1

RAFFLES INSTITUTION
2017 Year 5 Promotional Examination

Higher 2

BIOLOGY 9744/01
Paper 1 Multiple Choice 29th Sep 2017

1 hour
Additional materials: OMR Answer Sheet

READ THESE INSTRUCTIONS FIRST

Do not use staples, paper clips, highlighters, glue or correction fluid.

Write your name, class and index number on the OMR Answer Sheet in the spaces provided.

There are thirty questions in this paper. Answer all questions. For each question there are four
possible answers A, B, C, and D. Choose the one you consider correct and record your choice in
soft pencil on the separate OMR Answer Sheet.

Read the instructions on the OMR Answer Sheet very carefully.

Each correct answer will score half a mark. Marks will not be deducted for a wrong answer.
Any rough working should be done in this booklet.
Calculators may be used

(Erase all mistakes completely. Do not bend or fold the OMR Answer Sheet).

This document consists of 16 printed pages.

Raffles Institution
Internal Examination

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01

 2
1. Raffinose is a trisaccharide which can be degraded by certain enzymes. The results of two
different enzymatic incubations are shown in the table below:

Enzyme used Products

Sucrase Melibiose and fructose

Galactosidase Galactose and sucrose

Which of following statements are consistent with the results shown above?

I Raffinose is composed of three different monosaccharides.

II Melibiose is a disaccharide.
III One of the products of acid hydrolysis of raffinose is glucose.
IV The products of raffinose digestion by sucrase and galactosidase respectively will yield
a brick-red precipitate when heated with Benedict’s reagent.

A I and III only

B II and IV only
C I, II and III only
D All of the above

2. Which of the following statements about membrane fluidity are correct?

I The more saturated the fatty acid chains of the phospholipids, the more fluid the
membrane is.
II The greater the amount of cholesterol in the membrane, the less fluid the membrane is
at high temperatures.
III The longer the hydrocarbon tails of the phospholipids, the more fluid the membrane is.
IV At low temperatures, a membrane with phospholipids containing hydrocarbon tails with
more kinks is less likely to solidify.

A I and III only

B II and IV only
C I, II and III only
D II, III and IV only

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01 [turn over

 3
3. Which description concerning collagen is correct?

A Collagen is made up of polypeptides arranged parallel to each other and the amino acid
sequence contains a large variety of amino acids with different sized R-groups.
B Collagen is made up of polypeptides that are arranged very closely together and every
third amino acid in its amino acid sequence is glycine.
C Collagen has three polypeptides that are bound to one another by covalent cross links
forming a collagen fiber and the amino acid sequence contains amino acids with
hydrophobic R-groups.
D Collagen is an insoluble molecule and the amino acid sequence contains successive
amino acids which are rotated to allow formation of bonds.

4. A pear was cut into six equal segments, two of which were blanched by immersing them in
boiling water for one minute. Each segment of the pear was then cut into pieces and these
were treated in several ways as indicated in the table below. The time taken for each piece of
pear to develop a standard degree of browning was then recorded. You may assume that all
pieces had the same initial colour.

Liquid in which pear Time for appearance of browning at the

Initial treatment of
pieces were temperature indicated (min)
pear segment
immersed 20°C 40°C 100°C
unblanched 25 9 X
Water
blanched X X X
unblanched X X X
1% glucose solution
blanched X X X
0.1% nitric acid unblanched X X X
2% dithionite solution unblanched X 135 X

X denotes a pear piece that did not turn brown after 300 mins.

The enzyme involved in the browning of the pear pieces is ________________________.

I thermostable.
II denatured by blanching.
III less inhibited by 2% dithionite solution than by 0.1% nitric acid.
IV not the only agent responsible for the browning of the pear in the experiment.

Which of the following correctly complete the sentence?

A I and III only

B II and III only
C II and IV only
D II, III and IV only

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01

 4
5. A branched metabolic reaction pathway is described by the following statements:

• E can undergo an enzyme-catalyzed reaction to form either F or G

• H is produced from F
• H can undergo an enzyme-catalyzed reaction to form either I or K
• J is produced from I
• L is produced from K
• H allosterically inhibits the enzyme that catalyzes the reaction of E to form F
• J allosterically inhibits the enzyme that catalyzes the reaction of H to form I
• L allosterically inhibits the enzyme that catalyzes the reaction of H to form K

Which reaction would prevail if both J and L were present in the cell in high concentrations?

A F→H
B K→L
C E→G
D H→J

6. The electron micrograph below shows two organelles Y and Z in a mesophyll cell of a leaf.
Organelle Y

Organelle Z

Which of the following statements are false about organelles Y and Z?

I Oxygen
1 released by organelle Z is used for glycolysis in organelle Y.
II DNA
2 replication does not occur in both organelles.
III Transcription
3 occurs in both organelles.
IV Electron
4 carrier proteins are found on the inner membrane of both organelles.

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01 [turn over

 5

A I and IV only
B I, II and IV only
C II and III only
D I, III and IV only

7. Membranes within and at the surface of cells have different roles. The diagram allows the
identification of the various organelles within the cell, by describing the membrane structure
and function.

Which of the following correctly identifies the organelles?

1 2 3 4 5 6
A nucleus ribosome vesicle smooth ER mitochondrion chloroplast
B nucleolus rough ER vesicle smooth ER nucleus mitochondrion
C nucleus rough ER vesicle smooth ER mitochondrion chloroplast
D nucleus smooth ER mitochondrion rough ER vesicle chloroplast

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01

 6
8. The graph shows the effect of increasing the concentration of glucose in a solution on the rate
of glucose entry into a cell.

Which of the following statement(s) does/do not explain the cause of the plateau at X?
I All the carrier proteins are saturated with glucose.
II The carrier proteins are denatured and no longer able to function.
III The cell has used up its supply of ATP.
IV The concentrations of glucose inside and outside the cell are equal.

A I, II and IV only
B II, III and IV only
C II and III only
D I only

9. The diagram below shows a small polypeptide integrated into a membrane.

Which line in the table below correctly classifies the amino acids in this polypeptide?

Polar Non-polar
A Thr Pro
B Ile Tyr
C Asn Ser
D Phe Gly

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01 [turn over

 7
10. Diploid cells with x amount of DNA and 36 chromosomes are capable of undergoing both
mitosis and meiosis.

During which stage(s) could a cell with 2x amount of DNA and 72 chromosomes be found?

A anaphase of mitosis only

B anaphase of meiosis I only
C anaphase of mitosis and anaphase of meiosis I
D anaphase of mitosis and anaphase of meiosis II

11. The diagram below shows some of the events that take place during meiosis.

1 2

3 4

Which sequence of events is correct?

A 4→3→1→2
B 4→ 3→2→1
C 2→4→ 1→3
D 4→2→ 3→1

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01

 8

12. Three batches of cells at the start of G1 phase of the cell cycle were obtained. Each batch had
the same number of cells and were treated with drugs P, Q and R respectively. The relative
DNA content of the treated cells was measured after 24 hours. The three graphs below show
the results obtained. Untreated cells were expected to complete interphase within 24 hours.
drug P drug Q drug R

relative DNA content relative DNA content relative DNA content

number number number
of cells of cells of cells

2 4 2 4 2 4
relative DNA content/au relative DNA content/au relative DNA content/au

What is the effect of each drug on the cells?

drug P drug Q drug R

A Interferes with G1 phase Interferes with S phase Interferes with G2 phase
B Interferes with G2 phase Interferes with S phase Interferes with G1 phase
C Interferes with G2 phase Interferes with G1 phase Interferes with S phase
D Interferes with G1 phase Interferes with G2 phase Interferes with S phase

13. A 19 base-pair long DNA molecule was analysed to find the number of nucleotide bases in
each of the polynucleotide strands. Some of the results are shown.

number of nucleotide bases

A C G T
strand 1 4

strand 2 7 5

How many hydrogen bonds are present in this DNA molecule?

A 31
B 39
C 48
D 57

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01 [turn over

 9

14. Which statement(s) about RNA is/are correct?

I It is less stable than DNA as it contains a ribose sugar that lacks a 2’ OH group.
II It is able to form double-stranded regions with some areas of base pairing.
III It is a polymer of purine and pyrimidine joined by phosphodiester bonds.
IV It is synthesised in the 5’ to 3’ direction where the 5’-phosphate group of the growing RNA
strand is joined to the 3’-hydroxyl group of an incoming nucleotide.

A II only
B I and IV only
C II and III only
D I, III and IV only

15. Which of the following statement(s) about the translation process in all eukaryotes is/are false?

I Polypeptides are only synthesised in the cytosol.

II Amino acids are linked by the formation of peptide bonds catalysed by a ribozyme.
III Ribosomes contain an amino-acyl tRNA site that is occupied by the initiator tRNA attached
to methionine.
IV Amino-acyl tRNA synthetase attaches an amino acid to the 5’ end of a tRNA molecule.

A I, III and IV only

B II, III and IV only
C II and IV only
D I only

16. Scientists created a recombinant Gene A from mice culture cells by relocating the promoter as
shown below.

5’ 3’
Gene A
3’ 5’

Original gene Constitutive

promoter with
5’ 3’ arrow showing
Gene A direction of
3’ 5’
transcription

Recombinant gene

Multiple copies of the recombinant gene were reintroduced back into the cell culture to see its
effect on the expression of Gene A.

Which of the following statement(s) is/are true:

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01

 10

I The expression of Gene A product increased

II Transcription of Gene A cannot take place
III Translation of Gene A mRNA cannot take place
IV There is no change to the expression levels of Gene A product
V The expression of Gene A product stops/decreases

A I only B II, III and V C III and V D IV only

17. Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin
polypeptide of haemoglobin.

The diagram shows the sequence of bases in a small section of the coding strand of DNA for
both the HbA (normal) and HbS (sickle cell) β-globin alleles.

HbA CTGACTCCTGAGGAGAAGTCT

HbS CTGACTCCTGTGGAGAAGTCT

How will the mutation in the HbS allele result in the production of an altered version of the β-
globin polypeptide?

A A tRNA molecule with the anticodon CAC will hydrogen bond to the altered codon on
mRNA.
B All the amino acids coded for after the mutation will differ from those in the HbA protein.
C mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon
CTC.
D The ribosome will be unable to continue translation of the HbS mRNA after the altered
codon.
18. What happens when a cell that is infected by HIV divides by mitosis?

A Viral DNA is made from viral RNA.

B Viral DNA is replicated.
C Viral RNA is replicated.
D Viral RNA is transcribed from viral DNA.

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01 [turn over

 11

19. The graph represents the process of viral replication.

Which of the following is correct?

A nucleic acids proteins intracellular viral particles extracellular virions

B proteins nucleic intracellular viral particles extracellular virions
acids
C nucleic acids proteins extracellular virions intracellular viral particles

D proteins nucleic extracellular virions intracellular viral particles

acids

20. Some events that take place during specialized transduction are listed below.

1 Bacterial DNA is packaged in a phage capsid

2 Phage DNA and proteins are made
3 Recombination between donor DNA and recipient DNA may occur
4 Integration of phage DNA into bacteria DNA
5 Cell lysis

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01

 12

Which of the following shows the correct sequence of events?

A 1→2→3→5→4
B 2→1→5→4→3
C 3→4→1→2→5
D 4→2→1→5→3

21. An experiment was conducted to examine the effects of glucose and lactose on the levels of β-
galactosidase and bacteria growth in E.coli. Lactose and glucose were added to a culture of
bacteria at the start of the experiment and the levels of each were measured at specific time
intervals. The results are shown in the graphs below.

Which of the following is represented by the graphs?

Graph I Graph II Graph III
A Amount of glucose Amount of lactose Amount of β-galactosidase
B Amount of glucose Amount of lactose Amount of bacteria
C Amount of lactose Amount of β- Amount of glucose
galactosidase
D Amount of lactose Amount of β- Amount of bacteria
galactosidase

22. The cell cycle checkpoints involve a protein called cyclin-dependent kinase (CDK). Maintaining
a constant level of CDK is essential for mitosis to take place.

Which processes will help to maintain the presence of CDK?

I decreasing
1 rate of ubiquitination on the protein
II decreasing
2 rate of deadenylation on the 3’ end of mRNA
III methylation
3 of guanine on the 5’ end of mRNA
IV methylation
4 of cytosine on the CG-rich DNA sequence

A II and III only

B I, II and III only
C I, III and IV only
D I, II, III and IV

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01 [turn over

 13
23. The expression of the p53 gene is regulated by another gene, MDM2. An increase in p53
protein causes an increase in MDM2 protein that inhibits the expression of the p53 gene and
destroys p53 protein.

A drug has been developed to stop uncontrolled cell division of cancer cells. The drug binds to
the MDM2 protein.

Which statement describes the effects of this drug?

A The transcription of p53 is decreased and the transcription of MDM2 is increased.

B The transcription of p53 is increased and the transcription of MDM2 is increased.
C The transcription of p53 is decreased and the transcription of MDM2 is decreased.
D The transcription of p53 is increased and the transcription of MDM2 is decreased.

24. Which of the following statements describes a common feature of eukaryotic and prokaryotic
genomes?

A Both genomes contain non-coding sequences.

B Both genomes contain centromeres and telomeres.
C Both genomes are replicated by semi-conservative replication during interphase before
mitosis.
D Both genomes contain genes that require general transcription factors to initiate
transcription.

25. In light, Mg2+ ions move into the stroma. In the dark, the concentration of Mg2+ ions in the
stroma is low.

At high Mg2+ concentrations, CO2 and Mg2+ react with the active site of RuBP carboxylase
(rubisco), to form a carbamate group (CO2NH) and making the rubisco active. At low Mg2+
concentrations the carbamate group dissociates making the rubisco inactive.

Inactive rubisco will bind tightly at its active site with any RuBP present, so that no rubisco
catalysis can take place. An ATPase enzyme called rubisco activase, can, in high
concentrations of Mg2+, release the RuBP from the rubisco, producing a carbamate group and
activating the rubisco.

Which statement is supported by these facts?

A Inactivated rubisco can be reactivated by NADPH made in the light-dependent reaction.

B Low concentrations of 3C compound in the stroma of the chloroplast deactivate rubisco
C Rubisco without the carbamate group is inhibited by low concentrations of RuBP.
D The rate of carbon dioxide fixation increases when the carbamate group dissociates from
rubisco.

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01

 14
26. The graph shows the relationship between oxygen production during photosynthesis and light
intensity for a unicellular green organism in 0.02% sodium hydrogencarbonate solution.

What is the most likely explanation for the graph leveling off at 180 J m-2s-1?

A light limited and carbon dioxide saturated

B light saturated and carbon dioxide limited
C light limited and the temperature is below optimum
D light saturated and the temperature is above optimum

27. Which of the following correctly states a difference between aerobic and anaerobic respiration?

A The energy released is stored in ATP (adenosine triphosphate) in aerobic respiration but
not in anaerobic respiration.
B Pyruvic acid is formed in aerobic respiration, but not in anaerobic respiration.
C Lactic acid is formed in aerobic respiration in animals, but alcohol is formed in anaerobic
respiration in plants.
D Oxidation of glucose is complete in aerobic respiration, but incomplete in anaerobic
respiration.

28. Which processes produce ATP?

I glycolysis
II Krebs cycle
III electron transport system
IV light independent reactions of photosynthesis

A I, II, III and IV

B I, II and III only
C I and III only
D II and IV only

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01 [turn over

 15
29. A diagram shows the pedigree of Rett’s disease, a genetic neurological disorder which results
in autism-like symptoms.
Key:
Affected male

Unaffected male

Affected female

Unaffected female

Which of the following statements can be concluded based on the diagram above?

A This genetic disorder is a X-linked dominant trait.

B This genetic disorder is due to an autosomal recessive allele.

C Individual II-1 must be heterozygous for the mutant allele as III-2 and III-3 are affected
with the genetic disorder.
D Individual III-11 was affected with the genetic disorder as a result of genetic mutation
during his lifetime.

30. Incontinentia pigmenti is a condition that can affect the skin and is characterized by a blistering
rash at birth. The phenotypes of the offspring from different couples were observed and
recorded in the table below. Each couple in the table has 3 daughters and 2 sons.

Couple Couple’s Phenotypes Offspring’s phenotypes

Unaffected father
No affected offspring
I X
Unaffected mother

Affected father All daughters are affected

II X The sons are not affected
Unaffected mother
Unaffected father
1 out of the 2 sons are affected
III X
1 out of the 3 daughters are affected
affected mother

Which of the following conclusion can you derive from the information given?

A Incontinentia pigmenti is a sex-linked recessive condition.

B The unaffected mother in Couple II is homozygous dominant.
C Couple I are both homozygous dominant for incontinentia pigmenti.
D The affected mother in Couple III is a heterozygote.

-- END OF PAPER –

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01

 16
ANSWERS

1. D 2. B 3. B 4. B 5. C
6. B 7. C 8. B 9. A 10. A
11. B 12. D 13. C 14. A 15. A
16. C 17. A 18. B 19. A 20. D
21. A 22. B 23. B 24. A 25. C
26. B 27. D 28 B 29. A 30. D

© RI 2017 2017 Year 5 H2 Biology Promotional Examination 9744/01 [turn over