to glucocorticoids differently. In fat cells, for
example, the production of tyrosine aminotransferase is reduced, while
some other cell types do not respond to glucocorticoids at all. These
examples illustrate a general feature of cell specialization: different cell
types often respond in different ways to the same extracellular signal.
Underlying such adjustments are features of the gene expression pattern
that do not change and give each cell type its permanently distinctive
character.

Gene Expression Can Be Regulated at many of the Steps

in the Pathway from dNA to RNA to Protein
If differences among the various cell types of an organism depend on
the particular genes that the cells express, at what level is the control of
gene expression exercised? As we saw in the last chapter, there are many
steps in the pathway leading from DNA to protein, and all of them can
in principle be regulated. Thus a cell can control the proteins it makes
by (1) controlling when and how often a given gene is transcribed, (2)
controlling how an RNA transcript is spliced or otherwise processed, (3)
selecting which mRNAs are exported from the nucleus to the cytosol,
(4) selectively degrading certain mRNA molecules, (5) selecting which
mRNAs are translated by ribosomes, or (6) selectively activating or inac-
tivating proteins after they have been made (Figure 8–3).
Gene expression can be regulated at each of these steps, and through-
out this chapter we will describe some of the key control points along
their pathway from DNA to protein. For most genes, however, the con-
trol of transcription (step number 1 in Figure 8–3) is paramount. This
makes sense because only transcriptional control can ensure that no
unnecessary intermediates are synthesized. So it is the regulation of tran-
scription—and the DNA and protein components that determine which
genes a cell transcribes into RNA—that we address first.

inactive mRNA
NUCLEUS CYTOSOL mRNA
degradation 4
control
RNA
DNA transcript mRNA mRNA
1 2 3
transcriptional RNA RNA
Figure 8–3 Eucaryotic gene expression control processing transport translation protein
control 5
can be controlled at several different control and activity
localization control inactive
steps. examples of regulation at each of control protein
6
the steps are known, although for most protein
genes the main site of control is step 1: active
transcription of a DNa sequence into rNa. protein
 how transcriptional Switches Work 273

HOW TRANSCRIPTIONAL SWITCHES WORK

Only 50 years ago the idea that genes could be switched on and off was
revolutionary. This concept was a major advance, and it came originally
from the study of how E. coli bacteria adapt to changes in the composition
of their growth medium. Many of the same principles apply to eucaryotic
cells. However, the enormous complexity of gene regulation in higher
organisms, combined with the packaging of their DNA into chromatin,
creates special challenges and some novel opportunities for control—as
we shall see. We begin with a discussion of the transcription regulators,
proteins that control gene expression at the level of transcription.

Transcription Is Controlled by Proteins Binding to

Regulatory dNA Sequences
Control of transcription is usually exerted at the step at which the pro-
cess is initiated. In Chapter 7, we saw that the promoter region of a gene
attracts the enzyme RNA polymerase and correctly orients the enzyme to
begin its task of making an RNA copy of the gene. The promoters of both
bacterial and eucaryotic genes include an initiation site, where transcrip-
tion actually begins, and a sequence of approximately 50 nucleotides that
extends upstream from the initiation site (if one likens the direction of
transcription to the flow of a river). This region contains sites that are
required for the RNA polymerase to bind to the promoter. In addition
to the promoter, nearly all genes, whether bacterial or eucaryotic, have
regulatory DNA sequences that are used to switch the gene on or off.
Some regulatory DNA sequences are as short as 10 nucleotide pairs and
act as simple gene switches that respond to a single signal. Such sim-
ple switches predominate in bacteria. Other regulatory DNA sequences,
especially those in eucaryotes, are very long (sometimes more than
10,000 nucleotide pairs) and act as molecular microprocessors, integrat-
ing information from a variety of signals into a command that dictates
how often transcription is initiated.
Regulatory DNA sequences do not work by themselves. To have any
effect, these sequences must be recognized by proteins called transcrip-
tion regulators,which bind to the DNA. It is the combination of a DNA
sequence and its associated protein molecules that acts as the switch
to control transcription. The simplest bacterium codes for several hun-
dred transcription regulators, each of which recognizes a different DNA
sequence and thereby regulates a distinct set of genes. Humans make
many more—several thousand—signifying the importance and complex-
ity of this form of gene regulation in producing a complex organism.
Proteins that recognize a specific DNA sequence do so because the sur-
face of the protein fits tightly against the special surface features of the
double helix in that region. These features will vary depending on the
nucleotide sequence, and thus different proteins will recognize different
nucleotide sequences. In most cases, the protein inserts into the major
groove of the DNA helix (see Figure 5–7) and makes a series of molec-
ular contacts with the base pairs. The protein forms hydrogen bonds,
ionic bonds, and hydrophobic interactions with the edges of the bases,
usually without disrupting the hydrogen bonds that hold the base pairs
together (Figure 8–4). Although each individual contact is weak, the 20 or
so contacts that are typically formed at the protein–DNA interface com-
bine to ensure that the interaction is both highly specific and very strong;
indeed, protein–DNA interactions are among the tightest and most spe-
cific molecular interactions known in biology.
274 Chapter 8 Control of Gene expression

Figure 8–4 A transcription regulator binds transcription regulator

to the major groove of a DNA helix. Only
a single contact between the protein and e
ov
one base pair in DNa is shown. typically, g ro
r CH2
the protein–DNa interface would consist

o
aj
of 10–20 such contacts, each involving a

m
C H
different amino acid and each contributing asparagine N
O
to the strength of the protein–DNa
H
interaction. H
CH3 O H N
N H

H T N H N A N
N N
O H

outer limit of sugar–phosphate

ve
backbone on outside of double helix minor groo

Although each example of protein–DNA recognition is unique in detail,

many of the proteins responsible for gene regulation recognize DNA
through one of several structural motifs. These fit into the major groove
of the DNA double helix and form tight associations with a short stretch
of DNA base pairs. The DNA-binding motifs shown in Figure 8–5—the
homeodomain, the zinc finger, and the leucine zipper—are found in tran-
scription regulators that control the expression of thousands of different
genes in virtually all eucaryotic organisms. Frequently, DNA-binding
ECB3 E8.04/8.04
proteins bind in pairs (dimers) to the DNA helix. Dimerization roughly
doubles the area of contact with the DNA, thereby greatly increasing
the strength and specificity of the protein–DNA interaction. Because two
different proteins can pair in different combinations, dimerization also
makes it possible for many different DNA sequences to be recognized by
Figure 8–5 Transcription regulators a limited number of proteins.
contain a variety of DNA-binding motifs.
(a and B) Front and side views of the base pair sugar–phosphate
backbone
homeodomain—a structural motif found
in many eucaryotic DNa-binding
proteins (movie 8.1). It consists of three
consecutive a helices, which are shown as
cylinders in this figure. Most of the contacts
with the DNa bases are made by helix 3 2
Ser
(which is seen end-on in B). the asparagine 2 Arg
(asn) in this helix contacts an adenine in 3
the manner shown in Figure 8–4. (C) the 3 Asn
zinc finger motif is built from an a helix 1
and a b sheet (the latter shown as a twisted 1
arrow) held together by a molecule of zinc
(indicated by the colored spheres). Zinc Arg
fingers are often found in clusters covalently
joined together to allow the a helix of each (A) (B)
finger to contact the DNa bases in the
DNA
major groove (movie 8.2). the illustration COOH
here shows a cluster of three zinc fingers.
(D) a leucine zipper motif. this DNa-
binding motif is formed by two a helices,
each contributed by a different protein
molecule. Leucine zipper proteins thus bind
to DNa as dimers, gripping the double
helix like a clothespin on a clothesline
(movie 8.3).
each of these motifs makes many contacts
with DNa. For simplicity, only the hydrogen-
bond contacts are shown in (B), and none
of the individual protein–DNa contacts are (C) (D)
shown in (C) and (D). NH2
 how transcriptional Switches Work 275

Transcription Switches Allow Cells to Respond to Changes

in the Environment
The simplest and most completely understood examples of gene regula-
tion occur in bacteria and in the viruses that infect them. The genome of
the bacterium E. coli consists of a single circular DNA molecule of about
4.6 ¥ 106 nucleotide pairs. This DNA encodes approximately 4300 proteins,
although only a fraction of these are made at any one time. Bacteria regu-
late the expression of many of their genes according to the food sources
that are available in the environment. For example, in E. coli, five genes
code for enzymes that manufacture the amino acid tryptophan. These
genes are arranged in a cluster on the chromosome and are transcribed
from a single promoter as one long mRNA molecule from which the five
proteins are translated (Figure 8–6). When tryptophan is present in the Question 8–1
surroundings and enters the bacterial cell, these enzymes are no longer
Bacterial cells can take up the
needed and their production is shut off. This situation arises, for example,
amino acid tryptophan (Trp) from
when the bacterium is in the gut of a mammal that has just eaten a meal
their surroundings, or if there is an
rich in protein. These five coordinately expressed genes are part of an
insufficient external supply they can
operon—a set of genes that are transcribed into a single mRNA. Operons
synthesize tryptophan from other
are common in bacteria but are not found in eucaryotes, where genes are
small molecules. The Trp repressor is
transcribed and regulated individually (see Figure 7–36).
a transcription regulator that shuts
We now understand in considerable detail how the tryptophan operon off the transcription of genes that
functions. Within the promoter is a short DNA sequence (15 nucleotides code for the enzymes required for
in length) that is recognized by a transcription regulator. When this pro- the synthesis of tryptophan (see
tein binds to this nucleotide sequence, termed the operator, it blocks Figure 8–7).
access of RNA polymerase to the promoter; this prevents transcription A. What would happen to the
of the operon and production of the tryptophan-producing enzymes. The regulation of the tryptophan operon
transcription regulator is known as the tryptophan repressor, and it is con- in cells that express a mutant form
trolled in an ingenious way: the repressor can bind to DNA only if it has of the tryptophan repressor that
also bound several molecules of the amino acid tryptophan (Figure 8–7). (1) cannot bind to dNA, (2) cannot
The tryptophan repressor is an allosteric protein (see Figure 4–37): the bind tryptophan, or (3) binds

?
binding of tryptophan causes a subtle change in its three-dimensional to dNA even in the absence of
structure so that the protein can bind to the operator sequence. When tryptophan?
the concentration of free tryptophan in the cell drops, the repressor no B. What would happen in
longer binds tryptophan and thus no longer binds to DNA, and the tryp- scenarios (1), (2), and (3) if the
tophan operon is transcribed. The repressor is thus a simple device that cells, in addition, produced normal
switches production of a set of biosynthetic enzymes on and off accord- tryptophan repressor protein from a
ing to the availability of the end product of the pathway that the enzymes second, normal gene?
catalyze.
The bacterium can respond very rapidly to the rise in tryptophan concen-
tration because the tryptophan repressor protein itself is always present
in the cell. The gene that encodes it is continuously transcribed at a low
level, so that a small amount of the repressor protein is always being
made. Such unregulated gene expression is known as constitutive gene
expression.
Figure 8–6 A cluster of bacterial genes
can be transcribed from a single
promoter. each of these five genes encodes
a different enzyme; all of the enzymes
are needed to synthesize the amino acid
tryptophan. the genes are transcribed as a
promoter
E D C B A
single mrNa molecule, a feature that allows
E. coli chromosome their expression to be coordinated. Clusters
of genes transcribed as a single mrNa
operator molecule are common in bacteria. each
mRNA molecule such cluster is called an operon; expression
of the tryptophan operon shown here is
controlled by a regulatory DNa sequence
called the operator, situated within the
enzymes for tryptophan biosynthesis promoter.
276 Chapter 8 Control of Gene expression

promoter

start of transcription

_ 60 _ 35 _10 +1 +20
operator

tryptophan tryptophan
low high
inactive repressor
RNA polymerase

tryptophan active repressor

mRNA
GENES ARE ON GENES ARE OFF

Figure 8–7 Genes can be switched on and off with repressor proteins. If the concentration of tryptophan inside
the cell is low, rNa polymerase (blue) binds to the promoter and transcribes the five genes of the tryptophan
operon (left). If the concentration of tryptophan is high, however, the repressor protein (dark green) becomes active
and binds to the operator (light green), where it blocks the binding of rNa polymerase to the promoter (right).
Whenever the concentration of intracellular tryptophan drops, the repressor releases its tryptophan and falls off the
DNa, allowing the polymerase to again transcribe the operon. the promoter is marked by two key blocks of DNa
sequence information, the –35 and –10 regions, highlighted in yellow (see Figure 7–10). the complete operon is
shown in Figure 8–6.

Repressors Turn Genes Off, Activators Turn Them On

Figure 8–8 Gene expression can also
be controlled with activator proteins.
an activator protein binds to a regulatory
sequence on the DNa and then interacts
with the rNa polymerase to help it initiate
transcription. Without the activator, the
promoter fails to initiate transcription
efficiently. In bacteria, the binding of the
activator to DNa is often controlled by
the interaction of a metabolite or other
small molecule (red triangle) with the
activator protein. For example, the bacterial
catabolite activator protein (Cap) must bind
cyclic aMp (caMp) before it can bind to
DNa; thus Cap allows genes to be switched
on in response to increases in intracellular
caMp concentration.
The tryptophan repressor, as its name suggests, is a repressor protein:
in its active form, it switches genes off, or represses them. Some bacterial
transcription regulators do the opposite: they switch genes on, or activate
ECB3 m7.35/8.07
them. These activator proteins work on promoters that—in contrast to
the promoter for the tryptophan operator—are, on their own, only mar-
ginally able to bind and position RNA polymerase; they may, for example,
be recognized only poorly by the polymerase. However, these poorly
functioning promoters can be made fully functional by activator proteins
that bind to a nearby site on the DNA and contact the RNA polymerase to
help it initiate transcription (Figure 8–8). In some cases, a bacterial tran-
scription regulator can repress transcription at one promoter and activate
transcription at another; whether the regulatory protein acts as an activa-
tor or repressor depends, in large part, on exactly where the regulatory
sequences to which it binds are located with respect to the promoter.
Like the tryptophan repressor, activator proteins often have to interact
with a second molecule to be able to bind DNA. For example, the bacte-
rial activator protein CAP has to bind cyclic AMP (cAMP) before it can
RNA polymerase
bound activator
protein
binding site
for activator mRNA
protein
5¢ 3¢
protein
 how transcriptional Switches Work 277

bind to DNA. Genes activated by CAP are switched on in response to an

Question 8–2
increase in intracellular cAMP concentration, which signals to the bac-
terium that glucose, its preferred carbon source, is no longer available; Explain how dNA-binding proteins
as a result, CAP drives the production of enzymes capable of degrading can make sequence-specific
other sugars. contacts to a double-stranded
dNA molecule without breaking
An Activator and a Repressor Control the Lac Operon the hydrogen bonds that hold
the bases together. Indicate how,
In many instances, the activity of a single promoter is controlled by two through such contacts, a protein can
different transcription regulators. The Lac operon in E. coli, for example, distinguish a T-A from a C-G pair.
is controlled by both the Lac repressor and the activator protein CAP. The Give your answer in a form similar to
Lac operon encodes proteins required to import and digest the disac- Figure 8–4, and indicate what sorts
charide lactose. In the absence of glucose, CAP switches on genes that of noncovalent bonds—hydrogen
allow the cell to utilize alternative sources of carbon—including lactose.

?
bonds, electrostatic attractions, or
It would be wasteful, however, for CAP to induce expression of the Lac hydrophobic interactions (see Panel
operon when lactose is not present. Thus the Lac repressor shuts off the 2–7, pp. 76–77)—would be made.
operon in the absence of lactose. This arrangement enables the control There is no need to specify any
region of the Lac operon to integrate two different signals, so that the particular amino acid on the protein.
operon is highly expressed only when two conditions are met: lactose The structures of all the base pairs in
must be present and glucose must be absent (Figure 8–9). This genetic dNA
NA are given in Figure 5–6.
circuit thus behaves like a switch that carries out a logic operation in a
computer. When lactose is present AND glucose is absent, the cell exe-
cutes the appropriate program: in this case, transcription of the genes
that permit the uptake and utilization of lactose.
The elegant logic of the Lac operon first attracted the attention of biolo-
gists more than 50 years ago. The molecular basis of the switch was
uncovered by a combination of genetics and biochemistry, providing the
first insight into how gene expression is controlled. In a eucaryotic cell,
similar gene regulatory devices are combined to generate increasingly
complex circuits. Indeed, the developmental program that takes a ferti-
lized egg to adulthood can be viewed as an exceedingly complex circuit
composed of simple components like those that control the Lac and tryp-
tophan operons.

RNA-
CAP- polymerase- start site for RNA synthesis
binding binding site
site (promoter)

operator LacZ gene

_80 _40 1 40 80 Figure 8–9 The Lac operon is controlled

nucleotide pairs
by two signals. Glucose and lactose
concentrations control the initiation of
+ GLUCOSE OPERON OFF transcription of the Lac operon through
+ LACTOSE CAP not bound their effects on the Lac repressor protein
and Cap. When lactose is absent, the Lac
repressor repressor binds the Lac operator and shuts
+ GLUCOSE OPERON OFF off expression of the operon. addition
_ LACTOSE of lactose increases the intracellular
Lac repressor bound,
CAP not bound concentration of a related compound,
CAP
repressor allolactose. allolactose binds to the
_ GLUCOSE Lac repressor, causing it to undergo a
OPERON OFF
_ LACTOSE conformational change that releases its grip
Lac repressor bound on the operator DNa (not shown). When
CAP RNA polymerase
glucose is absent, cyclic aMp (red triangle)
_ GLUCOSE is produced by the cell and Cap binds to
+ LACTOSE OPERON ON DNa. LacZ, the first gene of the operon,
encodes the enzyme b-galactosidase, which
breaks down lactose to galactose and
RNA glucose.
278 Chapter 8 Control of Gene expression

Eucaryotic Transcription Regulators Control Gene

Expression from a distance
Eucaryotes, too, use transcription regulators—both activators and repres-
sors—to regulate the expression of their genes. The DNA sites to which
eucaryotic gene activators bound were originally termed enhancers,
because their presence dramatically enhanced, or increased, the rate of
transcription. It was surprising to biologists when, in 1979, it was discov-
ered that these activator proteins could enhance transcription even when
they are bound thousands of nucleotide pairs away from a gene’s pro-
moter. They also work when bound either upstream or downstream from
the gene. These observations raised several questions. How do enhancer
sequences and the proteins bound to them function over such long dis-
tances? How do they communicate with the promoter?
Many models for this ‘action at a distance’ have been proposed, but
the simplest of these seems to apply in most cases. The DNA between
the enhancer and the promoter loops out to allow eucaryotic activa-
tor proteins to directly influence events that take place at the promoter
(Figure 8–10). The DNA thus acts as a tether, causing a protein bound to
an enhancer even thousands of nucleotide pairs away to interact with
the proteins in the vicinity of the promoter—including RNA polymerase
II and the general transcription factors (see Figure 7–12). Often, addi-
tional proteins serve to link the distantly bound transcription regulators
to these proteins at the promoter; the most important is a large com-
plex of proteins known as Mediator (see Figure 8–10). One of the ways in
which eucaryotic activator proteins function is by aiding in the assembly
of the general transcription factors and RNA polymerase at the promoter.
Eucaryotic repressor proteins do the opposite: they decrease transcription
by preventing or sabotaging the assembly of the same protein complex.
In addition to promoting—or repressing—the assembly of a transcription
initiation complex, eucaryotic transcription regulators have an additional
mechanism of action: they attract proteins that modulate chromatin
structure and thereby affect the accessibility of the promoter to the gen-
eral transcription factors and RNA polymerase, as we discuss next.

eucaryotic
activator protein

TATA box
enhancer start of
BINDING OF
(binding site for transcription
GENERAL TRANSCRIPTION
activator protein)
FACTORS, MEDIATOR, AND
RNA POLYMERASE
Figure 8–10 In eucaryotes, gene activation
occurs at a distance. an activator protein
activator protein
bound to DNa attracts rNa polymerase
and general transcription factors (see
Figure 7–12) to the promoter. Looping of Mediator
the DNa permits contact between the
activator protein bound to the enhancer
and the transcription complex bound to the
promoter. In the case shown here, a large
protein complex called Mediator serves as
a go-between. the broken stretch of DNa
signifies that the length of DNa between the
enhancer and the start of transcription varies, RNA polymerase II
sometimes reaching tens of thousands of
nucleotide pairs in length. TRANSCRIPTION BEGINS
 how transcriptional Switches Work 279

Packing of Promoter dNA into Nucleosomes Affects

Initiation of Transcription
Initiation of transcription in eucaryotic cells must also take into account
the packaging of DNA into chromosomes. As we saw in Chapter 5, the
genetic material in eucaryotic cells is packed into nucleosomes, which, in
turn, are folded into higher-order structures. How do transcription regu-
lators, general transcription factors, and RNA polymerase gain access to
such DNA? Nucleosomes can inhibit the initiation of transcription if they
are positioned over a promoter, probably because they physically block
the assembly of the general transcription factors or RNA polymerase on
the promoter. In fact, such chromatin packaging may have evolved in
part to prevent leaky gene expression—initiation of transcription in the Question 8–3
absence of the proper activator proteins. Some transcription regulators bind
In eucaryotic cells, activator and repressor proteins exploit chromatin to dNA and cause the double helix
structure to help turn genes on and off. As we saw in Chapter 5, chroma- to bend at a sharp angle. Such
tin structure can be altered by chromatin-remodeling complexes and by “bending proteins” can stimulate
enzymes that covalently modify the histone proteins that form the core the initiation of transcription
of the nucleosome (see Figures 5–27 and 5–28). Many gene activators without contacting either the RNA
take advantage of these mechanisms by recruiting these proteins to pro- polymerase, any of the general

?
moters (Figure 8–11). For example, many transcription activators attract transcription factors, or any other
histone acetylases, which attach an acetyl group to selected lysines in transcription regulators. Can you
the tail of histone proteins. This modification alters chromatin structure, devise a plausible explanation for
probably allowing greater accessibility to the underlying DNA; moreover, how these proteins might work
the acetyl groups themselves are recognized by proteins that promote to modulate transcription? draw
draw
transcription, including some of the general transcription factors. a diagram that illustrates your
explanation.
Likewise, gene repressor proteins can modify chromatin in ways that
reduce the efficiency of transcription initiation. For example, many repres-
sors attract histone deacetylases—enzymes that remove the acetyl groups
from histone tails, thereby reversing the positive effects that acetylation
has on transcription initiation. Although some eucaryotic repressor pro-
teins work on a gene-by-gene basis, others can orchestrate the formation
of large swaths of transcriptionally inactive chromatin containing many

transcription regulator

TATA

histone-modifying
enzyme
chromatin-remodeling
complex

Figure 8–11 Eucaryotic gene activator

proteins can direct local alterations in
chromatin structure. activator proteins
can recruit histone-modifying enzymes and
remodeled nucleosomes
specific pattern of chromatin-remodeling complexes to the
histone modification promoter region of a gene. the action of
these proteins renders the DNa packaged
in chromatin more accessible to other
general transcription factors, proteins in the cell, including those required
Mediator, and for transcription initiation. In addition, the
RNA polymerase
covalent histone modifications can serve
as binding sites for proteins that stimulate
TRANSCRIPTION INITIATION transcription initiation.
280 Chapter 8 Control of Gene expression

genes. As discussed in Chapter 5, these transcription-resistant regions of

DNA include the heterochromatin found in interphase chromosomes and
the entire X chromosome in female mammals.

THE mOLECuLAR mECHANISmS THAT CREATE

SPECIALIzEd CELL TyPES
All cells must be able to switch genes on and off in response to signals in
their environments. But the cells of multicellular organisms have evolved
this capacity to an extreme degree and in highly specialized ways to form
an organized array of differentiated cell types. In particular, once a cell in a
multicellular organism becomes committed to differentiate into a specific
cell type, the choice of fate is generally maintained through many subse-
quent cell generations. This means that the changes in gene expression,
which are often triggered by a transient signal, must be remembered. This
phenomenon of cell memory is a prerequisite for the creation of organ-
ized tissues and for the maintenance of stably differentiated cell types.
In contrast, the simplest changes in gene expression in both eucaryotes
and bacteria are often only transient; the tryptophan repressor, for exam-
ple, switches off the tryptophan genes in bacteria only in the presence of
tryptophan; as soon as the amino acid is removed from the medium, the
genes are switched back on, and the descendants of the cell will have no
memory that their ancestors had been exposed to tryptophan.
In this section, we discuss some of the special features of transcriptional
regulation that are found in multicellular organisms. Our focus will be
on how these mechanisms create and maintain the specialized cell types
that give a worm, a fly, or a human its distinctive characteristics.

Eucaryotic Genes Are Regulated by Combinations of

Proteins
Because eucaryotic transcription regulators can control transcription ini-
tiation when bound to DNA many base pairs away from the promoter, the
nucleotide sequences that control the expression of a gene can be spread
over long stretches of DNA. In animals and plants it is not unusual to find
the regulatory DNA sequences of a gene dotted over tens of thousands of
nucleotide pairs, although much of this DNA serves as “spacer” sequence
and is not directly recognized by the transcription regulators.
So far in this chapter we have treated transcription regulators as though
each functions individually to turn a gene on or off. While this idea holds
true for many simple bacterial activators and repressors, most eucaryo-
tic transcription regulators work as part of a “committee” of regulatory
proteins, all of which are necessary to express the gene in the right cell,
in response to the right conditions, at the right time, and in the required
amount.
The term combinatorial control refers to the way that groups of regula-
tory proteins work together to determine the expression of a single gene.
We saw a simple example of such regulation by multiple signals when
we discussed the bacterial Lac operon (see Figure 8–9). In eucaryotes, the
regulatory inputs have been amplified, and a typical gene is controlled
by dozens of transcription regulators (Figure 8–12). Often, some of these
regulatory proteins are repressors and some are activators; the molecular
mechanisms by which the effects of all of these proteins are added up to
determine the final level of expression for a gene are only now beginning
to be understood. An example of such a complex regulatory system—one
that participates in the development of a fruit fly from a fertilized egg—is
described in How We Know, pp. 282–284.
 the Molecular Mechanisms that Create Specialized Cell types 281

regulatory DNA sequences Figure 8–12 Transcription regulators work

together as a “committee” to control the
expression of a eucaryotic gene. Whereas
spacer DNA the general transcription factors that
assemble at the promoter are the same for
all genes transcribed by polymerase II, the
transcription regulators and the locations of
their binding sites relative to the promoters
are different for different genes. the effects
of multiple transcription regulators combine
to determine the final rate of transcription
initiation. It is not yet understood in detail
histone-modifying
enzymes, chromatin-remodeling general how these multiple inputs are integrated.
complexes, and Mediator transcription
factors
transcription
regulators RNA polymerase

TATA
box start of
upstream
transcription

promoter

The Expression of different Genes Can Be Coordinated by

a Single Protein
In addition to being able to switch individual genes on and off, all
organisms—whether procaryote or eucaryote—need to coordinate the
expression of different genes. When a eucaryotic cell receives a signal to
divide, for example, a number of hitherto unexpressed genes are turned
on together to set in motion the events that lead eventually to cell divi-
sion (discussed in Chapter 18). One way in which bacteria coordinate the
expression of a set of genes is by having them clustered together in an
operon under the control of a single promoter (see Figure 8–6). This is
not the case in eucaryotes, in which each gene is transcribed and regu-
lated individually. So how do eucaryotes coordinate gene expression? In
particular, given that a eucaryotic
ECB3cellE8.15/8.12
uses a committee of transcription
regulators to control each of its genes, how can it rapidly and decisively
switch whole groups of genes on or off? The answer is that even though
control of gene expression is combinatorial, the effect of a single tran-
scription regulator can still be decisive in switching any particular gene
on or off, simply by completing the combination needed to activate or
repress that gene. This is like dialing in the final number of a combination
lock: the lock will spring open if the other numbers have been previously
entered. Just as the same number can complete the combination for dif-
ferent locks, the same protein can complete the combination for several
different genes. As long as different genes contain DNA sequences rec-
ognized by the same transcription regulator, they can be switched on or
off together, as a unit.
An example of this style of regulation in humans is seen with the glu-
cocorticoid receptor protein. In order to bind to regulatory sites in DNA
this transcription regulator must first form a complex with a molecule
of a glucocorticoid hormone (for example, cortisol; see Table 16–1,
p. 535). In response to glucocorticoids, liver cells increase the expression
of many different genes, one of which encodes the enzyme tyrosine ami-
notransferase, as discussed earlier. These genes are all regulated by the
binding of the glucocorticoid hormone–receptor complex to a regulatory
sequence in the DNA of each gene. When the body has recovered and the
282
hOW We KNOW:
GENE REGULATION—THE STORY OF EVE

The ability to regulate gene expression is crucial to the
proper development of a multicellular organism from a
fertilized egg to a fertile adult. Beginning at the earliest
moments in development, a succession of programs
controls the differential expression of genes that allows
an animal to form a proper body plan—helping to
distinguish its back from its belly, and its head from its
tail. These cues ultimately direct the correct placement
of a wing or a leg, a mouth or an anus, a neuron or a
sex cell.
A central problem in development, then, is understand-
ing how an organism generates these patterns of gene
expression, which are laid down within hours of fer-
tilization. A large part of the story rests on the action
of transcription regulators. By interacting with differ-
ent regulatory DNA sequences, these proteins instruct
every cell in the embryo to switch on the genes that are
appropriate for that cell at each time point during devel-
opment. How can a protein binding to a piece of DNA
help direct the development of a complex multicellular
organism? To see how we can address that large ques-
tion, we now review the story of Eve.
In the Big Egg
Even-skipped—Eve, for short—is a gene whose expres-
sion plays an important role in the development of
the Drosophila embryo. If this gene is inactivated by
mutation, many parts of the embryo fail to form and
the fly larva dies early in development. At the stage of
development when Eve is first switched on, the embryo
developing within the egg is still a single, giant cell
containing multiple nuclei afloat in a common cyto-
plasm. This embryo, which is some 400 mm long and
160 mm in diameter, is formed from the fertilized egg
through a series of rapid nuclear divisions that occur
without cell division. Eventually each nucleus will be
enclosed in a plasma membrane and become a cell;
however, the events that concern us happen before this
cellularization.
The cytoplasm of this giant egg is far from uniform: the
anterior (head) end of the embryo contains different pro-
teins from those in the posterior (tail) end. The presence
of these asymmetries in the fertilized egg and the early
embryo was originally demonstrated by experiments in
which Drosophila eggs were made to leak. If the front
end of an egg is punctured carefully and a small amount
of the anterior cytoplasm is allowed to ooze out, the
embryo will fail to develop head segments. Further, if
cytoplasm taken from the posterior end of another egg
is then injected into this somewhat depleted anterior
area, the animal will develop a second set of abdomi-
nal segments where its head parts should have been
(Figure 8–13).

anterior (head) posterior (tail)

normal fertilized egg prick to allow some anterior inject some posterior cytoplasm
cytoplasm to escape from a donor egg into anterior
end of host

embryo develops to larval stage

normal larva double-posterior larva

Figure 8–13 Molecules localized at the ends of the Drosophila egg control its anterior–posterior polarity. a small amount of
cytoplasm is allowed to leak out of the anterior end of the egg and is replaced by an injection of posterior cytoplasm. the resulting
double-tailed embryo (right) shows a duplication of the last three abdominal segments. a normal embryo (left) is shown for comparison.
(adapted from C. Nüsslein-Volhard, h.G. Frohnhöfer, and r. Lehmann, Science 238:1675–1681, 1987. With permission from aaaS.)

Finding the Proteins
This egg-draining experiment shows that the normal
head-to-tail pattern of development is controlled by
substances located at each end of the embryo. And
researchers were betting that these substances were
proteins. To identify them, investigators subjected eggs
to a treatment that would inactivate genes at random.
They then searched for embryos whose head-to-tail
body plan looked abnormal. In these mutant animals,
the genes that were disrupted must encode proteins
that are important for establishing proper anterior–pos-
terior polarity.
Using this approach, researchers discovered many
genes required for setting up anterior–posterior polar-
ity, including genes encoding four key transcription
regulators: Bicoid, Hunchback, Krüppel, and Giant.
(Drosophila genes are often given colorful names that
reflect the appearance of flies in which the gene is inac-
tivated by mutation.) Once these proteins had been
identified, researchers could prepare antibodies that
would recognize each. These antibodies, coupled to flu-
orescent markers, were then used to determine where
in the early embryo each protein is localized (see Panel
1–1, pp. 8–9).
The results of these antibody-staining experiments are
striking. The cytoplasm of the early embryo, it turns out,
contains a mixture of these transcription regulators,
each distributed in a unique pattern along the length of
the embryo (Figure 8–14). As a result, the nuclei inside
this giant, multinucleate cell begin to express different
genes depending on which transcription regulators they
are exposed to, which in turn depends on the location
of each nucleus along the embryo. Nuclei near the ante-
rior end of the embryo, for example, encounter a set
of transcription regulators that is distinct from the set
that bathe nuclei at the posterior end. Thus the differ-
ing amounts of these proteins provide the many nuclei
in the developing embryo with positional information
along the anterior–posterior axis of the embryo.
This is where Eve comes in. The regulatory DNA
sequences of the Eve gene can read the concentrations
of the transcription regulators at each position along
the length of the embryo. Based on this information,
Eve is expressed in seven stripes, each at a precise loca-
tion along the anterior–posterior axis of the embryo.
To find out how these regulatory proteins control the
expression of Eve with such precision, researchers
next set their sights on the regulatory region of the Eve
gene.
Gene regulation—the Story of Eve 283
dissecting the dNA
As we have seen in this chapter, regulatory DNA
sequences control which cells in an organism will
express a particular gene, and at what point that gene
will be turned on. One way to learn when and where
a regulatory DNA sequence is active is to hook the
sequence up to a reporter gene—a gene encoding a
protein whose activity is easy to monitor experimen-
tally. The regulatory DNA sequences will now drive the
expression of the reporter gene. This artificial DNA con-
struct is then reintroduced into a cell or an organism,
and the activity of the reporter protein is measured.
By coupling various portions of the regulatory sequence
of Eve to a reporter gene, researchers discovered that
the Eve gene contains a series of seven regulatory
modules, each of which is responsible for specifying a
single stripe of Eve expression along the embryo. So,
for example, researchers could remove the regulatory
module that specifies stripe 2 from its normal setting
upstream of Eve, place it in front of a reporter gene,
and reintroduce this engineered DNA sequence into the
Drosophila genome (Figure 8–15A). When embryos car-
rying this genetic construct are examined, the reporter
gene is found to be expressed in precisely the position
anterior posterior
Bicoid
Hunchback
Giant
Krüppel
Figure 8–14 The early Drosophila embryo shows a
nonuniform distribution of four transcription regulators.
284 Gene regulation—the Story of Eve

stripe 3 stripe 2 stripe 7

module module module

TATA Eve gene

(A)
(B)

stripe 2 TATA LacZ gene

module
(C) (D)

Figure 8–15 A reporter gene reveals the modular construction of the Eve gene regulatory region. (a) the Eve gene contains
regulatory sequences that direct the production of eve protein in stripes along the embryo. (B) embryos stained with antibodies to
the eve protein show the seven characteristic eve stripes. (C) In this experiment, a 480-nucleotide piece of the Eve regulatory region
(the stripe 2 module from a) is removed and inserted upstream of the E. coli LacZ gene, which encodes the enzyme b-galactosidase
(see Figure 8–9). (D) When the engineered DNa containing a single regulatory region is reintroduced into the genome of a Drosophila
embryo, the resulting embryo expresses b-galactosidase precisely in the position of the second of the seven Eve stripes. enzyme
activity is assayed by the addition of X-gal, a modified sugar that when cleaved by b-galactosidase generates an insoluble blue product.
(B and D, courtesy of Stephen Small and Michael Levine.) ECB3 m7.55/8.15

of stripe 2 (Figure 8–15B). Similar experiments revealed
the existence of other regulatory modules, one for each
of the other six stripes.
The question then becomes: how does each of these
modules direct the formation of a single stripe in a spe-
cific position? The answer, researchers found, is that
each module contains a unique combination of regula-
tory sequences that bind different combinations of the
four transcription regulators that are present in gradi-
ents in the early embryo. The stripe 2 unit, for example,
contains recognition sequences for all four regulators—
Bicoid and Hunchback activate Eve transcription, while
Krüppel and Giant repress it (Figure 8–16). The concen-
trations of these four proteins vary across the embryo
(see Figure 8–14), and these patterns determine which
of the proteins are bound to the Eve stripe 2 module
at each position along the embryo. The combination
of bound proteins then ‘tells’ the appropriate nuclei to
express Eve, and stripe 2 is formed.
The other stripe regulatory modules are thought to func-
tion along similar lines; each module reads positional
information provided by some unique combination of
transcription regulators and expresses Eve on the basis
of this information. The entire gene control region of Eve
is strung out over 20,000 nucleotide pairs of DNA and
binds more than 20 transcription regulators, including
the four discussed here. A large and complex control
region is thereby formed from a series of smaller mod-
ules, each of which consists of a unique arrangement of
short DNA sequences recognized by specific transcrip-
tion regulators. In this way, a single gene can respond to
an enormous number of combinatorial inputs. Eve itself
is a transcription regulator and it—in combination with
many other regulatory proteins—controls key events
later in the development of the fly. This organization
begins to explain how the development of a complex
organism can be orchestrated by repeated applications
of a few basic principles.

stripe 2 module: 480 nucleotide pairs

Krüppel and its Bicoid and its

binding site binding site

Giant and its Hunchback and

binding site its binding site

Figure 8–16 The regulatory module for Eve stripe 2 contains binding sites for four different transcription regulators.
all four regulators are responsible for the proper expression of Eve in stripe 2. Flies that are deficient in the two activators, Bicoid and
hunchback, fail to form stripe 2 efficiently; in flies deficient in either of the two repressors, Giant or Krüppel, stripe 2 expands and
covers an abnormally broad region of the embryo. as indicated in the top diagram, in some cases the binding sites for the transcription
regulators overlap and the proteins compete for binding to the DNa. For example, the binding of Bicoid and Krüppel to the site at the
far right is thought to be mutually exclusive.
 the Molecular Mechanisms that Create Specialized Cell types 285

glucocorticoid glucocorticoid Figure 8–17 A single transcription

receptor in hormone regulator can coordinate the expression
absence of of many different genes. the action of the
glucocorticoid
hormone glucocorticoid receptor is illustrated. On
the left is shown a series of genes, each of
which has various gene activator proteins
bound to its regulatory region. however,
these bound proteins are not sufficient on
their own to activate transcription efficiently.
gene 1 gene 1 On the right is shown the effect of adding
an additional transcription regulator—the
glucocorticoid receptor in a complex
with glucocorticoid hormone—that can
bind to the regulatory sequences of
each gene. the glucocorticoid receptor
gene 2 gene 2 completes the combination of transcription
regulators required for efficient initiation
of transcription, and the genes are now
switched on as a set.

gene 3 gene 3

GENES EXPRESSED AT LOW LEVEL GENES EXPRESSED AT HIGH LEVEL

hormone is no longer present, the expression of all of these genes drops

to its normal level. In this way a single transcription regulator can control
the expression of many different genes (Figure 8–17).

Combinatorial Control Can Create different Cell Types

The ability to switch many different genes on or off using just one protein
is not only useful in the day-to-day regulation of cell function. It is also
one of the means by which eucaryotic cells differentiate into particular
types of cells during embryonic development.
A striking example of the effect of a single transcription regulator on
ECB3 e8.20/8.17
differentiation comes from studying the development of muscle cells. A
mammalian skeletal muscle cell is a highly distinctive cell type. It is typi-
cally an extremely large cell that is formed by the fusion of many muscle
precursor cells called myoblasts. The mature muscle cell is distinguished
from other cells by the production of a large number of characteristic
proteins, such as the actin and myosin that make up the contractile appa-
ratus (discussed in Chapter 17) as well as the receptor proteins and ion
channel proteins in the cell membranes that make the muscle cell sensi-
tive to nerve stimulation. Genes encoding these muscle-specific proteins
are all switched on coordinately as the myoblasts begin to fuse. Studies
of muscle cells differentiating in culture have identified key transcription
regulators, expressed only in potential muscle cells, that coordinate gene
expression and thus are crucial for muscle-cell differentiation. These
regulators activate the transcription of the genes that code for the mus-
cle-specific proteins by binding to specific DNA sequences present in their
regulatory regions.
These key transcription regulators can convert nonmuscle cells to
myoblasts by activating the changes in gene expression typical of dif-
ferentiating muscle cells. For example, when one of these regulators,
MyoD, is artificially expressed in fibroblasts cultured from skin connec-
tive tissue, the fibroblasts start to behave like myoblasts and fuse to form
musclelike cells. The dramatic effect of expressing the MyoD gene in
fibroblasts is shown in Figure 8–18. It appears that the fibroblasts, which
are derived from the same broad class of embryonic cells as muscle cells,
286 Chapter 8 Control of Gene expression

Figure 8–18 Fibroblasts can be converted to muscle cells by a

single transcription regulator. as shown in this immunofluorescence
micrograph, fibroblasts from the skin of a chick embryo have been
converted to muscle cells by the experimentally induced expression
of the MyoD gene. the fibroblasts that expressed the MyoD gene
have fused to form elongated multinucleate musclelike cells, which
are stained green with an antibody that detects a muscle-specific
protein. Fibroblasts that do not express MyoD are barely visible in the
background. (Courtesy of Stephen tapscott and harold Weintraub.)

have already accumulated many of the other necessary transcription

regulators required for the combinatorial control of the muscle-specific
genes, and that addition of MyoD completes the unique combination that
directs the cells to become muscle. Some other cell types fail to be con-
verted to muscle by the addition of MyoD; these cells presumably have
not accumulated the other required transcription regulators during their
developmental history.
How the accumulation of different transcription regulators can lead to
(A)
20 mm the generation of different cell types is illustrated schematically in Figure
8–19. This figure also illustrates how, thanks to the possibilities of com-
binatorial control and shared regulatory DNA sequences, a limited set
of transcription regulators can control the expression of a much larger
number of genes.
The conversion of one cell type (fibroblast) to another (muscle) by a single
transcription regulator emphasizes one of the most important principles
discussed in this chapter: the dramatic differences between cell types—
such as size, shape, and function—are produced by differences in gene
ECB3 m7.75a/8.18 expression.

precursor cell

REGULATORY PROTEIN 1

cell division

REGULATORY REGULATORY
PROTEIN 2 PROTEIN 2

Figure 8–19 Combinations of a few

transcription regulators can generate
many different cell types during
2 1 1 2
development. In this simple scheme a
“decision” to make a new regulator
(shown as a numbered circle) is made
after each cell division. repetition of this REGULATORY REGULATORY REGULATORY REGULATORY
simple rule enables eight cell types PROTEIN 3 PROTEIN 3 PROTEIN 3 PROTEIN 3
(a through h) to be created using only three
different transcription regulators. each of
these hypothetical cell types would then
1 3
express different genes, as dictated by the 3 2 2 3 1 1 3 1 2
2
combination of transcription regulators that
are present within it. cell A cell B cell C cell D cell E cell F cell G cell H
 the Molecular Mechanisms that Create Specialized Cell types 287

Stable Patterns of Gene Expression Can Be Transmitted to

daughter Cells
As discussed earlier in this chapter, once a cell in a multicellular organ-
ism has become differentiated into a particular cell type, it will generally
remain differentiated, and all its progeny cells will remain that same cell
type. Some highly specialized cells never divide again once they have
differentiated; for example, skeletal muscle cells and neurons. But many
other differentiated cells, such as fibroblasts, smooth muscle cells, and
liver cells (hepatocytes), will divide many times in the life of an individ-
ual. All of these cell types give rise only to cells like themselves when
they divide: smooth muscle does not give rise to liver cells, nor liver cells
to fibroblasts.
This preservation of cellular identity means that the changes in gene
expression that give rise to a differentiated cell must be remembered and
passed on to its daughter cells through all subsequent cell divisions. For
example, in the cells illustrated in Figure 8–19, the production of each
transcription regulator, once begun, has to be perpetuated in the daugh-
ter cells of each cell division. How might this be accomplished?
Cells have several ways of ensuring that their daughters “remember”
what kind of cells they are supposed to be. One of the simplest is through
a positive feedback loop, where a key transcription regulator activates
transcription of its own gene in addition to that of other cell-type–specific
genes (Figure 8–20). The MyoD protein discussed earlier functions in such
a positive feedback loop. Another way of maintaining cell type is through
the faithful propagation of a condensed chromatin structure from parent
to daughter cell. We saw an example of this in Figure 5–30, where the
same X chromosome is inactive through many cell generations.
A third way in which cells can transmit information about gene expres-
sion to their progeny is through DNA methylation. In vertebrate cells,
DNA methylation occurs exclusively on cytosine bases (Figure 8–21). This
covalent modification of cytosines generally turns off genes by attract-
ing proteins that block gene expression. DNA methylation patterns are
passed on to progeny cells by the action of an enzyme that copies the
methylation pattern on the parent DNA strand to the daughter DNA strand
immediately after replication (Figure 8–22). Because each of these mech-
anisms—positive feedback loops, certain forms of condensed chromatin,

A
A

A the effect of
the transient signal
is remembered in
all of the cell's
A descendants
A

A
TRANSIENT Figure 8–20 A positive feedback loop
SIGNAL can create cell memory. protein a is a
protein A TURNS ON A
EXPRESSION transcription regulator that activates its
is not made
because it is OF PROTEIN A own transcription. all of the descendants of
normally required the original cell will therefore “remember”
for its own A that the progenitor cell had experienced a
A

A
transcription
transient signal that initiated the production
of the protein.
288 Chapter 8 Control of Gene expression

cytosine 5-methylcytosine and DNA methylation—transmits information from parent to daughter

H H H H cell without altering the actual nucleotide sequence of the DNA, they are
N N considered forms of epigenetic inheritance (see p. 192).
H H 3C
5 4 3N N
The Formation of an Entire Organ Can Be Triggered by a
6 1 2 methylation
H N O H N O Single Transcription Regulator
We have seen that even though combinatorial control is the norm for
Figure 8–21 Formation of 5-methylcytosine
eucaryotic genes, a single transcription regulator can be decisive in
occurs by methylation of a cytosine base switching a whole set of genes on or off, and can convert one cell type
in the DNA double helix. In vertebrates this into another. A dramatic extension of this principle comes from studies
event is confined to selected cytosine (C) of eye development in Drosophila, mice, and humans. Here, a transcrip-
nucleotides that fall next to a guanine (G). tion regulator, called Ey in flies and Pax-6 in vertebrates, is crucial for
eye development. When expressed in the proper type of cell, Ey can trig-
ger the formation of not just a single cell type but a whole organ—the
eye—composed of different types of cells all properly organized in three-
dimensional space.
The best evidence for the action of Ey comes from experiments in fruit
flies in which the Ey gene is artificially expressed early in development
in cells that normally go on to form legs. This abnormal gene expres-
sion causes eyes to develop in the middle of the legs (Figure 8–23). The
Drosophila eye is composed of thousands of cells, and how the Ey pro-
tein coordinates the specification of each cell in the eye is an actively
studied topic in developmental biology. Here, we shall simply note that
Ey directly controls the expression of many genes by binding to DNA
sequences in their regulatory regions. Some of the genes controlled by
Ey encode additional transcription regulators that, in turn, control the
expression of other genes. Moreover, some of these regulators act back
on Ey itself to create a positive feedback loop that ensures the continued
production of the Ey protein. So the action of just one transcription regu-
lator can produce a cascade of regulators whose combined actions lead
ECB3 m7.79/8.21
to the formation of an organized group of many different types of cells.
One can begin to imagine how, by repeated applications of this principle,
a complex organism is built piece by piece.

CH3 CH3
METHYLATION
OF NEWLY
A C G T A T C G T A C G T A T C G T
5¢ 3¢ SYNTHESIZED 5¢ 3¢
methylated STRAND
cytosine
unmethylated 3¢ 5¢ 3¢ 5¢
cytosine CH3 T G C A T A G C A T G C A T A G C A

A C G T A T C G T DNA H3C
5¢ 3¢
REPLICATION not recognized recognized by
by maintenance maintenance
3¢ 5¢ methyltransferase methyltransferase
T G C A T A G C A
METHYLATION CH3
H3C OF NEWLY
A C G T A T C G T SYNTHESIZED A C G T A T C G T
5¢ 3¢ STRAND 5¢ 3¢

3¢ 5¢ 3¢ 5¢
T G C A T A G C A T G C A T A G C A

H3C H3C

Figure 8–22 DNA methylation patterns can be faithfully inherited. an enzyme called a maintenance methyltransferase guarantees that
once a pattern of DNa methylation has been established, it is inherited by progeny DNa. Immediately after replication, each daughter
helix will contain one methylated DNa strand—inherited from the parent helix—and one unmethylated, newly synthesized strand. the
maintenance methyltransferase interacts with these hybrid helices, where it methylates only those CG sequences that are base-paired with
a CG sequence that is already methylated. In vertebrate DNa, a large portion of the cytosines in CG sequences are methylated.
 post-transcriptional Controls 289

fly in which the Ey gene is artificially

normal fly expressed in leg precursor cells
(red shows cells expressing the Ey gene)
group of cells group of cells
that give rise to that give rise to
an adult eye an adult leg

Drosophila
larva

Drosophila
adult

eye structure
formed on leg

(A) (B)
Figure 8–23 Expression of the Drosophila Ey gene in the precursor cells of the leg triggers the development
of an eye on the leg. (a) Simplified diagrams showing the result when a fruit fly larva contains either the normally
expressed Ey gene (left) or an Ey gene that is additionally expressed artificially in cells that will give rise to legs
(right). (B) photograph of an abnormal leg that contains a misplaced eye. (B, courtesy of Walter Gehring.)

POST-TRANSCRIPTIONAL CONTROLS
ECB3 m7.77/8.23

We have seen that transcription regulators control gene expression by

switching on or off transcription initiation. The vast majority of genes
in all organisms are regulated in this way. But additional points of con-
trol can come into play later in the pathway from DNA to protein, giving
cells a further opportunity to manage the amount of gene product that
is made. These post-transcriptional controls, which operate after RNA
polymerase has bound to a gene’s promoter and started to synthesize
RNA, are crucial for the regulation of many genes.
In Chapter 7, we described one type of post-transcriptional control: alter-
native splicing, which allows different forms of a protein to be made in
different tissues (Figure 7–21). Here we discuss a few more examples of
the many ways in which cells can manipulate gene expression after tran-
scription has begun.

Riboswitches Provide An Economical Solution to Gene

Regulation
The mechanisms for controlling gene expression we have described
thus far all involve the participation of a regulatory protein. But scien-
tists have recently discovered a number of mRNAs that can regulate their
own transcription and translation. These self-regulating mRNAs contain
riboswitches: short sequences of RNA that change their conformation
when bound to small molecules such as metabolites. Many riboswitches
have been discovered, and each recognizes a specific small molecule.
The conformational change that is driven by the binding of that molecule
can regulate gene expression (Figure 8–24). This mode of gene regulation
is particularly common in bacteria, where riboswitches sense key small
metabolites in the cell and adjust gene expression accordingly.
Riboswitches are perhaps the most economical examples of gene control
devices, because they bypass the need for regulatory proteins altogether.
The fact that short sequences of RNA can form such highly efficient gene
290 Chapter 8 Control of Gene expression
GUANINE IS SCARCE
mRNA
actively transcribing
RNA polymerase
GENES FOR PURINE
(A)
BIOSYNTHESIS ON
Figure 8–24 A riboswitch controls purine
biosynthesis genes in bacteria. (a) When
guanine is scarce, the riboswitch adopts a
structure that allows the elongating rNa
polymerase, which has already initiated
transcription, to continue transcribing into
the purine biosynthetic genes. the enzymes
needed for guanine synthesis are thereby
expressed. (B) When guanine is abundant,
it binds to the riboswitch, causing it to
undergo a conformational change. the new
conformation includes a double-stranded
structure (red) that forces the polymerase to
terminate transcription before it reaches the
purine biosynthetic genes. In the absence
of guanine, formation of this double-
stranded structure is blocked because one
of the rNa strands that forms it pairs with a
different region of the riboswitch (a). In this
example, the riboswitch blocks completion
of an mrNa. Other riboswitches control
translation of mrNa molecules once they
have been synthesized. (adapted from
M. Mandal and r.r. Breaker, Nat. Rev. Mol.
Cell Biol. 5:451–63, 2004. With permission
from Macmillan publishers Ltd.)
GUANINE IS PLENTIFUL
1 guanine binds to riboswitch
3 new structure
terminates transcription
G
transcription
terminator
2 riboswitch changes
conformation
GENES FOR PURINE
(B)
BIOSYNTHESIS OFF
control devices offers further evidence that, before modern cells arose, a
world run by RNAs may have reached a high level of sophistication (see
pp. 261–264).
The untranslated Regions of mRNAs Can Control Their
Translation
Once an mRNA has been synthesized, one of the most common ways of
regulating how much of its protein product is made is to control the ini-
tiation of translation. Although the details of translation initiation differ
between eucaryotes and bacteria, both use the same basic strategies for
regulating gene expression at this step.
Bacterial mRNAs contain a short ribosome-binding sequence located a
few nucleotides upstream of the AUG codon where translation begins.
This recognition sequence forms base pairs with the RNA in the small
ribosomal subunit, correctly positioning the initiating AUG codon within
the ribosome. Because this interaction is needed for efficient translation
initiation, it provides an ideal target for translational control. By block-
ing—or exposing—the ribosome recognition sequence, the bacterium can
either inhibit—or promote—the translation of an mRNA (Figure 8–25).
ECB3 m7.93/8.24
Eucaryotic mRNAs possess a 5¢ cap that helps guide the ribosome to
the first AUG, the codon where translation will start (see Figure 7–35).
In eucaryotic cells, repressors can inhibit translation initiation by bind-
ing to specific RNA sequences in the 5¢ untranslated region of the mRNA
and keeping the ribosome from finding the first AUG. When conditions
change, the cell can inactivate the repressor and thereby increase trans-
lation of the mRNA.
Small Regulatory RNAs Control the Expression of
Thousands of Animal and Plant Genes
As we saw in Chapter 7, RNAs perform many critical tasks in cells. In
addition to acting as intermediate carriers of genetic information, they
play key structural and catalytic roles, particularly in protein synthesis
(see pp. 253–254). But a recent series of striking discoveries has revealed
that noncoding RNAs—those that do not direct the production of a pro-
tein product—are far more prevalent than previously imagined and play
unanticipated, widespread roles in regulating gene expression.
One particularly important type of noncoding RNA, found in plants and
animals, is called microRNA (miRNA). Humans, for example, produce
more than 400 different miRNAs, which seem to regulate at least one-
third of all protein-coding genes. These short, regulatory RNAs control
gene expression by base-pairing with specific mRNAs and controlling
their stability and their translation.
 post-transcriptional Controls 291

Like other noncoding RNAs, such as tRNA and rRNA, the precursor
miRNA transcript undergoes a special type of processing to yield the
mature miRNA. This miRNA is then assembled with specialized proteins
to form an RNA-induced silencing complex (RISC). The RISC patrols the
cytoplasm, searching for mRNAs that are complementary to the miRNA
it carries (Figure 8–26). Once a target mRNA forms base pairs with an
miRNA, it is destroyed immediately by a nuclease present within the RISC
or else its translation is blocked and it is delivered to a region of the
cytoplasm where other nucleases will eventually degrade it. Once the
Figure 8–25 Gene expression can be
RISC has taken care of an mRNA molecule, it is released and is free to
controlled by regulating translation
seek out additional mRNA molecules. Thus a single miRNA—as part of initiation. (a) Sequence-specific rNa-
a RISC—can eliminate one mRNA molecule after another, thereby effi- binding proteins can repress the translation
ciently blocking production of the protein that the mRNA encodes. of specific mrNas by keeping the ribosome
from binding to the ribosome-recognition
Two features of miRNAs make them especially useful regulators of gene sequence (orange) found at the start of
expression. First, a single miRNA can regulate a whole set of different a bacterial protein-coding gene. Some
mRNAs so long as the mRNAs carry a common sequence; these sequences ribosomal proteins use this mechanism to
are often located in their 5¢ and 3¢ untranslated regions. In humans, some inhibit the translation of their own mrNa.
(B) an mrNa from the pathogen Listeria
individual miRNAs control hundreds of different mRNAs in this manner. monocytogenes contains a ‘thermosensor’
Second, a gene that encodes an miRNA occupies relatively little space in rNa sequence that controls the translation
the genome compared with one that encodes a transcription regulator. of a set of virulence genes. at the warmer
Indeed, their small size is one reason that miRNAs were discovered only temperature that the bacterium encounters
recently. Although we are only beginning to understand the full impact inside its human host, the thermosensor
sequence is denatured and the virulence
of miRNAs, it is clear that they represent a critical part of the cell’s equip- genes are expressed. (C) Binding of a small
ment for regulating the expression of its genes. molecule to a riboswitch causes a structural
rearrangement of the rNa, sequestering
RNA Interference destroys double-Stranded Foreign the ribosome-recognition sequence
and blocking translation initiation. (D) a
RNAs complementary, ‘antisense’ rNa produced
Some of the proteins that process and package miRNAs also serve as by another gene base-pairs with a specific
mrNa and blocks its translation. although
a cell defense mechanism: they orchestrate the destruction of ‘foreign’ these examples of translational control are
RNA molecules, specifically those that are double-stranded. Many virus- from bacteria, many of the same principles
es—and transposable genetic elements—produce double-stranded RNA operate in eucaryotes.

ribosome-binding site
AUG

AUG PROTEIN NO PROTEIN

5¢ 3¢ 5¢ 3¢
MADE MADE
mRNA
INCREASED
TEMPERATURE
translation repressor protein
AUG PROTEIN
5¢ 3¢
AUG NO PROTEIN MADE
5¢ 3¢
MADE
(A) (B)

5¢
AUG PROTEIN AUG PROTEIN
3¢ 5¢ 3¢ MADE
MADE

small molecule

AUG
AUG

5¢ 3¢ NO PROTEIN
NO PROTEIN MADE
3¢
5¢ MADE 3¢ antisense RNA 5¢
(C) (D)
292 Chapter 8 Control of Gene expression

Figure 8–26 An miRNA targets a precursor

complementary mRNA transcript for miRNA
destruction. the precursor mirNa is AAAAA
processed to form a mature mirNa. It NUCLEUS
then assembles with a set of proteins into
a complex called rISC. the mirNa then CYTOSOL
guides the rISC to mrNas that have a PROCESSING AND
complementary nucleotide sequence. EXPORT TO CYTOPLASM
Depending on how extensive the region RISC
of complementarity is, the target mrNa is proteins
either rapidly degraded by a nuclease within
the rISC or transferred to an area of the FORMATION OF RISC
cytoplasm where other cellular nucleases
will destroy it. single-stranded miRNA
3¢ 5¢

SEARCH FOR COMPLEMENTARY

TARGET mRNA

extensive match less extensive match

mRNA mRNA
AAAAA AAAAA

mRNA TRANSLATION REDUCED;

RAPIDLY mRNA SEQUESTERED AND
DEGRADED
RISC released EVENTUALLY DEGRADED

some time in their life cycles. This targeted RNA degradation mechanism,
called RNA interference (RNAi), helps to keep these potentially danger-
ous invaders in check.
The presence of foreign, double-stranded RNA in the cell triggers RNAi by
first attracting a protein complex containing a nuclease called Dicer. Dicer
cleaves the double-stranded RNA into short fragments (approximately
ECB3 m7.112/8.26
23 nucleotide pairs in length) called small interfering RNAs (siRNAs).
These short, double-stranded RNAs are then incorporated into RISCs, the
same complexes that can carry miRNAs. The RISC discards one strand of
the siRNA duplex and uses the remaining single-stranded RNA to locate
a complementary foreign RNA molecule (Figure 8–27). This target RNA
molecule is then rapidly degraded, leaving the RISC free to search out
more of the same foreign RNA molecules.
RNAi is found in a wide variety of organisms, including single-celled
fungi, plants, and worms, indicating that it is evolutionarily ancient. In
some organisms, including plants, the RNAi activity can spread from tis-
sue to tissue by the movement of RNA between cells. This RNA transfer
allows the entire plant to become resistant to a virus after only a few of
its cells have been infected. In a broad sense, the RNAi response resem-
bles certain aspects of the human immune system. In both cases, an
infectious organism elicits the production of ‘attack’ molecules (either
siRNAs or antibodies) that are custom designed to inactivate the invader
and thereby protect the host.

Scientists Can use RNA Interference to Turn Off Genes

The discovery of miRNAs, siRNAs, and the mechanism of RNAi has been
greeted with great enthusiasm. In a practical sense, RNAi has become
 essential Concepts 293

Figure 8–27 siRNAs destroy foreign RNAs. Double-stranded rNas foreign double-stranded RNA
from a virus or transposable genetic element are first cleaved by a
nuclease called Dicer. the resulting double-stranded fragments are
incorporated into rISCs, which discard one strand of the duplex and CLEAVAGE BY DICER
use the other strand to locate and destroy complementary rNas. this
mechanism forms the basis for rNa interference (rNai).
siRNAs

a powerful experimental tool that allows scientists to inactivate almost RISC

any gene in cultured cells or, in some cases, a whole plant or animal. We proteins FORMATION OF RISC
discuss how this method is being used to help determine the function of
individual genes in Chapter 10. single-stranded siRNA
At the same time, RNAi shows real potential as a powerful new approach
for treating human disease. Because many human disorders result from
the inappropriate expression of genes, the ability to turn these genes off
SEARCH FOR
by introducing complementary siRNA molecules holds great medical COMPLEMENTARY
promise. RNA

Finally, the discovery that RNAs play such a key role in controlling gene foreign RNA
expression expands our understanding of the types of regulatory networks
that cells have at their command. One of the great challenges of biology
in this century will be to determine how these networks cooperate to
RNA DEGRADED
specify the development of complex organisms, including ourselves.
RISC
released
ESSENTIAL CONCEPTS
• A typical eucaryotic cell expresses only a fraction of its genes, and
the distinct types of cells in multicellular organisms arise because
different sets of genes are expressed as cells differentiate.
• Although all of the steps involved in expressing a gene can in prin-
ciple be regulated, for most genes the initiation of transcription is the
most important point of control.
• The transcription of individual genes is switched on and off in cells
by transcription regulators. These act by binding to short stretches of
DNA called regulatory DNA sequences.
• Although each transcription regulator has unique features, most bind
to DNA using one of a small number of structural motifs. The precise
amino acid sequence that is folded into the DNA-binding motif deter-
mines the particular DNA sequence that is recognized.
• In bacteria, transcription regulators usually bind to regulatory DNA
sequences close to where RNA polymerase binds. They can either
activate or repress transcription of the gene. In eucaryotes, regula-
tory DNA sequences are often separated from the promoter by many
thousands of nucleotide pairs.
ECB3 m7.115i/8.27
• Eucaryotic transcription regulators act in two fundamental ways:
(1) they can directly affect the assembly process of RNA polymerase
and the general transcription factors at the promoter, and (2) they
can locally modify the chromatin structure of promoter regions.
• In eucaryotes, the expression of a gene is generally controlled by a
combination of transcription regulators.
• In multicellular plants and animals, the production of different tran-
scription regulators in different cell types ensures the expression of
only those genes appropriate to the particular type of cell.
• Cells in multicellular organisms have mechanisms that enable their
progeny to ‘remember’ what type of cell they should be.
• A single transcription regulator, if expressed in the appropriate pre-
cursor cell, can trigger the formation of a specialized cell type or
even an entire organ.
294 Chapter 8 Control of Gene expression

• Cells can also regulate gene expression by controlling events that

occur after transcription has begun. Many of these mechanisms
rely on RNA molecules that can influence their own transcription or
translation.
• MicroRNAs (miRNAs) control gene expression by base-pairing with
specific mRNAs and regulating their stability and their translation.
• Cells have a defense mechanism for destroying ‘foreign’ double-
stranded RNAs, many of which are produced by viruses. Scientists
can take advantage of this mechanism, called RNA interference, to
inactivate genes of interest by simply injecting cells with double-
stranded RNAs that target the mRNAs produced by those genes.

Key terms
activator post-transcriptional control
combinatorial control regulatory dNA
NA sequence
differentiation reporter gene
dNA methylation repressor
epigenetic inheritance riboswitch
gene expression RNA interference (RNAi)
microRNA (miRNA) small interfering RNA (siRNA)
positive feedback loop transcription regulator

QuESTIONS QuESTION 8–6

Which of the following statements are correct? Explain your
QuESTION 8–4 answers.
A virus that grows in bacteria (bacterial viruses are called A. In bacteria, but not in eucaryotes, most mRNAs encode
bacteriophages) can replicate in one of two ways. In the more than one protein.
prophage state, the viral dNA is inserted into the bacterial
B. most dNA-binding proteins bind to the major groove of
chromosome and is copied along with the bacterial genome
the double helix.
each time the cell divides. In the lytic state, the viral dNA
is released from the bacterial chromosome and replicates cI protein
many times in the cell. This viral dNA then produces
viral coat proteins that together with the replicated viral
dNA form many new virus particles that burst out of the
bacterial cell. These two forms of growth are controlled by
two transcription regulators, called cI (“c one”) and Cro, cI gene Cro gene
that are encoded by the virus. In the prophage state, cI is
expressed; in the lytic state, Cro is expressed. In addition
to regulating the expression of other genes, cI represses PROPHAGE NO Cro GENE
the Cro gene, and Cro represses the cI gene (Figure Q8–4). STATE TRANSCRIPTION

When bacteria containing a phage in the prophage state

are briefly irradiated with uV light, cI protein is degraded.
A. What will happen next?
Cro protein
B. Will the change in (A) be reversed when the uV light is
switched off?
C. Why might this response to uV light have evolved? cI gene Cro gene

QuESTION 8–5
(True/False) When the nucleus of a fully differentiated NO cI GENE LYTIC
TRANSCRIPTION STATE
carrot cell is injected into a frog egg whose nucleus has
been removed, the injected donor nucleus is capable of
programming the recipient egg to produce a normal carrot.
Explain your answer. Figure Q8–4

C. Of the major control points in gene expression
(transcription, RNA processing, RNA transport, translation,
and control of a protein’s activity), transcription initiation is
one of the most common.
d. The zinc atoms in dNA-binding proteins that contain
zinc finger domains contribute to the binding specificity
through sequence-specific interactions that they form with
the bases.
QuESTION 8–7
your task in the laboratory of Professor Quasimodo is
to determine how far an enhancer (a binding site for an
activator protein) could be moved from the promoter
of the straightspine gene and still activate transcription.
you systematically vary the number of nucleotide pairs
between these two sites and then determine the amount of
transcription by measuring the production of Straightspine
mRNA. At first glance, your data look confusing (Figure
Q8–7). What would you have expected for the results of
this experiment? Can you save your reputation and explain
these results to Professor Quasimodo?
amount of mRNA produced
50 60 70 80 90
number of nucleotides between enhancer and promoter
Figure Q8–7
QuESTION 8–8
many transcription regulators form dimers of identical
ECB2 EQ8.11/Q8.05
subunits. Why is this advantageous? describe three
structural motifs that are often used to contact dNA. What
are the particular features that suit them for this purpose?
QuESTION 8–9
The l repressor binds as a dimer to critical sites on the
l genome to repress the virus’s lytic genes. This is
necessary to maintain the prophage (integrated) state.
Each molecule of the repressor consists of an N-terminal
dNA-binding domain and a C-terminal dimerization domain
(Figure Q8–9). upon induction (for example, by irradiation
C
C C
C + avidin
N +
N N
N
repressor monomers repressor dimer
Figure Q8–9
end-of-Chapter Questions 295
with uV light), the genes for lytic growth are expressed,
l progeny are produced, and the bacterial cell is lysed (see
Question 8–4). Induction is initiated by cleavage of the
l repressor at a site between the dNA-binding domain
and the dimerization domain, which causes the repressor
to dissociate from the dNA. In the absence of bound
repressor, RNA polymerase binds and initiates lytic growth.
Given that the number (concentration) of dNA-binding
domains is unchanged by cleavage of the repressor, why do
you suppose its cleavage results in its dissociation from the
dNA?
QuESTION 8–10
The enzymes for arginine biosynthesis are located at
several positions around the genome of E. coli, and they
are regulated coordinately by a transcription regulator
encoded by the ArgR gene. The activity of ArgR is
modulated by arginine. upon binding arginine, ArgR
alters its conformation, dramatically changing its affinity
for the dNA sequences in the promoters of the genes for
the arginine biosynthetic enzymes. Given that ArgR is a
repressor protein, would you expect that ArgR would bind
more tightly or less tightly to the dNA sequences when
arginine is abundant? If ArgR functioned instead as an
activator protein, would you expect the binding of arginine
to increase or to decrease its affinity for its regulatory dNA
sequences? Explain your answers.
QuESTION 8–11
When enhancers were initially found to influence
transcription many thousands of nucleotide pairs from
100 110 the promoters they control, two principal models were
invoked to explain this action at a distance. In the ‘dNA
looping’ model, direct interactions between proteins bound
at enhancers and promoters were proposed to stimulate
transcription initiation. In the ‘scanning’ or ‘entry-site’
model, RNA polymerase (or another component of the
transcription machinery) was proposed to bind at the
enhancer and then scan along the dNA until it reached
the promoter. These two models were tested using an
enhancer on one piece of dNA and a b-globin gene and
promoter on a separate piece of dNA (Figure Q8–11).
The b-globin gene was not expressed from the mixture
of pieces. However, when the two segments of dNA
were joined via a protein linker, the b-globin gene was
expressed.
does this experiment distinguish between the dNA
looping model and the scanning model? Explain your
answer.
biotin attached to one end of
each DNA molecule
enhancer b-globin gene
C C cleavage
site
N N transcription
DNA-binding site enhancer promoter b-globin gene
Figure Q8–11
296 Chapter 8 Control of Gene expression

QuESTION 8–12 (A) CELL I

A
differentiated cells of an organism contain the same genes. OFF transient
signal A
(Among the few exceptions to this rule are the cells of A A A
the mammalian immune system, in which the formation of gene activator turns on transcription activator protein
specialized cells is based on limited rearrangements of the of activator mRNA turns on its own
genome.) describe an experiment that substantiates the transcription
first sentence of this question, and explain why it does. (B) CELL II
R
QuESTION 8–13 OFF transient
signal R
Figure 8–19 shows a simple scheme by which three R R R
gene repressor turns on transcription repressor protein
transcription regulators are used during development
of repressor mRNA turns off its own
to create eight different cell types. How many cell types transcription
could you create, using the same rules, with four different
transcription regulators? As described in the text, myod is Figure Q8–14
a transcription regulator that by itself is sufficient to induce
muscle-specific gene expression in fibroblasts. How does
this observation fit the scheme in Figure 8–19?

QuESTION 8–14 QuESTION 8–15

Imagine the two situations shown in Figure Q8–14. In
cell I, a transient signal induces the synthesis of protein
A, which is a gene activator that turns on many genes
including its own. In cell II, a transient signal induces the
synthesis of protein R, which is a gene repressor that turns
off many genes including its own. In which, if either, of
these situations will the descendants of the original cell
“remember” that the progenitor cell had experienced the
transient signal? Explain your reasoning.
discuss the following argument: “If the expression of every
gene depends on a set of transcription regulators, then the
expression of these regulators must also depend on the
expression of other regulators, and their expression must
depend on the expression of still other regulators, and so
on. Cells would therefore need an infinite number of genes,
most of which would code for transcription regulators.”
How does the cell get by without having to achieve the
impossible?

Figure 07-34

Problem 07-52
Chapter NINE 9
How Genes and Genomes
Evolve

No two people are exactly alike. Look at any crowd in a classroom or on GENERATING GENETIC
a bus: each individual differs in a host of heritable characteristics—in hair VARIATION
color, eye color, skin color, height, build, and so on (Figure 9–1). Although
we are all members of the same species, plainly our genomes do not con-
tain exactly the same information. RECONSTRUCTING LIFE’S
Such differences in the nucleotide sequences between one organism and FAMILY TREE
the next provide the raw material upon which evolution works. Sculpted
by selective pressures over billions of cell generations since the begin- EXAMINING THE HUMAN
ning of life on Earth, these variations have given rise to the spectacular
GENOME
menagerie of present-day life forms, from bacteria to whales. The diversity
of species thus depends on a delicate balance between the conservative
accuracy of DNA replication that enables progeny to inherit the virtues of
their parents, and the errors of genome replication and maintenance that
allow organisms to ‘try out’ novel features and evolve new capabilities. If
this balance had been struck differently, the whole history of life on Earth
would have been different.
In this chapter, we discuss how genes and genomes change over time.
We examine the molecular mechanisms by which genetic changes occur,
and we consider how the information in present-day genomes can be
deciphered to yield a historical record of the evolutionary processes that
have shaped them. We end the chapter by taking a closer look at the
human genome to see what our own DNA sequences tell us about who
we are and where we come from.
Figure 9–1 A group of English schoolchildren reflects the concept
of variation. Small differences in nucleotide sequence account for
differences in appearance between one individual and the next.
298 Chapter 9 how Genes and Genomes evolve

GENERATING GENETIC VARIATION

Evolution works on the DNA sequences that each organism inherits from
its ancestors: there is no natural mechanism for making long stretches
of entirely novel nucleotide sequences. In this sense, no gene—or
genome—is ever truly new. Evolution is more a tinkerer than an inven-
tor: the astonishing diversity in form and function that we see in living
systems is all the result of variations on preexisting themes.
As these variations pile up, over millions of generations, the cumulative
effect can be radical change. Several basic types of genetic change are
especially crucial in evolution (Figure 9–2):
• Mutation within a gene: an existing gene can be modified by muta-
tions that change single nucleotides or that delete or duplicate
one or more nucleotides. These mutations can alter the activity
or stability of a protein, change its location in the cell, or affect its
interactions with other proteins.
• Mutation within the regulatory DNA of a gene: when and where a
gene is expressed can be affected by mutations in the stretches of
DNA sequence that regulate its activity (described in Chapter 8).
For example, humans and fish have a surprisingly large number of
genes in common, but changes in the regulation of those shared
genes underlie many of the most dramatic differences between
those species.
• Gene duplication: an existing gene, a larger segment of DNA, or
even a whole genome can be duplicated, creating a set of closely

ORIGINAL GENOME GENETIC INNOVATION

MUTATION mutation
WITHIN A GENE

gene

regulatory MUTATION IN
DNA REGULATORY REGION

gene mutation

mRNA
GENE
DUPLICATION

gene

gene A EXON
SHUFFLING
+ +

gene B

organism A

Figure 9–2 Genes and genomes HORIZONTAL

can be altered by several different TRANSFER
mechanisms. Small mutations,
duplications, deletions, rearrangements,
and even the infusion of fresh genetic
material all contribute to genome organism B organism B with
evolution. new gene
 Generating Genetic Variation 299

related genes within a single cell. As this cell and its progeny
divide, the original gene and its duplicate can acquire additional
mutations and assume functions and patterns of expression dis-
tinct from each other and from the ancestral gene.
• Exon shuffling: two or more existing genes can be broken and
rejoined to make a hybrid gene containing DNA segments that
originally belonged to separate genes. In eucaryotes, the break-
ing and rejoining often occurs within the long intron sequences.
Because these sequences are eventually removed by RNA splicing,
the breaking and joining do not have to be precise to result in a
functional gene.
• Horizontal gene transfer: a piece of DNA can be transferred from
the genome of one cell to that of another—even to that of another
species. This process, rare among eucaryotes but common among
procaryotes, differs from the usual “vertical” transfer of genetic
information from parent to progeny.
Each of these forms of genetic variation—from the simple mutations that
occur within a gene to the more extensive duplications, deletions, re-
arrangements, and additions that occur within a genome—has played
an important part in the evolution of modern organisms. And they still Question 9–1

?
play that part today, as organisms continue to evolve. In this section, we In this chapter it is argued that
discuss these basic mechanisms of genetic change, and we consider their genetic variability is beneficial for
consequences for genome evolution. But first, we pause to consider the a species because it enhances that
complications of sex—the mechanism that many organisms use to pass species’ ability to adapt to changing
genetic information on to future generations. conditions. Why, then, does a cell
go to great lengths to ensure the
In Sexually Reproducing Organisms, Only Changes to the fidelity of DNA replication?
Germ Line Are Passed Along To Progeny
For bacteria and other unicellular organisms that reproduce asexually,
the inheritance of genetic information is fairly straightforward. Each
individual copies its genome and then splits in two, giving rise to two
daughters. Such organisms have a family tree that is simply a branching
diagram of cell divisions directly linking each individual to its progeny
and to its ancestors.
For a multicellular organism that reproduces sexually, the family connec-
tions are considerably more complex. For a start, sex mixes and matches
the genomes of two individuals to generate offspring that are genetically
distinct from either parent. It also makes use of genetic ambassadors—
cells designed specifically to carry a copy of the individual’s genome to
the next generation. These specialized reproductive cells—the germ cells
or gametes—come together during fertilization to give rise to a new indi-
vidual (as we discuss in Chapter 19). All the other cells of the body—the
somatic cells—are doomed to die without leaving descendants of their
own (Figure 9–3). The cell lineage that gives rise to the germ cells is called
the germ line, and it is through a series of germ-line cell divisions that
every organism traces its descent back to its ancestors and, ultimately,
back to the ancestors of us all—the first cells that existed, at the origin of
life more than 3.5 billion years ago. In this sense, somatic cells exist only
to help the germ line survive and propagate.
All this means that a mutation is passed on to the next generation only
if it occurs in a germ-line cell. A mutation that occurs in a somatic cell—
although it might have unfortunate consequences for the individual in
which it occurs (causing cancer, for example)—is not transmitted to the
organism’s offspring (Figure 9–4). Thus, in tracking the genetic changes
that accumulate during evolution, we must concentrate on events that
occur in the germ line.
300 Chapter 9 how Genes and Genomes evolve

Figure 9–3 Germ-line cells and somatic germ cell

cells have fundamentally different
functions. In sexually reproducing
organisms, genetic information is germ-line cells germ-line cells
propagated into the next generation by
specialized cells called germ-line cells
germ zygote zygote
(red). these give rise to the reproductive cell
cells—the germ cells (red half circles). Germ
cells are shown as half circles because they
contain only half the genetic complement
of the other cells in the body (full circles).
When two germ cells come together during
fertilization, they form a fertilized egg or
zygote (purple) that once again contains a
full set of chromosomes. this gives rise to
more germ-line cells and to somatic cells somatic cells somatic cells
(blue). Somatic cells form the body of the
organism but do not contribute their DNa PARENT OFFSPRING
to the next generation.

Although sexual reproduction involves the mixing of genomes—which

influences how genetic variations are propagated—many of the basic
mechanisms that generate genetic change are the same for both sexually
and asexually reproducing organisms, as we now discuss.

Point Mutations Are Caused by Failures of the Normal

ECB3 e9.01/9.02

Mechanisms for Copying and Maintaining DNA

Despite the elaborate mechanisms that exist to faithfully copy and main-
tain DNA sequences, each nucleotide pair in an organism’s genome runs
a certain small risk of changing each time a cell divides. Changes that
affect a single nucleotide pair are called point mutations. These typically
arise from rare errors in DNA replication or repair (discussed in Chapter
6, pp. 211–217).
The nucleotide mutation rate has been determined directly in experi-
ments with bacteria such as E. coli. Under laboratory conditions, E. coli
divides about once every 20–25 minutes; in less than a day, a single E.
coli can produce more descendants than there are humans on Earth—
enough to provide a good chance for almost any conceivable point
mutation to occur. A culture containing 109 E. coli cells thus harbors mil-
lions of mutant cells whose genomes differ subtly from the ancestor cell.
Some of these mutations may confer a selective advantage on individual
cells: resistance to a poison, for example, or the ability to survive when
deprived of a standard nutrient. By exposing the culture to a selective

germ cell

germ-line cells germ-line cells

A

germ zygote zygote

cell mutations
Figure 9–4 Mutations in germ-line
cells and somatic cells have different B
consequences. Mutations that occur in
germ-line cells (a) can be passed on to
progeny (green). those that arise in somatic
cells (B) affect only the individual in which
they occur (orange) and are not passed on
to that individual’s progeny. as we discuss
in Chapter 20, somatic mutations are somatic cells somatic cells
responsible for most human cancers
PARENT OFFSPRING
(see p. 719).
 Generating Genetic Variation 301

mutant E. coli cell medium lacking

that cannot grow histidine rare colony of His+ mutant
in the absence of SAMPLE OF CELLS
cells that can grow in
histidine (His–) CELLS DIVIDE, SPREAD ON
absence of histidine
INNOCULATE CULTURE MUTATIONS ARISE PETRI DISH

MUTATION IN His– cell in rich medium, bacteria in which REVERSION MUTATION

which includes different mutations IN His+ CELL
TGA inactive histidine, bacteria have occurred
His begin to multiply TG G active
ACT gene His
ACC gene
Figure 9–5 Mutation rates can be measured in the laboratory. In this
UGA mRNA experiment, an E. coli strain that carries a deleterious point mutation
stop codon in a gene needed to manufacture the amino acid histidine is used. UGG mRNA
mutation eliminates as long as histidine is supplied in the growth medium, this strain can
enzyme required to grow and divide normally. If a large culture of this strain is grown (say
make histidine 1010 cells) and is spread on an agar plate that lacks histidine, the great Trp protein
majority of cells will die. the rare survivors will contain a “reversion”
reversion mutation
mutation (an at to GC change) that corrects the original defect and restores production of
now allows the bacterium to grow in the absence of histidine. Such enzyme required to
mutations happen by chance and only rarely, but the ability to work make histidine
with very large numbers of E. coli cells makes it possible to detect
this change and to accurately measure its frequency. this type of
experiment revealed that the spontaneous mutation rate in E. coli was
approximately 1 mistake in every 109 nucleotides copied.

ECB3 n9.100/9.04
condition—adding an antibiotic or removing an essential nutrient—one
can find these needles in the haystack: cells that have undergone a spe-
cific mutation enabling them to survive in conditions where the original
cells cannot (Figure 9–5). In this way, one can determine how frequently
the specific mutation occurs, and from this one can estimate the overall
mutation frequency in E. coli: it is about 1 nucleotide change per 109
nucleotide pairs per cell generation. Humans have a mutation rate of 0.1
nucleotide change for every 109 nucleotide pairs copied—which is one-
tenth that of E. coli.
Point mutations provide a way of fine tuning a gene’s function by mak-
ing small adjustments to its sequence. They can also destroy a gene.
Very often, however, they do neither of these things. At many sites in the
genome, a point mutation has absolutely no effect on the appearance
or viability of the organism; such neutral mutations might fall in regions
whose sequence is unimportant, such as introns. They can also change
the third position of a codon such that the amino acid specified is the
same, or can direct the replacement of one amino acid with a related one
at a position in the protein that can tolerate either.

Point Mutations Can Change the Regulation of a Gene

Mutations in the coding sequences of genes are fairly easy to spot
because they change the amino acid sequence of the resulting protein in
predictable ways. But mutations in regulatory DNA are more difficult to
recognize, because they look like minor variations within long stretches
of DNA whose actual nucleotide sequence does not seem to matter. And
because regulatory sequences can be located some distance from the
coding sequence of the gene, it can be particularly challenging to identify
these elements and the changes that affect them.
Despite these difficulties, many examples have been discovered where
point mutations in regulatory DNA have profound consequences for
the organism. For example, a small number of people are resistant to
malaria because of a point mutation that affects the expression of a cell-
surface receptor to which the malaria parasite Plasmodium vivax binds.
302 Chapter 9 how Genes and Genomes evolve

percentage of population
that is
lactose tolerant
100%
90–99%
80–89%
70–79%
60–69%
50–59%
40–49%
Native Americans 30–39%
20–29%
10–19%
0–9%
no data

Indigenous Australians

Figure 9–6 The ability of adult humans to digest milk follows the domestication of cattle. approximately
10,000 years ago, humans in northern europe and central africa domesticated cattle, and the subsequent availability
of milk—particularly during periods of starvation—gave a selective advantage to those humans able to digest
lactose as adults. two independent point mutations that allow the expression of lactase in adults arose in human
populations—one in northern europe and another in central africa. these mutations have since spread through
different regions of the world. For example, the migration of Northern europeans to North america and australia
explains why most people living on these continents can digest lactose as adults although the native populations
remain lactose intolerant.

ECB3 n9.102/9.04.5

The mutation prevents the receptor from being produced in red blood
cells, rendering the individuals who carry this mutation immune to infec-
tion. Point mutations in regulatory DNA also play a role in our ability
to digest the sugar lactose. Our earliest ancestors were lactose intoler-
ant, because the enzyme that breaks down lactose—called lactase—was
made only during infancy. Adults, who were no longer exposed to breast
milk did not need the enzyme. When humans began to get milk from
domestic animals some 10,000 years ago, variant genes appeared in
the human population, enabling those who carried them to continue to
express lactase as adults. We now know that people who can digest milk
as adults contain a point mutation in the regulatory DNA of the lactase
gene, allowing it to be efficiently transcribed throughout their lives. In a
sense, adults who can digest lactose are “mutants” with respect to this
trait. It is remarkable how quickly this new characteristic spread through
the human population, especially in societies that depended heavily on
milk for nutrition (Figure 9–6).
These evolutionary changes in the regulatory sequence of the lactase
gene occurred relatively recently (10,000 years ago), well after humans
became a distinct species. However, much more ancient changes in
regulatory sequences have occurred in other genes; some of these are
thought to underlie many of the profound differences among species
(Figure 9–7).

DNA Duplications Give Rise to Families of Related Genes

Point mutations can influence the activity of an existing gene, but how do
new genes come into being? Gene duplication is perhaps the most impor-
tant mechanism for generating new genes from old ones. Once a gene
has been duplicated, one of the two gene copies can mutate and become
specialized to perform a different function, while the other continues to
 Generating Genetic Variation 303

ORGANISM A RELATED ORGANISM B Figure 9–7 Changes in regulatory DNA

can have dramatic consequences for the
embryonic stage 1 embryonic stage 1 development of an organism. (a) In this
gene 1 gene 2 gene 3 gene 1 gene 2 gene 3 hypothetical example, the genomes of
organisms a and B code for the same set
regulatory DNA sequences of regulatory proteins, but the regulatory
DNa controlling expression of the proteins
transcription TIME TIME is different. Both organisms express the
regulator same proteins at stage 1, but because of
transcription
embryonic stage 2 regulator embryonic stage 2 the differences in their regulatory DNa
gene 1 gene 2 gene 3 gene 1 gene 2 gene 3 they follow different pathways in stage 2.
(B) Differences in gene regulation during
development can have profound effects on
the appearance of the adult organisms.
(A)

(B)

carry out the original function. Or both copies may evolve so that the
function of the ancestral gene is divided between them. This specializa-
tion of duplicated genes occurs gradually, as mutations accumulate in
the descendants of the original cell in which gene duplication occurred.
Repeated rounds of this process of gene duplication and divergence
over many millions of years can allow one gene to give rise to a whole
family of genes, each with a specialized function, within a single genome.
Analysis of genome sequences reveals many examples of such gene fam-
ilies: in Bacillus subtilis, for example, nearly half of the genes have one
or more obvious relatives elsewhere in the genome (Figure 9–8). And in
vertebrates, the globin gene family clearly arose from a single primordial
gene, as we shall see shortly. But how does gene duplication occur in the
first place? ECB3 e9.29/9.05

It is thought that many gene duplications are generated by homologous

recombination. Homologous recombination normally takes place only
when two long stretches of nearly identical DNA become paired, most
often the same region of DNA on two homologous chromosomes (dis-
cussed in Chapter 6, pp. 218–221). But on rare occasions, a recombination
event will instead occur between two short repeated DNA sequences that
fall on either side of a gene. If a crossover occurs, one chromosome will
end up with an extra copy of the gene and the other will lose it (Figure
9–9). Once a gene has been duplicated in this way, subsequent crossovers
can readily add extra copies to the duplicated set by the same mecha-
nism. As a result, entire sets of closely related genes, arranged in series,
are commonly found in genomes.

283 genes in families with

20–77 gene members

764 genes in families with

4–19 gene members Figure 9–8 The Bacillus subtilis genome
contains many families of evolutionarily
2126 genes with related genes. the largest gene family in
273 genes in families the B. subtilis genome contains 77 genes
no family relationship
with 3 gene members
coding for a variety of transporters, proteins
that move materials across the cell membrane
(discussed in Chapter 12). (after F. Kunst
568 genes in families et al., Nature 390:249–256, 1997. With
with 2 gene members permission from Macmillan publishers Ltd.)
304 Chapter 9 how Genes and Genomes evolve

Figure 9–9 Gene duplication can occur short repeated DNA sequences
by crossovers between short repeated
gene
sequences on DNA. a pair of homologous
chromosomes undergoes recombination
at a short sequence (red) that brackets homologous
a gene (orange). In some cases, such gene chromosomes
repeated sequences are remnants of mobile
genetic elements, which are present in
many copies in the human genome (see
Figure 6–35). When crossing-over occurs MISALIGNMENT
as shown, the long chromosome will get
two copies of the intervening gene, while
the short chromosome will have the gene
deleted. the type of crossing-over that
X
produces gene duplications is called
unequal crossing-over because the resulting
products are unequal in size. If this process
occurs in the germ line, some progeny will
UNEQUAL CROSSING-OVER
inherit the long chromosome, while others
will inherit the short one.
gene gene

long chromosome

single-chain globin binds short chromosome

one oxygen molecule

The Evolution of the Globin Gene Family Shows How Gene

Duplication and Divergence Can Give Rise to Proteins
Tailored to an Organism and Its Development
The evolutionary history of the globin gene family provides a striking
ECB3 E9.05/9.07
example of how gene duplication and divergence has generated new
oxygen- proteins. The unmistakable similarities in amino acid sequence and
binding site EVOLUTION OF A structure among the present-day globins indicate that they all must derive
on heme SECOND GLOBIN
CHAIN BY from a common ancestral gene.
GENE DUPLICATION
FOLLOWED BY The simplest and most evolutionarily ancient globin molecule is a
MUTATION polypeptide chain of about 150 amino acids, which is found in many
marine worms, insects, and primitive fish. Like our hemoglobin, this
b
protein transports oxygen molecules throughout the animal’s body. The
b
oxygen-carrying molecule in the blood of adult mammals and most other
vertebrates, however, is more complex; this protein is composed of four
globin chains of two distinct types—a globin and b globin (Figure 9–10).
The four oxygen-binding sites in the a2b2 molecule interact, allowing an
allosteric change in the molecule as it binds and releases oxygen. This
structural shift enables the four-chain hemoglobin molecule to efficiently
take up and release four oxygen molecules in an all-or-none fashion, a
feat not possible for the single-chain version. This efficiency is particu-
a a larly important for large multicellular animals, which cannot rely on the
simple diffusion of oxygen through the body to oxygenate their tissues
four-chain globin binds four adequately.
oxygen molecules in a
cooperative way The a and b globin genes are the result of gene duplications that occurred
early in vertebrate evolution. About 500 million years ago, gene dupli-
Figure 9–10 A single-chain globin
molecule gave rise to the four-chain cations followed by mutation gave rise to two slightly different globin
hemoglobin used by humans and other genes, one encoding a globin, the other encoding b globin (Figure 9–11).
mammals. the mammalian hemoglobin Still later, as the different mammals began diverging from their common
molecule is a complex of two a- and two ancestor, the b-globin gene apparently underwent its own duplication and
b-globin chains. the single-chain globin divergence to give rise to a second b-like globin gene that is expressed
found in some primitive vertebrates forms a
dimer that dissociates when it binds oxygen, specifically in the fetus (see Figure 9–11). The resulting hemoglobin mol-
representing an intermediate stage in the ecule has a higher affinity for oxygen compared with adult hemoglobin, a
evolution of the four-chain
ECB3 molecule.
e9.06/9.08 property that helps transfer oxygen from mother to fetus.
 Generating Genetic Variation 305

Figure 9–11 Repeated rounds of duplication and mutation Chromosome

generated the globin gene family in humans. about 500 million 11
years ago, an ancestral globin gene duplicated and gave rise to
the b-globin gene family and to the related a-globin gene family. e g G gA d b
In vertebrates, a molecule of hemoglobin is formed from two
a chains and two b chains, as shown in Figure 9–10. the evolutionary
scheme shown was worked out by comparing globin genes from
many different organisms. For example, the nucleotide sequences 100 adult
of the gG and ga genes, which produce globin chains that form fetal
fetal b

millions of years ago

hemoglobin, are much more similar to each other than either of them b
is to the adult b gene. In humans, the b-globin genes are located in
300 a-globin
a cluster on Chromosome 11. a chromosome breakage event that
occurred about 300 million years ago separated the a- and b-globin genes
genes; the a-globin genes now reside on human Chromosome 16
(not shown). 500
single-chain
globin
700

Subsequent rounds of duplication in both the a- and b-globin genes gave

rise to additional members of these families. Each of these duplicated
genes has been modified by point mutations that affect the properties of
the final hemoglobin molecule, and by changes in regulatory DNA that
determine when—and how strongly—each gene is expressed. As a result,
each globin differs slightly in its ability to bind and release oxygen and is
ECB3 e9.07/9.09
well suited to the stage in development at which it is expressed.
In addition to these specialized globin genes, there are several duplicated
DNA sequences in the a- and b-globin gene clusters that are not func-
tional genes. They are similar in DNA sequence to the functional globin
genes, but they have been disabled by the accumulation of many muta-
tions that destroy the encoded proteins and prevent their expression. The
existence of such pseudogenes makes it clear that, as might be expected,
not every DNA duplication leads to a new functional gene. Although we
have focused here on the role of gene duplication and divergence as it
relates to the evolution of the globin genes, similar histories apply to the
many other gene families present in the human genome.

Whole Genome Duplications Have Shaped the

Evolutionary History of Many Species
Almost every gene in the genomes of vertebrates exists in multiple ver-
sions, suggesting that rather than individual genes being duplicated in a
piecemeal fashion, the whole vertebrate genome was duplicated in one
fell swoop. Early on in vertebrate evolution, it appears that the entire
genome actually underwent duplication twice in succession, giving rise
to four copies of every gene. In some groups of vertebrates, such as the
salmon and carp families (including the zebrafish; see Figure 1–39), there
may have been yet another duplication, creating an eightfold multiplicity
of genes.
The precise history of whole genome duplications in vertebrate evo-
lution is difficult to chart because many other changes have occurred
since these ancient evolutionary events. In some organisms, however,
full genome duplications are especially obvious as they have occurred
relatively recently—evolutionarily speaking. The frog genus Xenopus,
for example, comprises a set of closely similar species related to one
another by repeated duplications or triplications of the whole genome
(Figure 9–12). Such large-scale duplications can happen if cell division
fails to occur following a round of genome replication in the germ line
of a particular individual. Once an accidental doubling of the genome
occurs in the germ line, it will be faithfully passed on to other germ cells
in the individual and, ultimately, to its progeny.
306 Chapter 9 how Genes and Genomes evolve
Figure 9–12 Different species of the frog
Xenopus have different DNA contents.
X. tropicalis (above) has an ordinary diploid
genome with two sets of chromosomes
in every somatic cell; the tetraploid X.
laevis (below) has a duplicated genome
containing twice as much DNa per cell.
(Courtesy of enrique amaya.)
ECB3 e9.08/9.10
Figure 9–13 An exon can be duplicated
by a recombination event. the general
scheme is the same as that of Figure 9–9,
with a short repeated sequence indicated
in red; however, here an exon within a
gene (blue), rather than an entire gene, is
duplicated. an mrNa transcribed from the
original gene will contain two exons,
a and B, whereas the long chromosome will
produce an mrNa with three exons
(a, B, and a second copy of B). Because the
duplicated exon is joined by an intron (gray/
yellow) with its splicing sequences intact,
the modified nucleotide sequence can be
readily spliced after transcription to produce
a functional mrNa.
New Genes Can Be Generated by Repeating the Same
Exon
The role of DNA duplication in evolution is not confined to the expan-
sion of gene families. It can also act on a smaller scale to modify single
genes by creating internal duplications. As we discussed in Chapter 4,
many proteins are composed of a set of smaller protein domains. Some
proteins—such as antibodies (see Figure 4–29) or fibrous proteins such
as collagen—are built from multiple copies of the same domain linked
together in series. These proteins are encoded by genes that have evolved
by repeated duplications of a single DNA segment.
In eucaryotes, each individual protein domain in such genes is usually
encoded by a separate exon. Duplicating these domains within a gene
can then occur by breaking and rejoining the DNA anywhere in the long
introns on either side of the exon that codes for the protein domain
(Figure 9–13). Without introns there would be very few sites in the orig-
inal gene at which a recombinational crossover between homologous
chromosomes could duplicate the domain without damaging it. The evo-
lution of new proteins is therefore thought to have been greatly facilitated
by the organization of eucaryotic DNA coding sequences as a series of
relatively short exons separated by long, noncoding introns (see Figures
7–17 and 7–18).
Novel Genes Can Also Be Created by Exon Shuffling
The type of recombination that allows exons to be duplicated within a
gene can also occur between two different genes, joining together two
initially separate exons that code for quite different protein domains—an
important process called exon shuffling. The lack of precision that can
be tolerated in a recombination event that breaks and rejoins two introns
greatly increases the probability that a chance recombination between
introns in different genes will generate a hybrid gene that joins exons.
The presumed results of such recombinations are seen in many present-
day proteins, which are a patchwork of many different protein domains
(Figure 9–14).
intron intron
exon A exon B
homologous
chromosomes
MISALIGNMENT
exon A exon B
exon A exon B X
UNEQUAL CROSSING-OVER
exon A exon B exon B
long chromosome
exon A
short chromosome
 Generating Genetic Variation 307

It has been proposed that all the proteins encoded by the human genome H2N COOH
(approximately 24,000) arose from the duplication and shuffling of a few EGF
thousand distinct exons, each encoding a protein domain of approxi-
mately 30–50 amino acids. This remarkable idea suggests that the great H2N COOH

diversity of protein structures is generated from a quite small universal CHYMOTRYPSIN

“list of parts” pieced together in different combinations.
H 2N COOH

The Evolution of Genomes Has Been Accelerated by the UROKINASE

Movement of Mobile Genetic Elements H2N COOH

The mobile genetic elements described in Chapter 6 are another impor- FACTOR IX
tant source of genomic change and have profoundly affected the structure
of modern genomes. These parasitic DNA sequences can colonize a H2N COOH

genome and can spread within it. During this process, they often disrupt PLASMINOGEN

the function or alter the regulation of existing genes; sometimes they Figure 9–14 Exon shuffling can generate
even create novel genes through fusions between mobile sequences and proteins with new combinations of
segments of existing genes. protein domains. each type of symbol
represents a different type of protein
The insertion of a mobile genetic element into the coding sequence of a domain. During evolution, these have been
gene or into its regulatory region is a frequent cause of the “spontaneous” joined together end-to-end to create the
mutations that are observed in many organisms. Mobile genetic elements modern-day humanECB3 e9.10/9.12
proteins shown here.
can severely disrupt a gene’s activity if they land directly within its coding
sequence. Such an insertion mutation destroys the gene’s capacity to
encode a useful protein. For example, a number of the mutations in
the Factor VIII gene that cause hemophilia in humans result from the
insertion of mobile genetic elements into the gene.
The activity of mobile genetic elements can also change the way in which
existing genes are regulated. For example, an insertion of an element into
the regulatory region of a gene will often have a striking effect on where
and when that gene is expressed (Figure 9–15). Many mobile genetic ele-
ments carry DNA sequences that are recognized by specific transcription
regulators; if these elements insert themselves near a gene, that gene
can be brought under the control of these new transcription regulators,
thereby changing the gene’s expression pattern. Thus, mobile genetic
elements can be a significant source of developmental changes, and they
are thought to have been particularly important in the evolution of the
body plans of multicellular plants and animals.
Finally, mobile genetic elements provide opportunities for genome re-
arrangements by serving as targets of homologous recombination. For
example, the duplications that gave rise to the b-globin gene cluster are
thought to have occurred by crossovers between Alu-like sequences
that are sprinkled throughout the genome (see Figures 9–9 and 6–35).
However, mobile genetic elements also have more direct roles in the
evolution of genomes. In addition to relocating themselves, these para-

Figure 9–15 Mutation due to a mobile

genetic element can induce dramatic
alterations in the body plan of an
organism. (a) a normal fruit fly (Drosophila
melanogaster). (B) the fly’s antennae have
been transformed into legs because of a
mutation in regulatory DNa sequences
that cause genes for leg formation to be
activated in the positions normally reserved
for antennae. although this particular
change is not advantageous to the fly, it
does illustrate how the movement of a
transposable element can produce a major
change in the appearance of an organism.
(a, courtesy of e.B. Lewis; B, courtesy of
(A) (B) Matthew Scott.)
308 Chapter 9 how Genes and Genomes evolve
Figure 9–16 Mobile genetic elements can
create new exon arrangements. When two
mobile genetic elements of the same type
(red) happen to insert near each other in a
chromosome, the transposition mechanism
occasionally uses the ends of two different
elements (instead of the two ends of the
same element) and thereby moves the
chromosomal DNa between them to a new
site. Because introns are very large relative
to exons, the illustrated insertion of a new
exon into a preexisting intron is a frequent
outcome of such a transposition event.
?
Question 9–2
Why do you suppose that
horizontal gene transfer is
more prevalent in single-celled
organisms than in multicellular
organisms?
1 mm
mobile genetic elements
exon 1A exon 2A exon 3A
GENE A, containing two similar
transposable elements in introns
element ends
EXON 2A EXCISED BY TRANSOPSASE
THAT RECOGNIZES THE ENDS OF TWO
SEPARATE ELEMENTS
exon 2A
fragment of
GENE A
exon 1B exon 2B exon 3B
normal
GENE B
INSERTION INTO MIDDLE OF GENE B
exon 1B exon 2B exon 2A exon 3B
new GENE B
with extra exon
sitic elements occasionally rearrange neighboring DNA sequences of the
host genome. When two mobile genetic elements that are recognized by
the same transposase integrate into neighboring chromosomal sites, the
DNA between them can itself ECB3 E9.11/9.13
be transposed. In eucaryotic genomes, this
provides a pathway for the movement of exons, generating new genes by
creating novel arrangements of existing exons (Figure 9–16).
Genes Can Be Exchanged Between Organisms by
Horizontal Gene Transfer
So far we have considered genetic changes that take place within the
genome of an individual organism. However, genes and other portions of
genomes can also be exchanged between individuals of different species.
This mechanism, known as horizontal gene transfer, is rare among
eucaryotes but common among bacteria (Figure 9–17).
E. coli, for example, has acquired about one-fifth of its genome from other
species within the past 100 million years. And such genetic exchanges
are currently responsible for the rise of new and potentially dangerous
strains of drug-resistant bacteria. For example, genes that confer resist-
ance to antibiotics can be transferred from species to species. This DNA
exchange provides the recipient bacterium with an enormous selective
advantage in evading the antimicrobial compounds that constitute mod-
ern medicine’s frontline attack against bacterial infection. As a result,
many antibiotics are no longer effective against the common bacterial
infections for which they were originally used. For example, most strains
of Neisseria gonorrhoeae, the bacterium that causes gonorrhea, are now
resistant to penicillin; this antibiotic is therefore no longer the primary
treatment for this disease.
Figure 9–17 Bacterial cells can share DNA by a process called
conjugation. Conjugation begins when a donor cell (top) attaches
to a recipient cell (bottom) by a fine appendage, called a sex pilus.
DNa from the donor cell then moves through the pilus into the
recipient cell. In this electron micrograph, the sex pilus has been
labeled along its length by viruses that specifically bind to it to make
the structure more visible. Conjugation is one of several ways in which
bacteria carry out horizontal gene transfer. (Courtesy of Charles
C. Brinton Jr. and Judith Carnahan.)
 reconstructing Life’s Family tree 309

RECONSTRUCTING LIFE’S FAMILY TREE

Given an understanding of the basic molecular mechanisms by which
genomes change, we can begin to decipher clues to our evolutionary his-
tory by comparing and analyzing genome sequences. Perhaps the most
astonishing revelation of such genome analyses has been that homolo-
gous genes—genes that are similar in their nucleotide sequence because
of common ancestry—can often be recognized across vast evolutionary
distances. Unmistakable homologs of many human genes are easy to
detect in such organisms as worms, fruit flies, yeasts, and even bacteria.
The nematode worm Caenorhabditis elegans, the fly Drosophila mela-
nogaster, and the vertebrate Homo sapiens—the first three animals for
which a complete genome sequence was obtained—are very distant rela-
tives: the lineage leading to vertebrates is thought to have diverged from
that leading to nematodes and insects more than 600 million years ago.
Yet when the 19,000 genes of C. elegans, the 14,000 genes of Drosophila,
and the 25,000 or so genes of Homo sapiens are systematically compared,
we find that about 50% of the genes in each of these species have clear
homologs in one or both of the other two species. In other words, clearly
recognizable versions of at least half of all human genes were already
present in the common ancestor of worms, flies, and humans.
By tracing such relationships among genes, we can begin to define the
evolutionary relationships among different species, placing each bacte-
rium, animal, plant, or fungus in a single vast family tree of life. In this
section, we discuss how these relationships are determined and what
they tell us about our genetic heritage.

Genetic Changes That Provide a Selective Advantage Are

Likely to Be Preserved
Evolution is commonly thought of as progressive, but at the molecular
level the process is random. Consider the fate of a point mutation. As
we discussed earlier, on rare occasions such a mutation may represent
a change for the better; very often, it will cause no significant difference
in the organism’s prospects; and sometimes it will cause serious dam-
age—by disrupting the coding sequence for a key protein, for example.
Changes due to mutations of the first type will tend to be perpetuated,
because the organism that inherits them will have an increased likeli-
hood of reproducing itself. Changes due to mutations of the second
type—selectively neutral changes—may or may not be passed on, because
it is a matter of chance whether the mutant organism or its cousins will
secure the available resources and breed successfully. In contrast, muta-
tions that cause serious damage lead nowhere: the organism that inherits
them dies, leaving no progeny. Through endless repetition of this cycle of
error and trial—of mutation and natural selection—organisms gradually
evolve. Their genetic specifications change and they develop new ways
to exploit the environment, to survive in competition with others, and to
reproduce successfully.
Clearly, some parts of the genome can accumulate mutations more eas-
ily than others in the course of evolution. A segment of DNA that does

?
not code for protein or RNA and has no significant regulatory role is free Question 9–3
to change at a rate limited only by the frequency of random mutation. In Highly conserved genes such as
contrast, alterations in a gene that codes for a highly optimized essential those for ribosomal RNA are present
protein or RNA molecule cannot be accommodated so easily: when muta- as clearly recognizable relatives in all
tions occur, the faulty organism is almost always eliminated. Genes of this organisms on Earth; thus, they have
latter sort are therefore highly conserved; that is, the proteins they encode evolved very slowly over time. Were
are very similar from organism to organism. Throughout 3.5 billion years such genes “born” perfect?
or more of evolutionary history, the most highly conserved genes remain
310 Chapter 9 how Genes and Genomes evolve
Figure 9–18 Phylogenetic trees display
the relationships among modern life
forms. In this family tree of higher primates,
humans fall closer to chimpanzees than to
gorillas or orangutans, as there are fewer
differences between human and chimp
nucleotide sequences than there are
between those of humans and gorillas or
humans and orangutans. as indicated, the
genome sequences of all four species are
estimated to differ from the sequence of
their last common ancestor by about 1.5%.
Because changes occur independently
in each lineage, the divergence between
any two species will be twice as much as
the amount of change that takes place
between each of the species and their last
common ancestor. For example, humans
and orangutans typically show sequence
divergences of slightly more than 3%, while
human and chimp genomes differ by about
1.2%. although this phylogenetic tree is
based solely on nucleotide sequences, the
estimated times of divergence, shown on
the right side of the graph, derive from data
obtained from the fossil record. (Modified
from F.C. Chen and W.h. Li, Am. J. Hum.
Genet. 68:444–456, 2001. With permission
from elsevier.)
last common ancestor of all higher primates 15
percentage nucleotide substitution
1.5
millions of years before present
last common
10
1.0 ancestor of
human and
chimp
5
0.5
0 0.0
human chimpanzee gorilla orangutan
perfectly recognizable in all living species. These latter genes (which
encode crucial proteins such as DNA and RNA polymerases) are the ones
that must be examined if we wish to trace family relationships among the
most distantly related organisms in the tree of life.
For species that are more closely related, however, it is often more
informative to focus on the selectively neutral changes. These changes
accumulate steadily at a rate that is unconstrained by selection pressures.
They therefore provide us with a simple and easily readable evolutionary
clock that can be used to estimate the amount of time that has passed
ECB3 m4.75/9.16
since two species diverged from a common ancestor. For example, com-
parisons of such nucleotide changes have allowed us to construct a
highly accurate phylogenetic tree that shows the evolutionary relation-
ships among higher primates (Figure 9–18).
Human and Chimpanzee Genomes Are Similar in
Organization As Well As in Detailed Sequence
Humans and chimpanzees are so closely related that it is possible to
reconstruct gene sequences of the extinct common ancestor of the two
species (Figure 9–19). Not only do humans and chimpanzees seem to have
essentially the same set of 25,000 genes, but these genes are arranged
in nearly the same way along the chromosomes of the two species. The
only substantial exception is human Chromosome 2, which arose from a
fusion of two chromosomes that remain separate in the chimpanzee, the
gorilla, and the orangutan.
Even the massive resculpting of genomes by mobile genetic elements
(discussed earlier in this chapter) has produced only minor differences
between the human and chimp genomes. More than 99% of the million
copies of the Alu retrotransposon sequences that are present in both
genomes are in corresponding positions, indicating that most of the Alu
sequences in our genome underwent transposition before humans and
chimpanzees diverged. However, as described earlier, members of the
Alu family are still capable of transposing, as is evident from a small
number of observed cases in which new Alu insertions have caused
human genetic disease. These cases involve transposition of this DNA
into sites that were unoccupied in the genomes of the patients’ parents.
Functionally Important Regions Show Up As Islands of
Conserved DNA Sequence
As we delve back further into our evolutionary history and compare our
genomes with those of more distant relatives, the picture changes. The
lineages of humans and mice, for example, diverged about 75 million

gorilla CAA
Q can be reconstructed by comparing
human DNA GTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGG
chimp DNA GTGCCCATCCAAAAAGTCCAGGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGG
protein V P I Q K V Q D D T K T L I K T I V T R
K intake and energy utilization. as indicated
human DNA ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAAGTCACCGGTTTGGAC
chimp DNA ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAGGTCACCGGTTTGGAC
protein I N D I S H T O S V S S K Q K V T G L D
gorilla AAG
gorilla CCC
P last common ancestor was probably the
human DNA TTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC
chimp DNA TTCATTCCTGGGCTCCACCCTATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC
protein F I P G L H P I L T L S K M D Q T L A V
V and chimpanzees reflect relatively recent
human DNA TACCAACAGATCCTCACCAGTATGCCTTCCAGAAACGTGATCCAAATATCCAACGACCTG
chimp DNA TACCAACAGATCCTCACCAGTATGCCTTCCAGAAACATGATCCAAATATCCAACGACCTG
protein Y Q Q I L T S M P S R N M I Q I S N D L
gorilla ATG
D nucleotides are identical between humans
human DNA GAGAACCTCCGGGATCTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGG
chimp DNA GAGAACCTCCGGGACCTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGG
protein E N L R D L L H V L A F S K S C H L P W
gorilla GAC
years ago. We both have genomes of the same size containing practi-
cally the same genes. Both genomes are also peppered with mobile
genetic elements. However, the mobile genetic elements in the mouse
and human genomes, although similar in sequence, are distributed
differently. This observation implies that the elements have been inde-
pendently proliferating and moving around the genome in each lineage
since the two species diverged (Figure 9–20). In addition to the movement
of mobile genetic elements, the large-scale organization of the genomes
has become scrambled by manyECB3 episodes of chromosome breakage and
e9.16/9.17
recombination—it is estimated that there has been a total of about 180
“break-and-join” events. As a result, the overall structures of the chro-
mosomes have changed dramatically. For example, in humans most
centromeres lie near the middle of the chromosome, whereas those of
mouse are located at the chromosome ends.
Nevertheless, in spite of the genetic shuffling, one can still recognize
many blocks of conserved synteny, regions where corresponding genes
are strung together in the same order in both species. These genes were
neighbors in the ancestral species and, despite all the chromosomal
upheavals, they remain neighbors in the two present-day species. More
human b-globin gene cluster
e gG gA d b
mouse b-globin gene cluster
e g b major
10,000
nucleotide pairs
reconstructing Life’s Family tree 311
Figure 9–19 Ancestral gene sequences
closely related present-day species.
Shown here in five contiguous sections is
a sequence from the coding region of the
leptin gene from humans and chimpanzees.
Leptin is a hormone that regulates food
by the codons boxed in green, only 5 (of
441 nucleotides total) differ between the
chimp and human sequences. Only one of
these changes results in a change in the
amino acid sequence. the sequence of the
same as the human and chimp sequences
where they agree; in the few places where
they disagree, the gorilla sequence (pink)
can be used as a ‘tiebreaker.’ this strategy
is based on the relationship shown in
Figure 9–18: differences between humans
events in evolutionary history, and the
gorilla sequence reveals the most likely
precursor sequence. For convenience,
only the first 300 nucleotides of the leptin
coding sequences are shown. the last 141
and chimpanzees.
Figure 9–20 The positions of mobile
genetic elements in the human and
mouse genomes reflect the long
evolutionary time separating the
two species. this stretch of human
Chromosome 11 (introduced in Figure
9–11) contains five functional b-globin–like
genes (orange); the comparable region
from the mouse genome contains only four.
In the human b-globin gene cluster, the
positions of human Alu sequences (green
circles) and human L1 sequences (red
circles) are shown. In the mouse genome,
the positions of B1 elements (relatives of
the human Alu elements; blue triangles)
and mouse L1 elements (relatives of the
human L1 elements; brown triangles) are
shown. the absence of mobile genetic
elements within the globin structural genes
b minor
can be attributed to natural selection, which
would have eliminated any insertion that
compromised gene function. the Alu and
L1 mobile elements are described in more
detail in Chapter 6 (pp. 222–223). (Courtesy
of ross hardison and Webb Miller.)
312 Chapter 9 how Genes and Genomes evolve

mouse exon intron

GTGCCTATCCAGAAAGTCCAGGATGACACCAAAACCCTCATCAAGACCATTGTCACCAGGATCAATGACATTTCACACACGGTA-GGAGTCTCATGGGGGGACAAAGATGTAGGACTAGA
GTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACGGTAAGGAGAGT-ATGCGGGGACAAA---GTAGAACTGCA
human

ACCAGAGTCTGAGAAACATGTCATGCACCTCCTAGAAGCTGAGAGTTTAT-AAGCCTCGAGTGTACAT-TATTTCTGGTCATGGCTCTTGTCACTGCTGCCTGCTGAAATACAGGGCTGA
GCCAG--CCC-AGCACTGGCTCCTAGTGGCACTGGACCCAGATAGTCCAAGAAACATTTATTGAACGCCTCCTGAATGCCAGGCACCTACTGGAAGCTGA--GAAGGATTTGAAAGCACA

Figure 9–21 Accumulated mutations have resulted in considerable divergence in the nucleotide sequences of
the human and the mouse genomes. Shown here in two contiguous sections are portions of the human and mouse
leptin gene sequences. positions where the sequences differ by a single nucleotide substitution are boxed in green,
and positions where they differ by the addition or deletion of nucleotides are boxed in yellow. Note that the coding
sequence of the exon is much more conserved than the adjacent intron sequence.

than 90% of the mouse and human genomes can be partitioned into
such corresponding regions of conserved synteny. Within these regions,
we can align the DNA of mouse with that of humans and compare the
nucleotide sequences in detail. Such genome-wide sequence compari-
sons reveal that in the roughly 80 million years since humans and mice
diverged from their common ancestor, about 50% of the nucleotides have
changed. Against this background of dissimilarity, however, one can now
begin to see very clearly the regions where changes are not tolerated
and the human and mouse sequences have remained nearly the same
(Figure 9–21). Here, the sequences have been conserved by purifying
selection—that is, the elimination of individuals carrying mutations that
interfere with important functions.
The power of comparative genomics can be increased by stacking our
genome up against the genomes of additional animals, including the rat,
chicken, and dog. Such comparisons take advantage of the results of the
‘natural experiment’ that has lasted for hundreds of millions of years, and
they highlight some of the most interesting regions of these genomes.
These comparisons reveal that roughly 5% of the human genome consists
of DNA sequences that are highly conserved in many other mammals
(Figure 9–22). Surprisingly, only about one-third of these sequences code
for proteins. Some of the conserved noncoding sequences correspond
ECB3 e9.19/9.19
to regulatory DNA, whereas others produce RNA molecules that are not
translated into protein. But the function of the majority of these sequences
remains unknown. This unexpected discovery has led scientists to con-
clude that we understand much less about the cell biology of vertebrates
than we had previously imagined. With enormous opportunities for new
discoveries, we should expect many surprises ahead.

Genome Comparisons Show That Vertebrate Genomes

Gain and Lose DNA Rapidly
Going back further in evolution, we can compare our genome with those
of fishes. The fish and mammalian lineages diverged about 400 million
years ago. This is long enough for random sequence changes and differ-
ing selection pressures to have obliterated almost every trace of similarity
in nucleotide sequence except where purifying selection has operated to
prevent change. Regions of the genome conserved between humans and
fishes thus stand out even more strikingly. In fishes, one can still recog-
nize most of the same genes as in humans and even many of the same
segments of regulatory DNA. On the other hand, the extent of duplica-
tion of any given gene is often different, resulting in different numbers of
members of gene families in the two species.
Another thing that stands out is that although all vertebrate genomes
contain roughly the same number of genes, their overall size varies con-
siderably. Whereas human, dog, and mouse are all in the same size range
 reconstructing Life’s Family tree 313

human gene :190,000 nucleotide pairs Figure 9–22 Comparison of

nucleotide sequences from
5¢ 3¢
many different vertebrates
reveals regions of high
conservation. the nucleotide
intron exon intron multispecies conserved sequences
sequence examined in this
diagram is of a small segment
of the human gene for a plasma
chimpanzee
100% indentical membrane transporter protein.
50% identical exons in the complete gene
orangutan (top) are indicated in magenta.
baboon
In the expanded region of the
gene, the position of the exon
marmoset is indicated in red. In the lower
lemur part of the figure, the human
DNa sequence is aligned with
rabbit that of different vertebrates; the
percent
horse identity percent identity with the human
gene for successive stretches of
cat 100 nucleotide pairs is plotted in
dog green, with only identities above
50% shown. the sequence of
mouse the exon is conserved in all the
opossum species, including the chicken
and fish. three blocks of intron
chicken
sequence that are conserved
fish (Fugu) 100% in the mammals, but not in the
50%
chicken or fish, are shown in blue.
the functions of most conserved
10,000 nucleotide pairs intron sequences in the human
genome (including these three)
are not known. (Courtesy of eric
D. Green.)
(3 ¥ 109 nucleotide pairs), the chicken genome is only one-third this size.
An extreme example of genome compression is the puffer fish, Fugu
rubripes (Figure 9–23), whose tiny genome is one-tenth the size of mam-
malian genomes, largely because of the small size of its introns. Fugu
introns, as well as other noncoding segments in the animal’s genome,
ECB3 m4.83/9.20

lack the repetitive DNA that makes up a large portion of most mammalian
genomes. Nonetheless, the positions of most Fugu introns are perfectly
conserved when compared with their positions in mammalian genomes
(Figure 9–24). Clearly, the intron structure of most vertebrate genes was
already in place in the common ancestor of fish and mammals.
What factors could be responsible for the size differences among modern
vertebrate genomes? Detailed comparisons of many genomes have led
to the unexpected finding that small blocks of sequence are being lost
from and added to genomes at a surprisingly rapid rate. It seems likely
that the Fugu genome is so tiny because it lost DNA sequences faster
than it gained them. Over long periods, this imbalance would result in a
major “cleansing” of those DNA sequences whose disappearance could
be tolerated. In retrospect, this process has been enormously helpful to
biologists: by “trimming the fat” from the Fugu genome, evolution has
generously provided a slimmed-down version of a vertebrate genome in
which the only DNA sequences that remain are those that are very likely
to have important functions.

Sequence Conservation Allows Us to Trace Even the Most

Figure 9–23 The puffer fish, Fugu
Distant Evolutionary Relationships rubripes, has a remarkably compact
As we go back further still to the genomes of even more distant relatives— genome. at 400 million nucleotide pairs,
the Fugu genome is only one-quarter the
beyond apes, mice, fish, flies, worms, plants, and yeasts, all the way to
size of the zebrafish genome, even though
bacteria—we find fewer and fewer resemblances to our own genome. Yet the two species have nearly the same genes.
even across this enormous evolutionary divide, purifying selection has (From a woodcut by hiroshige, courtesy of
maintained a few hundred fundamentally important genes in all domains arts and Designs of Japan.)

ECB3 e9.20/9.21
314 Chapter 9 how Genes and Genomes evolve

Figure 9–24 The positions of introns are human gene

conserved between Fugu and humans.
Comparison of the nucleotide sequences
of the human and Fugu genes encoding
the huntingtin protein. Both genes (red)
contain 67 short exons that align in 1:1
correspondence with one another; these
exons are connected by the curved black
lines. the human gene is 7.5 times larger
than the Fugu gene (180,000 versus 24,000
nucleotide pairs), due entirely to the larger
introns in the human sequence. the larger
size of the human introns is due in part to
mobile genetic elements, whose positions Fugu gene
are represented by the blue vertical bars. In
humans, mutation of the huntingtin gene 0.0 100.0 180.0
causes huntington’s disease, an inherited thousands of nucleotide pairs
neurodegenerative disorder. (adapted from
S. Baxendale et al., Nat. Genet. 10:67–76,
1995. With permission from Macmillan
of the living world. By comparing the sequences of these genes in differ-
publishers Ltd.)
ent organisms and seeing how far they have diverged, we can attempt to
construct a phylogenetic tree that goes all the way back to the ultimate
ancestors—the cells at the origins of life from which we all derive.
To construct such a tree, biologists have focused on one particular gene
that is conserved in all living species: the gene that codes for one of the
ribosomal RNAs (rRNAs) of the small ribosomal subunit (see Figure 7–31).
Because the process of translation is fundamental to all living cells, this
component of the ribosome has been well conserved since early in the
history of life on Earth (Figure 9–25).
By applying the same principles used to construct the primate family tree
(see Figure 9–18), the small subunit rRNA nucleotide sequences have
been used to create a single all-encompassing tree of life (Figure 9–26).
Although many aspects of this phylogenetic tree were anticipated by
classical taxonomy (which is based on the outward appearance of organ-
isms), there were also many surprises. Perhaps the most important was
the realization that some of the organisms that were traditionally classed
as “bacteria” are as widely divergent in their evolutionary origins as is
any procaryote from any eucaryote. As discussed in Chapter 1, it is now
apparent that the procaryotes comprise two distinct groups—the bacte-
ECB3 e9.21/9.22
ria and the archaea—that diverged early in the history of life on Earth.
The living world therefore has three major divisions or domains: bacteria,
archaea, and eucaryotes (see Figure 9–26).
Although we humans have been classifying the visible world since antiq-
uity, we now realize that most of life’s genetic diversity lies in the world
of invisible microbes. These organisms have tended to go unnoticed,
unless they cause disease or rot the timbers of our houses. Yet micro-
organisms make up most of the total mass of living matter on our planet.

GTTCCGGGGGGAGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAACCTCACCC human
GCCGCCTGGGGAGTACGGTCGCAAGACTGAAACTTAAAGGAATTGGCGGGGGAGCACTACAACGGGTGGAGCCTGCGGTTTAATTGGATTCAACGCCGGGCATCTTACCA Methanococcus
ACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGC.ACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCT E. coli
GTTCCGGGGGGAGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAACCTCACCC human

Figure 9–25 Some genetic information has been conserved since the beginnings of life. a part of the gene for the small
subunit of rrNa (see Figure 7–31) is shown. Corresponding segments of nucleotide sequence from three distantly related species
(Methanococcus jannaschii, an archaeon; Escherichia coli, a bacterium; and Homo sapiens, a eucaryote) are aligned in parallel. Sites
where the nucleotides are identical between species are indicated by green shading; the human sequence is repeated at the bottom
of the alignment so that all three two-way comparisons can be seen. the dot halfway along the E. coli sequence denotes a site where a
nucleotide has been either deleted from the bacterial lineage in the course of evolution or inserted in the other two lineages. Note that
the sequences from these three distantly related organisms have all diverged from one another to a roughly similar extent, while still
retaining unmistakable similarities.

ECB3 e9.22/9.23
 examining the human Genome 315

A R CH A EA
EU
CA
Sulfolobus
human RY
Haloferax
maize yeast
O TE
A
RI
Aeropyrum
Paramecium
S
cyanobacteria
E
Methanothermobacter
CT

Bacillus
Methanococcus
BA

Dictyostelium

E. coli Euglena

Trypanosoma
common Giardia
Thermotoga
ancestor 1 change/10 nucleotides Trichomonas
Aquifex cell

Figure 9–26 The tree of life has three major divisions. each branch on the tree is labeled with the name of a
representative member of that group, and the length of each branch corresponds to the degree of difference in their
small subunit rrNa sequences (see Figure 9–25). Note that all the organisms we can see with the unaided eye—
animals, plants, and fungi (highlighted in yellow)—represent only a small subset of the diversity of life.

ECB3 e9.23/9.24

Only now—through the analysis of DNA sequences—are we beginning

to glimpse a picture of life on Earth that is not grossly distorted by our
biased perspective as large animals living on dry land.

EXAMINING THE HUMAN GENOME

We have seen how genomes change gradually over time, and how com-
paring the genomes of different species can highlight crucial events in
their evolutionary histories. We shall now turn our attention to our own
genome, which is full of clues about where we came from and who we
are.
The human genome—all 3.2 ¥ 109 nucleotide pairs—is distributed over
22 autosomes and 2 sex chromosomes. The human genome sequence
refers to the complete nucleotide sequence of the DNA contained in
these 24 chromosomes. A wide variety of humans contributed DNA for
the genome-sequencing project, and because individual humans differ
from one another by an average of 1 nucleotide in 1000, the published
human genome sequence is a composite of many individual sequences.
It represents at once both our unity and our diversity as a species.
At its peak, the Human Genome Project generated raw nucleotide
sequences at a rate of 1000 nucleotides per second, around the clock.
(A)
The sheer quantity of information provided by this effort is staggering
(Figure 9–27). Although it will be many decades before the data are fully
analyzed, information gleaned from the human sequence has already
affected the content of every chapter in this book. In this section, we
describe some of our genome’s most striking features.

Figure 9–27 The human genome stretches back to our origins.

If each nucleotide pair is drawn to span 1 mm, the scale in (a), then
the human genome would extend 3200 km (approximately 2000
miles)—far enough to stretch across the center of africa, the site of our
human origins (red line in B). at this scale, there would be, on average,
a protein-coding gene every 130 m. an average gene would extend
for 30 m, but the coding sequences in this gene would add up to only
just over a meter. (B)
316 Chapter 9 how Genes and Genomes evolve
?
Question 9–4
Mobile genetic elements, such as
the Alu sequences, are found in
many copies in human DNA. In what
ways could the presence of an Alu
sequence affect a nearby gene?
Figure 9–28 The sequence of
Chromosome 22 shows how human
chromosomes are organized.
(a) Chromosome 22, one of the
smallest human chromosomes, contains
48 ¥ 106 nucleotide pairs and makes
up approximately 1.5% of the entire
human genome. Most of the left arm
of Chromosome 22 consists of short
repeated sequences of DNa that are
packaged in a particularly compact
form of chromatin (heterochromatin),
as discussed in Chapter 5. (B) a tenfold
expansion of a portion of Chromosome
22 shows about 40 genes. those in
dark brown are known genes and
those in red are predicted genes.
(C) an expanded portion of (B) shows
the entire length of several genes.
(D) the intron–exon arrangement of
a typical gene is shown after a further
tenfold expansion. each exon (red)
codes for a portion of the protein, while
the DNa sequence of the introns (gray)
is relatively unimportant. (adapted
from the International human Genome
Sequencing Consortium, Nature
409:860–921, 2001. With permission
from Macmillan publishers Ltd.)
The Nucleotide Sequence of the Human Genome Shows
How Our Genes Are Arranged
When the DNA sequence of human Chromosome 22, one of the smallest
human chromosomes, was completed in 1999, it became possible for the
first time to see exactly how genes are arranged along an entire verte-
brate chromosome (Figure 9–28). With the publication of the “first draft”
of the entire human genome in 2001, and the finished draft sequence
in 2004, we now have a panoramic view of the genetic landscape of all
human chromosomes (Table 9–1).
The first striking feature of the human genome is how little of it—only
a few percent—codes for proteins, structural RNAs, and catalytic RNAs
(Figure 9–29). Almost half of the remaining DNA is made up of mobile
genetic elements that have colonized our genome over evolutionary
time. Because they have accumulated mutations, most of these elements
can no longer move; rather, they are relics from an earlier evolutionary
era when mobile genetic elements ran rampant through our genome.
A second notable feature of the human genome is the very large average
gene size of 27,000 nucleotide pairs. Only about 1300 nucleotide pairs are
required to encode a protein of average size (about 430 amino acids in
humans). Most of the remaining DNA in a gene consists of long stretches
of noncoding DNA in the introns between the relatively short protein-
coding exons (see Figure 9–28D). In addition to the introns and exons,
each gene is associated with regulatory DNA sequences that ensure that
the gene is expressed at the proper level and time, and in the proper type
of cell. In humans, these regulatory DNA sequences are typically spread
out over tens of thousands of nucleotide pairs, much of which seems to
be ‘spacer’ DNA.
Exons and regulatory sequences comprise less than 2% of the human
genome. Yet from comparative genomic studies, we estimate that 5% of
the human genome is highly conserved with other mammalian genomes
(A) Human Chromosome 22 in its mitotic conformation,
composed of two DNA molecules, each 48 ¥ 106 nucleotide pairs long
heterochromatin
¥10
10% of chromosome arm ~40 genes
(B)
¥10
1% of chromosome containing 4 genes
(C)
¥10
single gene of 3.4 ¥ 104 nucleotide pairs
(D)
exon intron gene expression
regulatory DNA
sequences
protein
folded protein
 examining the human Genome 317

TABlE 9–1 SoME VITAl STATISTICS foR THE HuMAN GENoME

DNa length 3.2 ¥ 109 nucleotide pairs*
Number of genes approximately 25,000
Largest gene 2.4 ¥ 106 nucleotide pairs
Mean gene size 27,000 nucleotide pairs
Smallest number of exons per gene 1
Largest number of exons per gene 178
Mean number of exons per gene 10.4
Largest exon size 17,106 nucleotide pairs
Mean exon size 145 nucleotide pairs
Number of pseudogenes** more than 20,000
percentage of DNa sequence in exons (protein 1.5%
coding sequences)
percentage of DNa in other highly conserved 3.5%
sequences***
percentage of DNa in high-copy repetitive approximately 50%
elements
*the sequence of 2.85 billion nucleotides is known precisely (error rate of only
about one in 100,000 nucleotides). the remaining DNa consists primarily of short
highly repeated sequences that are tandemly repeated, with repeat numbers
differing from one individual to the next.
**a pseudogene is a nucleotide sequence of DNa closely resembling that of
a functional gene but containing numerous mutations that prevent its proper
expression. Most pseudogenes arise from the duplication of a functional gene
followed by the accumulation of damaging mutations in one copy.
***these include DNa encoding 5¢ and 3¢ Utrs (untranslated regions of mrNas),
genes for structural and catalytic rNas, regulatory DNa, and conserved regions of
unknown function.

and is therefore likely to be functionally important (see Figure 9–22). We

simply do not know the function of this other DNA.
Another surprising feature of the human genome is its relatively small
number of genes. Earlier estimates had been in the neighborhood of
100,000 (see How We Know, pp. 318–319). Although the exact number
is still not certain, revised estimates place the number of human genes
Figure 9–29 The bulk of the human
at about 25,000, bringing us much closer to the gene numbers for sim- genome is made of noncoding and
pler multicellular animals, such as Drosophila (14,000) and C. elegans repetitive nucleotide sequences. the
(19,000). LINes, SINes, retroviral-like transposons,
and DNa-only transposons are mobile
Finally, the nucleotide sequence of the human genome has revealed that genetic elements that have multiplied in
the critical information it carries seems to be in an alarming state of dis- our genome by replicating themselves
array. As one commentator described our genome: “In some ways it may and inserting the new copies in different
resemble your garage/bedroom/refrigerator/life: highly individualistic, positions. these mobile genetic elements
are discussed in Chapter 6 (pp. 222–223).
but unkempt; little evidence of organization; much accumulated clutter
Simple repeats are short nucleotide
(referred to by the uninitiated as ‘junk’); and the few patently valuable sequences (less than 14 nucleotide pairs)
items indiscriminately, apparently carelessly, scattered throughout.” that are repeated again and again for
long stretches. Segment duplications are
percentage large blocks of the genome (1000–200,000
0 10 20 30 40 50 60 70 80 90 100 nucleotide pairs) that are present at two or
more locations in the genome. the unique
sequences that are not part of any introns or
LINEs SINEs introns exons (dark green) include gene regulatory
retroviral-like elements protein-coding regions elements, as well as sequences whose
DNA-only transposon ‘fossils’ functions are not known. the most highly
GENES
MOBILE GENETIC ELEMENTS repeated blocks of DNa in heterochromatin
non-repetitive DNA that is in have not yet been completely sequenced;
simple repeats neither introns nor exons therefore about 10% of human DNa
segment duplications sequences are not represented in this
REPEATED SEQUENCES UNIQUE SEQUENCES diagram. (Data courtesy of e. Margulies.)
318
hOW We KNOW:
CouNTING GENES
How many genes does it take to make a human? It
seems a natural thing to wonder. If 6000 genes can pro-
duce a yeast, and 14,000 a fly, how many are needed
to encode a human being—a complex creature, curi-
ous and clever enough to study its own genome? Until
researchers completed the first draft of the human
genome sequence, the most frequently cited estimate
was 100,000. But where did that figure come from? And
how was the revised estimate of only 25,000 genes
derived?
Walter Gilbert, a physicist-turned-biologist who won a
Nobel Prize for developing techniques for sequencing
DNA, was one of the first to throw out a ballpark esti-
mate of the number of human genes. In the mid-1980s,
Gilbert suggested that humans could have 100,000
genes, an estimate based on the average size of the
few human genes known at the time (about 3 ¥ 104
nucleotide pairs) and the size of our genome (3 ¥ 109
nucleotide pairs). This back-of-the-envelope calcula-
tion yielded a number with such a pleasing roundness
that it wound up being quoted widely in articles and
textbooks.
The calculation provides an estimate of the number of
genes a human could have in principle, but it does not
address the question of how many genes we actually
do have. As it turns out, that question is not so easy
to answer, even with the complete human genome
sequence in hand. The problem is, how does one iden-
tify a gene? We saw in Chapter 5 that genes are defined
as regions of DNA that determine the characteristics of
a cell or organism, and that these DNA segments usu-
ally encode a protein or a functional RNA. We now know
that such coding segments comprise only a few percent
of the human genome. So, looking at a given piece of
raw DNA sequence—an apparently random string of As,
Ts, Gs, and Cs—how can one tell which parts are genes
and which parts are ‘junk’? Being able to accurately and
reliably distinguish the coding sequences from the non-
coding sequences in a genome is necessary before one
can hope to locate and count its genes.
Signals and chunks
As always, the situation is simplest in procaryotes and
simple eucaryotes such as yeasts. To identify genes in
such a genome, one essentially searches through the
entire DNA sequence looking for open reading frames
(ORFs). These are long sequences—say, 100 codons or
more—that lack stop codons. A random sequence of
nucleotides will by chance encode a stop signal for pro-
tein synthesis about once every 20 codons (as there are
three stop codons in the set of 64 possible codons). So
finding an ORF—a continuous nucleotide sequence that
encodes more than 100 amino acids—is the first step in
identifying a good candidate for a gene. Today compu-
ter programs are used to search for such ORFs, which
begin with an initiation codon, usually ATG, and end
with a termination codon, TAA, TAG, or TGA (Figure
9–30).
In animals and plants, the process of identifying ORFs is
complicated by the presence of large intron sequences
that interrupt the coding portions of genes. As we have
seen, these sequences are generally much larger than
the exons themselves, which might represent only a few
percent of the gene. In human DNA, exons sometimes
contain as few as 50 codons (150 nucleotide pairs),
while introns may exceed 10,000 nucleotide pairs in
length. Fifty codons is too short to generate a statisti-
cally significant ‘ORF signal,’ as it is not all that unusual
for 50 random codons to lack a stop signal. Moreover,
introns are so long that they are likely to contain by
chance quite a bit of ‘ORF noise,’ numerous stretches
of sequence lacking stop signals. Finding the true ORFs
in this sea of information in which the noise often out-
weighs the signal is quite difficult. Thus, to identify
genes in eucaryotic DNA, it is also necessary to search
for other distinctive features that mark the presence of
a gene. These include the splicing sequences that signal
an intron–exon boundary (see Figure 7–19) or distinctive
DNA regulatory sequences that lie upstream of a gene.
But the most powerful approach to identifying genes is
through homology with genes from other organisms.
For example, even a very short ORF is likely to be an
exon if the amino acid sequence it encodes matches up
with a known protein from another organism. In addi-
tion, if a presumptive ORF is highly conserved in several
different genomes, it is very likely to code for a protein
even though the gene that contains it may not yet have
been identified or studied (see Figure 9–22). Through
such comparisons (for example, human versus mouse
versus zebrafish) it is possible to identify short ORFs of
unknown function and, with more work, to piece them
together into whole genes.
In 1992, researchers used a computer program to
predict protein-coding regions in preliminary human
sequence data. They found two genes in a 58,000-
nucleotide-pair segment of Chromosome 4, and
five genes in a 106,000-nucleotide-pair segment of
Chromosome 19. That works out to an average of 1
gene every 23,000 nucleotide pairs. Extrapolating from
that density to the whole genome would give humans
nearly 130,000 genes. It turned out, however, that the
chromosomes the researchers analyzed had been cho-
sen for sequencing precisely because they appeared
to be gene-rich. When the estimate was adjusted to
take into account the gene-poor regions of the human
genome—guessing that half of the human genome had
maybe one-tenth of that gene-rich density—the esti-
mated number dropped to 71,000.
 Counting Genes 319

Matching tags Human gene countdown

Of course, these estimates are based on what we think
genes look like; however, we are still learning how
to recognize genes. A different but complementary
approach to counting the coding regions in a genome
involves determining experimentally how many genes
are actually expressed.
To determine which protein-coding genes are expressed
in a particular cell type or tissue, mRNAs are isolated and
converted into complementary DNAs, or cDNAs (dis-
cussed in Chapter 10). Because mRNAs are produced by
transcription and splicing from protein-coding genes,
this collection of cDNAs represents the sequences of all
genes that were being expressed in the cells from which
the mRNA was prepared. The cDNAs are prepared from
a variety of tissues because the goal of this approach
is to identify every gene, and different tissues express
different genes. An additional benefit of working with
cDNAs stems from the fact that mRNAs lack the introns
and the stretches of DNA that lie between genes; thus,
cDNA sequences correspond directly to the coding
sequences in the genome.
Short fragments of these cDNAs, called expressed
sequence tags, or ESTs, are then sequenced; the result-
ing EST sequences are compared with the nucleotide
sequence of the entire genome to locate the gene that
corresponds to each EST. By carefully analyzing how
ESTs map onto the human genome, researchers arrived
at an estimate of about 24,000 genes that code for
proteins.
Now the most accurate approach to predicting genes
combines different types of data, including (1) EST
analyses, (2) computerized searches of the genome for
ORFs and for sequences that signal the splice sites at the
ends of every exon, and (3) comparisons with genome
sequences from other organisms, especially other
mammals. This last approach is particularly powerful
because, as we have seen in this chapter, mammalian
genomes are sufficiently divergent that only the most
crucial portions of their genomes—the exons and regu-
latory sequences, for example—are similar (see Figure
9–22).
Although the estimates are all converging around
24,000 to 25,000, it could be many years before we
have the final answer to how many genes it takes to
make a human. For example, genes that code for short
RNAs such as microRNAs are particularly difficult to
identify. As computational methods are refined, and as
we collect more data on the human genome and on
the genome sequences of other organisms, our ability
to predict where genes reside within a particular DNA
sequence can only improve. In the end, however, know-
ing the exact number of genes is not nearly as important
as understanding the functions of each gene and how
it interacts with other genes to build a human being.
These are central questions that are likely to occupy
biologists for at least the next century.

nucleotide pairs x1000

0 1 2 3 4 5 6 7

3 reading
frames of
DNA strand A

3 reading
frames of
DNA strand B

stop codons methionine codons

Figure 9–30 Computer programs are used to find genes. In this example, a DNa sequence of 7500 nucleotide pairs from the
pathogenic yeast Candida albicans was fed into a computer, which then translated the entire sequence in all six possible open reading
frames (OrFs), three from each strand (see Figure 7–25). the output displays each reading frame as a horizontal column, with the stop
codons (tGa, taa, and taG) marked by the longer vertical lines and methionine codons (atG) marked by the shorter lines. Four OrFs
(yellow) can be clearly identified by the statistically significant absence of stop codons. For each OrF, the presumptive initiation codon
(atG) is indicated in red. the additional atG codons in the OrFs code for methionine.
320 Chapter 9 how Genes and Genomes evolve

Accelerated Changes in Conserved Genome Sequences

Help Reveal What Makes Us Human
As soon as both the human and the chimpanzee genome sequences
became available, scientists began searching for DNA sequence changes
that might account for the striking differences between us and them. With
3 billion nucleotide pairs to compare in the two species, this might seem
an impossible task. But the job was made much easier by confining the
search to the sequences that are highly conserved across multiple mam-
malian species (see Figure 9–22), representing parts of the genome that
are most likely to be functionally important. Although these sequences
are conserved, they are not identical: when the version in one species is
compared with that in another, they are typically found to have drifted
apart by a small amount corresponding simply to the time elapsed since
the last common ancestor. In a small proportion of cases, however,
one sees signs of a sudden evolutionary spurt. For example, some DNA
sequences that have been highly conserved in other mammalian spe-
cies are found to have changed exceptionally fast during the six million
years of human evolution since we diverged from the chimpanzees. Such
human accelerated regions are thought to reflect functions that have been
especially important in making us different in some useful way.
In one study, about 50 such sites were identified—one-quarter of which
were located near genes associated with neural development. The
sequence exhibiting the most rapid change (18 changes between human
and chimp, compared with only two changes between chimp and chicken)
was examined further and found to encode a short noncoding RNA mol-
ecule that is produced in the human cerebral cortex at a critical time
during brain development. Although the function of this RNA is not yet
known, this exciting finding is stimulating further studies that will hope-
fully shed light on features of the human brain that distinguish us from
closely related species.

Genetic Variation Within the Human Genome Contributes

to Our Individuality
With the exception of identical twins, no two people have exactly the
same genome. When the same region of the genome from two different
humans is compared, the nucleotide sequences typically differ by about
0.1%. That might seem an insignificant degree of variation, but consider-
ing the size of the human genome, that amounts to some 3 million genetic
differences in each maternal or paternal chromosome set between one
person and the next. Detailed analysis of the data on human genetic vari-
ation suggests that the bulk of this variation was already present early in
our evolution, perhaps 100,000 years ago, when the human population
was still small. This means that a great deal of the genetic variation we
possess today was inherited from our early human ancestors.
Most of the genetic variation in the human genome takes the form of
single base changes called single-nucleotide polymorphisms (SNPs,
pronounced snips). These polymorphisms are simply points in the
genome that differ in nucleotide sequence between one portion of the
population and another—positions where one large fraction of the popu-
lation has a G-C nucleotide pair, for example, while another has an A-T
(Figure 9–31). Two human genomes chosen at random from the world’s
population will differ by approximately 2.5 ¥ 106 SNPs that are scattered
throughout the genome. Because SNPs are present at such a high density,
they provide useful markers in genetic analyses in which one attempts to
link a specific trait (such as disease susceptibility) with a particular pat-
tern of SNPs (as we discuss in Chapter 19). This type of analysis should
 examining the human Genome 321

~1000 nucleotide pairs Figure 9–31 Single-nucleotide

T G T G A C C G T
polymorphisms (SNPs) are sequences
individual A A C A C T G G C A in the genome that differ by a single
T A T G T C C A T
nucleotide pair between one portion of
individual B the population and another. Most, but
A T A C A G G T A
T A T G A C C A T not all, such changes in the human genome
individual C
A T A C T G G T A occur in regions where they do not affect
individual D
T A T G A C C A T the function of a gene.
A T A C T G G T A

SNP1 SNP2 SNP3

lead to improvements in health care by allowing doctors to determine

whether an individual is susceptible to a disease, such as heart disease,
long before he or she shows any symptoms. The person can then change
his or her behavior to help prevent the disease before it arises.
Another important source of variation inherited from our ancestors is the
duplication and deletion of large blocks of DNA. When the genome of any
person is compared with the standard reference genome, one observes
roughly 100 differences involving long blocks of sequence. Some of
these differences are very common, whereas others are present in only
a small minority of people. From an initial sampling, nearly half of these
sequences contain known genes. In retrospect, this type of variation is
not surprising, given the extensive history of DNA addition and DNA loss
in vertebrate genomes discussed earlier. Exactly how it contributes to our
individuality, however, remains a mystery.
ECB3 e20.23/9.29

In addition to the SNPs and the duplications and deletions that we inher-
ited from our ancestors, humans also possess repetitive nucleotide Question 9–5
sequences that are particularly prone to new mutations. CA repeats, for You are interested in finding out
example, are ubiquitous in the human genome. Nucleotide sequences the function of a particular gene
containing large numbers of CA repeats are often replicated inaccu- in the mouse genome. You have
rately (imagine trying to copy a word that is nothing more than a string determined the nucleotide sequence
of CACACACACACACACA…); hence the precise number of repeats can of the gene, defined the portion that
vary widely from one individual to the next. Because they show such codes for its protein product, and
exceptional variability, and because this variability has arisen so recently, searched the relevant database for
CA repeats, and others like them, make ideal markers for differences similar sequences; however, neither
between individual humans. Differences in the numbers of CA and other the gene nor the encoded protein
types of repeats at different positions in the genome are used to identify resembles anything previously
individuals by DNA fingerprinting in crime investigations, paternity suits, described. What types of additional
and other forensic applications (see Figure 10–19).

?
information about the gene and the
Most of the variations in the human genome sequence are genetically encoded protein would you like to
silent, as they fall within DNA sequences in noncritical regions of the know in order to narrow down its
genome. Such variations have no effect on how we look or how our cells function, and why? Focus on the
function. This means that only a small subset of the variation we observe information you would want, rather
in our DNA is responsible for the heritable differences from one human than on the techniques you might
to the next. As we discuss in Chapter 19, a major challenge in human use to get that information.
genetics is to learn to recognize those relatively few variations that are
functionally important against the large background of neutral variation.

The Human Genome Contains Copious Information Yet

to Be Deciphered
Even with the human genome sequence in hand, many questions
will continue to challenge cell biologists throughout the next century.
Perhaps the most perplexing one is this: given that a human, a chimp,
and a mouse contain essentially the same genes, and therefore the same
proteins, what makes these creatures so different from each other?
The answer, it seems, will come in large part from studies of gene regu-
lation. The proteins encoded in the genome are like the components of
a construction kit. By assembling the components in different combina-
322 Chapter 9 how Genes and Genomes evolve
A exons
1 12 1
Dscam gene
Figure 9–32 Alternative splicing of RNA
transcripts can produce many distinct
proteins. the Drosophila Dscam proteins
are receptors that help nerve cells make
their appropriate connections. the final
mrNa transcript contains 24 exons, four
of which (denoted a, B, C, and D) are
present in the Dscam gene as arrays of
alternative exons. each mature mrNa
contains 1 of 12 alternatives for exon a
(red), 1 of 48 alternatives for exon B (green),
1 of 33 alternatives for exon C (blue), 1
of 2 alternatives for exon D (yellow), and
all of the 19 invariant exons (gray). If all
possible splicing combinations were used,
38,016 different proteins could in principle
be produced from the Dscam gene. Only
one of the many possible splicing patterns
(indicated by the magenta line) and the
mature mrNa it produces is shown.
(adapted from D.L. Black, Cell 103:
367–370, 2000. With permission from
elsevier.)
B exons C exons D exons
48 1 33 12
A8 C16
mRNA
B24 D2
one out of 38,016 possible splicing patterns
tions and in different orders, many different things can be built with the
same kit. In the end, however, the overall shape of the final object is
determined by the instructions that prescribe how the components are
to be put together.
To a large extent, the instructions needed to produce a multicellular ani-
mal are contained in the noncoding regulatory DNA that is associated
with each gene. As discussed in Chapter 8, this DNA contains, scattered
within it, dozens of separate regulatory elements—short DNA segments
that serve as ECB3
binding sites for specific transcription regulators. This regu-
e9.30/9.29
latory DNA can be said to define the sequential program of development:
the rules that cells follow as they proliferate, assess their positions in the
embryo, and switch on new sets of genes accordingly.
Although comparisons among many different species are a powerful way
to pinpoint key regulatory sequences in a vast excess of unimportant
DNA, we still do not know how to read these sequences accurately. For
example, different transcription regulators can bind to the same short
stretch of DNA, so that knowing the DNA sequence is not enough to spec-
ify which protein or proteins might actually regulate the gene. In addition,
the fact that control of gene expression occurs in complex and combina-
torial ways (see Figure 8–12) complicates our attempts to decipher when
in development and in which type of cell each gene is expressed.
Another challenge in interpreting the information encoded in the human
genome comes from the prevalence of alternative splicing. We know
that most human genes undergo alternative splicing, allowing cells to
produce a range of related but distinct proteins from a single gene (see
Figure 7–21). Often this splicing is regulated, so that one form of the pro-
tein is produced in one type of tissue, while other forms are produced
preferentially in other tissues. In one extreme case, from Drosophila, a
single gene might produce as many as 38,000 different protein variants
through alternative splicing (Figure 9–32). Thus an organism can produce
far more protein products than it has genes. We do not yet know enough
about the biology of alternative splicing to predict exactly which human
genes are subject to this process, and when and where during develop-
ment such regulation might occur. However, it does seem that alternative
splicing is especially prevalent in the developing brain.
Another uncertainty in interpreting the human genome concerns the pre-
cise roles of microRNAs (see pp. 290–291). Discovered relatively recently,
these short RNAs regulate as many as one-third of all human genes, yet
few of them have been studied in any detail. Finally, although an esti-
mated 1.5% of the human genome codes for protein, an additional 3.5% is
highly conserved when compared with that of other mammalian genom-
es—and is therefore presumed to be important (see p. 312). Some of this
conserved DNA produces RNA molecules of known function and some is
regulatory DNA; the rest remains mysterious.
 essential Concepts 323

The human body is formed as the result of complex sequences of decisions

that cells make as they proliferate and specialize during our develop-
ment: which RNA molecules and which proteins are to be made where,
and exactly when and how much of each is to be produced. The infor-
mation for all these decisions is contained within the human genome
sequence, but we are only beginning to learn how to read this type of
code. Deciphering this information is one of the great challenges for the
next generation of cell biologists.

ESSENTIAL CONCEPTS
• By comparing the nucleotide or amino acid sequences of contempo-
rary organisms we are beginning to reconstruct how genomes have
evolved in the billions of years that have elapsed since the appear-
ance of the first cells.
• Genetic variation—the raw material for evolutionary change—occurs
by a variety of mechanisms that alter the nucleotide sequences
of genomes. These changes range from simple point mutations to
larger-scale duplications and rearrangements.
• Genetic changes that offer an organism a selective advantage or
those that are selectively neutral are the most likely to be perpetu-
ated. Changes that seriously compromise an organism’s fitness are
eliminated through natural selection.
• Gene duplication is one of the most important sources of genetic
diversity. Once a gene has been duplicated, the two copies can accu-
mulate different mutations and thereby diversify to perform different
functions. Over evolutionary time, repeated rounds of gene duplica-
tion and divergence can produce large gene families.
• The evolution of new proteins is thought to have been greatly facili-
tated by the swapping of exons between genes to create hybrid
proteins with new functions.
• The human genome contains 3.2 ¥ 109 nucleotide pairs divided
among 22 autosomes and 2 sex chromosomes. Only a few percent of
that DNA codes for proteins and for structural, regulatory, and cata-
lytic RNAs.
• Individual humans differ from one another by an average of 1 nucleo-
tide pair in every 1000; this variation underlies our individuality and
provides the basis for identifying individuals by DNA analysis.
• Comparing genome sequences of different species provides a power-
ful way to identify genes and to highlight other functionally important
parts of the genome.
• Because related species (such as human and mouse) share many
genes in common, evolutionary changes that affect how these genes
are regulated are especially important in understanding the differ-
ences between species.

Key terms
conserved synteny horizontal gene transfer
divergence open reading frame (ORF)
exon shuffling phylogenetic tree
germ cell point mutation
germ line purifying selection
gene duplication and single-nucleotide polymorphism (SNP)
divergence somatic cell
homologous gene
324 Chapter 9 how Genes and Genomes evolve
QUESTIONS
QUESTION 9–6
Discuss the following statement: “Mobile genetic elements
are parasites. They are harmful to the host organism and
therefore place it at an evolutionary disadvantage.”
QUESTION 9–7
Human Chromosome 22 (48 Mb in length) has about 700
protein-coding genes, which average 19,000 nucleotide
pairs in length and contain an average of 5.4 exons, each
of which averages 266 nucleotide pairs. What fraction of
the average protein-coding gene is converted into mRNA?
What fraction of the chromosome do these genes occupy?
QUESTION 9–8
(True/False) The majority of human DNA is unimportant
junk. Explain your answer.
QUESTION 9–9
Mobile genetic elements make up nearly half of the human
genome and are inserted more or less randomly throughout
it. However, in some spots these elements are rare, as
illustrated for a cluster of genes called HoxD, which lies on
Chromosome 2 (Figure Q9–9). This cluster is about
Chromosome 22
Chromosome 2
100 kb
Figure Q9–9
100 kb in length and contains nine genes whose differential
expression along the anteroposterior axis of the developing
embryo helps establish the basic body plan for humans
(and for other animals). Why do you suppose that mobile
genetic elements are so rare in this cluster? In Figure Q9–9,
lines that project upward indicate exons of known genes.
Lines that project downward indicate mobile genetic
(A) HUMAN b-GLOBIN cDNA
COMPARED WITH HUMAN
b-GLOBIN GENE
human b-globin cDNA 3¢
5¢
5¢ human b-globin gene
Figure Q9–10
elements; they are so numerous they merge into nearly a
solid block outside the HoxD cluster. For comparison, an
equivalent region of Chromosome 22 is shown.
QUESTION 9–10
An early graphical method for comparing nucleotide
sequences—the so-called diagon plot—still yields one of
the best visual comparisons of sequence relatedness. An
example is illustrated in Figure Q9–10, in which the human
b-globin gene is compared with the human cDNA for b
globin (which contains only the coding portion of the gene;
Figure Q9–10A) and to the mouse b-globin gene (Figure
Q9–10B). Diagon plots are generated by comparing blocks
of sequence, in this case blocks of 11 nucleotides at a
time. If 9 or more of the nucleotides match, a dot is placed
on the diagram at the coordinates corresponding to the
blocks being compared. A comparison of all possible blocks
generates diagrams such as the ones shown in Figure
Q9–10, in which sequence similarities show up as diagonal
lines.
A. From the comparison of the human b-globin gene
with the human b-globin cDNA (Figure Q9–10A), can you
deduce the positions of exons and introns in the b-globin
gene?
B. Are the exons of the human b-globin gene (indicated
by shading in Figure Q9–10B) similar to those of the mouse
b-globin gene? Identify and explain any key differences.
C. Is there any sequence similarity between the human
and mouse b-globin genes that lies outside the exons?
If so, identify its location and offer an explanation for its
preservation during evolution.
D. Did the mouse or human gene undergo a change of
HoxD cluster intron length during their evolutionary divergence? How
can you tell?
QUESTION 9–11
Your advisor, a brilliant bioinformatician, has high regard
for your intellect and industry. She suggests that you write
a computer program that will identify the exons of protein-
coding genes directly from the sequence of the human
genome. In preparation for that task, you decide to write
down a list of the features that might distinguish protein-
coding sequences from intronic DNA and from other
(B) MOUSE b-GLOBIN GENE
COMPARED WITH
HUMAN b-GLOBIN GENE
3¢
mouse b-globin gene
5¢
3¢ 5¢ human b-globin gene 3¢
 end-of-Chapter Questions 325

sequences in the genome. What features would you list? Gene Amino Acids Rates of Change
(You may wish to review basic aspects of gene expression in
Chapter 7.) Nonsynonymous Synonymous
histone h3 135 0.0 4.5
QUESTION 9–12 hemoglobin a 141 0.6 4.4
Why do you expect to encounter a stop codon about every Interferon g 136 3.1 5.5
20 codons or so in a random sequence of DNA?
rates were determined by comparing rat and human sequences
and are expressed as nucleotide changes per site per 109 years.
QUESTION 9–13 the average rate of nonsynonymous changes for several dozen
The genetic code (see Figure 7–24) relates the nucleotide rat and human genes is about 0.8.
sequence of mRNA to the amino acid sequence of encoded
proteins. Ever since the code was deciphered, some have QUESTION 9–15
claimed it must be a frozen accident—that is, the system
randomly fell into place in some ancestral organism and Some genes evolve more rapidly than others. But how
was then perpetuated unchanged throughout evolution; can this be demonstrated? One approach is to compare
others have argued that the code has been shaped by several genes from the same two species, as shown for
natural selection. rat and human in the table above. Two measures of rates
A striking feature of the genetic code is its inherent of nucleotide substitution are indicated in the table.
resistance to the effects of mutation. For example, a Nonsynonymous changes refer to single-nucleotide
change in the third position of a codon often specifies the changes in the DNA sequence that alter the encoded
same amino acid or one with similar chemical properties. amino acid (ATC Æ TTC, which gives isoleucine Æ
But is the natural code more resistant to mutation than phenylalanine, for example). Synonymous changes refer
other possible versions? The answer is an emphatic “Yes,” to those that do not alter the encoded amino acid
as illustrated in Figure Q9–13. Only one in a million (ATC Æ ATT, which gives isoleucine Æ isoleucine, for
computer-generated “random” codes is more error- example). (As is apparent in the genetic code, Figure 7–24,
resistant than the natural genetic code. there are many cases where several codons correspond to
Does the resistance to mutation of the actual genetic the same amino acid.)
code argue in favor of its origin as a frozen accident or as a A. Why are there such large differences between the
result of natural selection? Explain your reasoning. synonymous and nonsynonymous rates of nucleotide
substitution?
B. Considering that the rates of synonymous changes
25 are about the same for all three genes, how is it possible
number of codes (thousands)

for the histone H3 gene to resist so effectively those

20 nucleotide changes that alter its amino acid sequence?

15
C. In principle, a protein might be highly conserved
because its gene exists in a ‘privileged’ site in the genome
10
that is subject to very low mutation rates. What feature of
natural the data in the table argues against this possibility for the
code
5
histone H3 protein?

0 QUESTION 9–16
0 5 10 15 20
susceptibility to mutation
Plant hemoglobins were found initially in legumes,
where they function in root nodules to lower the oxygen
Figure Q9–13 concentration, allowing the resident bacteria to fix
nitrogen. These hemoglobins impart a characteristic pink
color to the root nodules.The discovery of hemoglobin in
QUESTION 9–14 plants was initially surprising because scientists regarded
hemoglobin as a distinctive feature of animal blood. It
Which one of the processes listed below is NOT thought was hypothesized that the plant hemoglobin gene was
to contribute significantly to the evolution of new protein- acquired by horizontal transfer from an animal. Many
coding genes? more hemoglobin genes have now been sequenced
A. Duplication of genes to create extra copies that can from a variety of organisms, and a phylogenetic tree of
acquire new functions. hemoglobins is shown in Figure Q9–16.
B. Formation of new genes de novo from noncoding DNA A. Does the evidence in the tree support or refute the
in the genome. hypothesis that the plant hemoglobins arose by horizontal
Figure 01-01 Mutation
C. Horizontal resistance
transfer of DNA ofofthe
between cells natural gene transfer?
different
versus other possible codes (Problem 1-5). B. Supposing that the plant hemoglobin genes were
codespecies.
originally derived by horizontal transfer (from a parasitic
D. Mutation of existing genes to create new functions.
nematode, for example); what would you expect the
E. Shuffling of protein domains by gene rearrangement. phylogenetic tree to look like?
326 Chapter 9 how Genes and Genomes evolve

VERTEBRATES
Whale
Rabbit
Chicken Cat
Cobra
Salamander Human
Cow
Frog

Goldfish

PLANTS

Barley

Earthworm Lotus
Alfalfa
Insect Bean

Clam

INVERTEBRATES
Nematode
Chlamydomonas

Paramecium
PROTOZOA

Figure Q9–16

QUESTION 9–17
The accuracy of DNA replication in the human germ cell
line is such that on average only about 0.6 out of the
6 billion nucleotides is altered at each cell division. Because
most of our DNA is not subject to any precise constraint
on its sequence, most of these changes are selectively
neutral. Any two modern humans picked at random will
showFigure 01-06 of nucleotide sequence in every
about 1 difference
1000 nucleotides. Suppose we are all descended from
a single pair of ancestors—Adam
Phylogenetic tree for andhemoglobin
Eve—who weregenes from
genetically identicalof
a variety andspecies
homozygous (each chromosome
(Problem 1-37). The
was identical
legumes to its
are homolog).
shown Assuming
in bold. that all germ-line
mutations that arise are preserved in descendants, how
many cell generations must have elapsed since the days
of Adam and Eve for 1 difference per 1000 nucleotides
to have accumulated in modern humans? Assuming that
each human generation corresponds on average to 200
cell-division cycles in the germ-cell lineage and allowing 30
years per human generation, how many years ago would
this ancestral couple have lived?
Chapter TEN 10
Analyzing Genes and Genomes

The twenty-first century promises to be an exciting time for cell biology. MANIPULATING AND
New methods for analyzing and manipulating DNA, RNA, and proteins are ANALYZING DNA
fueling an information explosion and allowing us to study genes and cells
MOLECULES
in previously unimagined ways. We now have access to the sequences of
many billions of nucleotides, providing the molecular blueprints for doz-
ens of organisms—from microbes and plants to birds, insects, humans, DNA CLONING
and other mammals. And powerful new techniques are helping us to
decipher this information, allowing us not only to compile huge, detailed
catalogs of genes and proteins but to begin to unravel how these com- DECIPHERING AND
ponents work together to form functional cells, tissues, and organisms. EXPLOITING GENETIC
The goal is nothing short of obtaining a complete understanding of the INFORMATION
process that takes place, moment to moment, inside all living things.
This technological revolution has been powered, in large part, by the
development of methods that have dramatically increased our ability to
handle DNA. In the early 1970s, it became possible, for the first time,
to isolate a given piece of DNA out of the many millions of nucleotide
pairs in a typical chromosome. This in turn made it possible to generate
new DNA molecules in the test tube and to introduce this custom-made
genetic material back into living organisms. These developments—
dubbed recombinant DNA technology or genetic engineering—make it
possible to create chromosomes with combinations of genes that could
never have formed naturally, or combinations that could conceivably
occur in nature but might take thousands of years of chance events to
come together.
Of course, humans have been experimenting with DNA, albeit without
realizing it, for millennia. Modern garden-rose varieties, for example, are
328 Chapter 10 analyzing Genes and Genomes
Figure 10–1 Humans have been
experimenting with DNA for millennia.
(a) the oldest known depiction of a rose in
Western art, from the palace of Knossos in
Crete, around 2000 BC. Modern roses are
the result of centuries of breeding between
such wild roses. (B) a pug and a poodle
illustrate the range of dog breeds. all dogs,
regardless of breed, belong to a single
species. (B, courtesy of heather angel.)
Question 10–1
DNA sequencing of your own two
b-globin genes (one from each of
your two Chromosome 11s) reveals
?
a mutation in one of the genes.
Given this information alone, should
you worry about being a carrier of
an inherited disease that could be
passed on to your children? What
other information would you like to
have to assess your risk?
(A) (B)
the product of centuries of selective breeding between strains of wild
roses from China and Europe (Figure 10–1A). Similarly, the enormous
variation in the sizes, colors, shapes, and even behaviors of different
ECB3 E10.01/10.01
breeds of dogs is the result of deliberate genetic experiments—with
selection for desired traits—carried out since the gray wolf, the ancestor
of the modern dog, was first domesticated some 10,000–15,000 years ago
(Figure 10–1B).
Modern genetic engineering techniques, however, allow us to alter DNA
with much greater precision and speed. With the latest equipment and
techniques, even a beginning student can now collect an organism’s
genetic material, isolate a region of DNA containing a specific gene,
produce a virtually unlimited number of exact copies of this DNA, and
determine its nucleotide sequence with relative ease. Using variations
of these engineering techniques, the isolated gene can be redesigned in
the laboratory and then transferred back into cells in culture to elucidate
its function. With slightly more sophisticated methods, the engineered
genes can be inserted into animals and plants, so that they become a
functional and heritable part of the organism’s genome.
These technical breakthroughs have had a dramatic impact on all aspects
of cell biology. They have made possible our present knowledge of the
organization and evolutionary history of the complex genomes of eucary-
otes (as discussed in Chapter 9) and have led to the discovery of whole
new classes of genes, RNAs, and proteins. They provide new ways of
determining the functions of proteins and of individual domains within
proteins, revealing a host of unexpected relationships among them. And
they give biologists an important set of tools for unraveling the mecha-
nisms by which a whole animal or plant can develop from a single cell.
Recombinant DNA technology has also had a profound influence on
many aspects of human life outside scientific research: it is used to detect
the mutations in DNA that are responsible for inherited disorders and to
diagnose an individual’s predisposition to genetic diseases such as can-
cer; it is used in forensic science to identify or acquit suspects in a crime;
it is used to produce an increasing number of human pharmaceuticals,
including insulin for diabetics and the blood-clotting protein Factor VIII
for hemophiliacs. Even our laundry detergents, which contain heat-sta-
ble proteases that digest food spills and blood spots, make use of the
products of DNA technology. Of all the discoveries described in this book,
those that led to the development of recombinant DNA technology are
likely to have the greatest impact on our everyday lives.
In this chapter we describe the most common methods for manipulating
genes and determining their function. We first survey the principal meth-
ods of the revolutionary field of recombinant DNA technology, beginning
with a discussion of the basic techniques of DNA analysis. Next we
describe how DNA sequences can be isolated and produced in large num-