Investigation of Bovine Herpesvirus 1 BH

Izdavač Publisher
Veterinarski fakultet Sveučilišta u Zagrebu Faculty of Veterinary medicine Zagreb

Hrvatska veterinarska komora Croatian Veterinary Chamber
Urednici Editors
Prof. Dr. Ivica Harapin Prof. Dr. Josip Kos
Grafički urednik Graphic Editor

Josipa Skočibušić, graf. ing.
Tisak Printed By
Intergrafika d.o.o., Zagreb, Bistranska 19
Radovi tiskani u Zborniku su recenzirani
XVI. kongres Mediteranske federacije za zdravlje i produktivnost preživača (FeMeSPrum), Zadar, Croatia, 2008
POKROVITELJ PATRONAGE
REPUBLIKA HRVATSKA REPUBLIC OF CROATIA
MINISTARSTVO POLJOPRIVREDE MINISTRY OF AGRICULTURE, Fisheries

ribarstva i ruralnog razvitka and Rural Development
ORGANIZATORI ORGANIZERS
VETERINARSKi FAKULTET FACULTY OF VETERINARY MEDICINE

SVEUČILIŠTA U ZAGREBU UNIVERSITY OF ZAGREB
Hrvatska veterinarska komora Croatian Veterinary Chamber
POSEBNO ZAHVALJUJEMO GREAT GRATITUDE TO THE MINISTRY

MINISTARSTVU ZANOSTI I FOR SCIENCE AND TECHNOLGY OF
TEHNOLOGIJE REPUBLIKE HRVATSKE REPUBLIC CROATIA ON ASSIST TO THE
NA POMOĆI PRI ORGANIZACIJI ORGANIZATION OF XVI. CONGRESS OF
XVI. KONGRESA MEDITERANSKE THE MEDITERRANEAN FEDERATION
FEDERACIJE ZA ZDRAVLJE I FOR HEALTH AND PRODUKTION OF
PRODUKTIVNOST PREŽIVAČA RUMINANTS
MEĐUNARODNI ORGANIZACIJSKI ODBOR
INTERNATIONAL ORGANIZING COMMITTEE
Prof. Dr. Sc. J. Kos, Croatia
Prof. Dr. Arcangelo Gentile, Italy
Prof. Dr. Antonio Pugliese, Italy
Dr. Sc. B. Fatur, Slovenia
Prof. Dr. M. Erman Or, Turkey
Prof. Dr. Paulino Garcia Partida, Spain
Prof. Dr. Pablo Diez-Banos, Spain
Prof. Dr. Hossein Hamali, Iran
XVI Congress of the Mediterranean Federation for Health and Production of Ruminants (FeMeSPrum), Zadar, Croatia, 2008
NACIONALNI ORGANIZACIJSKI NATIONAL ORGANIZING
ODBOR COMMITTEE
Predsjednik: Prof. Dr. Josip Kos, DVM President: Prof. Dr. Josip Kos, DVM
Organizacijski tajnik: Prof. Dr. Ivica Harapin, DVM Organisation secretary: Prof. Dr. Ivica Harapin, DVM
Tehnički tajnik: dr. Nikica Prvanović, DVM Technical secretary: dr. Nikica Prvanović, DVM
Članovi Members
Prof. Dr. Marijan Cergolj, DVM, Prof. Dr. Zdenko Makek, DVM,
Prof. Dr. Antun Tomašković, DVM, prof. dr. Ljiljana Bedrica, DVM,
Prof. Dr. Vlasta Šerman, DVM, doc. dr. Zoran Milas, DVM,
doc. dr. Tomislav Babić, DVM, doc. dr. Dražen Vnuk, DVM,
dr. Juraj Grizelj, DVM, Zlatko Hrastnik, DVM, Ivo Forgač, DVM
dr. Pero Božić, DVM, dr. Željko Cvetnić, DVM, Danimir Kolman, DVM
ZNANSTVENO STRUČNI SCIENTICIC PROFESSIONAL

ODBOR COMMITTEE
Predsjednik President:
Prof. Dr. Ivica Harapin, DVM
Članovi: Members:
Prof. Dr. Josip Kos, DVM, Prof. Dr. Antun Tomašković, DVM,
Prof. Dr. Zdenko Makek, DVM, Prof. Dr. Darko Capak, DVM,
Prof. Dr. Zvonko Stojević
ODRŽAVANJE XVI. KONGRESA XVI. CONGRESS OF THE
MEDITERANSKE FEDERACIJE ZA MEDITERRANEAN FEDERATION
ZDRAVLJE I PRODUKTIVNOST FOR HEALTH AND PRODUCTION OF
PREŽIVAČA RUMINANTS IS SPONSORED BY:
POMOGLI SU:
INTERVET GLAVNI SPONZOR
ALAPIS
NEXE GRUPA
BAYER HEALTHCARE, Bayer Pharma d. o. o.
CENTAR ZA UNAPREĐIVANJE STOČARSTVA
GAVRILOVIĆ
MEDICAL INTERTRADE
PFIZER CROATIA Odjel veterine
PHOENIX FARMACIJA D. D.
VETERINA d. d.
VETERINARSKA MREŽA
ZIK 90
Contents - Sadržaj
Invited Lectures - Pozvana predavanja
Sušić, V., A. Ekert Kabalin, I. Štoković, Ž. Pavičić, B. Mioč, V. Pavić, Z. Barać, S. Menčik 13
Autochthonous Ruminant Breeds in Croatia
Autohtone pasmine preživača u Hrvatskoj
Antonio Gonzalez-Bulnes, Claudia A. Letelier, Ignacio Contreras-Solís, Juraj Grizelj 25
brief review of the state of the art in assisted reproduction in small ruminants
Situación actual de las técnicas de reproducción asistida en pequeños rumiantes
Aktualni status postupaka asistirane reprodukcije malih preživača
Infectious Diseases - Zarazne bolesti

Juan Muñoz Bielsa 35
NEW SOLUTION FOR THE CONTROL OF THE BOVINE RESPIRATORY COMPLEX
Nove mogućnosti kontrole zaraznog goveđeg respiratornog sindroma
Reina, R., Grego, E., Lacerenza, D., Profiti, M., Rosati, S. 43
GENETIC CHARACTERIZATION OF SMALL RUMINANT LENTIVIRUS GENOTYPE E
GENETSKA KARAKTERIZACIJA LENTIVIRUSA GENOTIPA E U MALIH PREŽIVAČA
Lika, E., Lika A., Gjino P., Turmalaj L., Grizelj J., Vince S. 47
Entomological surveillance for Bluetongue vectors in Tirana
ENTOMOLOŠKO ISTRAŽIVANJE BLUETONGUE VEKTORA U TIRANI
Habus, J., N. Turk, M. Friess, R. Zobel, Z. Grabarevic, Lj. Barbic, Z. Stritof, Z. Milas, V. Staresina 51
Sheep - associated malignant catarrhal fever – a case report
Zarazna korica goveda – prikaz slučaja
Nadalian M., Sadeghi-Nasab A., Hemmatzadeh F., Nadjafi J., Seifoori P., Gorjidooz M., Bahonar A. 57
Detection of persistently infected (PI) calves with bovine viral diarrhea
virus (BVDV) using “Ear Notch Test” and comparing it by Immuno-capture ELISA
Otkrivanje perzistentno inficirane (PI) teladi s goveđim virusom virusnog
proljeva (BVDV) koristeći rez uške i njegova usporedba s Immuno-capture ELISOM
Ata Ayhan, Mesih Kocamüftüoğlu, Sibel Hasircioğlu, Mehmet Kale 63
Investigation of Bovine Herpesvirus-1 (BHV-1) Infection in Relation to Fertility
in Repeat Breeder Cows
Istraživanje infekcije goveđim herpes-virusom-1 u odnosu na plodnost
krava koje se preganjuju
Lupo Tiziana, Daniele Macrì, Vitale Maria, Antonella Migliazzo, Stefano Reale, Fabrizio Vitale 71
PrP ANALISYS IN SICILIAN SCRAPIE OUTBREAKS
sc
Analiza PrPsc kod pojave svrbeža u ovaca na siciliji

Yavru, S., O. Yapici, M. Kale, Ş. Şahinduran, F. Pehlivanoğlu, m.k. Albay, o. Avci 75
SEROLOGICAL, VIROLOGICAL AND HAEMATOLOGICAL EXAMINATION OF CORONAVIRUS
INFECTION IN CALVES WITH DIARRHEA AND THEIR DAMS
Serološka, virusološka i hematološka pretraga na koronavirusnu
infekciju u teladi s proljevom te njihovih majki
Carcangiu V., Mura M. C., Vacca G. M., Parmeggiani A., Pazzola M., Dettori M. L., Bini P. P. 81
GH and some haematochemical parameters variation during the first two
months of lactation in mouflon (Ovis gmelini musimon)
II XVI. kongres Mediteranske federacije za zdravlje i produktivnost preživača (FeMeSPrum), Zadar, Croatia, 2008
GH I VARIJACIJE NEKIH HEMATOKEMIJSKIH PARAMETARA TIJEKOM PRVA DVA MJESECA
LAKTACIJE U MUFLONA (OVIS GMELINI MUSIMON)
Romero Tejeda A., Thiry J., Preziuso S., Thiry E., Petralia P., Valente C., Cuteri V. 89
Serological detection of a Bovine herpesvirus 1 related infection in
buffaloes (Bubalus bubalis) by using BoHV-1 blocking ELISA
Serološko otkrivanje goveđeg herpesvirusa 1 povezanog s infekcijom u
bufala (Bubalus bubalis)
Pavlak, M., M. Benić, D. Cvitković, M. Tadić 97
Epidemiological data of intrammamary infection in cattle - a quantitative
analysis of published data and comparison with data in Croatia
Epidemiološki podatci rasprostranjenosti mastitisa u goveda – analiza
publiciranih podataka i usporedba s podatcima pojave mastitisa u Hrvatskoj
Alireza Haghparast, Evert Hensen 113
Bovine MHC Class II Structure-Function Relationships: Implications for
Vaccine Development
ODNOSI GRAĐE I ULOGE GOVEĐIH MHC KLASE II: IMPLIKACIJE ZA RAZVOJ VAKCINE
Parasitology - Parazitologija
Díez-Baños, P., Dacal, V., Vázquez, L., Pardo, M., Cienfuegos, S., Díez-Baños, N., López, C.,
Panadero, R., Morrondo, P. 119
ANALYSIS OF THE PREVALENCE AND PARASITIC INTENSITY BY LUNG NEMATODA IN ROE
DEER (Capreolus capreolus) HUNTED IN GALICIA (NW SPAIN): EFFECT OF AGE
ANALIZA POJAVNOSTI I INTENZITETA INVAZIJE PLUĆNIM NEMATODIMA U SRNA
(Capreolus capreolus) ODSTRIJELJENIH U GALICIJI (SZ ŠPANJOLSKA): UTJECAJ DOBI
Díaz, P., J. Pedreira, J. L. Suárez, R. Sánchez-Andrade, R. Panadero, A. Paz-Silva,
P. Díez-Baños, P. Morrondo 123
INFLUENCE OF THE LIVER FLUKE-CONTROL PRACTICES ON THE PREVALENCE AND EGG-
OUTPUT IN SEMIEXTENSIVE BEEF CATTLE HERDS
UTJECAJ POSTUPAKA KONTROLE JETRENIH METILJA NA POJAVNOST I POLUČIVANJE
JAJAŠACA U SEMIEKSTENZIVNO DRŽANIH STADA TOVNIH GOVEDA
Morrondo, P., Vázquez, L., Pardo, M., Dacal, V., Díaz, P., Paz, A., Sánchez-Andrade, R., Arias,
M.S., Uriarte, J., Díez-Baños, P. 129
ROE DEER (Capreolus capreolus) AS A RESERVOIR OF PARASITIC INFECTIONS IN
DOMESTIC RUMINANTS UNDER FIELD CONDITIONS IN GALICIA
SRNA (Capreolus capreolus) KAO REZERVOAR PARAZITSKIH INVAZIJA ZA PAŠNO
DRŽANE DOMAĆE PREŽIVAČE U GALICIJI
Francisco, I., M. Arias, J. Pedreira, A. Paz-Silva, R. Francisco, R. Sánchez-Andrade, P. Díaz,
J. L. Suárez, P. Díez-Baños, P. Morrondo. 133
A SEROEPIDEMIOLOGICAL SURVEY OF BOVINE PARAMPHISTOMOSIS BY USING THE Cd2 ELISA
SEROEPIDEMIOLOŠKO ISTRAŽIVANJE GOVEĐE PARAMFISTOMOZE METODOM Cd2 ELISA
Vázquez, L., Dacal, V., Cienfuegos, S., Díaz, P., Lago, N., Panadero, R., Fernández, G.,
Morrondo, P., López, C. 139
OCURRENCE OF TREMATODE EGGS IN SHEEP FROM GALICIA (N.W. SPAIN)
Učestalost nalaza jajašaca metilja u ovaca iz pokrajine Galicija ( sjevero-
zapadna Španjolska)
Dacal, V., Vázquez L., Cienfuegos S., Panadero R., Pato J., Fernández G., Díez-Baños P., López C. 147
INFECTION BY INTESTINAL CESTODES IN SHEEP FROM GALICIA (N.W. SPAIN)
Infekcija ovaca iz područja Galicije crijevnim trakavicama
XVI Congress of the Mediterranean Federation for Health and Production of Ruminants (FeMeSPrum), Zadar, Croatia, 2008 III
Vitale Maria, Scatassa Maria Luisa, La Giglia Maria, Giangrosso Giuseppe, Currò Vittoria,
Vitale Fabrizio, and Caracappa Santo 153
Toxoplasma gondii screening, by molecular and serological methods, in a
farm with a rural management in Sicily
Istraživanje Toxoplasmae gondii molekularnim i serološkim metodama na
farmama sa zastarijelom tehnologijom na području Sicilije
Pieragostini E., Alloggio I., de Ruvo G., Rubino G., Petazzi F. 157
Genetical markers of resilience to tick borne diseases (TBD) - a research
project for the improvement of sheep breeding and management strategies
Genetski markeri rezistencije na bolesti prenosive krpeljima (BPK)-
istraživački project sa ciljem napredka uzgoja ovaca i srategija upravljanja
Poglayen Giovanni, Stancampiano Laura, Varcasia Antonio, Anna Paola Pipia, Caterina Bio,
Costanza Romanelli 161
PASSIVE MONITORING EXPERIENCES ON CYSTIC ECHINOCOCCOSIS IN ITALY
ISKUSTVA PASIVNOG MONITORINGA CISTIČNE EHINOKOKOZE U ITALIJI
Pauling Bruce 163
A Field Report to Compare the Responses in calves with diarrhoea
associated with Cryptosporidiosis when treated with Electrolytes with or
without Betacyclodextrin
USPOREDBA ODGOVORA NA TERAPIJU PROLJEVA POVEZANOG SA KRIPTOSPORIDIOZOM
PROVEDENU ELEKTROLITIMA SA I BEZ B-CIKLODEKSTRINA
Metabolic Diseases - Metaboličke bolesti

Masucci Marisa, Michela Pugliese, Alessio Scardillo, Antonio Sutera, Ferrantelli V., Giuseppe Licitra 169
NEUROLOGICAL MANIFESTATIONS AND LIVER DISEASE IN DAIRY COWS
Neurološki poremećaji i bolesti jetre u muznih krava
Abbasi, M, Gharzi, A. 173
Effects of sex on histological characteristics of skin in Lori sheep
Utjecaj spola na histološke osobitosti kože u Ovaca pasmine lori
Blanco-Penedo, I., López-Alonso, M., Miranda, M., Castillo, C., Hernández, J., Prieto Montaña,
F. Benedito, J. L. 177
Metabolic profile determination in calves from different management in NW Spain
ODREĐIVANJE METABOLIČKOG PROFILA TELADI S RAZLIČITIH UZGOJA
SJEVEROZAPADNE ŠPANJOLSKE
Tooloei, M. Nadalian, M., Khosravi, A., Helan, J. A., Najafie, R. 185
A field outbreak of Aflatoxicosis with high fatality rate in feedlot calves
in Tehran Province - Iran
A field outbreak of Aflatoxicosis with high fatality rate in feedlot calves
in Tehran Province - Iran
Morgante M., Stelletta C., Cannizzo C., Casalone M., Coppola L., Gianesella M. 193
Subacute rumen acidosis in dairy herds: diagnostics tools
Subakutna acidoza buraga u mliječnih krava: dijagnostički postupci
Radojičić Biljana, B. Dimitrijević, A. Krasnić 201
INFLUENCE OF PROPYLEN GLYCOL IN FEED FOR PROPHYLAXIS OF KETOSIS IN
PERIPARTAL PERIODS OF DAIRY COWS
utjecaj PROPiLEN GLikOLa u hrani na spriječavanje ketoze u muznih krava prije poroda
IV XVI. kongres Mediteranske federacije za zdravlje i produktivnost preživača (FeMeSPrum), Zadar, Croatia, 2008
Tabrizi, Afshin Davasaz, Roozali Batavani, Siamak Asri-Rezaei, Malahat Ahmadi 207
Electrophoretic study of plasma proteins in dairy cows with clinical and
subclinical mastitis by Agarose gel procedure
Istraživanje proteina plazme elektroforezom u mliječnih krava s kliničkim
i subkliničkim mastitisom postupkom gel Agara
Bustamante Cano J, Hernández Arroyave W., Gutiérrez Chávez A. J., Alonso Alonso P.,
González Montaña J. 213
SECONDARY COPPER DEFICIENCY IN CATTLE FROM MOLYBDENUM INTOXICATION: CLINIC
AND PATHOLOGICAL STUDY.
[HIPOCUPROSIS BOVINA SECUNDARIA A MOLIBDENOSIS: ESTUDIO CLÍNICO,
HISTOPATOLÓGICO Y HEMATOLÓGICO
Sekundarna deficijencija bakra u goveda otrovanih molibdenom: Klinički i
patološki nalaz
Comin A., Tidu L., Cornacchia G., Cappa A., Renaville B., Prandi A. 221
NEONATAL PERIOD AND HAIR CORTISOL IN CATTLE AS A MARKER OF STRESs
NEONATALNO RAZDOBLJE I DLAČNI KORTIZOL U GOVEDA KAO MARKER STRESA
Kostelić, A., Branka Artuković, R. Beck, M. Benić, M. Cergolj, I. Štoković, Z. Barać 227
Diseases of sheep on Croatian islands
Bolesti ovaca na hrvatskim otocima
Stojević, Z., Natalija Filipović, Z. Tuček, Blanka Beer Ljubić, K. Dolanski, Lina Bačar-Huskić 233
The influence of calcium-propionate in diet on energy status in dairy cows
Utjecaj dodavanja propionata u hrani na energetski status mliječnih krava
Kayar, A., Mehmet Erman OR, Remzi Gonul, Banu Dokuzeylul, Ali Rıza Kiziler, Birsen
Aydemir, Abdullah Aksu, Cağla Parkan, Tamercan Morkoc, and Bora Bartucu 237
The Clinical Efficiency of Minerasol® Which is a New Trace Element
Combination on Sheep
Učinak kombinacije minerala u pripravku Minerasol na nivo nekih
elemenata u ovaca
Trojacanec, P., T. Dovenski, V. Ilieski, S. Trojacanec, K. Ilievska, L. Pendovski 243
Possibilities for teaching reproductive clinical anatomy using laparoscopy
Primjena laparoskopije u nastavi reproduktivne kliničke anatomije
Reproduction, Obstretics and Udder Health - Reprodukcija, porodništvo i zdravlje vimena

González Montaña JR, Cal L, Benech A, Lataste V, Grille L, Rodas E. 247
PREGNANCY TOXEMIA IN EWES: ALTERNATIVE THERAPEUTIC IN EXTENSIVE SYSTEM
CONDITIONS
GESTOSIS OVINA SUBCLÍNICA: ALTERNATIVAS TERAPÉUTICAS EN CONDICIONES DE
EXPLOTACIÓN EXTENSIVA
GRAVIDITETNA TOKSEMIJA U OVACA: ALTERNATIVNA TERAPIJA U EKSTENZIVNOM OVČARENJU
Hamali H., S. Mosafery 253
A Survey of Teat End Hyper Keratosis Prevalence in the Tabriz Dairy Herds
Hiperkeratoza sisa u stadima mliječnih krava u provinciji Tabriz
Pengov A, Podpečan O. 261
PERACUTE STAPHYLOCOCCUS AUREUS MASTITIS IN EWES
PERAkutni STAPHYLOCOCCUS AUREUS MASTITIS u ovaca
Zobel ,R., D. Gereš, R. Turk, D. Gračner, D. Žubčić 267
Onset of ovulation analysis in dairy cows
Analiza vremena nastupa ovulacije u mliječnih plotkinja
Prvanović, N., D. Đuričić, S. Vince, J. Sulon, J. F. Beckers, N. Filipović, M. Cergolj, J. Grizelj,
M. Samardžija, T. Dobranić, M. Lipar 275
Influence of breed, parity and lactation on PAG and progesterone profiles
in pregnant saanen and boer goats
Utjecaj pasmine, pariteta i laktacije na koncentraciju PAG i progesterona
tijekom gravidnosti sanskih i burskih koza
Šeol, B., T. Naglić, H. Ball, D. Finlay, K. Matanović, M. Martinec 281
An outbreak of Mycoplasma bovis mastitis on a diary cows farm in Croatia
Epizootija mastitisa uzrokovanog bakterijom Mycoplasma bovis u mliječnih
krava u Hrvatskoj
Grizelj, J., S. Vince, A. González de Bulnes, M. Karadjole, T. Dobranić, M. Samardžija, I. Getz,
N. Prvanović, M. Belić, A.Tomašković, M. Lipar, D. Cvitković 287
THE ULTRASONIC EXAMINATION OF OVARIES AS A TOOL IN GOAT SUPEROVULATION
PROCEDURES
ULTRAZVUČNA PRETRAGA JAJNIKA U SUPEROVULACIJSKIM POstSTUPCIMA U KOZA
Saif A. Balios 293
SYNCHRONIZATION OF OESTRUS IN KARADI EWES: THE USE OF DIFFERENT PMSG DOSES
Sinkronizacija estrusa u karadi ovaca: uporaba različitih PMSG DOza
Surgery, Miscellaneous - Kirurgija, ostalo

Gjino P., Koleci Xh., Turmalaj L., Grizelj J., Vince S., Lika E. 301
Role of Bovine Digital Dermatitis (BDD) on service period of dairy cattle
Utjecaj bovinog digitalnog dermatitisa na servis period krava muzara
Zemljič, Borut 307
INFLUENCE ON PREVALENCE OF THE DERMATITIS DIGITALIS PAPILLOMATOSA IN THE
DAIRY HERDS
UTJECAJ NA POJAVNOST PAPILOMATOZNOG DIGITALNOG DERMATITISA U MLIJEČNIH
KRAVA
Capak, D., B. Radišić, D. Vnuk, I. Harapin, J. Kos, T. Babić, Marija Lipar, and D. Matičić 313
Unilateral scrotal hernia in ram
JEDNOSTRANA SKROTALNA HERNIJA U OVNA
Cabras, P. A., A. Firinu, S. Tola, A. Orrù, A. M. Deiana, S. Usai, S. R. Poddighe, V. Petruzzi 317
Infectious Keratoconjunctivitis (Pink Eyes) in Sardinian Goats: Clinical,
Diagnostics and Epidemiological Considerations
Zarazni Keratokonjunktivitis (Pink Eyes) u sardinijskih koza: klinička,
dijagnostička i epiemiološka razmatranja
Babić, T., Kos J., Smolec O. 321
THE FIGURATIVE OUTLINE OF HORN DEFORMATION AND HORN INJURIES OF THE FARM
CATTLE TREATED IN THE WIDER SURROUNDING COUNTRYSIDE OF ZAGREB
SLIKOVIT PRIKAZ DEFORMACIJA I OZLJEDA ROGOVA FARMSKIH GOVEDA OBRAĐENIH U
ŠIROJ OKOLICI ZAGREBA
Morelli C., Cubeddu M. G., Calabrò G., Russo M., Di Pietro C., Passantino A. 325
PENALTIES FOR BREACH OF EC FOOD LAW IN ITALY
Kazne za kršenje EC zakona o hrani u Italiji
Cubeddu G. M., Lai M. G., Coda S., Fois G. M. 329
Penal and Civil Cases in the matter of cattle: forensic observations
Il contenzioso penale e civile in materia di bovini: osservazioni medico-legali
KRIVIČNE I GRAĐANSKE PARNICE S PREDMETOM GOVEDA: SUDSKI OSVRTI
VI XVI. kongres Mediteranske federacije za zdravlje i produktivnost preživača (FeMeSPrum), Zadar, Croatia, 2008
Pugliese A., Tortorella A., Di Marco V., Di Pietro S., Russo M., Gruppillo A., Scardillo A., Niutta P.P. 333
EPIDEMIOLOGICAL DATA ON INFECTIOUS KERATOCONJUNTIVITIS (IKC) OF SHEEP AND
GOAT IN SICILY
EPIDEMIOLOški pokazatelji zaraznog KERATOkonjUNTIVITISa (IKC) ovaca i
koza na Siciliji
Robles-Robles, R., Revuelta, J.F., González-Montaña, J.R. 337
THE ECONOMICS OF EXTENSIVE BEEF PRODUCTION IN SPAIN
Isplativost ekstenzivnog uzgoja goveda u Španjolskoj
Džaja., P., M.Čuljak, J. Bagarić., V. Vrkić., K. Rukavec, F. Martinković., E. Šatrović, M.
Radačić,
I. Vranješ, A. Lokin., I. Semren 345
CERTAIN FEATURES OF RAW SKIN FROM LARGE DOMESTIC HOOFED ANIMALS
NEKA SVOJSTVA SIROVIH GOVEĐIH KOŽA
Džaja P., Z. Perić, M. Vujić, J. Kos, Ž. Grabarević, E. Šatrović, J. Bagarić, M. Radačić, B.
Artuković, A. Lokin, T. Zubak 351
THE MOST COMMON JURIDICAL CASSES OF CATTLE SINCE 1923 -2007
NAJČEŠĆI SUDSKI SLUČAJEVI IZ GOVEDARSTVA OD 1923-2007.
Bazargani T. T., Hemmatzadeh F., Nadjafi J. and Sadeghi-Nasab A. 361
Outbreak of the BVDV induced gastro-neuropathy in a feedlot calves
around Tehran (Iran)
POJAVA BVDV-OM INDUCIRANE NEFROPATIJE KOD TELADI U OKOLICI TEHERANA (IRAN)
Šehić, M., V. Butković, D. Stanin, B. Škrlin, B. Radišić, J. Kos 369
Comparison of conventional and digital radiography of phalangeal bone
and soft tissue in cattle
Usporedba konvencionalne i digitalne radiografije kosti i mekih česti
falangi goveda
Fernández, G., Lago, N., Pato, J.,López, C.M., Díez-Baños, P., Cienfuegos, S, Viña, M. 377
SEROLOGICAL SURVEY OF MAEDI-VISNA IN SHEEP IN LUGO (NORTH-WEST SPAIN)
SEROLOGICAL SURVEY OF MAEDI-VISNA IN SHEEP IN LUGO (NORTH-WEST SPAIN)
Posters - Posteri
Kale, M., Ö. Kurşunb, A. S. Akcan Kalec, F. Pehlivanoğlud, S. Hasırcıoğlua, S. Yavrue 383
SPINAL CORD TISSUE DETECTION IN COMMINUTED BEEF IN A PRIVATE ABATTOIR IN
SOUTHERN TURKEY
Detekcija tkiva leđne moždine u usitnjenoj govedini iz privatne mesnice u
južnoj Turskoj
Kale, M., Ayhan ATA, Sibel Yavru, Orhan Yapkiç, Oya Bulut, Uğur Büyükyörük, Mehmet Şükrü
Gülay, Oğuzhan Avci 389
INVESTIGATION OF BOVINE VIRAL DIARRHEA VIRUS (BVDV) INFECTION IN RELATION TO
FERTILITY IN CATTLE
Istraživanje utjecaja BVD ( Bovine Viral Diarrhea) na plodnost u goveda
Kale, M., O. Kursun, A. S. Akcan Kale, F. Pehlivanoglu, A. Guner, R. Baskaya, Y. Dogruer,
C. Outurk 397
DETECTION OF SPINAL CORD TISSUES AS BOVINE SPONGIFORM ENCEPHALOPATHY
SPECIFIED RISK MATERIAL (BSE-SRM) IN BEEF CARCASSES DURING SPLITTING IN TURKEY
OTKRIVANJE TKIVA RIZIČNOG ZA PRIJENOS BSE PRILIKOM ODVAJANJA GOVEĐIH
POLOVICA U TURSKOJ
XVI Congress of the Mediterranean Federation for Health and Production of Ruminants (FeMeSPrum), Zadar, Croatia, 2008 VII
Dobranić, T., M. Samardžija, D. Đuričić, I. Harapin, S. Vince, D. Gračner, N. Prvanović,
J. Grizelj, M. Karadjole, Lj. Bedrica, D. Cvitković 403
THE METABOLIC PROFILE OF BOER GOATS DURING PUERPERIUM
NIVELES DE METALES TÓXICOS (As, Cd, Hg y Pb) EN HÍGADOS DE BOVINOS CRIADOS EN
INTENSIVO EN LA PROVINCIA DE LEÓN (N.O. ESPAÑA).
Escudero, A., González JR, Miranda M, Hernández J, Lechuga A, Castillo C, Benedito JL. 409
TOXIC METAL CONCENTRATIONS (As, Cd, Hg y Pb) IN LIVER OF BEEF CATTLE FROM
PROVINCE OF LEON (NW SPAIN).
KONCENTRACIJE TOKSIČNIH METALA (As, Cd, Hg I Pb) U JETRI TOVNE JUNADI S
PODRUČJA LEONA (SJEVEROZAPADNA ŠPANJOLSKA)
Benech, A., Cal L, Martín A, Da Silva S, Lataste V, Torío R, Fernández Rodríguez F, González
Montaña JR, Prieto Montaña F y Rodas E. 415
STARVED PERIOD IN LATE GESTATION: EFFECTS ON EWES AND LAMBS
RESTRICCIÓN DEL ALIMENTO EN LA GESTACIÓN AVANZADA: EFECTOS SOBRE LA OVEJA
Y SOBRE EL CORDERO
UTJECAJ GLADOVANJA TIJEKOM KASNE GRAVIDNOSTI NA OVCU I JANJAD
Filipović, Natalija, Nikica Prvanović, T. Mašek, Ž. Mikulec, Z. Stojević 421
Bone metabolism in dairy ewes during lactation
Koštani metabolizam u mliječnih ovaca tijekom laktacije
Majić-Balić, I., S. Milinković-Tur, J. Piršljin, B. Beer Ljubić, A. Orak, P. Božić 427
Activity of glutathione peroxidase in sperm and blood serum of simmental
breeding bulls
Aktivnost glutation peroksidaze u spermi i krvnom serumu bikova
simentalske pasmine
Marenjak, T. M., Nina Poljičak-Milas,Jasna Piršljin, Blanka Beer Ljubić, Ivančica Delaš 433
Interactive fat supplementation changed the milk quality and plasma
thyroid hormone concentration in Simmental cows
DODATAK NEŽAŠTIĆENE MASTI U OBROK MIJENJA KVALITETU MLIJEKA I
KONCENTRACIJU HORMONA ŠTITNJAČE U SIMENTALSKIH KRAVA
Blanka Beer Ljubić, Renata Laškaj, Jasna Piršljin, Ivanka Majić-Balić, Terezija Silvija
Marenjak, Suzana Milinković-Tur 441
Seasonal changes in lipid composition of bovine serum and seminal plasma
Utjecaj godišnjih doba na sastav masnih tvari u serumu i sjemenoj plazmi bikova
Karadjole, M., I. Getz, N. Macesic, M. Samardzija, T. Karadjole, G. Bacic, Z. Makek, T.
Dobranic, M. Knezevic, G. Perculija, D. Cvitkovic 451
EFFECT OF DONOR BREED ON BOVINE OOCYTE RECOVERY AND IN VITRO EMBRYO
DEVELOPMENT AFTER OVUM PICK UP
Utjecaj pasmine goveda na jajne stanice dobivene postupkom
transvaginalne ultrazvučne punkcije I embrionalni razvoj in vitro
Maćešić, N., Marijan Cergolj, Nikica Prvanović, Marko Samardžija, Tugomir Karadjole,
Martina Karadjole, Goran Bačić, Tomislav Dobranić, Antun Kostelić, Miroslav Benić 457
THE ETIOLOGY AND PREVALENCE OF INTRAMAMMARY INFECTION OF DAIRY GOATS IN
REGIONS OF NORTH CROATIA
ETIOLOGIJA I PREVALENCIJA INTRAMAMARNIH INFEKCIJA KOZA U SJEVERNOJ HRVATSKOJ
Šakić Vedad, Katica Velija, Crnkić Ćazim, Softić Almira, Brdarić Maja 461
PHENOTYPE AND PRODUCTIVE CHARACTERISTICS OF DUBIAN ZECKEL SHEEP
FENOTIPSKE I PROIZVODNE KARAKTERISTIKE OVCE DUBSKE PRAMENKE
VIII XVI. kongres Mediteranske federacije za zdravlje i produktivnost preživača (FeMeSPrum), Zadar, Croatia, 2008
Grabarević, Ž., Seiwerth, S., Čorić, M., Šoštarić-Zuckermann, I.C., Hohšteter, M., Artuković, B.,
Beck, A, Gudan-Kurilj, A., Džaja, P., Švić, L. 467
Metastatic cholangiocarcinoma in a cow - case report
Metastatski kolangiocelularni karcinom krave – prikaz slučaja
Dettori, M.L., G.M. Vacca, V. Carcangiu, M. Pazzola, M. Sanna, G. Maricosu, P.P. Bini 473
POLIMORFISMO DEL GENE CSN1S2 NELLA CAPRA SARDA
POLIMORFIZAM GENA CSN1S2 U SARDINIJSKE KOZE
Sanchez, L, Cantalapiedra, J.A., Carril, J. A., Iglesias, A. 481
ANALYSIS OF GROWTH CURVE OF CROSSES RUBIA GALLEGA X NELLORE BY MEANS OF
MICHAELIS-MENTEN EQUATION
ANALISIS DE LA CURVA DE CRECIMIENTO DE CRUCES DE RUBIA GALLEGA X NELORE
MEDIANTE LA ECUACION DE MICHAELIS-MENTEN
Gönül Remzi, Abdullah Kayar, Tanay Bílal, M. Erman Or, Çağla Parkan, H. Tamer
Dodurka, Tevfik Gülyaşar, Bora Barutçu 485
COMPARISON OF MINERAL LEVELS IN BONE AND BLOOD SERUM OF CATTLE IN
NORTHWESTERN TURKEY
USPOREDBA RAZINE MINERALA U KOŠTANOM SUSTAVU I KRVI KRAVA U
SJEVEROZAPADNOJ TURSKOJ
Cubeddu G.M., Coluccio P., Lai M.G., Pintori G.,Vacca E. 491
Forensic observation on the use of auricular marks on the Sardinian purebred
sheep
Osservazioni cliniche, medico-legali, legislative e di benessere animale
sull’applicazione delle marche auricolari in ovini di razza sarda
MEDICINSKO-PRAVNI OSVRT NA PRIMJENU UŠNIH MARKICA KOD SARDINIJSKIH PASMINA
OVACA
Gharzi, A and Abbasi, M 497
Biometry and histomorphometry of ovary in Lori local sheep
Biometrija i histomorfometrija ovarija ovce pasmine Lori
Hassanpour, A., Amougli Tabrizi, B. 498
Biochemical and hematological parameters in cows with TRP
Biokemijski i hematološki pokazatelji u goveda sa TRP
Yahya Tahamtana, Seyyed Shahram Shekarforooshb, Seyyed Ali Pourbakhshc 499
The survey on prevalence of E.coli O157:H7 using VT1, 2 and eae genes from
sheep in Shiraz-Iran
Pregled pojavnosti E.coli O157:H7 upotrebom VT 1,2 i eae gena iz pokrajine
Shiraz u Iranu
Yahya Tahamtana, Ali Pourbakhsh, Shahram Shekarforoosh 500
First Identification of Escherichia coli O157:H7 by Improved Trypticase Soy
Broth and Sorbitol MacConkey Agar containing cefixime and tellurite and
comparison with PCRs from cattle carcasses in Shiraz-Iran
Prva identifikacija E.coli O157:H7 na poboljšanoj podlozi bujona sojine
triptikaze i sorbitol McConkey agaru koji sadrže cefexim i telurit u
usporedbi s PCR od goveđih lešina u iranskoj pokrajini Shiraz
Saif A. Balios, Muaffq S. Kassim and Rabea A.S.Al-Oramary. 501
Induction of parturition in ewes (local breeds) and subsequent survival of
neonates
Brianti, E., Abbene S., Gaglio G., Risitano A.L., Ferlazzo M., Chiofalo B., Cavallaro M., Giannetto S. 502
Effects of untreated gastrointestinal nematode infections on performances
and development of effective immune response in lambs of Valle del Belice
breed
XVI Congress of the Mediterranean Federation for Health and Production of Ruminants (FeMeSPrum), Zadar, Croatia, 2008 IX
Bahari Aliasghar, Mohammadreza Sadeghi, Shamsedin Ghaemmaghami, Ali Sadeghi-nasab 503
Serological survey on bovine viral diarrhea virus infection of cattle in
Hamadan area-Iran
Haghparast Alireza, Gholamreza Mohammadi, Shalaleh Mousavi 504
Seroepidemiology of Bovine Leukemia Virus (BLV) infection in the north
eastern provinces of Iran
Leoni, G. G., Bebbere D., Satta V., °Berlinguer F., Mereu P., Pirastru M., Manca L., Naitana S. 505
GENETIC CARACTERIZATION OF SARDINIAN MOUFLON POPULATION USING
MICROSATELLITES AND mtDNA MARKERS.
Kocamüftüğlu Mesih, Ayhan Ata, Mehmet Kale, Sibel Hasircioğlu 506
Investigation of Bovine Viral Diarrhea Virus (BVDV) Infection in Relation to
Fertility in Dairy Cows with Repeat Breeding
Prvanović, N., M. Cergolj, A. Tomašković, N. Maćešić, J. Grizelj, M. Samardžija, T. Dobranić,
N. Filipović, G. Bačić, M. Lipar 507
Influence of impropriate milking on udder health of dairy cows
Mohagheghzadeh Ali 508
ANTIMICROBIAL EFFECT OF EDTA_TRIS AND ANTIBIOTICS ON SALMONELLA
TYPHIMURIUM INVITRO AND ON BROILER CARCASE
Nicolussi P, Bonelli P, Pau S, Canalis M, Soru A, Sarria A, Patta C, Marongiu E, Di Gennaro A,
Bonfini B, Savini G. 509
Effects of Bluetongue live modified vaccine on early and mid pregnancy in
sheep
Vicari D., Mancuso R., Cicero A., Randazzo V., Martorana C., Chetta M., Ferrantelli V., Castiglione F. 510
Epidemiological survey of infectious causes of diarrhea in young small
ruminants in Sicily
Castiglione F., Tamburello A., Macrì D., Emanuele M.C., Alaimo C., Monteverde V., Puleio R.,
Manno C., Ferrantelli V., Nicholas R.A.J. *, Loria G.R. 511
Development of “potency test” for evaluation of farm vaccines against
contagious agalactia in a natural outbreak
Galia S., Pugliese M., De Majo M., Mazzullo G. 515
CLINICAL AND HISTOPATHOLOGICAL FINDINGS IN A CASE OF OVINE OCULAR SQUAMOUS
CELL CARCINOMA (OSCC)
Sušić, V., A. Ekert Kabalin, I. Štoković, Ž. Pavičić, B. Mioč, V. Pavić, Z. Barać 521
Sheep of the Island of Pag: lambing frequency and lamb birth weight during
winter-spring season
Paška ovca: učestalost janjenja i porodna masa janjadi tijekom zimsko-
proljetne sezone
Benić, M., Ž. Cvetnić, M. Lojkić, B. Habrun, G. Kompes, M. Cergolj,, N. Maćešić 527
Prevalence and aethiology of cow mastitis in small dairy holdings in Croatia
Prevalencija i etiologija mastitisa krava u malim obiteljskim gospodarstvima
Di Marco Vincenzo, Russo Miriam, Aronica Vincenzo, Fiasconaro Michele, Scimeca Salvatore,
Alongi Angelina, Torina Alessandra 531
Case Report of anaplasmosis on a sheep farm in the Nebrodi Mountain range
(Sicily – Italy - Europe)
Caracappa Santo, Torina Alessandra, Nicosia Silviane, D’Agostino Rosalia, Russo Miriam, Alongi
Angelina, Di Marco Vincenzo 533
Theileria equi in ovine: a cases report
Barriada Alvarez M., Martínez López L. M. 535
ANIMAL IDENTIFICATION: CONDITIONS OF THE INDIVIDUAL IDENTIFICATION OF BOVINE
ANIMALES IN ASTURIAS (SPAIN)
Invited Lectures
Pozvana predavanja
XVI Congress of the Mediterranean Federation for Health and Production of Ruminants (FeMeSPrum), Zadar, Croatia, 2008 11
Autochthonous Ruminant Breeds in Croatia
Autohtone pasmine preživača u Hrvatskoj
V. Sušić1, A. Ekert Kabalin1, I. Štoković1, Ž. Pavičić2, B. Mioč3, V. Pavić3, Z. Barać4, S.

Menčik1
1
Department of Animal Husbandry, Faculty of Veterinary Medicine, University of Zagreb, Croatia
2
Department of Animal Hygiene, Environment and Ethology, Faculty of Veterinary Medicine, University of
Zagreb, Croatia
3
Department of Animal Science II, Faculty of Agriculture, University of Zagreb, Croatia
4
Croatian Livestock Centre, Zagreb, Croatia
In every geographical region, as well as in the regions of the Republic of Croatia, autochthonous
breeds of animals evolved and adapted under the influence of a number of factors - ranging from natural
selection to those implemented by man (Posavi et al., 2001). Declining numbers or the disappearance
of autochthonous domestic animal breeds in the last hundred years is the result of an increasingly
rapid technological development and the establishment of greater economic requirements, in addition
to socio-economic changes and the migration of the rural population to urban areas. Consequently, at
present time in the world, like in Croatia, a great deal of attention has been given to the preservation
of autochthonous breeds of animals.
After signing the Convention of Biological Diversity in 1992 and its ratification by the Croatian
Parliament in 1996, creating of national strategies for protecting Croatia’s biological and landscape
diversity have started. The main reasons for protection the diversity of autochthonous animal breeds
are their value as components of Croatian heritage, as well as their inclusion in the historico-cultural
development of certain regions (Ekert Kabalin and Štoković, 2007; Posavi et al, 2001; Sušić et al.,
2001).
The main ways to preserve autochthonous breeds includes identification, ascertaining size
and status of endangered breeds, their genotyping and conservation methods in situ and ex situ.
Preservation in situ implies the preservation of the population in their original environment, while
ex situ implies the preservation of animals removed from their original environment. Two methods
of preservation can be used: in vivo (live animals) and in vitro (storage of genetic material like
semen, embryos or other tissues in the gene bank) (Štoković et al., 2007 a and b; FAO 2005; Henson
1992).
As an urgent measure to put a stop to the disappearance of autochthonous breeds, the Republic
of Croatia increased financial Subsidies for their breeding. Besides that, several research and
aplied programes started with the goals to develop favourable marketing conditions with the
commercialization of autochthonous products that need to find a place on the domestic and foreign
markets (Ekert Kabalin and Štoković, 2007).
Status of autochthonous ruminant breeds in Croatia

According to the World Watch List categorization, Croatian autochthonous ruminant breeds are
located on different levels of endangerment (Barać et al., 2007; Bulić et al., 2007; Ekert Kabalin
and Štoković, 2007; CLC, 2007; DZZP, 2006; Sušić et al., 2006b and 2001; Posavi et al., 2004 and
2001).
The present status of autochthonous ruminant breeds in Croatia are illustrated in Tables 1 and
2.
Table 1: Status of Croatian autochthonous cattle breeds in the year 2006 (Source: CLC, 2007; Annual Report
for 2006)
Number of animals Effective

Population
Breed Number Number population
status
of males of females size*
Istrian cattle 18 343 68,41 in danger
Buša of Lika 11 100 39,64 in danger
Şlavonian-Syrmian
1 26 3,85 critical
Podolian
* Effective population size (Ne) is the fundamental criteria for the determination of endangered
breeds. It is calculated according to the expression: Ne = (Nm * Nf) / (Nm + Nf)
Table 2: Breed structure of sheep and goats under selection control and estimate of population size in 2006
(Source: CLC, 2007- Annual Report for 2006)
Number of Estimate of
Number of Number of
Breed rams /he- Total heads population
sheep /goats yearlings
goats size
Istrian Sheep 1.923 285 53 2.261 2.261
Sheep of the Island of Cres 603 121 23 747 15.000
Sheep of the Island of Pag 1.944 411 88 2.443 30.000
Ruda Sheep 253 37 17 307 307
Pramenka of Lika 4.035 866 81 4.982 30.000
Pramenka of Dalmatia 2.311 447 78 2.836 200.000
Tsigai 1.841 682 39 2.562 3.000
Sheep of the Island of Rab 645 129 22 796 6.500
Croatian variegated goat 210 23 7 240 20.000
Primary characteristics of Croatian autochthonous cattle, sheep and goat breeds

According to the List of autochthonous and protected breeds and strains of domestic animals
(NN 127/98, 73/03, 39/06, 126/07) in autochthonous breeds of ruminants are included: Istrian cattle,
Buša of Lika, Şlavonian-Syrmian Podolian, Pramenka of Dalmatia, Ruda Sheep (Dubrovnik Sheep),
Sheep of the Island of Cres, Sheep of the Island of Rab, Pramenka of Lika, Istrian Sheep, Sheep of
the Island of Pag, Tsigai, Sheep of the Island of Krk, Croatian variegated goat and Croatian white
goat (MPŠVG, 1998, 2003, 2006 and 2007).
CATTLE
The Istrian cattle belongs to a group of primitive primigenius European cattle. Among the people
it’s still called boškarin. The creation of this cattle breed favours arable land, gentle climate and a rich
14 XVI. kongres Mediteranske federacije za zdravlje i produktivnost preživača (FeMeSPrum), Zadar, Croatia, 2008
Istrian cattle
millenial livestock tradition. Cows of a mature age are tall in withers around 138 cm and the length
of the body is around 155 cm. Bulls are on average tall in withers around 155 cm and can attain 170
cm. On average, they weigh between 1000 and 1200 kg (some examples can attain up to 1400 kg).
Istrian cattle has a coarse physical constitution and strong bone structure, resistant and strong with
great working abilities. Most often, they are light grey to white in colour transitioning to darker grey
tones. The horns are proportionally long in a shape that resembles a lyre. At the roots they are greyish
to yellowish, and from the half way point to the tops they are dark grey to black. The hooves are hard
made with very sturdy keratin, trimmed with black hair. At birth, the calves are often red, although
they can be white to grey. Istrian cattle belongs to a late maturing breed of cattle whose maturity
reaches 6-7 years in age providing the extraordinary possibility for long lasting useage of these
cattle in work. High resistancy, modesty and adaptability to the conditions of the Istrian climate,
gives the possibility to use poorer, marginal pastures and overgrown wooded vegetation which is
the main food source in the time of drought. Today we endeavour to include this breed in sustainable
production based on the meat production as well as autochthonous cheeses (www.hssc.hr; Posavi et
al., 2004 and 2002).
The Buša of Lika was included in the critical breeds category, however, according to the report
from the Croatian Livestock Centre for 2006 (CLC, 2007) it is mentioned as a breed in danger. It
belongs to the group of short-horned cattle - Bos brachyceros europaeus. It belongs to the primitive
(extensive) breed of cattle which can be found in regions where man’s influence on its breeding is
very weak. The Buša of Lika is a tiny cattle with a coarse physical constitution. The height of the
wither is 100 to 110 cm. The cow weighs from 180 to 250 kg and the bull approximately 300 kg. It
is nearly always one colour, from completely bright, brown throughout, prutaste (national name for
buša with concealed, bushy, narrow tiger stripes) red to black colour with stripes on its back which
is in contrast with its basic colour. The horns and hooves are always dark. It is a late maturing cattle.
The first time heifers mate is from 2 years. The calves are tiny, their birth weight is approximately 15
kg. The fertility of the Buša ok Lika is about 85-90%. Female animals remain fertile between 10 to
12 years. They live about 20 years. The Buša of Lika is the result of poor nutrition and little care so
that its milk production is not greater than 700 to 800 litres. The milk is excellent quality because it
Buša of Lika
has 4 to 6% milk fat. Lactation lasts about 8 months. The production of meat is poor (55%) because
the Buša is bony and tiny animal. The work ability of the Buša of Lika is modest, but satisfactory for
the extensive agricultural needs of its breeding area. This breed is suitable for individual breeding
in families which are involved in extensive raising and who have modest breeding facilities. Cattle
are held outside in summers and winters, whether they are in the pastures or corrals. Only during the
Slavonian-Syrmian Podolian
coldest winter or in bad weather they are closed in the stables. It is favourable for the economical
production of cattle meat and the production of autochthonous cheeses (www.hssc.hr; Posavi et al.,
2004 and 2002).
The Şlavonian-Syrmian Podolian belongs to the group of long-horned cattle - Bos taurus. At
the beginning of the 20th century it was the most significant and the most representative of cattle
breeds in Croatian regions of Baranja, Syrmia and Slavonia and in the part of Podravina. Today,
most of the animals are raised in The Croatian Centre for Reproduction in Cattle Breeding. It is a
late-maturing, very resistant and perservering cattle with a sturdy skeleton. The height of the cow is
approximately 130 cm, while the bulls are approximately 10 cm higher. The colour of the Slavonian-
Syrmian Podolian is white grey to dark grey, often with dark pigmentation on the lower neck and
head. In bulls, there is noticeable pigmentation, and bigger dark circles around the eyes. The horns
are the main feature of this breed, differing in length, often in a slanted position to the tops which
portrude on the side, with a big span between the tops (lyre-shape). The other type of horns are in
a more vertical position and the tops hooked backwards so these horns have a pitch fork shape. In
the past, this breed of cattle was raised mainly because of work and meat. Milk products range from
800 to 1000 litres in lactation. Today we can regard this breed as an important genetic resource, and
in addition, it is necessary to emphasize its ecological and economic value in producing specific
products - cattle meat and the production of autochthonous cheeses (www.hssc.hr; Posavi et al., 2004
and 2002).
SHEEP
The Pramenka of Dalmatia belongs to the large group of pramenka sheep. This is a Croatian
autochthonous breed of sheep raised in the wider territory of Dalmatia region. It is very resistant,
adaptable to the specific climate conditions (high summer temperatures often accompanied by long
lasting drought) and characterized by its good use of low quality grass. The Pramenka of Dalmatia
represents a very valuable population of sheep, esspecially in territories with difficult economic
conditions (karstic, mountainous terrains, Dalmatian hinterland). Rams have strong horns, while
sheep are generally hornsless. The ears are in a straight position. The fleece is an open end kind with
piercing tufts. The body mass of a sheep is between 30 to 40 kg and the ram is 45-55 kg. It is a late
maturing breed. The colour of the wool is mostly white, although we have a significant percentage
of animals with black colour, and a smaller percentage with brown and grey wool. Fertility is low
(liter size is 1.1). Milk production varies from 50 to 100 kg of milk in a lactation period of 150-180
days. Until age of 120 days weight gain is approximately 170 grams per day. Randement is from 45
to 52%, with high meat quality. Today the Pramenka of Dalmatia is mostly bred for its lamb meat.
Only a small number of sheep are used for milk and cheese production (www.hssc.hr ; Posavi et al.,
2004 and 2002; Mioč et al., 2000).
Sheep of the Island of Cres Sheep of the Island of Rab
Pramenka of Lika Tsigai (Source: Posavi et al., 2004)
Istrian Sheep Sheep of the Island of Pag
Ruda Sheep (Dubrovnik Sheep) is breed which is raised on a narrow Croatian coastal belt from
the Pelješac peninsula to the border with Montenegro. It is assumed that breed came into existence
with time in the Republic of Dubrovnik through crossbreeding of domestic pramenka sheep and
merino fine wooled sheep which were imported by sailors from Spain, Portugal and Italy. According
to the colour of the wool, the Dubrovnik Sheep is in 90% of cases white, and rarely black. The
average body mass of the sheep is 30-40 kg, and of rams 42-52 kg. Sheep are in wither height 58-62
cm and rams 62-66 cm. Sheep breeding is mainly extensive and nutrition is based on pasture. Just a
small number of sheep breeders use concentrated fodder for feeding. The remaining heads are raised
exclusively for their meat products (lamb). Sheep fertility is 120-150%, the body mass of lambs of
30-45 days old weigh 12-15 kg, in a period of 3-4 months the body weight is 25-30 kg. Currently the
Dubrovnik sheep is one of the most endangered of all indigenous breeds of sheep in the Republic of
Croatia (www.hssc.hr; Posavi et al., 2004 and 2002; Mioč et al., 2003 and 2000).
Sheep of the Island of Cres have origins and are raised on the islands Cres and Lošinj. Based
on the environment the Sheep of the Island of Cres is small, quite lively and rather resistant. The
torso of the Sheep of the Island of Cres is middle length and height, rather well built with some
thinner, longer but distinctively strong legs adapted to the difficult rocky terrains on the island Cres.
The height of the withers of the sheep is approximately 60-65 cm and for rams 63-70 cm. The body
mass of the sheep is approximately 33-40 kg and of the rams about 50 kg. Sheep are with or without
horns, and rams have strong, sturdy and very pronounced horns. They belong to the category of long
tailed sheep. Concerning its production quality the Sheep of the Island of Cres belongs to a group
of breeds with combined production properties. Fertility is 120-150%. The body mass of lambs 30-
45 days old amounts from 12 to 15 kg. Milk production is 100-150 litres. Annual shear amount per
sheep is 1-1,5 kg and rams from 2 to 3 kg. The lambs of Sheep from Island Cres are highly requested
because of theirs meat quality. (www.hssc.hr; Pavić et al. 2006; Posavi et al., 2004 and 2002; Mioč
et al., 2000).
The Sheep of the Island of Rab is remarkable resistant breed and adaptive to the climate of the
island of Rab (high summer temperatures often accompanied by long lasting drought, bora wind in
winter months). In the sheep profile the nasal bone is slightly prominent and they are often horned.
The fleece is white and half closed. The head and the legs are often white but on the legs, head and
ears there might appear black, brown or grey spots. Sheep lamb one lamb in a litter, rarely two
so the average size of the litter is 1,1 -1,2 lambs. During lactation from 150-170 days the sheep
produces from 80-120 kg of milk. The daily weight gain of lambs aged up to 100 days amounts to
approximately 180 g. Slaughtery utilization of lambs amounts from 45-55% and the quality of the
meat is excellent so it represents a culinary speciality. Today sheep are mainly raised for lamb-meat,
and just a small number of sheep are used for milk production (www.hssc.hr; Posavi et al., 2004 and
2002; Mioč et al., 2006 and 2000).
The Pramenka of Lika is a breed which was developed in the mountainous area of Lika and
Gorski Kotar. It is the most typical type of pramenka in Croatia. This sheep belongs to the group of
medium developed sheep, pronoucedly resistant and adaptive. The Pramenka of Lika is well built
with a strong physical constitution. Sheep have an average weight of 45-55 kg, while rams 65-75 kg.
Usually some have pronounced length rather than body height. The height of the withers in sheep is
62-65 cm, while in rams 67-72 cm. The body ends with a tail which reaches as far as under the ankle
joints. The body is covered in open fleece mixed wool, composed of pointed tufts. Rams are horned,
sheep are mostly hornless. White is the typical colour. Head is spotty with bigger and smaller black
speckles. Milk production during lactation is 120-150 litres. A lamb of 3-4 months reaches a weight
of 20-25 kg ( www.hssc.hr; Posavi et al., 2004 and 2002; Mioč et al., 2000 and 1998).
The Istrian Sheep is breed expanded in the wider territories of Istra. Although the origin of this
breed isn’t completely clear, it’s exterior implies the type of mediterranean sheep in which were
left traces by certain Italian breeds, particularly Bergamo sheep. Istrian Sheep are included in the
sturdiest pramenka in Croatia, which is confirmed by the fact that the average mass of sheep reaches
up to 70 kg, and rams up to 100 kg. The height of wither in rams is 82-88 cm and in sheep 76-80
cm. They are well built, with a strong physical constitution and pronounced body length. The head is
mid length with a convex profile line. In many sheep ear agility can be entirely limited inside closed
spiral horns. The fleece covers the upper side of the neck and back, while the stomach, legs and face
are covered in short hair. The body is fundamentally white with spots while the stomach and the
legs are usually entirely black. Sometimes the pigmentation is so pronounced that it looks like its
black foundation. Istrian Sheep belong to the group of sheep with combined meat-milk production
characteristics. In the course of lactation from 200 days on average sheep produce about 120 kg of
milk, a smaller number of heads produce even more than 200 kg. The most of breeders of Istrian
Sheep produce hard sheep cheese which is greatly valued on the market. The fertility of the Istrian
sheep is 130-150 %, and the body weight of lambs at the age of 45-60 days is 15-18 kg (www.hssc.
hr; Mikulec et al., 2007; Posavi et al., 2004 and 2002; Mioč et al., 2000).
Sheep of the Island of Pag are raised almost exclusively on the island of Pag. This breed is a
little smaller than other island sheep breeds. The torso is well built, with middle pronounced width
and depth. Sheep have an average body weight of 30-40 kg and rams 50 kg or more. The height of
wither in sheep is 57-60 cm, and in rams 59- 63 cm. They are mainly white and in approximately 2%
of cases they appear in a black colour, and that individuals are rarely remaining for breeding. Sheep
are mainly hornless while rams are mostly horned, though there are some without horns. Because the
back is not much higher than the withers, the back line lightly climbs towards the back. The body is
well covered with wool. The fleece is closed to half closed. The legs are sturdy. The length of the tail
reaches under the ankle joint. Fertility is approximately 120%. Lambs suckle until 30 days. The birth
weight of lambs is about 3 kg. The body mass of lambs 30-45 days old is 12-15 kg. After the suckling
period sheep are milked about 5 months so that the average length of lactation is about 180 days,
and in that time Sheep of the Island of Pag produce from 80 to 150 litres of milk. The fundamental
production goal in breeding Sheep of the island of Pag is the production of milk and well known
cheese. A special place on the Croatian market is also reserved for the high quality lamb meat. (www.
hssc.hr; Sušić et al., 2006a; Pavić et al., 2005; Posavi et al., 2004 and 2002; Mioč et al., 2000).
The Tsigai is one of the oldest breeds which was created in the Middle East from where it
expanded into the Balkan peninsula and in certain parts of Europe. In Croatia it is bred in regions of
Slavonia and Barania. It is a large breed, with a well built body and a strong physical constitution.
The average height in sheep amounts to 60-76 cm while 70-85 cm in rams. Rams have a prominent
profile. Sheep are hornless and rams may have horns. The ears are big and often slouching. The head,
ears and legs are black. At birth the lamb is a grey mouse colour. With time this colour is lost, so
that at the age of 4 months the lamb gets white coloured wool, except for grey-born lambs which are
mostly black and rarely variegated. The Tsigai is a breed of combined production characteristics - for
meat, milk and wool production. Adult sheep weigh 50-65 kg and rams 70-100 kg. Although during
lactation the Tsigai can give up to 120 litres of milk, today it is bred exclusively for the production of
lamb-meat. Fertility is 140-180%, and the weight gain of lambs of 3-4 months amounts to 30-35 kg
(www.hssc.hr; Posavi et al., 2004 and 2002; Mioč et al., 2000).
Sheep of the Island of Krk is breed especially resistant, adaptive to the climate on the island of
Krk (high summer temperatures often accompanied by long lasting drought, bora wind in the winter
months). It is a smaller sheep, but proportional with a sturdy build. It is lively and resistant. The sheep
are most often white, rarely black, grey or brown. The head of the sheep is small, with a straight
profile and hornless. In rams the nasal bone profile is pronounced and they are often horned. The
fleece is half closed to closed. The head and the legs are most often white but on the legs, heads and
ears can appear black, brown or grey spots. These sheep most often lamb one lamb in a litter, rarely
two, so the average size of the litter is 1,1-1,2 lambs. During lactation from 150 to 170 days sheep
produce from 90 to 120 kg of milk. Aged up to 100 days, the average daily weight gain amounts to
about 180 g. Randement of slaughterd lambs amounts to approximately 45%, the meat quality is
excellent and represents a culinary speciality. Sheep of the Island of Krk are mostly raised today for
their lamb-meat which is highly regarded on the Croatian market („Lamb from the island of Krk“). A
small number of sheep are used for milk production, although there is growing interest in the market
for hard sheep cheeses („Sheep cheese from the island of Krk“) (www.hssc.hr; Posavi et al., 2004 and
2002; Mioč et al., 2004 and 2000).
GOAT
The Croatian variegated goat is characterized by its resistance and adaptability to difficult
available passages and difficult karst terrains. The average body weight amounts to 30-40 kg in
females and to 40-60 kg in males. The body is covered with long, thick and shiny hair of different
colours. The horns are dark, coarse and dull and grow behind like a sabre. Breeding of Croatian
varietgated goats is organized primarily in extremely extensive conditions. Goat fertility on average
amounts to 100% and in some flocks it can be 20-30% twins. The average milk production is about
100 l during lactation from 150-200 days. At present time the major production goal for breeders of
Croatian varieated goat is meat (www.hssc.hr; Posavi et al., 2004 and 2002).
Besides Croatian variegated goat, there is also the Croatian white goat, but this population is not
introduced as a breed in the National Register, nor does it exist in the FAO’s reports of endangered
autochthonous breeds. Basic characteristics of this population are resistance, adaptability, modesty,
agility, liveliness and persistance. Goats are white, sometimes cream to a light yellowish colour. They
are raised primarly because of the meat. The main breeding regiones are territories with difficult
economic conditions (mountain karstic terrains, Dalmatian hinterland, islands) similar to the Croatian
variegated goat. The average body mass of an adult female is between 40-60 kg while the male is 50-
70 kg, depending on the environmental conditions, mostly feeding. Goats have good fertility, early
maturity, most often give birth to twins, so the average fertility is from 160-180 %. During lactation
from 250 to 280 days they produce 250 to 300 kg of milk, and the average daily weight gain of kids
is about 180 g (www.hssc.hr; Posavi et al., 2004 and 2002).
Croatian variegated goat (Source: Posavi et al., Croatian white goat (Source: Posavi et al., 2004)
2004)
Financial Subsidies
It is clear fact that the production capacity of autochthonous breeds is relatively low and that those
populations cannot be competitive with other high productive breeds and/or crossbreeds concerning
the conditions of conventional livestock production. Taking into consideration that the protection of
autochthonous domestic animal breeds are special interest, the Republic of Croatia insured financial
resources for their breeding. Those financial resources are used for paying breeders/owners through
subsidies (Dadić and Jakopović, 2007).
Subsidies in Croatian livestock production can be divided into three fundamental groups:
subsidies in conventional production (in milk production, for fattening cattle, for breeding cattle…),
then subsidies in ecological production and subsidies for the breeding of autochthonous and protected
breeds. The legal regulations for subsidies in cattle production is based on the Law of the country
subsidiary in agriculture, fishery and forestry (NN 87/02; NN 117/03; NN 82/04; NN 12/05; NN
85/06; NN 141/06 - MPŠVG 2002, 2003, 2004, 2005 and 2006) and the Regulation of manners and
conditions concerning the implementation of the production subsidies model (NN 17/07 - MPŠVG,
2007) (Dadić and Jakopović, 2007; www.hssc.hr).
Table 3: Paid subsidies for Croatian autochthonous ruminant breeds during the year 2006
(Source: www.hssc.hr)
Number of Sum Total ≈ Euros per

Breed
heads Kunas ≈ Euros head
Istrian cattle 613 2.431.500 ≈ 334.500 ≈ 550
Buša of Lika 141 603.000 ≈ 83.000 ≈ 600
Slavonian Syrmian Podolian cattle 141 550.500 ≈ 76.000 ≈ 550
Istrian sheep 1849 647.150 ≈ 89.000 ≈ 50
Sheep of the island of Cres 593 207.550 ≈ 29.000 ≈ 50
Sheep of the island of Pag 1620 567.000 ≈ 78.000 ≈ 50
Ruda Sheep 265 139.125 ≈ 19.000 ≈ 70
Pramenka of Lika 1997 698.950 ≈ 96.000 ≈ 50
Pramenka of Dalmatia 164 57.400 ≈ 8.000 ≈ 50
Tsigai 294 102.900 ≈ 14.000 ≈ 50
Sheep of the island of Rab 668 233.800 ≈ 32.000 ≈ 50
Croatian variegated goat 200 70.000 ≈ 10.000 ≈ 50
Conclusion
The most rational strategies for the protection of autochthonous ruminant breeds are to ensure
that they evolve or that they remain as a functional part of the production system. Therefore, in
their economic assessment we have to take into consideration some specific factors which give
them preference in comparison with high productive breeds. Those factors are: genotype diversity,
environment adaptation, socio-cultural contributions in heritage as well as production of some
autochthonous products or some other unique use (Kuterovac et al., 2001; Rege, 1999; WWL-DAD
3, 2000). Also, breeding and production of autochthonous ruminant breeds can be opportunity to
increase market and tourist offer (national parks, eco-villages…) (Sušić et al., 2001; Horvath, 1996).
In this way, a part of Croatian future agriculture could be based on raising autochthonous breeds in
an ecologically acceptable manner, within sustainable production systems, in order to gain optimal
results as well as to protect biological diversity.
Reference:
1. Barać, Z., B. Mioč, V. Pavić, V. Sušić (2007): Uzgoj izvornih pasmina ovaca i koza u Republici Hrvatskoj.
Konferencija o izvornim pasminama i sortama kao dijelu prirodne i kulturne baštine. Šibenik, 13. - 16.
studenog 2007. Knjiga sažetaka (Radna verzija), Zagreb, 12-13.
2. Bulić, V., A. Ivanković, Z. Ivkić, M. Špehar, N. Kelava, M. Konjačić (2007): Stanje i odlike izvornih
pasmina goveda u Hrvatskoj. Konferencija o izvornim pasminama i sortama kao dijelu prirodne i kulturne
baštine. Šibenik, 13. - 16. studenog 2007. Knjiga sažetaka (Radna verzija), Zagreb, 41-42.
3. Croatian Livestock Centre - CLC (2007): Annual Report for 2006. Zagreb.
4. Dadić, M., I. Jakopović (2007): Zakonske odrednice uzgoja izvornih i zaštićenih pasmina i sojeva domaćih
životinja u Republici Hrvatskoj. Konferencija o izvornim pasminama i sortama kao dijelu prirodne i
kulturne baštine. Šibenik, 13. - 16. studenog 2007. Knjiga sažetaka (Radna verzija), Zagreb, 67-70.
5. DZZP - Državni zavod za zaštitu prirode, Ministarstvo kulture RH / State Institute for Nature Protection,
Ministry of Culture (2006): Biodiversity of Croatia.
6. Ekert Kabalin, A., I. Štoković (2007): Očuvanje hrvatskih izvornih pasmina. Drugi kongres studenata
veterinarske medicine s međunarodnim sudjelovanjem. Zagreb, 13. - 16. lipnja, 2007. Zbornik, Zagreb,
19-20.
7. FAO (2005): Options and Srategies for the Conservation of Farm Animal Genetic Resources. FAO
international workshop from 7th to 10th November 2005. (http://www.fao.org/ag/againfo/subjects/en/
genetics/documents/ITCMTGSWI/fagr.pdf), Montpellier, France.
8. Henson, Elizabeth L. (1992): In situ conservation of livestock and poultry. FAO animal production and
health paper 99,Rome, FAO and UNEP, 1992.
9. Horvath, Š. (1996): Hrvatske baštinjene pasmine. Pokret prijatelja prirode “Lijepa naša”. Zagreb.
10. Kuterovac, K., A. Kljujev, M. Janeš, A. Pezo, K. Sinković, Z. Nushol, M. Dražić (2001): Zaštita i očuvanje
raznolikosti domaćih životinja u Hrvatskoj. Biološka raznolikost u stočarstvu Republike Hrvatske, Zbornik
radova, 13.-27. HAZU, Zagreb.
11. Mikulec, D., Pavić, V., Sušić, V., Mioč, B., Mikulec, K., Barać, Z., Prpić, Z., Vnučec, I. (2007) Odlike
vanjštine različitih kategorija istarskih ovaca
12. Mioč, B., Ivanković, A., Pavić, Vesna, Barać, Z., Sinković, Karmen, Marić, I. (2003): Odlike eksterijera i
polimorfizmi proteina krvi dubrovačke ovce. Stočarstvo 57 (1), 3-11. Stočarstvo. 61 (1), 13-22.
13. Mioč, B., Pavić V., Barać, Z. (1998): Odlike eksterijera ličke pramenke. Stočarstvo 52 (1): 93-98.
14. Mioč, B., Pavić, V. and Ivanković, A. (2000): Tipovi i pasmine ovaca i koza u Republici Hrvatskoj.
Stočarstvo 54 (1): 56-61.
15. Mioč, B., Pavić, V., Barać, Z., Sušić, V., Prpić, Z., Vnučec, I., Mulc, D. (2006): Vanjština rapske ovce.
Stočarstvo. 60 (3); 163-171.
16. Mioč, B.; Pavić, V.; Ivanković, A.; Barać, Z.; Vnučec, I.; Čokljat, Z. (2004): Odlike eksterijera i polimorfizmi
proteina krvi krčke ovce. Stočarstvo. 58, (5) 331-341.
17. MPŠVG - Ministarstvo poljoprivrede šumarstva i vodnog gospodarstva (1998, 2003, 2006, 2007): Popis
izvornih i zaštićenih pasmina i sojeva domaćih životinja. Izmjene i dopune popisa izvornih i zaštićenih
pasmina i sojeva domaćih životinja te njihov potrebni broj. NN 127/98, 73/03, 39/06, 126/07.
18. MPŠVG - Ministarstvo poljoprivrede šumarstva i vodnog gospodarstva (2002, 2003, 2004, 2005, 2006):
Zakon o državnoj potpori u poljoprivredi, ribarstvu i šumarstvu. Izmjene i dopune Zakona o državnoj
potpori u poljoprivredi, ribarstvu i šumarstvu. NN 117/03, 82/04, 12/05, 85/06, 141/06.
19. MPŠVG - Ministarstvo poljoprivrede šumarstva i vodnog gospodarstva (2007): Pravilnik o načinu i
uvjetima provedbe modela poticanja proizvodnje. NN 17/07.
20. Pavić, V., Mioč, B., Sušić, V., Barać, Z., Vnučec, I., Prpić, Z., Čokljat, Z. (2006): Vanjština creske ovce.
Stočarstvo. 60 (1); 3-11.
21. Pavić, Vesna, B. Mioč, Z. Barać, I. Vnučec, V. Sušić, N. Antunac, Dubravka Samardžija (2005): Vanjština
paške ovce. Stočarstvo 59 (2): 83-90.
22. Posavi, M., R. Ozimec, M. Ernoić, F. Poljak (2004): Enciklopedija hrvatskih domaćih životinja. Katarina
Zrinski d.o.o., Varaždin.
23. Posavi, M., M. Ernoić, R. Ozimec, F. Poljak (2002): Hrvatske pasmine domaćih životinja. Ministarstvo
zaštite okoliša i prostornog uređenja, Zagreb.
24. Posavi, M., M. Ernoić, R. Ozimec, F. Poljak (2001): Hrvatske izvorne pasmine domaćih životinja.
Veterinarski dani 2001. Znanstveno-stručno savjetovanje s međunarodnim sudjelovanjem. Opatija, 17.-19.
listopada 2001. Zbornik, Zagreb, 187-189.
25. Rege, J. E. O. (1999): Economic valuation of farm animal genetic resources. Proceedings of an FAO/ILRI
Workshop, 25.-27., Rim.
26. Štoković, I., A. Ekert Kabalin, V. Sušić, I. Karadjole, T. Balenović, A. Kostelić (2007a): Zaštita zdravlja i
rizici u in situ modelima očuvanja ugroženih izvornih pasmina domaćih životinja. Konferencija o izvornim
pasminama i sortama kao dijelu prirodne i kulturne baštine. Šibenik, 13. - 16. studenog 2007. Knjiga
sažetaka (Radna verzija), Zagreb, 261-264.
27. Štoković, I., A. Ekert Kabalin, V. Sušić, I. Karadjole, T. Balenović, A. Kostelić, S. Menčik (2007b): Zaštita
zdravlja, zakonska regulativa i rizici u očuvanju izvornih pasmina domaćih životinja. Stočarstvo 61 (6):
481-487.
28. Sušić, V., A. Ekert Kabalin, I. Karadjole, T. Balenović, I. Štoković, Igor (2006a): Paška ovca. IV. simpozij
poljoprivrede, veterinarstva, šumarstva i biotehnologije. Zenica, Bosna i Hercegovina. (poster).
29. Sušić, V., A. Ekert Kabalin, I. Štoković, I. Karadjole, T. Balenović (2006b): Hrvatske izvorne pasmine
domaćih životinja. IV. simpozij poljoprivrede, veterinarstva, šumarstva i biotehnologije. Zenica, Bosna i
Hercegovina. (pozvano predavanje).
30. Sušić, V., T. Balenović, I. Martinić, D. Katica, I. Štoković, A. Ekert Kabalin (2001): Hrvatske autohtone
pasmine domaćih životinja. Veterinarski dani 2001. Znanstveno-stručno savjetovanje s međunarodnim
sudjelovanjem. Opatija, 17.-19. listopada 2001. Zbornik, Zagreb, 177-186.
31. WWL-DAD:3 (World watch list for domestic animal diversity), 3rd edition. Ed. Beate D. Scherf FAO,
Rome, 2000.
32. ...www.hssc.hr - Croatian Livestock Centre - CLC web page - accessed March 15., 2008.
brief review of the state of the art in assisted
reproduction in small ruminants
Situación actual de las técnicas de reproducción

asistida en pequeños rumiantes
Aktualni status postupaka asistirane reprodukcije

malih preživača
Antonio Gonzalez-Bulnes, Claudia A. Letelier, Ignacio Contreras-Solís, Juraj Grizelj
Departamento de Reproducción Animal, INIA. Avda. Puerta de Hierro s/n, 28040-Madrid, Spain.
Faculty of Veterinary Medicine
Abstract
The use of assisted reproduction techniques is crucial for the improvement of productive yields in small
ruminants, either applying artificial insemination or embryo transfer or combining both techniques; a previous
oestrus synchronization is always necessary. Current work is a brief review of the state of the art in assisted
reproduction in small ruminants.
Sažetak
Korištenje postupaka asistirane reprodukcije ključno je za poboljšanje produktivnosti malih preživača, bilo
korištenjem umjetnog osjemenjivanja (U.O.) ili embriotransfera (ET), bilo kombiniranjem obaju tehnika; uz
uvijek neophodnu prethodnu sinkronizaciju estrusa. Ovaj rad predstavlja skraćeni pregled spoznaja iz područja
asistirane reprodukcije malih preživača.
Introducción
Ovino y caprino son especies tradicionalmente importantes en el área Mediterránea. Los
pequeños rumiantes, desde un punto de vista social, favorecen la producción de productos de primera
necesidad, a un coste menor que otras especies, y permiten el mantenimiento de las actividades
agrarias en zonas desfavorecidas; desde un punto de vista medioambiental permiten la utilización
de los recursos naturales mediante la explotación de los recursos pastables, facilitan la conservación
del medio gracias al aprovechamiento de zonas de matorral, limpiando las zonas de explotación y
evitando la propagación de incendios. En el esquema de producción actual, los pequeños rumiantes
tienen un tercer papel, la elaboración de productos de calidad, de origen natural y con posibilidades
de competir en el mercado frente a productos similares. Este sistema debe partir de razas susceptibles
de aportar buenos rendimientos en las condiciones ambientales y de manejo de cada país, de cada
región y de cada explotación. A partir de ello, la aplicación de programas de manejo reproductivo y
de selección y mejora genética es básica para conseguir un aumento de las producciones.
Las técnicas de manejo reproductivo y de reproducción asistida pueden ser dirigidas al macho,
inseminación artificial, o a la hembra, producción y transferencia de embriones. Ambas técnicas
permiten la optimización de la eficiencia reproductiva y, en el caso de los programas de selección y
mejora genética, el testaje de los reproductores mediante pruebas de progenie, posibilitando con ello
la disponibilidad de genealogías paternas y/o maternas, la difusión amplia y rápida de los caracteres
mejorantes y la conexión entre los rebaños adscritos al sistema de selección. Ambas pueden ser
combinadas, y ambas exigen previamente la inducción y sincronización del celo y la ovulación en
las hembras. Sus procedimientos, rendimientos y la influencia de factores intrínsecos, principalmente
genéticos, y extrínsecos, derivados de factores medioambientales y de manejo, son revisados en el
presente manuscrito.
Inducción y sincronización de celos y ovulaciones

El control del momento de aparición del celo y la ovulación es esencial para un adecuado manejo
de la reproducción tanto en ovejas como cabras. Esta acción permite inducir el periodo de partos en
la época más adecuada para el ganadero, aumentando la eficiencia reproductiva del rebaño. Y lo que
es más, la sincronización de celos es indispensable para ser aplicado previamente a la inseminación
artificial y/o la transferencia de embriones.
La sincronización de celos es comúnmente realizada mediante la administración de progesterona,
o sus derivados, y eCG (gonadotropina coriónica equina). Los tratamientos progestativos disminuyen
la pulsatilidad de LH a valores similares a una fase luteal, evitando la ovulación de los folículos
de tamaño preovulatorio; la retirada del progestágeno, junto a la administración de eCG, induce la
aparición de una fase folicular, del celo y la ovulación.
La progesterona o los progestágenos pueden ser aplicados por vía oral, intramuscular, subcutánea
e intravaginal. Sin embargo, su uso en la práctica está restringido a la aplicación vaginal, en esponjas
de poliuretano impregnadas con un progestágeno (Robinson, 1967); los más comúnmente utilizado
son el FGA (acetato de fluorogestona) y el MAP (acetato de medroxiprogesterona), con una
eficacia similar (Steffan et al., 1982). La progesterona puede ser aplicada también en dispositivos
intravaginales (CIDR, Rhodes et al., 1988).
En ovejas, los dispositivos intravaginales son mantenidos entre 12 y 14 días (Robinson, 1965), para
sobrepasar la vida activa de un posible cuerpo lúteo. En cabras, las esponjas pueden ser mantenidas
por 16 días (tratamiento largo, Armstrong et al., 1982); pero una duración tan larga puede causar
vaginitis y otros problemas y, así, el protocolo más utilizado es la combinación de un progestágeno
por 11 días y una dosis de prostaglandina F2α para lisar un posible cuerpo lúteo (Corteel et al., 1988).
La eCG se inyecta en el momento de la retirada de la esponja, con el objetivo tanto de favorecer un
mayor número de folículos preovulatorios como de inducir la ovulación. La dosis de eCG es también
crucial; la dosis media en ovejas es 500 UI, pero varía desde 250 a 600 UI, dependiendo de la raza,
edad, estación del año y estado fisiológico (Cognie et al., 1970; Evans y Robinson, 1980).
Sin embargo, la sincronización de celos con progestágenos tiene varios inconvenientes. En primer
lugar, las tasas de concepción son menores que en celo natural. Esta disminución en la fertilidad se
ha relacionado, en la oveja, con anomalías en el transporte espermático y su supervivencia en el
tracto reproductivo femenino (Hawk y Conley, 1971), alteraciones en los patrones de secreción de
LH (Scaramuzzi et al., 1988) y calidad de las ovulaciones (Killian et al., 1985). Las posibles causas
parecen estar relacionadas con deficiencias en la secreción de esteroides durante el desarrollo folicular
preovulatorio (Gonzalez-Bulnes et al., 2005a). En cabras, el uso de eCG también contribuye a los
fallos en fertilidad debido a que induce la producción de anticuerpos, lo que disminuye la fertilidad de
sucesivos tratamientos. Finalmente, el aumento de la regulación internacional en material de residuos
químicos, que ha causado la prohibición de su uso en Estados Unidos o una fuerte restricción en los
límites máximos de residuos permitidos en la Unión Europea.
La sincronización de celos en pequeños rumiantes puede ser obtenida, en razas no estacionales o
durante la época reproductiva en animales estacionales, mediante la inducción de luteolisis controlada
por la administración de dos dosis de prostaglandina F2a, o sus análogos, separados 9–11 días (Nuti
et al., 1992). Este tratamiento es efectivo para sincronizar celos en estación sexual, con más del 90%
de las hembras mostrando sintomatología de celo (Greyling, 1996), pero la fertilidad es menor que
con progestágenos (67% vs 80%) (Kusina et al., 2000). Las posibles causas de esta disminución
no son bien conocidas. Estudios en ovejas (Boland et al., 1978), indican posibles alteraciones en
la dinámica de crecimiento de los folículos preovulatorios y/o el momento de ovulación (Barret
et al., 2002). Estudios en cabras indican que el momento de la fase luteal afecta la respuesta de las
cabras a la inducción de celos con prostaglandinas. Los tratamientos con prostaglandinas se inyectan
con un intervalos de 9-11 días; así, la mayoría de los animales estarán en mitad de la fase luteal
en el momento de la segunda inyección. Esto asegura que todos los animales ovularán de forma
sincronizada. Sin embargo, este sería el peor momento para el tratamiento, considerando la dinámica
folicular; el mejor momento sería temprano en la fase luteal. Así, hay un mayor número de hembras
con síntomas de celo, una aparición más temprana de esta sintomatología y un mayor número de
animales respondiendo con ovulaciones en cabras tratadas en fase luteal temprana (Gonzalez-
Bulnes et al., 2005b). En cabras, como en otros rumiantes, la mayoría de los folículos en la primera
onda de crecimiento están en estado creciente (ver la revisión de Rubianes y Menchaca, 2003). El
número de ondas foliculares y el día de emergencia de los folículos es muy variable entre animales e
impredecible (Ginther y Kot, 1994; de Castro et al., 1999; Gonzalez-Bulnes et al., 1999; Menchaca
y Rubianes, 2002). Así, algunos de los folículos más grandes están en crecimiento en los días 11 y
16, pero otros están estáticos o en regresión (Gonzalez-Bulnes et al., 2005b). Esta alta variabilidad
individual causa una pérdida total de sincronización de la segunda y sucesivas ondas foliculares; lo
que interfiere con la fertilidad.
Inseminación Artificial
Actualmente, el uso de la inseminación artificial (IA) es ineludible en programas de selección
genética, ya sea para leche, lana o carne. El uso de la IA se desarrolló fuertemente en Australia en
la década de 1970, en ovejas de lana, de forma similar a como se realizaba en novillas lecheras,
inseminando entre 15 y 17 horas después de la detección de celos (Lightfoot y Salamon, 1970). La
aplicación de tratamientos progestativos, diseñados en el mismo país a finales de 1960 y principios
de los 70 fue muy importante para el desarrollo de la IA, debido a la posibilidad de inseminar en
tiempo prefijado sin detección de celos, 55-56 horas después de la retirada del progestágeno, con una
fertilidad del 50% (Colas y Brice, 1970). En cabras, la inseminación debe ser aplicada antes, 46-47
horas después de la retirada de la esponja.
El uso combinado de IA y progestágenos permite el uso de semen refrigerado a 15ºC, con dosis
no menores de 400 x 106, con una fertilidad de aproximadamente el 50% (Fieni et al., 1992). En
cabras, la estructura anatómica del cérvix permite una deposición del semen más profunda, incluso
en el útero, en un 30-50% de las hembras, así, la fertilidad puede alcanzar el 70% (Amoah y Gelaye,
1997). Las tasas de fertilidad obtenidas estarán determinadas por la viabilidad de los espermatozoides
(Hawk y Conley, 1971) y el intervalo entre la ovulación y la deposición del semen (Signoret y
Cognie, 1975).
El uso de semen congelado está dificultado en ovejas por la imposibilidad de traspasar el cérvix;
en cabras, es posible alcanzar un 40% de fertilidad. El desarrollo de la IA mediante laparoscopía
(IAL) por Killeen y Caffrey (1982), permitió depositar el semen en el interior del útero y, así, un
significativo incremento en las tasas de fertilidad con semen congelado. El uso de IAL con semen
refrigerado es también beneficioso, ya que aumenta la fertilidad usando dosis con menor número de
espermatozoides.
Desde un punto de vista técnico, en el uso de IAL, es importante asegurar la deposición del
semen en el interior del útero y no en la pared uterina, evitar el uso de anestesia que puede interferir
con la ovulación (Radford, 1966), y distribuir la mitad de cada dosis en cada cuerno uterino, evitando
la exteriorización de los ovarios (McKelvey et al., 1985).
Superovulación y transferencia de embriones

Si la IA es la técnica de elección para maximizar el progreso genético a partir del macho, la
tecnología de embriones es la técnica para realizarlo usando la hembra. En esencia, la superovulación
consiste en la administración de altas dosis de productos comerciales de FSH para estimular el
crecimiento de un alto número de folículos preovulatorios y, así, un alto número de oocitos para la
producción in vitro de embriones o un alto número de ovulaciones para la producción in vivo.
Actualmente, los protocolos para producción de embriones in vivo aplicados en nuestro grupo en
ganado caprino consisten en la sincronización de celos con la aplicación de 45mg de FGA durante
16 días, combinada con una dosis única de 0.4ml de cloprostenol en la primera inyección de FSH;
el tratamiento superovulatorio consiste en 8 dosis de 1.25ml de FSH ovina (OvagenTM, ICP, NZ), a
intervalos de 12h. El uso de este protocolo permite una media de 14.3 cuerpos lúteos, 11.3 embriones
recuperados y 6.8 embriones viables por cabra superovulada. En ovejas, el protocolo es similar,
excepto que las dosis son decrecientes (1.5mLx3; 1.25mLx2; 1mlx3); el número medio de cuerpos
lúteos es 15.9, con una media de 13.5 embriones recuperados y 7.0 embriones viables por hembra
(Gonzalez-Bulnes et al., 2004).
Sin embargo, los rendimientos están limitados por una alta variabilidad en la respuesta ovárica
a los tratamientos superovulatorios necesarios para incrementar el número de embriones, por
alteraciones en los procesos de fertilización y en la viabilidad de los embriones durante los estadios
tempranos de desarrollo.
Aktualni status postupaka asistirane reprodukcije malih preživača
Uvod
Ovce i koze su tradicionalno važne vrste u području Sredozemnog bazena. Mali preživači, sa
socijalnog gledišta, omogućuju proizvodnju primarnih proizvoda uz manji trošak nego ostale vrste
te omogućuju poljoprivrednu aktivnost u područjima s nepovoljnim uvjetima. S gledišta okoliša,
mali preživači omogućuju iskorištavanje prirodnih dobara putem korištenja pašnjaka, oni olakšavaju
očuvanje okoliša zahvaljujući iskorištavanju šipražja, krčeći takova područja te na taj način ujedno
smanjuju i mogućnost pojave požara.
U smislu suvremene proizvodnje, mali preživači imaju novu ulogu, a to je produkcija kvalitetnih
proizvoda, prirodnog podrijetla, spremnih za tržišnu utrku sa sličnim proizvodima. Takav sustav
kreće od odgovarajućeg pasminskog odabira koji može ostvariti dobre prinose u datim prirodnim
okolnostima i načinima uzgoja u svakoj pojedinoj zemlji ili području te napose tipu iskorištavanja.
Krenuvši od toga, primjena reproduktivnih i selekcijskih programa te genetskog unaprijeđenja
predstavlja temelj ostvarenja veće proizvodnje.
Tehnologija upravljanja reprodukcijom i postupci asistirane reprodukcije, mogu biti orijentirani
prema mužjaku (umjetno osjemenjivanje) ili prema ženki (proizvodnja i transfer zametaka). Obje
tehnike omogućuju optimizaciju reproduktivne učinkovitosti te, u slučaju selekcijskih programa
i genetskog unaprijeđenja, testiranje takovih rasplodnih potencijala putem progenih testova,
omogućujući tako poznavanje podrijetla matera i očeva, široku i brzu difuziju poželjnih osobina
i vezu između stada uključenih u sustav selekcije. Obje tehnike mogu biti kombinirane, a svaka
zahtijeva predhodnu indukciju estrusa te sinkronizaciju estrusa i ovulacije u ženki. Njihovi postupci,
rezultati i utjecaj unutarnjih čimbenika (primarno genetskih) te vanjskih (proizašli iz okoliša i uzgoja),
tema su ovog rada.
Indukcija i sinkronizacija estrusa i ovulacije

Kontrola trenutka pojave estrusa i ovulacije temelj je adekvatnog upravljanja reprodukcijom u
ovaca i koza. Ovaj postupak omogućuje poticanje razdoblja janjenja i jarenja u razdoblju kada je to
stočaru najpoželjnije, povećavajući tako reproduktivnu učinkovitost stada. I ne samo to, sinkronizacija
estrusa neophodna je za provođenje umjetnog osjemenjivanja i embriotransfera.
Sinkronizacija estrusa uobičajeno se provodi aplikacijom progesterona ili njegovih derivata i
eCG-a (konjski korionski gonadotropin). Progestagenski postupak smanjuje pulsatorno izlučivanje
LH na vrijednosti slične onima u lutealnoj fazi ciklusa, spriječavajući tako ovulaciju preovulatornih
folikula. Vađenje progestagena, uz istodobnu aplikaciju eCG-a inducira pojavu folikularne faze
ciklusa, estrus i ovulaciju.
Progesteron ili progestageni mogu se aplicirati peroralno, intramuskularno, subkutano te
intravaginalno. Ipak, njegovo korištenje je u praksi ograničeno na vaginalnu aplikaciju, u vidu
poliuretanskih spužvica impregniranih nekim progestagenom (Robinson, 1967). Najčešće se koriste
FGA (fluorogeston acetat) i MAP (medroksiprogesteron acetat) sa sličnom učinkovitošću (Steffan
i sur., 1982). Progesteron može biti korišten i u vidu intravaginalnih spirala (CIDR, Rhodes i sur.,
1988).
U ovaca se takovi intravaginalni umetci postavljaju na razdoblje od 12 do 14 dana (Robinson,
1965) kako bi vremenski nadmašili razdoblje aktivnosti žutog tijela koje se možda u tom trenutku
nalazi na jajniku.
U koza se pak spužvice mogu držati i 16 dana (dugi tretman; Armstrong i sur., 1982); ali u tom
slučaju moguća je pojava vaginitisa i drugih problema pa se zato koristi protokol koji kombinira
aplikaciju progestagena kroz 11 dana i jednokratnu aplikaciju prostaglandina F2α koji će dovesti do
lize eventualno prisutnog žutog tijela (Corteel i sur., 1988).
Injekcija konjskog korionskog gonadotropina (eCG) se aplicira paralelno sa vađenjem spužvice,
s ciljem kako nastanka većeg broja preovulatornih folikula, tako i indukcije ovulacije. Doziranje
eCG-a je od odlučujuće važnosti; prosječna doza u ovaca je 500 i.j., ali varira od 250 do 600 i.j.,
ovisno o pasmini, dobi životinje, razdoblju godine i fiziološkom statusu (Cognie i sur., 1970; Evans
y Robinson, 1980).
Ipak, sinkronizacija estrusa progestagenskim preparatima ima i svoje nedostatke. Na prvom
mjestu svakako je niža stopa koncepcije, nego što je slučaj u spontanom, prirodno nastalom estrusu.
Navedeno smanjenje plodnosti povezuje se u ovaca, sa anomalijama u transportu spermija i njihovom
preživljavanju u reproduktivnom traktu (Hawk i Conley, 1971), promijenjenim modelom sekrecije
LH (Scaramuzzi i sur., 1988) i kvalitetom ovulacije (Killian et al., 1985). Mogući uzroci čini se da su
povezani sa manjkavostima u sekreciji steroida tijekom razvoja preovulatornih folikula (Gonzalez-
Bulnes i sur., 2005a).
U koza pak, korištenje eCG-a također doprinosi smanjenoj plodnosti zbog indukcije nastanka
antitijela koji umanjuju učinkovitost sljedećih tretmana. Konačno, pooštrena je međunarodna
legislativa vezano uz kemijske rezidue, što je dovelo do njegove zabrane korištenja u SAD-u te do
jake restrikcije maksimalno dozvoljenih granica rezidua u Europskoj Uniji.
Sinkronizacija estrusa se u malih preživača može ostvariti kod nesezonalnih pasmina ili tijekom
trajanja sezone spolne aktivnosti u sezonalnih životinja, inukcijom luteolize aplikacijom dvaju doza
prostaglandina F2α ili njihovog analoga, u razmaku od 9-11 dana (Nuti i sur., 1992). Ovaj je postupak
učinkovit u sinkroniziranju estrusa tijekom trajanja sezone spolne aktivnosti, sa više od 90% ženki
koje pokazuju znakove estrusa (Greyling, 1996), ali je plodnost niža u odnosu na postupke koji
uključuju progestagene (67% nasuprot 80%) (Kusina i sur., 2000). Mogući uzroci ovoga smanjenja
nisu posvema poznati. Istraživanja u ovaca (Boland i sur., 1978) ukazuju na moguće promjene u
dinamici rasta preovulatornih folikula i trenutak pojave ovulacije (Barret i sur., 2002). Studije na
kozama su pokazale da odgovor koza na indukciju estrusa prostaglandinima ovisi o razdoblju lutealne
faze u kojoj je tretman obavljen. Tretman prostaglandinima odvija se dvostrukom aplikacijom istih, u
razmaku od 9-11 dana; na taj način većina životinja će biti u sredini lutealne faze u trenutku aplikacije
druge injekcije. To će osigurati da sve životinje ovuliraju u isto vrijeme. Ipak, to je najgori trenutak
za tretman s gledišta folikularne dinamike. Najbolji bi trenutak bio tijekom rane lutealne faze što bi
dovelo do većeg broja koza sa simptomima estrusa, ranije pojave estrusa i većeg broja životinja koje
će ovulirati (Gonzalez-Bulnes i sur., 2005b).
U koza, kao i u ostalih preživača, većina folikula u prvom valu folikularnog rasta nalazi se
u fazi rasta (Rubianes y Menchaca, 2003). Broj folikularnih valova i dan pojave folikula veoma
varira između životinja i nepredvidiv je (Ginther i Kot, 1994; de Castro i sur., 1999; Gonzalez-
Bulnes i sur., 1999; Menchaca i Rubianes, 2002). Na taj način, samo su neki od najvećih folikula
11. i 16. dana ciklusa u rastu, dok su ostali statični ili u regresiji (Gonzalez-Bulnes i sur., 2005b). Ta
visoka individualna varijabilnost svih folikularnih valova, osim prvog, uzrok je potpunog gubitka
sinkronizacije drugog i svih sljedećih folikularnih valova spolnog ciklusa, što utječe na smanjenje
plodnosti.
Umjetno osjemenjivanje
Korištenje umjetnog osjemenjivanja (U.O.) neizbježno je u programima genetske selekcije,
bilo u smislu produkcije mlijeka, vune ili mesa. Uporaba UO-a snažno se razvila u Australiji 70-tih
godina 20. stoljeća u ovaca za proizvodnju vune na sličan način kako se realizira u krava muzara,
osjemenjujući ih između 15 i 17 sati nakon detekcije estrusa (Lightfoot i Salamon, 1970). Primjena
progestagenskih postupaka, osmišljenih u istoj zemlji koncem 60-tih i početkom 70-tih godina prošlog
stoljeća, odigrala je vrlo važnu ulogu u razvoju U.O.-a, zahvaljujući mogućnosti osjemenjivanja u
unaprijed određeno vrijeme, bez detekcije estrusa, 55-56 sati nakon vađenja spužvica te sa plodnošću
od 50% (Colas i Brice, 1970).
U koza osjemenjivanje mora biti izvršeno nešto ranije, 46-47 sati nakon izvlačenja spužvice.
Kombiniranje U.O.-a i progestagena omogućuje uporabu sjemena ohlađenog na 15ºC, u dozi ne
manjoj od 400x106 te plodnosću od približno 50% (Fieni i sur., 1992).
U koza anatomska građa cerviksa omogućuje dublje polaganje sjemena, uključujući čak i uterus u
30-50% ženki; na taj način plodnost može dosegnuti i 70% (Amoah i Gelaye, 1997). Stope ostvarene
plodnosti određene su vitalnošću spermija (Hawk i Conley, 1971) te razmakom između ovulacije i
polaganja sjemena (Signoret y Cognie, 1975).
Uporaba smrznutog sjemana otežana je u ovaca zbog nemogućnosti prolaza kroz cerviks. U koza
pak moguće je dosegnuti 40% plodnosti.
Razvoj laparoskopskog umjetnog osjemenjivanja (L.U.O.) kojeg su uveli Killeen i Caffrey
(1982), je omogućio polaganje sjemena u maternicu i na taj način značajan porast stope plodnosti
pri korištenju smrznutog sjemena. Korištenje L.U.O.-a s ohlađenim sjemenom je također koristno jer
povećava plodnost korištenjem doza s manjim brojem spermija.
S tehničkog gledišta, prilikom L.U.O. važno je ostvariti polaganje sjemena u unutrašnjost
maternice, a ne greškom u samu materničnu stijenku. Nadalje, treba izbjeći korištenje anestezije
jer može interferirati sa ovulacijom (Radford, 1966) te je potrebno raspodijeliti polovicu korištene
doze u svaki od materničnih rogova, izbjegavajući prilikom manipulacija eksteriorizaciju jajnika
(McKelvey i sur., 1985).
Superovulacija i trensfer zametaka

Ako je U.O. tehnika izbora kojom maksimiziramo genetski napredak koji polazi od mužjaka,
onda je tehnologija sa zametcima tehnika koja se temelji na ženkama.
Sažeto rečeno, superovulacija se sastoji od aplikacije visokih doza komercijalnih produkata FSH
kako bi se izazvala stimulacija rasta velikog broja preovulatornih folikula i na taj način velik broj
oocita za in vitro produkciju zametaka ili velik broj ovulacija za proizvodnju zametaka in vivo.
Protokoli za proizvodnju zametaka in vivo u koza koji se trenutačno koriste u našem
istraživačkom timu se sastoje od sinkronizacije estrusa aplikacijom spužvica 45mg FGA tijekom
16 dana u kombinaciji sa jednom dozom 0,4mL cloprostenola paralelno sa prvom injekcijom FSH.
Superovulacijski tretman sastoji se od 8 doza od 1,25mL ovčjeg FSH (OvagenTM, ICP, Novi Zeland) u
razmacima od 12 sati. Korištenje ovog protokola ostvaruje u prosjeku 14,3 žutih tijela; 11,3 zametaka
nakon ispiranja maternice i 6,8 vitalnih zametaka po svakoj superovuliranoj kozi.
U ovaca je protokol sličan, osim što su doze hormona u padajućem nizu (1,5mLx3; 1,25x2;
1mLx3). Prosječan broj žutih tijela je 15,9; prosjek dobivenih zametaka nakon ispiranja maternice
13,5 te 7 vitalnih zametaka po svakoj ženki (Gonzalez-Bulnes i sur., 2004).
Ipak, učinkovitost tehnike ograničena je visokom varijabilnošću jajničkog odgovora na
superovulatorne tretmane neophodne za povećanje broja zametaka te promjenama u procesu oplodnje
i vitalnosti zametaka tijekom ranog razvojnog razdoblja.
Referencias bibliográficas
1. Amoah EA, Gelaye S.. Biotechnological advances in goat reproduction. J Anim Sci 1997; 75: 578-585.
2. Armstrong DT, Pfitzner AP, Porter KJ, Warnes GM, Janson PO, Seamark RF.. Ovarian responses of anoestrous
goats to stimulation with pregnant mare serum gonadotrophin. Anim. Reprod. Sci. 1982; 5: 15-23.
3. Baril G, Vallet JC. Time of ovulation in dairy goats induced to superovulate with porcine follicle stimulating
hormone and out of the breeding season. Theriogenology 1990; 34: 303-311.
4. Barret DW, Bartlewski PM, Cook SJ, Rawlings NC. Ultrasound and endocrine evaluation of the ovarian
response to PGF2α given at different stages of the luteal phase in ewes. Theriogenology 2002; 58: 1409–
1424.
5. Boland MP, Gordon IR, Kellcher DL. The effect of treatment by prostaglandin analogue (ICI-80996) or
progestagen (SC-9880) on ovulation and fertilization in cyclic ewes. J Agric Sci Cambr 1978; 91: 727–
730.
6. Cognie Y, Mariana JC, Thimonier J. Etude du moment d’ovulation chez la brebis normale ou traitee par un
progestagen associe ou non a une injection de PMSG. Ann Biol Anim Bioch Biophys 1970; 10: 15-24.
7. Colas G, Brice G. Fertility of fluorogestona acetate treated ewes inseminated with frozen sperm. Ann Zootech
1970; 19: 353
8. Corteel JM, Leboeuf B, Baril G. Artificial breeding of adults goats and kids induced with hormones to ovulate
outside the breeding season. Small Rumin Res 1988; 1: 19-35.
9. de Castro T, Rubianes E, Menchaca A, Rivero A. Ovarian dynamics, serum estradiol and progesterone
concentrations during the interovulatory interval in goats. Theriogenology 1999; 52: 399–411.
10. Evans G, Robinson TJ. The control of fertility in sheep: endocrine and ovarian responses to progestagen-PMSG
treatment in the breeding season and in anoestrous. J Agric Sci Camb 1980; 94: 69-88.
11. Fieni F, Roques JM, Tainturier D, Bruyas JF. Utilisation du contrôle endoscopique pour l’insémination intra-
utérine chez les petits ruminants. Rec. Méd. Vét. 1992 ; 168: 295-302.
12. Ginther OJ, Kot K. Follicular dynamics during the ovulatory season in goats. Theriogenology 1994; 42:
987–1001.
13. Gonzalez de Bulnes A, Osoro K, Lopez Sebastian, A. Factores condicionantes de la respuesta del ganado
caprino a la sincronización de celos mediante progestágenos y PMSG. Archivos de Zootecnia, 1999; 48:
231-234.
14. Gonzalez-Bulnes A, Baird DT, Campbell BK, Cocero MJ, Garcia-Garcia RM, Inskeep EK, Lopez-Sebastian
A, McNeilly AS, Santiago-Moreno J, Souza CJ, Veiga-Lopez A. Multiple factors affecting the efficiency of
multiple ovulation and embryo transfer in sheep and goats. Reprod Fertil Dev 2004; 16: 421-435
15. Gonzalez-Bulnes A, Veiga-Lopez A, Garcia P, Garcia-Garcia RM, Ariznavarreta C, Sanchez MA, Tresguerres
JAF, Cocero MJ, Flores JM. Effects of progestagens and prostaglandin analogues on ovarian function and
embryo viability in sheep. Theriogenology. 2005a; 63: 2523-2534.
16. Gonzalez-Bulnes A, Diaz-Delfa C, Garcia-Garcia RM, Urrutia B, Carrizosa JA, Lopez-Sebastian A. Origin
and fate of preovulatory follicles after induced luteolysis at different stages of the luteal phase in goats.
Anim Reprod Sci 2005b 6: 237-245.
17. Greyling JPC. The effect of dose of prostaglandin in the synchronization of oestrus in the Boer goat doe. In:
Proceedings of the Sixth International Conference in Goats, Beijing, China, 1996, p. 826 (abstract).
18. Hawk HW, Conley HH. Sperm transport in ewes administred synthetic progestagen. J Anim Sci 1971; 24:
233.
19. Killeen ID, Cafrey GJ. Uterine insemination of ewes with the aid of a laparoscope. Aust Vet J 1982; 59:
95.
20. Killian DB, Kiesling DO, Warren JR. Lifespan of corpora lutea induced in estrous-synchronized cycling and
anoestrous ewes. J Anim Sci 1985; 61: 210.
21. Kusina NT, Tarwirei H, Hamudikuwanda H, Agumba G, Mukwena J.. A comparison of the effects of
progesterone sponges and ear implants, PGF2α, and their combination on efficacy of estrus synchronization
and fertility of Mashona goat does. Theriogenology 2000; 53: 1567–1580.
22. Lightfoot RJ, Salamon S. Fertility of ram spermatozoa frozen by the pellet method. J Reprod Fertil 1970;
22: 385-398.
23. McKelvey WAC, Robinson JJ, Aitken RP. The evaluation of a laparoscopic insemination technique in ewes.
Theriogenology, 1985; 24: 519-535.
24. Menchaca A, Rubianes E. Relation between progesterone concentrations during the early luteal phase and
follicular dynamic in goats. Theriogenology 2002; 57: 1411–1419.
25. Nuti LC, Minhas BS, Baker WC, Capehart JS, Marrack P. Superovulation and recovery of zygotes from Nubian
and alpine dairy goats. Theriogenology 1987; 28: 481-488.
26. Radford HM.. Pharmacological blockade of ovulation in the ewe. J Endocrinol 1966; 34: 135-136.
27. Rhodes L, Nathanielsz PW. Comparison of a controlled internal drug release device containing progesterone
with intravaginal medroxiprogesterone sponges for estrus synchronization in ewes. Theriogenology 1988;
4: 831.
28. Robinson TJ, Moore NW, Holst PJ, Smith JF.. The evaluation of several progestogens administered in
intravaginal sponges for the synchronization of oestrus in the entire cyclic Merino ewe. In: T.J. Robinson
(ed.). Control of the ovarian cycle in the sheep. White and Bull PTY Ltd., Sydney, 1967: 76-91.
29. Robinson TJ. Use of progestagen impregnated sponges inserted intravaginally or subcutaneously for the control
of the oestrous cycle in the sheep. Nature, 1965; 206: 39-41.
30. Robinson TJ. The control of the ovarian cycle in the sheep. Sydney University Press, Sydney, Australia, 1967;
pp: 237-244.
31. Rubianes E, Menchaca A. The pattern and manipulation of ovarian follicular growth in goats. Anim Reprod
Sci 2003; 78: 271–287.
32. Scaramuzzi RJ, Downing JA, Campbell BK, Cognie Y. Control of fertility and fecundity of sheep by means of
hormonal manipulation. Austr J Biol Sci 1988; 41: 37-45.
33. Signoret JP, Cognie Y. Determination of the moment of ovulation in ewe and sow. Influence of environment
and hormonal treatment. Ann Biol Anim Bioch Biophys 1975; 15: 205-214.
34. Steffan J, Poissonet P, Thibier M. Control of oestrus in ewe lambs and yearling ewes with medroxiprogesterone
acetate and fluorogestone acetate. Anim Reprod Sci 1982; 5: 191-198.
NEW SOLUTION FOR THE CONTROL OF THE BOVINE RESPIRATORY
COMPLEX
Nove mogućnosti kontrole zaraznog goveđeg

respiratornog sindroma
Juan Muñoz Bielsa
International Marketing, International Product Manager Ruminant Biologicals, Intervet International bv

( part of Schering Plough, P.O. Box 31, 5830 AA Boxmeer, The Netherlands, E-mail: juan.munozbielsa@
intervet.com
The respiratory disease complex of ruminants consists of the single clinical entity of
bronchopneumonia, but is caused by numerous combinations of infectious agents, compromised
host defences, and environmental conditions. Over the past decade, a number of viruses and bacteria/
mycoplasma have been associated with acute bovine respiratory disease. The importance of these
different agents depend on the prevalence and incidence in the herd, control measures available on
the farm (such as vaccination) and if the pathogen can cause direct damage to the lung or if it works
more as a predisposing factor.
MAIN RESPIRATORY PATHOGENS

Depending on if the pathogens cause direct damage to the lungs or not we could propose the
following classification:
Predispose to damage Direct damage
BHV-1 BRSV
BVDV M haemolytica
Parainfluenza-3 P multocida
Bovine Adenovirus H sommus
Bovine Coronavirus M bovis
Predispose to damage
Bovine Herpesvirus Type 1 (BHV-1)

BHV-1 is a member of the family of the Herpesviridae and the subfamily of Alphaherpesvirinae.
Depending on the route of inoculation, infection with BHV-1 results mostly in acute inflammation
of the mucous membrane of either the upper respiratory tract, giving rise to infectious bovine
rhinotracheitis (IBR), or of the genital tract, causing infectious pustular vulvovaginitis (IPV) in
female cattle and infectious pustular balanoposthitis (IPB) in bulls. BHV-1.1 strains are associated
with the more severe respiratory infections and BHV-1.2 with the milder genital infections, but both
subtypes can however be isolated from both tracts.
The acute infection is characterized by fever, depression, loss of appetite, hyperaemia of the
mucosae, mucosal lesions and discharge. This sometimes results in complete obstruction of the nasal
passage or even the trachea, with animals eventually suffocating to death. In the field, the clinical
signs of disease are often worsened by secondary infections.
Parainfluenza-3 (PI-3)
Parainfluenza virus type 3 (PI-3) is a RNA virus classified in the paramyxovirus family. Variation
in virulence between strains has been reported.
The widespread prevalence of antibodies to this virus indicates that it is ubiquitous in the
cattle population. This finding suggests the possibility of repeat infections or at least persistence of
antibodies after infection.
Infection appears to spread rapidly in susceptible cattle housed at high population densities and
in close contact. By itself, PI-3 is a relatively mild infection; death loss to the disease is rare, and
maybe non-existent. The clinical signs include fever, cough, nasal and ocular discharge, increased
respiratory rate, and increased breath sounds.
Following initial multiplication in the upper respiratory tract, the virus multiplies in the lung,
growing in high titters in pneumocites and alveolar macrophages, and by adversely affecting the
function of these cells may pave the way for secondary bacterial infection. The most important
role of PI-3 is in predisposing the respiratory tract to subsequent infection by other viruses and
bacteria such as M haemolytica, making the mixed infections more damaging and dangerous.
Bovine alveolar macrophages (BAM) are the initial cellular defenders of the lungs against
bacterial colonization. Impaired BAM function may help to explain the pathogenesis of the severe
bacterial pneumonia in cattle that often follows PI-3 infection. The results from a challenge study
showed that microbicidal activity was almost completely eliminated in alveolar macrophages from
control calves at 4 to 8 days after virus challenge (Adair, 2000). It was also found the presence of
virus antigen in circulating mononuclear cells following challenge.
Bovine Virus Diarrhea Virus (BVDV)

BVD is an RNA virus of the genus Pestivirus and included in the family Flaviviridae. It is
recognised the existence of two species of BVDV, BVDV Type 1and Type 2. Within the BVDV-
1 species there are at least 5 serologically distinct subspecies, 1a-1e. BVDV-1 has a worldwide
distribution while BVDV-2 is largely restricted to USA although some have been isolated from
Europe. The role of BVDV in the bovine respiratory complex is controversial. As a single infection
it causes a mild respiratory disease (some strains are more pneumopathogenic than others). The most
important feature of BVDV infection is its immunosupressor effect that may enhance the disease
caused by other viruses (particularly IBR and BRSV) and bacteria (synergistic interaction between
M haemolytica and BVDV has been shown experimentally).
Bovine Adenovirus (BAV)

There are 9 different types of Adenovirus and they are usually responsible of a mild subclinical
infection. It has been associated with pneumonia, enteritis and/or conjunctivitis. Type 3 BAV is the
serotype most often associated with respiratory infection. In late 70,s and early 80’s it was considered
part of the Bovine Respiratory Complex but later on lost importance and we eliminated from most
of the commercial vaccines.
Coronavirus
The role of Coronavirus is still under discussion and although recent studies in USA detect
seroconversion against Coronavirus in cases of pneumonia, it is not clear what is the real significance
of this virus.
Direct Damage
Bovine Respiratory Syncytial Virus (BRSV)

BRSV) is classified in the genus Pneumovirus of the family Paramyxovirinae. There are antigenic
differences between G proteins of BRSV isolates. Based on antigenic reactivity RSV isolates were
divided into 3 subgroups (A, B and AB). The biological appearance of different subgroups of RSV
has not yet been assessed, but some degree of cross protection is evident.
BRSV antibodies are found in cattle all over the world. Prevalence of antibodies to BRSV
increases with age and is over 70% in cattle of 2 years of age and more.
BRSV plays a significant role in the pathogenesis of pneumonia in cattle. In calves less than 6
months of age induces an acute interstitial pneumonia with alveolitis and bronchitis. Respiratory
tract signs of BRSV in older cattle are moderate or absent and seldom severe. The clinical signs
in calves are elevated body temperature (40-42.2 C), depression, decreased feed intake, elevated
respiratory rates, hypersalivation, and nasal and lacrimal discharges. Subcutaneous emphysema and
intermandibular edema are sometimes noted.
Primary BRSV infections tend to occur mainly in autumn and winter. Respiratory disease during
BRSV infection is severe in some cases and absent in others. It is not clear which factors are responsible
for the severity of the disease: virulence of the virus, level of specific maternal antibodies, presence
of concurrent viral, bacterial and mycoplasma infections, housing and management conditions or
weather conditions.
Re-infections can happen in animals of all ages. The re-infections are most often observed in
autumn and winter but they can also be observed in summer. Re-infections, determined by measuring
significant antibody rises, can result not only from virus replication after re-exposure to the virus,
but also from activation of a putative persistent virus infection. RSV may circulate in herds through
continuous subclinical re-infections or through chronically or persistently infected cattle, which shed
BRSV for some undetermined period, or through both of these epidemiological mechanisms. (Wim
van der Poel, 1995)
Observations from experimental infection studies and natural outbreaks indicate that maternally
derived antibodies (MDA) does not prevent BRSV infection in calves but modify the severity of
the disease. Most cases of severe BRSV mediated disease develop in calves aged 1-3 months, at
which time they still possess maternal antibodies in serum. Nevertheless, maternal antibodies may be
protective to a certain degree, since the severity and incidence of disease in calves less than 3 months
of age seem to be inversely related to the serum level of MDA (Larsen, 2000)
Mannheimia haemolytica
M haemolytica is a normal inhabitant of the nasal pharyngeal mucosa of healthy cattle.
Fifteen different serotypes of M haemolytica have been identified in cattle. In the UK, pneumonic
pasteurellosis in cattle is associated mainly with serotype A1. During the years 1982-85, serotype A1
comprised 56% of all M. haemolytica isolates and 63% of lung isolates submitted to the Moredun
Research Institute for serotyping (Quirie et al, 1986). Other biotype A serotypes accounted for only
14% of the total (serotype A2, 8%; all other A serotypes combined, 6%). In the early ‘90s, it became
apparent that the incidence of serotype A6 was increasing, and during the years 1990-99 serotypes
A1 and A6 each accounted for approximately 30% of bovine isolates (unpublished observations).
Under conditions of impaired pulmonary defences caused by stress (transport, weaning…),
nutritional deficiencies, and/or pre-existing viral infections (in particular BHV-1, BVD and PI-3), M
haemolytica is able to proliferate rapidly within the lung and then produce a severe fibrinopurulent
bronchopneumonia.
M haemolytica causes the most severe damage of all the recognised bacterial pathogens. It
produces a potent leukotoxin that destroys the macrophages and the neutrophiles.
Pasteurella multocida
P Multocida is a normal inhabitant of the nasal pharyngeal mucosa of healthy cattle. There
are different serotypes being A and D the ones involved in the bovine respiratory complex. P
multocida causes less damage in the respiratory tract than M haemolytica and cause a fibrinous
bronchopneumonia.
Mycoplasma bovis
Mycoplasma bovis is not ubiquitous and the occurrence of this agent in a herd is always connected
with cases of mastitis, arthritis and/or pneumonia. Clinically healthy calves can harbour M bovis
in the respiratory tract and shed the agent through nasal discharge fro months. The most common
histological findings are interstitial and catarrhal to catarrhal-purulent bronchopneumonia.
Haemophilus somnus
H somnus is a gram-negative bacteria and is a normal inhabitant of the nasal pharyngeal mucosa
of healthy cattle. It has been associated with pneumonia, fibrinous pleuritis, myocarditis, septicemis,
pericarditis, polyarthritis and meningoencephalitis. It is considered a significant component of
the respiratory complex that affects calves in the feedlots of USA. The isolation of H somnus has
been published in United Kingdom, Denmark, Germany and Hungary, but it is believed to have a
worldwide distribution.
CONTROL OF BOVINE RESPIRATORY COMPLEX

The health status of a calf depends on the level of management, nutrition, parasite control,
environmental conditions and presence of respiratory pathogens. The control of the bovine respiratory
complex should be directed to all the parameters mentioned already but we will focus in this article
in the control of respiratory disease through vaccination.
Different technologies have been used in the production of respiratory vaccines and they have
been presented in different combinations. The efficacy of a vaccine depends on: choice of the right
antigen, active on the presence of maternally derived antibodies, safe and right combination.
It is very important that veterinarians and farmers have a clear idea of what is the purpose of
our vaccination scheme: control of clinical signs, control of the infection and/or eradication of the
disease.
There are currently vaccines available in the market for the control of BHV-1, BVDV, PI-3,
BRSV, M haemolytica and P multocida. Former vaccines containing bovine adenovirus were
withdrawn from all different markets and current research on adenovirus vaccines is focused on
the use of apathogenig strains of adenovirus as vector vaccines. In the case of bovine Coronavirus
there are vaccines available fro the control of enteric Coronavirus but not respiratory Coronavirus.
A vaccine against respiratory Mycoplasma bovis infection was developed in the 80’s but was never
commercialised and there is at least one inactivated vaccine available in USA but its efficacy is
unknown.
Recommended vaccination programme

IBR: control and eradication of the disease with the use of marker vaccines. Vaccination should
be carried out every 6 months and use of live vaccines is particularly recommended to achieve
reduction of virus circulation (Bovilis IBR marker live)
BVDV: Control should be aimed primarily to avoid the birth of animals persistently infected
in utero and for that reason vaccination of the dam with a vaccine that has been proved to provide
foetal protection is recommended (Bovilis BVD). In feed-lots where animals may be supplied
from different sources there can be circulation of BVDV and vaccination against BVDV may be
necessary. Maternally derived antibodies can be present until month six of life and they can interfere
with vaccination.
Bovine Adenovirus and Bovine Respiratory Coronavirus: There are currently no vaccines
available for the control of these viruses in western Europe. The only product available in Hungary
is a combined product that will be removed from the market when the IBR eradication programme
starts. Bovine adenovirus has lost importance as a respiratory pathogen while the role of bovine
Coronavirus could result to be more important than we believe now.
Mycoplasma bovis and Pasteurella multocida: There are bacterins available for the control of
Pasteurella multocida A and D, but they have not been proved to be very efficacious. Mycoplasma
bovis vaccines are not available in Europe and the efficacy of those sold in USA is unknown.
BRSV: Vaccination against BRSV is widespread in Europe as it is considered the major component
of the bovine respiratory complex. As the disease can affect animals even when maternally derived
antibodies are present, it is crucial that vaccination is efficacious on the presence of MDA.
Parainfluenza-3: Due to the fact of being spread worldwide and its negative effect on pulmonary
macrophages it is common practice to vaccinate against PI-3.
M haemolytica: Major bacterial pathogen. Former inactivated M haemolytica vaccines were
of very low efficacy. It was found that those vaccines did not contain the relevant antigens required
to provide protection against M haemolytica infection. Two main technologies were developed
and are currently being used in the production of these vaccines: Iron regulated proteins (IRP) and
leukotoxins. Iron regulated proteins have been shown to be highly protective and moreover they are
cross protective within different strains of M haemolytica, making them the most suitable antigen to
be used in M haemolytica vaccines.
Bovilis Bovipast
Vaccine developed for the control of BRSV, PI-3 and M haemolytica infections even when
maternally derived antibodies are present in the calf. First dose can be administered when the calf
is two weeks old. The fact of being efficacious in the presence of maternally derived antibodies is
extremely important because diseases such as BRSV can cause disease despite of MDA being present
Primary course consists of two injections (5 mls each) administered subcutaneosly and animals
should be booster prior to each pneumonia season. It combines the three major respiratory pathogens
and it is the ideal complement for IBR marker vaccination in those farms where there is evidence of
bronchopneumonia.
The vaccine includes an inactivated BRSV and PI-3 strains, and iron regulated proteins of M
haemolytica A1. Iron regulated proteins have been proved to be highly immunogenic and because
they are shared by the different serotypes of M haemolytica they guarantee protection against them.
IRP’s are located in the outer membrane of M haemolytica grown in vivo or under iron-restricted
in vitro conditions. Former M haemolytica vaccines lack thse IRP’s and that was the reason of their
non-efficacy when used in the field.
The vaccine efficacy against BRSV and PI-3 was assessed in different challenge studies. In both
studies the response from vaccinated animals was very good but in the case of the BRSV challenge it
was extremely good showing the superior efficacy of the BRSV strain included in the Table 1 shows
the effect of vaccination in the level of clinical signs induced by BRSV.
T able 1-E ffec t of vac c ination on c linic al s c ore (tem perature, nas al dis c harge,
c oughing)
5
Total clinical score
3
V ac c inates
1 C ontrols
-1
0 2 4 6 8 10 12 14
D ay after B R S V c hallenge
We also studied the quality of the immunological response induced by the BRSV strain of Bovilis
Bovipast. Two antibody responses are generally considered to contribute to BRSV protection. These
are against G and F antigens. Virus neutralization (VN) measures F and G antibody and most of
the ELISA s employed measure primarily F antibody. F antibody has been correlated with a good
degree of protection by trials involving the administration of monoclonal passive F antibody. Trials
with vaccines suggest the VN response is not always well correlated to protection. A study carried
out by P. Kerkhofs at VAR (Veterinary and Agrochemical Research Centre) in Belgium showed that
the inactivated BRSV strain from Bovilis Bovipast induced a higher serological response than a live
(mlv) strain against F protein (Table 2)
Table 2. ELISA response Live vs Bovilis Bovipast
1
mean ELISA titre (OD)
0.8
0.6 inac
0.4 mlv
0.2
0
v1 v2 day 7 14 24 44 56
sample time
In the case of M haemolytica protection was showed not only against challenge with serotype
A1 (table 3) but also when challenged with serotype A6 (table 4), showing the efficacy and cross-
protection of the IRP’s. Moredun Research Institute in Scotland developed the challenge model and
it is a very severe challenge model that induces high mortality level in non-vaccinated animals.
Table 3. Challenge with M haemolytica A1
Number of animals Dead % Mortality

Control 12 8 66.60%
Bovilis Bovipast 12 2 16.60%
Table 4. Challenge with M haemolytica A6
Number of animals Dead % Mortality

Control 8 7 87.50%
Bovilis Bovipast 8 1 12.50%
The vaccine is currently available in most of the European countries and it is the first choice by
most veterinarians in the control of bronchopneumonia in cattle due to its efficacy against the most
important pathogens in calves of almost all ages. Iron regulated proteins meant a major breakthrough
in Mannheimia haemolytica vaccines and this superior technology ensures high cross-protection
against this deadly bacteria.
References
AdairBM. Effect of parainfluenza-3 virus challenge on cell-mediated immune function in parainfluenza-3
vaccinated and non-vaccinated calves. Res Vet Sci. 2000 Apr;68(2):197-9.
Larsen LE: Bovine Respiratory Syncytial Virus (BRSV): A review. Acta Vet. Scan. 2000, 41, 1-24
Van der Poel W: Epidemiology of Bovine Respiratory Syncytial Virus Infections. Ph D Thesis 1995
GENETIC CHARACTERIZATION OF SMALL RUMINANT LENTIVIRUS
GENOTYPE E
GENETSKA KARAKTERIZACIJA LENTIVIRUSA GENOTIPA E U

MALIH PREŽIVAČA
Reina, R., Grego, E., Lacerenza, D., Profiti, M., Rosati, S.
Dipartimento di Produzioni Animali Epidemiologia ed Ecologia, Universita di Torino, Torino.Italy.
INTRODUCTION
Small ruminant lentiviruses (SRLV) are wide world distributed affecting sheep and goats and
cause slow and insidious disease affecting lungs, brain, mammary gland and articular joints. Although
the prototypes Maedi Visna Virus (MVV) and Caprine arthritis-Encephalitis Virus (CAEV) have been
originally isolated from sheep and goat respectively, the species barrier is less tight than previously
thought and an increased number of recent studies characterized goat isolates more related to MVV
cluster and vice versa.
Main target cell of SRLV is the monocyte/macrophage lineage although it has been found in vivo
in some epithelial tissues, brain, among others. Also in vitro SRLV are able to infect a wide range of
cell types including several immortalized cell lines
Genetic organisation of SRLV fits in with other complex lentiviruses such as HIV or SIV. Thus,
structural genes gag, pol and env as well as accessory genes tat, vif and rev are usually present in
the genome, all of them controlled by the regulation of the LTR. Artificial deletions in the AML,
AP1 and CAAAT sites of the LTR have shown to decrease viral titers in vitro. Among the structural
genes, viruses artificially deleted in the dUTPase subunit of the pol gene have shown to be competent
for viral replication in dividing cells, but viral growth in terminally non-dividing cells is reduced or
abrogated, with an increase in G→A transition mutations hampering viral fitness. In a similar way,
among the accessory genes, the SRLV tat or vpr-like increased the viral load, tissue distribution and
severity of inflammatory lesions when compared with vpr-deleted counterpart.
The majority of SRLVs can be classified in 3 groups attending to genetic homologies in gag
and pol genes. Group A includes the prototypes of Visna Maedi viruses. Group B includes caprine
arthritis encephalitis virus prototypes and group C houses the divergent CAEV1GA strain.
Recently, a new highly divergent subtype named E have been found in Italian goats. In this work
we have isolated, sequenced and analysed the complete genome of the first double naturally deleted
SRLV, the genotype E, as well as its in vitro biological features.
Sažetak
Lentivirusi malih preživača (SRLV) rasprostranjeni su širom svijeta djelujući na ovce i koze
uzrokojući sporu, ali progredirajuću bolest koja djeluje na pluća, mozak, mliječnu žlijezdu i zglobove.
Iako su prototipovi Maedi Visna Virusa (MVV) i kozjeg artritis - encefalitis virusa (CAEV) izvorno
izolirani iz ovaca tj. koza, vrsna granica je tanja nego što se ranije mislilo, a više je novijih istraživanja
pronašlo kozje izolate povezanijima sa MVV skupinom i obrnuto. Glavna ciljna stanica SRLV su
monocitno / makrofagnog podrijetla iako ih se in vivo pronašlo i u nekim epitelnim tkivima i mozgu,
između ostalog. Sedam godina stara koza, klinički zdrava i visoko reaktivna na antigen tipa E, ali
negativna na genotip A i B je odabrana za izolaciju virusa. Nakon žrtvovanja, dobiveni su različiti
uzorci ciljnih tkiva. DNK i RNK su ekstrahirani iz kultura i korišteni za amplifikaciju genoma.
Kompletni genom genotipa E amplificiran je PCR-om. Test infektivnosti izveden je inficiranjem
različitih kozjih staničnih tipova konvencionalnim sojem CAEV-To1/89 i genotipom E. Izolacija
virusa bila je uspješna iz tkiva slezene, mliječne žlijezde i mamarnog limfnog čvora dok sinovijska
membrana, korioidni pleksus, pluća i medijastinalni limfni čvor ostadoše intaktni barem do 5. pasaže
što je ocijenjeno prisutstvom CPE i/ili PCR pozitivnom reakcijom. Genom genotipa E sastojao se od
8454bp uključujući funkcionalni LTR, 3 strukturna gena (gag, pol i env) i 2 akcesorna gena normalno
prisutna u SRLV vif i rev. Ipak, utvrđena je delecija u pol genu što je bilo prisutno u svim stadima
u kojima je taj genotip E bio prisutan. Zbog toga što dvostruka delecija može spriječiti replikaciju
u nedijelećim stanicama kao što su makrofagi akumulacijom mutacija tijekom rane infekcije,
predmnijevali smo ranu infekciju premonocita u koštanoj srži. Potom, ti rano inficirani monociti
mogu doseći mliječnu žlijezdu te zajedno sa epitelnim stanicama mogu odigrati ključnu ulogu u
patogenezi tog novog genotipa.Serološka dijagnostika sa komercijalnim kitovima koja se bazira na
gag i TM regijama može bit umanjena jer su uočene mnoge razlike u tim regijama kod SRLV-E.
MATERIAL AND METHODS

Animals, Virus and Cells. A seven year old goat, clinically healthy and highly reactive against
type E antigen but negative against genotypes A and B was selected for virus isolation. Following
sacrifice, different target tissue explants were obtained. Co-cultivation of blood derived macrophages
with ovine foetal choroid plexus cells was also carried out. DNA and RNA from the cultures were
extracted and used for genome amplification. CAEV field isolate TO1/89 was obtained by explantation
of synovial membrane from arthritic goat and was used in in-vitro experiments as conventional
strain.
Amplification cloning and sequencing of viral genome. The complete genome of genotype E was
amplified by PCR with primers which were designed based on known fragments, resulting in five
overlapping products. PCR was performing using Qiagen Long Range PCR following manufacturer’s
instructions. In parallel, when necessary the amplicons were cloned into pCR-XL TOPO vector
(Invitrogen). Sequencing was carried out with fluorescent dye terminators on an ABI PRISM 310
Genetic Analyzer. One step RT-PCR (Superscript; Invitrogen) was carried out to amplify the Rev-
encoding regions according to the instructions manual.
Infectivity assay. Different caprine cell types were infected with conventional strain CAEV-
To1/89 and genotype E. Titres were calculated using an indirect non-radioactive method (HS-Lenti
RT Activity kit, Cavidi) at different times post-infection.
RESULTS
Virus isolation was successfully carried out in spleen, mammary gland and mammary lymph
node while synovial membrane, choroid plexus, lung and mediastinal lymph node remained all
negative at least until the 5th passage as assessed by presence of CPE and/or PCR positive reactions.
Supernatant from positive cultures were used to replicate the isolate in foetal choroid plexus (CP),
spleen, synovial membrane (SM) and epithelial milk cells (EM). RT activity increased with every
passage reaching a maximum level at passage 4 with viral titre of 1.5 x 105 TCID50/ml in CP as well as
SM but not in spleen. However, the SRLV-E behavior was only comparable with that of conventional
strain when using EM cells.
The genome of genotype E consisted in 8454 bp including a functional LTR, the three structural
genes (gag, pol and env) and two accessory genes normally present in SRLV vif and rev. However,
a deletion in the pol gene corresponding to the dUTPase subunit was found. We could demonstrate
that this deletion was present in all the flocks in which this genotype E was present, representing
a peculiar genetic marker of this distant genotype. A second deletion based on SRLV consensus
sequences and corresponding to tat or vpr-like accessory gene was identified between vif and env
genes. Regarding LTR we have found a single copy of the 70 bp repeat described for CAEV-Co
reference strain which includes additional AP-1, CAAAT, GAS and TAS sites.
CONCLUSIONS
The first double naturally deleted SRLV in dUTPase and vpr-like regions showed a restricted
growth limited to mammary cells and only after several adaptation steps was able to replicate on
GM and CP cells. Since the double deletion could hamper replication in non dividing cells such
as macrophages (target cell of the SRLV) by accumulation of mutations in early infection, we
have hypothesized the early infection of pre-monocytes in bone marrow. After that, pre-infected
monocytes could reach mammary gland and together with epithelial cells could develop a key role
on the pathogenesis of this new genotype centered in vertical transmission. Serodiagnosis with
commercial kits normally based on gag and TM regions may be impaired since a high number of
differences were observed in these regions in SRLV-E.
(Extended results are currently being written in a full paper for publication)
Entomological surveillance for Bluetongue vectors
in Tirana
ENTOMOLOŠKO ISTRAŽIVANJE BLUETONGUE VEKTORA U TIRANI
Lika E.,1 Lika A.2, Gjino P.1, Turmalaj L.1, Grizelj J.³, Vince S.3
1
Faculty of Veterinary Medicine, Tirana, Albania
2
Institute of Food Safety and Veterinary, Tirana, Albania
3
Faculty of Veterinary Medicine, Zagreb, Croatia
Abstract
The incursion of Bluetongue virus (BTV) in the Mediterranean basin have implicated numerous countries
that had never experienced the infection in their territory before. To define the infection area and better control
the infection, some of them have established entomological and serological surveillance plans. The circulation
of bluetongue virus (BTV) was detected serologically in Albania in 2002. In the same season a survey for
Culicoides Latreille, 1809, was also made to establish whether Culicoides imicola Kieffer, 1913, the main vector
of BTV in the Mediterranean Basin or any other suspected vector species were present. The present study was
designed to analyse the monthly activity of Culicoides species in the region of Tirana, particularly secondary
vector species such as C. obsoletus, C. pulicaris and C. punctatus. While the main vector, C. imicola was not
detected in the present study, a number of species which are known or suspected BTV vectors including C.
obsoletus and C. pulicaris complex were among the most prevalent in Tirana. Here we report the results of this
entomological survey during the year 2005.
Key word: Bluetongue virus, Culicoides vectors, entomology, surveillance, trap
Sažetak
Prodor Bluetongue virusa (BTV) u područje Sredozemlja obuhvatio je brojne zemlje koje do tada nikada
nisu imale infekciju na svom području. Kako bi odredile područje infekcije i bolje kontrolirale istu, neke od
njih su načinile entomološke i serološke planove nadzora. Cirkuliranje Bluetongue virusa serološki je utvrđeno
u Albaniji 2002. U istoj sezoni provedeno je istraživanje Culicoides Latreille, 1809 kako bi se utvrdilo da li je
prisutan Culicoides imicola Kieffer, 1913, glavni vector BTV-a na Sredozemlju ili neki drugi pretpostavljeni
vektor. Ova je studija osmišljena u svrhu analize mjesečne aktivnosti Culicoides sp. u Tiranskoj regiji, posebice
sekundarnih vrsta vektora poput C. obsoletus, C. pulicaris i C. punctatus. Iako u ovoj studiji provedenoj u Tirani
nije utvrđen glavni vector - C. imicola, utvrđene su brojne druge vrste poznatih i pretpostavljenih BTV vektora
uključujući C. obsoletus i C. pulicaris kompleks kao najprevalentnije. U radu se iznosi izvješće ove entomološke
studije obavljene 2005.
Ključne riječi: Bluetongue virus, Culicoides vektori, entomologija, nadzor, klopka
Introduction
Bluetongue virus causes an infectious, non-contagious disease of ruminants, and is transmitted
between its vertebrate hosts by Culicoides biting midges (Diptera: Ceratopogonidae). Bluetongue
virus is thought to infect all known species of ruminant. However, severe disease usually occurs only
in certain breeds of sheep, particularly the fine-wool and mutton breeds and some species of deer,
most notably the North American white-tailed deer. Clinical signs may include fever, depression,
excessive salivation, nasal discharge (serous, muco-purulent or bloody), facial oedema, hyperaemia
and ulceration of the oral mucosa, coronitis, lameness, muscle weakness and death. The mortality
rate and the severity of the clinical signs seem to vary with the breed and age of the animal infected
(with the older age groups being more susceptible), the type and strain of the virus and certain rather
ill-defined interactions with the environment.
In the field BTV is transmitted between its vertebrate hosts almost entirely via the bites of various
species of biting arthropod, and extensive experimental and epidemiological investigation has shown
that by far the most important of these are certain species of Culicoides biting midge which are true
biological vectors. The distribution of BTV is therefore limited to those geographical areas where
competent vector species of Culicoides are present and its transmission to those times of the year
when the climatic conditions are favorable for adult vector activity.
The BTV epizootic started in 1998 when the virus serotype BTV-9 was isolated on four Greek
islands, Rhodes, Leros, Kos and Samos close to the Turkish mainland. In the following years the
disease spread to northern Greece and nearby Balkan countries including Albania, Kosovo, Bulgaria
and Bosnia-Herzegovina. It is thought that the disease first appeared in Albania during 2001 as an
extension of the outbreak in the neighboring Greek regions of Epirus and Western Macedonia. In
2002, a sero-survey was carried out in 15 district of Albania to detect antibodies to BTV in cattle
and small ruminants (Di Ventura M. et al., 2004). In total, 1754 sera samples from cattle and small
ruminants were examined of which 264 (15,1%) were positive using C-ELISA, with sero-positive
cases being widely distributed, even in mountainous areas.
The relatively high sero-prevalence of antibodies to BTV in Albania is evidence that Culicoides
vectors are present but there is little entomological data as to which species are prevalent in the
country. A limited survey of 43 catches carried out in conjunction with the 2002 sero-prevalence
study (Goffredo M. et al., 2004), identified 20 Culicoides species of which C. obsoletus was the most
prevalent.
The present study was undertaken to study the monthly activity of Culicoides species in the
region of Tirana, in order to reevaluate the medical importance of Culicoides Complexes such as
Obsoletus, Pulicaris and Nubeculosus Complexes according to each season of the year.
Material and Methods

Study Area
Entomological monitoring was carried out in Tirana region (in the territory of the Institute of
Food Safety and Veterinary in the suburb part of Tirana). According to the sero-survey of 2002,
Tirana was the district with the highest BTV prevalence; interestingly Tirana was also the district in
which animals showed the highest neutralising antibody titres.
Sampling Protocols
Monitoring activity was carried out during the period 1 January – 31 December 2005. The
capture, catch analysis and identification of species of Obsoletus and Pulicaris Complex were carried
out according to the methods described by Goffredo and Meinswinkel, 2004. One light trap for
insects of the type “Onderstepoort” with 8 W UV-light tube and downdraught suction motor was
available for the study. The light trap was positioned in open air with the UV-light tube 1.5-2 m
above ground level. The light trap was operated overnight, starting from 1 hour before sunset to
08.00 am the following morning. The resultant insect catch was poured through a fine gauze square
and then transferred to a plastic jar containing 70 % alcohol. The insect were identified under a
stereomicroscope Stemi 2000-C using appropriate taxonomic keys.
Results
During the course of this study, a total of 3680 Culicoides specimens (2964 females and 716 males)
were obtained from 365 trap collection during all the year 2005. The species of Obsoletus, Pulicaris
and Nubeculosus Complexes and Other Culicoides species were identified under a stereomicroscope
Stemi 2000-C using appropriate taxonomic keys according to the methods described by Goffredo
and Meinswinkel, 2004.
The abundance of the Obsoletus, Pulicaris and Nubeculosus Complexes according to each month
is shown in the Table No. 1.
Table No. 1. The abundance of the Obsoletus, Pulicaris, Nubeculosus Complexes and other species of Culi-
coides every month
Number of Culicoides according to each month

Complexes Jan Feb Mars April May June July Aug Sep Oct Nov Dec
Obsoletus 16 11 38 217 89 91 187 41 44 6 31 36
Pulicaris 37 48 37 26 62 13 16 5 1
Nubeculosus 4 1
Other species
18 110 389 419 919 402 274 67 23 2
of Culicoides
1000
900
800
700
600
500
400 C . o b s o le tus
300 C . p ulic a ris
C . nub e c ulo s us
200
O the r
100
0
C . nub e c ulo s us
January
February
Mars
April
May
C . o b s o le tus
June
July
August
September
October
November
December
Fig. 1. The abundance of the Obsoletus, Pulicaris, Nubeculosus Complexes and Other species of Culicoides
every month
Obsoletus Complex was the most abundant complex and accounting for 21.9 % of the total
catch; Pulicaris Complex accounted for 6.65 % followed by Nubeculosus Complex that accounted
for 0.13 %. Other Culicoides species accounted for 71.3 % of the total.
Discussion
Of more than 1400 Culicoides species worldwide, fewer than 20 are considered to be actual or
possible vectors of bluetongue virus. While the main vector, C. imicola was not detected in the present
study, a number of species which are known or suspected BTV vectors including obsoletus and
pulicaris complex were among the most prevalent in Tirana region. These findings are in agreement
with the results of the previous survey in Albania and similar to those reported for other countries
(Purse B. V. et al. 2006)
As for the seasonal trend of culicoides fauna, it could be determined especially for Obsoletus
Complex which is also the most abundant complex. The first adult appeared on 13 January 2005 and
the last one was collected on 27 December 2005, the highest number of specimens being collected
at the end of April.
All of these new finding are of interest since they suggest that BTV may be able to overwinter in
Tirana region were adult vector, especially of Obsoletus Complex, are present during all the year.
In general, our survey confirms what previously observed on the Culicoides fauna composition
of Albania, and particularly on the distribution and abundance of Obsoletus Complex. During the
entomological survey of 2002, the species of the Obsoletus Complex result the most abundant, and
at least two species of the complex, C. obsoletus and C. scoticus, were present.
References
1. Di Ventura M., Tittarelli M., Semproni G., Bonfini B., Savini G., Conte A., Lika A. (2004): Serological
surveillance of bluetongue virus in cattle, sheep and goats in Albania. Vet. Ital., 40 (3), 101-104.
2. Goffredo M., Delécolle J., Semproni G., Lika A. (2004): Culicoides (Diptera: Ceratopogonidae) in Albania:
results of the 2002 entomological survey for bluetongue. Vet. Ital., 40 (3), 209-211.
3. Goffredo M. and Meiswinkel R. (2004): Entomological surveillance of bluetongue in Italy: methods of
capture, catch analysis and identification of Culicoides biting midges. Vet. Ital., 40 (3), 260-265.
4. Purse B. V., Nedelchev N., Georgiev G., Veleta E., Boorman J., Denison E., Veronesi E., Carpenter S., Baylis
M., Mellor S. (2006): Spatial and temporal distribution of bluetongue and its Culicoides vectors in Bulgaria.
Medical and Veterinary Entomology 20 (3), 335-344.
Sheep - associated malignant catarrhal fever – a case
report
Zarazna korica goveda – prikaz slučaja
Habus, J1., N. Turk1, M. Friess2, R. Zobel3, Z. Grabarevic4, Lj. Barbic1, Z. Stritof1,

Z. Milas1, V. Staresina1
1
Department of Microbiology and Infectious Disease with Clinic, Faculty of Veterinary Medicine, University
of Zagreb, Zagreb, Croatia.
2
Institute of Virology, Faculty of Veterinary Medicine, Zurich, Switzerland.
3
Vetmed d.o.o., Stružec, Croatia
4
Department of General Pathology and Pathological Morphology, Faculty of Veterinary Medicine, University
of Zagreb, Zagreb, Croatia.
SUMMARY
Sheep associated malignant catarrhal fever is severe, highly fatal, viral disease of cloven-hoofed animals.
SA-MCF occurs worldwide, usually sporadically, although significant herd outbreaks are occasionally seen. It
is caused by ovine herpesvirus 2 (OvHV-2), member of the emerging subfamily Gammaherpesvirinae, genus
Rhadinovirus. Sheep are the natural hosts of OvHV-2 but the infection may be transmitted to cattle, pigs and
big variety of wild ruminant species. Interestingly, sheep remain healthy upon infection with OvHV-2, while
other susceptible hosts develop clinically evident disease. Exact mechanism of transmission from sheep to the
susceptible species is still not cleared. Up to now, OvHV-2 has never been successfully propagated in vitro.
However, OvHV-2 DNA has been detected in nasal secretions of sheep. Aerosolized nasal secretions containing
infectious virus has been speculated as a way in which sheep transmit OvHV-2 to susceptible animals. Generally,
infected cattle and pigs which develop symptoms of SA-MCF are considered unable to transmit disease to other
hosts. Several suspected cases of SA-MCF in cows without identification of the causative agent have been
reported previously in Croatia. In June 2005, on a farm in Stružec, north-west Croatia, where 17 diary cows and
2 heifers shared stables and meadows with dozen sheep, one of the heifers developed symptoms reminiscent
of SA-MCF. Symptoms included anorexia, high fever, profuse catarrhal discharge from the eyes and nares,
bilateral corneal opacity, necrosis of the muzzle and erosions of the buccal epithelium. Due to anorexia there
was also a significant weight loss. Ten days following onset of the disease neurological symptoms such as
ataxia, tremor, convulsions and hyperesthesia occurred. Animal died within 14 days. During the autopsy sharply
demarcated erosions on the mucosal surfaces including tongue, oral mucosa, oesophagus, abomasums, jejunum,
colon, caecum and urinary bladder were found. Histopathology revealed significant perivascular and intramural
arterial infiltrations with mononuclear cells, mostly lymphocytes. In order to confirm diagnosis, samples from
brain, cerebellum, spleen and lymph nodes were obtained and submitted to DNA extraction procedures for
molecular diagnosis. Fluorogenic real-time PCR amplification specific for OvHV-2 was preformed and OvHV-2
DNA was detected in all investigated organs. For the first time in Croatia OvHV-2 was identified and quantified
as a causative agent of SA-MCF.
Sažetak
Zarazna korica je izuzetno teška i najčešće letalna virusna zarazna bolest domaćih i divljih papkara. Bolest
se javlja širom svijeta, najčešće sporadički, no moguća je i pojava epizootija sa znatnim gospodarskim štetama.
Uzročnik zarazne korice je ovčji herpesvirus 2 (OvHV2), unutar emergentne podporodice Gammaherpesvirinae,
rod Rhadinovirus. Prirodni rezervoar ove bolesti su ovce koje ne pokazuju znakove bolesti, dok se bolest klinički
može očitovati u goveda, svinja te u različitih divljih papkara. Točan način prijenosa s ovce na prijemljive životinje
nije još u potpunosti razjašnjen. Također, do danas nije uspjelo izdvajanje uzročnika in vitro, no molekularnim
metodama dokazana je virusna DNA u nosnom sekretu ovaca te se smatra da je infekcija primljivih životinja
posljedica širenja kapljične infekcije s ovce na goveda. Bolest prelazi isključivo s rezervoara na domaćine,
a bolesne životinje ne izlučuju virus i ne mogu širiti infekciju. U Hrvatskoj je do sada zabilježeno nekoliko
slučajeva zarazne korice goveda, a dijagnosticiranje se osnivalo na epizootiološkim podacima, kliničkoj slici,
patoanatomskom i histopatološkom nalazu. U lipnju 2005, na jednoj farmi u mjestu Stružec (Sisačko-moslavačka
županija), u istom objektu bilo je smješteno 17 mliječnih krava i 2 junice zajedno sa desetak ovaca. U jedne
od junica pojavili su se klinički znakovi koji su upućivali na zaraznu koricu goveda. Bolest je nastupila naglo,
a očitovala se gubitkom apetita, povišenom tjelesnom temperaturom, profuznim sluzavim iscjetkom iz očiju i
nosa, obostranim zamućenjem rožnica, nekrotičnim promjenama na nosnom ogledalu i erozijama po sluznici
usne šupljine. Životinja je značajno izgubila na tjelesnoj masi, a desetak dana nakon pojave prvih znakova bolesti
došlo je i do poremetnje funkcije SŽS-a u smislu otežanog kretanja, drhtanja, grčeva i pojačane osjetljivosti
na podražaje. Životinja je uginula 14-og dana od pojave bolesti. Razudbom su ustanovljene oštro ograničene
erozije na sluznici jezika, usta, jednjaka, sirišta, tankog i debelog crijeva, slijepog crijeva i mokraćnog mjehura.
Histopatološki, ustanovljena je znatna perivaskularna i intramuralna infiltracija arterija mononuklearnim
stanicama, uglavnom limfocitima. U cilju objektivnog dijagnosticiranja bolesti uzorkovana su tkiva mozga,
slezene i limfnih čvorova u cilju identifikacije i kvantifikacije virusne DNA. Iz spomenutih organa ekstrahirana
je virusna DNA te je amplificirana metodom lančane reakcije polimeraze u stvarnom vremenu (Real-time PCR)
uporabom početnica specifičnih za OvHV-2. U svim istraživanim organima ustanovljena je i kvantificirana
OvHV-2 DNA što predstavlja prvi dokaz i kvantifikaciju uzročnika zarazne korice goveda u Hrvatskoj.
INTRODUCTION
Malignant catarrhal fever (MCF) is severe and frequently fatal disease syndrome of certain domestic
and wild cloven-hoofed animals caused by closely related members of family Gammaherpesvirinae.
Two major epidemiological forms of MCF are defined; one is known as wildebeest associated MCF
(WA-MCF) reflecting the fact that the causative agent (Alcephaline herpesvirus 1) exist in nature
as endemic subclinical infection in wildebeest. Second epidemiological form is described as sheep-
associated malignant catarrhal fever (SA-MCF) and it is caused by closely related ovine herpesvirus 2
(OvHV-2) (PLOWRIGHT et al., 1990). Wildebeest associated MCF is restricted to African continent
e.g. to the places inhabited by the wildebeest, while sheep associated MCF occurs worldwide. Though
never successfully propagated in vitro there is a substantial epidemiologic, serologic and molecular
evidence that all varieties of domestic sheep represent a reservoir of OvHV-2 that can be transmitted
to susceptible, poor adopted ruminants, such as domestic cattle, deer, other wild ruminants and,
recently reported, also to pigs (ALBINI et al., 2003; KIM et al., 2003; LI et al., 2005). SA-MCF
usually appears sporadically and affects only one or few animals, but occasionally significant herd
outbreaks can be seen (BEREZOWSKI et al., 2005).
The disease may present a wide spectrum of clinical manifestations ranging from the peracute
form, when minimal changes are observed prior to death, to the more florid cases characterized with
more specific symptoms. In both forms of the disease, animals with clinical signs are not a source of
infection as virus is only excreted by the natural hosts – wildebeest and sheep, respectively (LI et al.,
1995; ACKERMANN, 2006).
Since the etiological agent has never been propagated in vitro, routine diagnostics of the diseases
in the past relied mostly on clinics, pathology and histopathology. Recently usefulness and advantages
of molecular methods for detection and identification of viral DNA were reported (BAXTER et al.,
1993; LI et al., 1995).
Suspected cases of SA-MCF in cows without identification of the agent have already been
reported in Croatia during the last decades. This paper describes a case of SA-MCF in 13 month-
old heifer from northwest Croatia and subsequent diagnostic findings including identification and
quantification of OvHV-2 DNA in different organs.
CASE HISTORY
Assessment of epidemiological data and clinical signs. In June 2005, on a farm in north-
west Croatia, where 17 Simmental diary cows and 2 heifers shared stables and meadows with a
dozen sheep, a 13 month-old heifer showed symptoms reminiscent of SA-MCF; anorexia, high
fever, bilateral corneal opacity, profuse catarrhal discharges from the eyes and nares, necrosis of the
muzzle and erosion of the buccal epithelium. Due to anorexia there was also a significant weight
loss. Ten days following onset of the disease neurological symptoms occurred, such as ataxia, tremor,
convulsions and hyperesthesia and animal died.
Pathology and histopathology. Macroscopically lymph nodes were swollen. Sharply demarcated
erosions were found on the most mucosal surfaces including tongue, oral mucosa, oesophagus,
abomasums, jejunum, colon, coecum and urinary bladder. Hemorrhagic punctuations were found on
the larynx, trachea, pericardium, endocardium and gall bladder. Epicardium of the right atrium was
thickened and covered with fibrinoso-haemorrhagic exudates. In the eyes, congestion and oedema
with bluish opacity were noted. Sharply demarcated necrotic skin lesions on the thorax were also
seen. A brain was congested and the lungs were oedematous.
Following the autopsy, organ samples were taken for histopathological analysis. After formalin
fixation, the samples were embedded in paraffin and cut on 5 µm thick slices which were deparaffinized
and stained with routine haematoxylin-eosin method. Histopathologicaly, the most important finding
was very significant perivascular and intramural arterial infiltrations with mononuclear cells, mostly
lymphocytes.
Real-time PCR. Formaldehyde fixed samples from brain (73a, non-identified region), cerebellum (73b),
spleen (73c, 73d), and lymph nodes (73e, 73f) were obtained. 25 mg from each brain, cerebellum, and lymph
nodes or 10 mg from spleen were washed twice with phosphate buffered saline (PBS) before DNA extraction.
DNA was extracted from tissues using the QIAamp DNA Mini Kit (Qiagen, Basel, Switzerland)
according to the protocol of the supplier. In order to reduce viscosity, the lyzed sample was transferred
to a QIAshredder column (Qiagen) and centrifuged at room temperature for 5 minutes (ALBINI et
al., 2003). The DNA was eluted in a volume of between 70 and 100 µl. Fluorogenic real-time PCR
amplification specific for OvHV 2 DNA was performed in duplicate wells with 10 µl template or with
a 1:10 dilution of it, using the primers, probe, reaction mix and thermal cycle conditions essentially
as described previously (HUSSY et al., 2001). A synthetic 72mer consisting of the primary target
sequences was used as a positive control. Negative controls consisted of one sample without added
DNA (negative control 1) and one sample containing the eluted from an unloaded column (negative
control 2).
Results are shown in Table 1. Indeed, OvHV-2 DNA was detected in brain, cerebellum, spleen as
well as lymph nodes, indicating that the corresponding animals had been infected with OvHV-2, the
agent of sheep-associated malignant catarrhal fever.
Table 1. Detection of OvHV-2 DNA in samples from Croatian cattle with suspected MCF.
Sample Ct value Interpretation

Positive control 29, 31 a
OvHV-2 DNA detected
Negative control 1 Not applicableb Not detected
Negative control 2 Not applicable Not detected
Brain (73a) 26, 26 OvHV-2 DNA detected
Brain (73a) 1:10 33, 32 OvHV-2 DNA detected
Cerebellum (73b) Not tested
Cerebellum (73b) 1:10 32, 31 OvHV-2 DNA detected
Spleen (73c) 28, 28 OvHV-2 DNA detected
Spleen (73c) 1:10 27, 28 OvHV-2 DNA detected
Spleen (73d) 26, 27 OvHV-2 DNA detected
Spleen (73d) 1:10 26, 26 OvHV-2 DNA detected
Lymph node (73e) Not applicable Not detected
Lymph node (73e) 1:10 24, 24 OvHV-2 DNA detected
Lymph node (73f) 27, 27 OvHV-2 DNA detected
Lymph node (73f) 1:10 25, 24 OvHV-2 DNA detected
Ct values from two independent wells are shown
a
b
If a Ct value has not been detected until cycle 40 of the real-time PCR reaction, the corresponding sample is
considered to be negative. The term “Ct value” is therefore not applicable for negative samples.
DISCUSSION
Suspected cases of SA-MCF in cows without identification of the agent have already been
reported in Croatia, especially in northwest areas where cows usually share stables and meadows with
sheep. Also in this case epidemiological data revealed close contact of heifer with sheep. Clinical
findings were consistent with those already described in literature (OIE, 2004), but regarding the
fact that clinical findings and gross pathological examination can not be relied on, cause they can
be extremely variable, histopathological examination of a variety of tissues has been preformed.
Finding of significant perivascular and intramural arterial infiltration of mononuclear cells, mostly
lymphocytes, is characteristic for SA-MCF and provide us a more certain diagnosis.
It must be emphasised that SA-MCF is one of the few known infectious diseases for which an
etiological agent has never been isolated. An evidence of OvHV-2 infection relies only on presence
of antibodies in reactions where AVH-1 infected cells were used as antigen and on the detection
and amplification of viral DNA in various clinical materials such as peripheral blood leukocytes of
clinically affected animals as well as fresh tissues and paraffin-embedded samples collected post
mortem (LI et al., 1994; HUSSY et al., 2001). Since viral DNA has been detected, a various highly
specific and sensitive PCR (Polymerase chain reaction) methods have been employed worldwide in
studies of the disease in clinically affected animals and the natural hosts.
Fluorogenic real-time PCR amplification specific for OvHV-2 DNA was performed in our study
and OvHV-2 DNA was detected in brain, cerebellum, spleen as well as lymph nodes. Detection of
OvHV-2 DNA in a variety of tissues from animals with MCF-like disease, clearly demonstrates
that those animals had been infected with OvHV-2. Since OvHV-2 is found only on extremely rare
occasions in healthy animals (MULLER-DOBLIES et al., 2001A, 2001B), a causative involvement
of OvHV-2 in the observed disease is extremely likely. However, inhibition of the PCR reaction
in undiluted samples has previously been observed (ALBINI et al., 2003). Therefore it was not
surprising that one undiluted sample reacted negatively, whereas the Ct values obtained from the
1:10 dilution were often equal to or even lower than Ct values obtained from undiluted DNA. A PCR
method, especially real-time PCR emerged as a robust test that can be employed to detect viral DNA
in various clinical materials such as peripheral blood leukocytes of clinically affected animals as well
as fresh tissues and paraffin-embedded samples collected post mortem (BAXTER et al., 1993; LI et
al., 1995; HUSSY et al., 2001). Finally, for the first time, using fluorogenic real-time PCR, OvHV-2
was identified and quantified in one Croatian cow as the causative agent of SA-MCF.
LITERATURE
ACKERMANN, M. (2006): Pathogenesis of gammaherpesvirus infections. Vet. Microbiol. 113, 211-222.
ALBINI, S., W. ZIMMERMANN, F. NEFF, B. EHLERS, H. HANI, H. LI, D, HUSSY, M. ENGELS, M.,
ACKERMANN (2003): Identification and quantification of ovine gammaherpesvirus 2 DNA in fresh and
stored tissues of pigs with symptoms of porcine malignant catarrhal fever. J. Clin. Microbiol. 41, 900-904.
BAXTER, S.I.F., I. POW, A. BRIDGEN, H.W. REID (1993): PCR detection of the sheep-associated malignant
catarrhal fever. Arch.Virol., 132, 149-159.
BEREZOWSKI, J.A., G.D. APPLEYARD, T.B. CRAWFORD, J. HAIGH, H. LI, D.M. MIDDLETON, B.P.
O’CONNOR, K. WEST, M. WOODBURY (2005): An outbreak of sheep-associated malignant catarrhal
fever in bison (Bison bison) after exposure to sheep at a public auction sale. J.Vet. Diagn. Invest. 17, 55-
58.
HUSSY, D., N. STAUBER, C.M. LEUTENEGGER, S. RIEDER, M. ACKERMANN (2001): Quantitative
fluorogenic PCR assay for measuring ovine herpesvirus 2 replication in sheep. Clin. Diagn. Lab. Immunol.
8,123-128.
KIM, O., H. LI, T.B. CRAWFORD (2003): Demonstration of sheep-associated malignant catarrhal fever virions
in sheep nasal secretions. Virus Res. 98, 117-122.
LI, H., D. O’TOOLE, O. KIM, L. OAKS, T.B. CRAWFORD (2005): Malignant catarrhal fever-like disease in
sheep after intranasal inoculation with ovine herpesvirus. J.Vet. Diagn. Invest. 2. 17, 171-175.
LI, H., SHEN, D.T., D. O’TOOL, D.P KNOWLES, J.R. GORHAM, T.B. CRAWFORD, (1995): Investigation of
sheep-associated malignant catarrhal fever virus infection in ruminants by PCR and competitive inhibition
enzyme-linked immunoadsorbant assay. J. Clin. Microbiol. 8, 2048-2053.
LI, H., D.T. SHEN, D. O’TOOL, D.P. KNOWLES, J.R. GORHAM, T.B. CRAWFORD (1994): Competitive
inhibition enzyme-linked immunoadsorbant assay for antibody in sheep and other ruminants to a conserved
epitope of malignant catarrhal fever virus. J. Clin. Microbiol 7, 1674-1679.
OIE (2004): Manual of diagnostic tests and vaccines for terrestrial animals. Malignant catarrhal fever. 5th
edition. Chapter 2.3.14.
MULLER-DOBLIES, U. U., J. EGLI, B. HAUSER, H. LI, M. STRASSER, F. EHRENSPERGER, U. BRAUN,
M. ACKERMANN (2001a): Malignant catarrhal fever in Switzerland: 2. Evaluation of the diagnosis.
Schweiz Arch. fur Tierheilkd. 143, 581-91.
MULLER-DOBLIES, U. U., J. EGLI, H. LI, U. BRAUN, M. ACKERMANN (2001b): Malignant catarrhal
fever in Switzerland. 1.Epidemiology. Schweiz Arch. fur Tierheilkd. 143, 173-83.
PLOWRIGHT, W. (1990): Malignant catarrhal fever virus. In: Virus Infection of Ruminants (Dinter, Z.,B.
Morein,, Eds), 123-150.
Detection of persistently infected (PI) calves with
bovine viral diarrhea virus (BVDV) using “Ear Notch
Test” and comparing it by Immuno-capture ELISA
Otkrivanje perzistentno inficirane (PI) teladi s goveđim

virusom virusnog proljeva (BVDV) koristeći rez uške i
njegova usporedba s Immuno-capture ELISOM
Nadalian M.1, Sadeghi-Nasab A.2*, Hemmatzadeh F.3, Nadjafi J.4, Seifoori

P.4, Gorjidooz M.6, Bahonar A.7
1
Faculty of Veterinary Medicine, University of Tehran, Clinical Sciences, Tehran, Iran
2
Junior school of veterinary medicine, Bu-Ali Sina University, Clinical Sciences, Hamedan, Iran
3
Faculty of Veterinary Medicine, University of Tehran, Department of Microbiology, Tehran, Iran
4
Iran Veterinary Organization, Department of pathobiology, Tehran, Iran
Bovine herd helth manager, Tehran, Iran
6
7
Facutly of Veterinary Medicine, University of Tehran, Department of Food Hygiene, Tehran, Iran
*Corresponding author’s e-mail: sadeghinasabali@basu.ac.ir
Abstract
For detection of persistent infected (PI) calves with bovine viral diarrhea virus (BVDV) immunohistochemistry
(IHC) using ear notch samples compared with an antigen-capture ELISA (ACE) technique and confirmed by
RT-PCR. Blood samples of 552 Holstein calves and cows with 6-24 months old from 15 dairy farms located
in Tehran province (Iran), submitted for detection of BVDV antigen in buffy coat cells using ACE, RT-PCR
and also their formalin fixed ear notch samples by IHC. The results analyzed by SPSS for determination of
sensitivity, specificity and Kappa value of ACE and IHC. Calves were classified as PI if they remained positive
by 3 separate weeks double ACE or RT-PCR. Accordingly, RT-PCR confirmed 13 PI calves but ACE detected
6 cases, 46.15% (6/13) and IHC 10 cases, 76.92% (10/13), correctly. According to RT-PCR, specificity of ACE
and IHC was determined 100% and 84.21% respectively. Kappa value between IHC- RT-PCR and ACE- RT-
PCR determined 0.61 and 0.493 respectively. The results have shown that IHC is more effective method for
detection of PI calves than ACE. Ear notch is an easy, accurate and less expensive ante mortem diagnostic test
for detecting PI calves. But the results confirmed that using double ACE and confirming its results by RT-PCR
is better than using IHC and RT-PCR for screening of PI calves.
Key words: BVDV, RT-PCR, Immunohistochemistry, ear notch, PI calves
Sažetak
BVDV uzrokuje česte infekcije u goveda koje se manifestiraju različitim sindromima. Prenatalna infekcija
može kod teladi prouzrokovati imunotoleranciju i perzistentnu infekciju (PI), kao i bolest sluznice. Telad s
perzistentnom infekcijom je najveći prenositelj bolesti unutar i između stada. Tako se strategije spriječavanja
BVDV-a većinom svode na identifikaciju i eliminaciju takve teladi. Cilj ovog istraživanja bio je utvrditi
pouzdanost i provodljivost imunofistokemijskih metoda koristeći uzroke rezova uha, te ih usporediti s ELISA
tehnikom za detekciju BVDV PI životinja (potvrđenih s RT-PCR).
Materijali i metode: Uzorci krvi od 552 Holsteinse teladi i krava starosti od 6 do 24 mjeseci, sa 15 različitih
farmi iz teheranske regije (Iran), korišteni su za dokazivanje BVDV antigena u buffy coat stanicama koristeći
ACE, RT-PCR kao i formalinom fiksiran rez uha za IHC. Rezultati su zatim analizirani s SPSS za determinaciju
senzitivnosti, specifičnosti i Kappa vrijednost ACE-a I IHC-a. Rezultati: Telad je klasificirana kao PI ako je
ostala pozitivna u tri zasebna, s razmakkom od tjedan dana, dvostruka ACE i RT-PCR testiranja. S RT-PCR-om
je ustanovljeno 13 PI jedinki, dok s ACE-om 6 jedinki, 46,15% (6/13) I IHC 10 slučajeva, 76,92% (10/13). S
obzirom na RT-PCR, specifičnost ACE-a I IHC-a bila je 100% i 84,21%. Kappa vrijednost između IHC-RT-PCR
I ACE-RT-PCR je iznosila 0,61 i 0,493.
Zaključak: Rezultati IHC-a I RT-PCR-a se nisu podudarali kod 6 teladi. Kod 3 teleta , IHC je bio pozitivan,
dok je RT-PCR bio negativan. S obzirom da se virusni antigen može dokazati u tkivima i duže vrijeme nakon što
virus više nije prisutan u krvi, vjerojatno je telad ranije imala epizodu akutne infekcije te se rezidualni virusni
antigen još uvijek mogao dokazati u tkivima. Tri teleta pozitivna RT-PCR-om nisu bila pozitivna s IHC-om.
To je vjerojatno virus te teladi nije bio otkriven označenim protutijelima ili pak virus nije bio prisutan u koži.
Ovi su rezultati pokazali da je IHC metoda dijagnostike uspješnija za detekciju PI teladi od ACE-a. Ušni rez je
jednostavna, točna i jeftina posmortalna metoda otkrivanja PI teladi. Rezultati su pak pokazali da je za skrining
PI teladi bolje korištenje dvostruke ACE i provjera rezultata RT-PCR-om nego korištenje IHC I RT-PCR-a.
Ključne riječi: BVDV, RT-PCR, imunohistokemija, ušni rez, PI telad
Introduction
Bovine viral diarrhea virus (BVDV) is a common pestiviruse infection of cattle causing many
of disease syndromes (2, 6, 15). Prenatal infection can also result immunotolerance and persistent
infection (PI) in calves and mucosal disease. PI calves are regarded as the major source of spreading
BVDV within and among herds. Therefore, eliminating BVDV strategies are most relying in part
on accurate identification and removal of PI calves from herds(12, 18, 19, 20). The objective of this
study was to evaluate the reliability and feasibility of immunohistochemistry (IHC) using ear notch
samples, comparing to an antigen-capture ELISA (ACE) technique for the detection of BVDV PI
animals (confirmed by RT-PCR).
Materials and methods

Blood samples of 552 Holstein calves and cows with 6-24 months old from 15 dairy farms
located in Tehran province (Iran), submitted for detection of BVDV antigen in their buffy coat cells
using ACE, RT-PCR and also their formalin fixed ear notch samples by IHC. The results analyzed
with SPSS for determination of sensitivity, specificity and Kappa value of ACE and IHC. Blood
samples were collected from jugular vein in 10 ml vacutainer tubes contain 1 ml of 3.85% sodium
citrate and delivered to the laboratory in the ice containers (4 °C) maximum within 24 h. The skin
biopsies were collected from the distal part of the ear using an “ear notcher” to obtain a cylindrical
1 cm diameter of the ear pinna. Notcher was washed with water and disinfected with 2% formalin
solution between each collection. Samples were fixed in 10% buffered formalin solution.
3-1) Antigen-Capture ELISA (ACE): Detection of BVDV antigen in Buffy coat cells was
performed using a commercially available kit (Pestivirus antigen detection kit, Moredun Scientific
Limited, UK). According to the manufacturer’s instructions, after sample preparation and antigen
extraction, assay protocol at 450 nm within 30 minutes and based on recommended OD limits (C1
>0.8, C2 = 0.4-0.6, C3 = 0.2-0.4, C4<0.2) was performed.
3-2) Reverse Transcription–PCR (RT-PCR): Reverse transcription–PCR, as described (22)
and modified previously (14), was performed on buffy coat samples from all examined calves.
TriPure isolation reagent (Roche diagnostic GmbH, Mannheim, Germany) was employed for
RNA extraction. After this stage cDNA was synthesized and then PCR procedure was performed
(14, 22)
One primer set, forward (5’-ATGCCCTTAGTAGGACTAGCA-3’) and reverse
(5’-TCAACTCCATGTGCCATGTAC-3’) specific for all of pestiviruses was used for RT-PCR
according to Vilcek et al (1994) which was modified by Kargar Moakhar et al (2004)(14). In this
PCR process, one positive cDNA derived from NADL strain and one negative cDNA obtained from
non-infected cell culture was used as positive and negative control, respectively. The electrophoresis
analysis of the PCR products was run in 1.5% agarose gel using TAE buffer at 100V for 45 min.
Visualization of ethidium bromide stained DNA bands was performed by a UV transilluminator and
gel images were printed using video camera and thermal printer (Figure1).
3-3) Immunohistochemistry (IHC): From formalin fixed ear notch samples referred to
pathology lab serial sections were performed. Five-micrometer tissue sections were mounted on
poly-L-lysine-coated slides and stained for BVDV by using a manually procedure adapted from a
previously described technique (11). Anti-BVDV (pesti) monoclonal antibody labelled with fluorescein
isothiocyanate (BIO 316, Bio-X diagnostics kit, Belgium) was used. Stained sections were examined
by fluorescent microscopy. Positive Immunofluorescent (IF) staining for BVDV was green fluorescent
evidnce within the cytoplasm of keratinocytes of epidermis and hair follicles, sebaceous epithelial
cells, mononuclear cells in dermis, vascular smooth muscle cells and chondrocytes (Figure2).
Results
Calves were classified as PI if they remained positive by 3 separate weeks double ACE or RT-
PCR. Accordingly, RT-PCR confirmed 13 PI but ACE detected 6 cases, 46.15% (6/13) and IHC 10
cases, 76.92% (10/13), correctly. According to RT-PCR, specificity of ACE and IHC was determined
100% and 84.21% respectively. Kappa value between IHC- RT-PCR and ACE- RT-PCR determined
0.61 and 0.493 respectively (table).
Figure 1) Gel electrophoretic analysis of PCR products using a specific primer for pestiviruses. Lane 1 posi-
tive control, lane 2-7: positive samples with 288bp band, lane 8: negative control and M: 100bp marker.
Table) Comparison of results of Immunofluorescent and ACE with Rt-PCR
Non PI and true negative
Positive predictive value

Non PI but false positive
PI but false negative
Negative predictive
PI and true positive
Sensitivity %
Specificity %
Kappa value
detected
detected
P Value
value
SE□
Tests
IF‫٭‬ 10 3 3 16 76.92 84.21 76.92 84.21 0.61 0.145 0.001

ACE♣ 6 7 0 19 46.15 100 100 70.83 0.493 0.144 0.001
‫(٭‬IF) Immunofluorescent ,♣ Antigen-Capture ELISA (ACE) , □Standard Error
Figure 2) Positive IHC staining for BVDV. Green fluorescent evidence within the cytoplasm of keratinocytes
(A1, A2, B3), sebaceous epithelial cells (C5, D6), mononuclear cells of dermis (C4), chondrocytes (D7).
Conclusions
Surprisingly, the lowest sensitivity was obtained with ACE, which resulted in higher numbers of
false negatives. Several factors could account for this; occasionally, PI valves can produce neutralizing
antibodies which will reduce viruses to the undetectable levels by ACE, but Rt-PCR will not affect
(3). Rt-PCR can detect trace amounts of viruses in blood of transient infected animals (8) and finally
it is likely, our positive cases were not being enough for evaluation of used kit efficacy.
IHC technique has been described for detection of acute (1, 5, 17, 21) or persistent infection
(4, 10, 11, 13, 16) with the various performance. Results of IF and Rt-PCR of 6 calves were in
disagreement. In 3 calves, IF were positive but Rt-PCR was negative. Because viral antigen may
be detectable in tissues for an extended time after the virus has been cleared from the blood (4, 17),
it is likely, these calves had undergone an acute infection prior and that residual viral antigen was
still detectable in their tissues. Three PI calves which were detected by Rt-PCR were not positive by
IF. It is likely, the viral antigens of these PI calves were undetectable by used labelled monoclonal
antibody (the used monoclonal antibody is directed against the NS3 protein) or may be undetectable
as a cause of long lasting formalinization (2) or lack of sufficient viral antigens in the examined skin
sections (1, 11).
IF staining is inherently subjective in interpretation, even in the hands of experienced
diagnosticians (5). This is compounded by the relatively poor definition of cells and tissues afforded
by poorly prepared tissue sections. In addition, the immunohistochemical staining procedure uses
proteolytic enzymes that may allow the recognition of viral antigens that are masked as a result
of autolysis and therefore not detectable using the routine FA testing method (5). Use of different
monoclonal antibodies may have accounted for some of the disparity in results between the FA and
Rt-PCR and even other IHC studies.
The results represent, IF is more effective method for detection of PI calves than ACE. Ear notch
is an easy, accurate and less expensive ante mortem diagnostic test for detecting PI calves. But the
results confirmed that using double ACE and confirming its doubtful results by Rt-PCR is better than
using IHC and Rt-PCR for screening of PI calves.
According to this study, the sensitivity of IF is greater than ACE for detection of PI animals
(76.92% versus 41.15%). Kappa value between Rt-PCR and IF is 0.61 which represent a good
agreement (P value=0.001) (9). IF could be used as a screening test but false negative cases would
be missed because it is a single step test. Despite of simple sampling, transporting, inexpensive and
other advantages mentioned, it is better to use conventional protocol, double ACE with 3 weeks
separation for screening PI animals in herds (7).
References
1. Baszler, TV; Evermann, JF; Kaylor, PS; Byington, TC and Dilbeck, PM (1995). Diagnosis of naturally
occurring bovine viral diarrhea virus infections in ruminants using monoclonal antibody-based
immunohistochemistry.Vet. Pathol. 32, PP: 609-618.
2. Brock, KV (2004). The many faces of bovine viral diarrhea virus. Veterinary Clinics of North America:
Food Animal Practice. Bovine Viral Diarrhea Virus. 20, PP: 115-169.
3. Brock, KV; Grooms, DL; Ridpath, JF and Bolin, SR (1998). Changes in levels of viremia in cattle
persistently infected with bovine viral diarrhea virus. J. Vet. Diagn. Invest.10(1),PP: 22-26
4. Cornish, TE; Olphen, AL; Cavender, JL; Edwards, JM; Jaeger, PT; Vieyra, LL; Woodard, LF; Miller, DF
and O’Toole D (2005).Comparison of ear notch immunohistochemistry, ear notch antigen-capture ELISA,
and buffy coat virus isolation for detection of calves persistently infected with bovine.viral diarrhea virus.
J. Vet. Diagn . Invest. 17, PP: 110–117.
5. Ellis, JA; Martin, K; Norman, GR and Haines, DM (1995). Comparison of detection methods for bovine
viral diarrhea virus in bovine abortions and neonatal death. J Vet Diagn Invest. 7: 433-436.
6. Hemmatzadeh, F; Mommtaz, H; Keyvanfar, H and Bani-hasan, E (2006). Antigenic pattern of BVDV
isolated in IRAN. Indian Veterinary Journal. 82(10), PP: 1048-1050.
7. http://www.oie.int/eng/normes/mmanual/A_00132.htm. (2004): BOVINE VIRAL DIARRHOEA, Manual
of Diagnostic Tests and Vaccines for Terrestrial Animals. CHAPTER 2.10.6.
8. Gogorza LM, Moran PE, Larghi JL, Segue R, Lissarrague C, Saracco M, Braun M, Esteban EM (2005):
Detection of bovine viral diarrhea virus (BVDV) in seroposetive cattle. Preventive veterinary medicine. 72,
49-54.
9. Gordis L (2000): Epidemiology. 2nd edition. WB Saunders Company. 77-79.
10. Grooms, DL and Keilen, ED (2002).Screening of Neonatal Calves for Persistent Infection with Bovine
Viral Diarrhea Virus by Immunohistochemistry on Skin Biopsy Samples. Clin. Diagn. Lab. Immunol. July;
9(4), PP: 898–900.
11. Haines, DM; Clark, EG and Dubovi, EJ (1992). Monoclonal antibody-based immunohistochemical
detection of bovine viral diarrhea virus in formalin-fixed, paraffin-embedded tissues. Vet. Pathol.29, PP:
27-32.
12. Houe, H; Lindberg, A and Moennig, W (2006). Test Strategies in Bovine Viral Diarrhea Virus
Control and Eradication Campaigns in Europe. J. Vet. Diagnos. Invest. 18, PP: 427-436.
13. Luzzago, C; Frigerio, M; Tolari, F; Mazzei, M; Salvadori, C; Del Piero, F and Arispici M (2006). Indirect
immunohistochemistry on skin biopsy for the detection of persistently infected cattle with bovine viral
diarrhoea virus in Italian dairy herds. New Microbiology. 29, PP: 127-131.
14. Moakhar, KR; Akhavizadegan, MA; Hemmatzadeh, F and Amini, F (2004). Genotyping of Different
Pestivirus Isolates by RT-PCR and RLFP technique. Arch. Razi Ins. 58, PP: 1-8.
15. Nettleton, PF and Entrican, G (1995). Ruminant pestiviruses. Br Vet J. 151, PP: 615-642.
16. Njaa, BL; Clark, EG; Janzen, EJ; Ellis, JA and Haines, DM (2000). Diagnosis of persistent bovine viral
diarrhea virus infection by immunohistochemistry staining of formalin-fixed skin biopsies. J. Vet. Diagn.
Investigation. 12,PP: 393-399.
17. Ridpath, JF; Hietala, SK; Sorden, S and Neill, JD (2002). Evaluation of the reverse transcription-
polymerase chain reaction/probe test of serum samples and immunohistochemistry of skin
sections for detection of acute bovine viral diarrhea infections. Journal of Veterinary Diagn
Investigation. 14 (4), PP: 303-307.
18. Sagar, MG and Ridpath, JF (2005): Bovine Viral Diarrhea Virus: Diagnosis, Management and Control.
Blackwell Science Ltd. London, UK. PP: 123-124.
19. Saliki, JT and DuBois, WR (2004). Laboratory diagnosis of bovine viral diarrhea virus infections. Veterinary
Clinics of North America: Food Animal Practice. Bovine Viral Diarrhea Virus. 20, PP: 69-83.
20. Sandvik, T (2005). Selection and use of laboratory diagnostic assays in BVD control programs. Preventive
Vet. Med. 72, 1-2, 3-16.
21. Thur, B; Zlinszky, K and Ehrensperger, F (1996). Immunohistochemical detection of bovine viral diarrhea
virus in skin biopsies: a reliable and fast diagnostic tool. J. Vet.med. B 43, PP: 163-166.
22. Vilcek, S; Herring, AJ; Nettlton, PF; Lowings, JP and Paton, DJ (1994). Pestiviruses isolated from pigs,
cattle and sheep can be allocated into at least three genogroups using polymerase chain reaction and
restriction endonuclease analysis. Arch. Virol. 136, PP: 309-323.
Investigation of Bovine Herpesvirus-1 (BHV-1) Infection in
Relation to Fertility in Repeat Breeder Cows
Istraživanje infekcije goveđim herpes-virusom-1 u

odnosu na plodnost krava koje se preganjuju
Ayhan ATA1, Mesih KOCAMÜFTÜOĞLU 2, Sibel HASIRCIOĞLU 3, *, Mehmet KALE 3

1
Dept. of Theriogenology and Artificial Inseminatiom, Faculty of Veterinary Medecine, Mehmet Akif Ersoy
University, 15100, Burdur, TURKEY. 2 Dept. of Gynecology and Reproduction, Faculty of Veterinary
Medecine, Mehmet Akif Ersoy University, 15100, Burdur, TURKEY. 3 Dept. of Virology, Faculty of Veterinary
Medecine, Mehmet Akif Ersoy University, 15100, Burdur, TURKEY. * Represent author:sibel_has04@hotmail.
com
ABSTRACT
The aim of this study was to determine the seroprevalence of BHV-1 and investigate the relation between
BHV-1 infection and fertility in repeat breeder ( RB ) cows in Burdur province, Turkey. For this purpose,
serum samples were collected from 108 RB cows and tested by enzyme linked immunosorbent assay (ELISA)
for antibodies against BHV-1. Seroprevalence was 9.25% (10/108) in these animals. Although no significant
difference was detected between ages of seropositive and seronegative RB cows, the difference between
seropositive and seronegative RB cows for open days (OD) was statistically significant (P<0.01). The difference
for conception rate (CR) between these groups was statistically found insignificant (P=0.37). The difference
between ages of seropositive and seronegative pregnant RB cows was found significant (P<0.001) whereas OD
of these pregnant RB cows was not statistically different (P> 0.05). Also, the difference between non-pregnant
seropositive and seronegative RB cows for calving to fourth insemination date interval (CFIDI) was statistically
significant whereas the difference between ages of these non-pregnant animals was statistically insignificant.
In conclusion, the results of this study showed that there was a close relation between BHV-1 infections and
fertility in RB cows and seropositivity for BHV-1 in these animals affected the fertility of herds negatively.
Keywords: Dairy cattle, BHV-1, repeat breeder, fertility, ELISA
Sažetak:
Cilj ove studije je utvrditi serološku nadmoć BHV-1 virusa i istražiti odnos infekcije BHV-1 i plodnosti
mliječnih krava u provinciji burdar u Turskoj. Stoga su prikupljeni uzorci 108 krava s preganjanjem i testirani
ELISA testom za titar antitijela protiv BHV-1. Serološka nadmoć ( seroprevalencija je utvrđena u devet.25%
(10/108 ispitivanih životinja. Iako nije uočena signifikantna razlika između životne dobi seropozitivnih
i seronegativnih krava, razlika u broju dana seropozitivnih i seronegativnih je bila statistički signifikantna
(p<0.05 , P=0.02 S druge stran erazlika postotka koncepcije (CR između ovih dviju skupina nije bila statistički
signifikantna ( P=0.36. Zaključili smo da su rezultati ove studije pokazali da postoji bliska povezanost u infekciji
BHV-1 s neplodnošću mliječnih krava koje se preganjaju. Također je očito da seropozitivnost na BHV-1 utječe
negativno na plodnost čitavog stada.
Ključne riječi: Mliječna goveda, preganjanje, plodnost, ELISA
INTRODUCTION
The bovine herpesvirus–1 is a member of the genus Varicellovirus within the subfamily
Alphaherpesvirinae, which belongs to the family Herpesviridae (Murphy et al. 1999). This virus
causes respiratory disease- Infectious bovine rhinotracheitis (IBR) -in cattle, genital diseases-
infectious pustular vulvovaginitis (IPV) in females or infectious pustular balanoposthitis (IPB) in
males- and other clinical syndroms such as conjunctivitis, metritis, mastitis, encephalitis, abortion,
enteritis, loss in milk production and generalized systemic infections. Many infections run with a
subclinical course (Straub 1990).
BHV–1, like other alphaherpesviruses, can set up a latent infection in neurons of sensory ganglia
(Ackermann and Wyler 1984). Due to stressful conditions or corticosteroid treatment latent BHV–
1 can be reactivated and re-excreted at irregular intervals. Therefore, cattle latently infected with
BHV–1 can also be a source of infection (Pastoret et al. 1984).
IBR/IPV infections cause substantial economic losses such as weight loss, decrease in milk
production, abortion, neonatal and embryonic death, stillbirth and fertility disorders such as
endometritis and repeat breeder (Hage et al 1998, Miller 1991). The most important reproductive
disorders that the genital form of disease cause in infected cows are necrotising endometritis and
necrotising oophoritis. Also, these disorders can lead to the problems of repeat breeder and infertility
in infected cows (Kendrick and McEntree 1987).
In many study done, infertility problems have been associated with BHV–1 infections (Elezhary
et al. 1980, Miller 1991). Miller (1991) reported that the use of semen contaminated with IBR
virus for natural/artificial insemination probably would cause temporary infertility, lasting one to
two weeks.
The aim of this study was to determine the seroprevalence of BHV–1 and investigate the relation
between BHV–1 infection and fertility in RB cows in Burdur province, Turkey.

Farm: The study period started on March 10, 2006 and ended on April 25, 2007. The samples of
this study comprised 108 Holstein-Fresian RB cows (aged 2 to 10 yrs for cows ) kept at 30 different
dairy farms in Burdur, southwest Turkey. The main cattle-rearing activity is mixed (crop-livestock),
small-scale (2–10 cattle) dairy production. Cattle are primarily kept for milk production. Average
annual milk production on these farms was 6,000 L per cow. All animals on each farm were housed
in the same free stall barn with intensive contact between animals. Data were collected at individual
cattle and farm levels.
Animals: RB cow reproductive status was determined by palpation and condition of the fetus
was recorded. All the dairy cows in this study were examined vaginally, and were healthy and free
of anatomical abnormalities of the reproductive tract. To exclude the possible effects of reproduction
problems related to nutrition deficiency RB cows with body condition lower than 2.5 score were
not included in this study. Body condition scores were allocated on a scale of 0–5 (in increments of
0.25), with a score of 0 representing extremely thin or emaciated cows and 5 representing extremely
fat or obese cows (Domecq et al. 1997, Loeffler et al. 1999). During the study none of the RB cows
exhibited any overt clinical signs of BHV–1 or any other disease. None of the animals had ever been
vaccinated against BHV–1.
Data collection and artificial insemination (AI): Interviews were performed in order to gather
information about the farms. Information regarding the herd and each animal sampled were recorded
through a personal interview with the farmer or farm manager. AI dates, presence of pregnancy
following 6–8 weeks insemination by rectal palpation records were recorded by the inseminator.
All inseminations were performed by the same experienced veterinarian using BHV–1 free frozen-
thawed semen containing at least ten million of motile spermatozoa (Consorzio Semenzoo-Italy Via
Masaccio, 11- 42010 Mancasale, Italy) of proven fertility from a single bull (VANZETTI VALENT
RAUL ET). Fourth insemination was carried out on the day of spontaneous estrus. The stage of the
estrus cycle was determined by rectal palpation and observation of the secondary signs of estrus. The
insemination coincided with mid-estrus, as evidenced by cervical mucous discharge (CMD) and high
myometrial tone and contractility. The semen was placed into the corpus uteri. They were subjected
to AI according to the routine a.m.-p.m. scheme and used for fertility assessment. Breeding day (day
0) equals the day of onset of strong estrus signs. Calving dates were obtained from the farmer’s
records.
Pregnancy control and calculations of conception rate: Eight weeks postinsemination, rectal
examinations to determine pregnancy were carried out. When an insemination led to a positive
pregnancy check, it was defined as successful. If the outcome of an insemination was not known (e.g.
due to slaughter before pregnancy diagnosis) this observation was omitted from the calculations. If two
inseminations had occurred less than 10 days apart, they were recorded as only one insemination. CR
was calculated as the percentage of inseminations resulting in pregnancy lasting at least 8 weeks.
Serology: Blood samples (10 ml) were collected from the tail vein of each RB cow at estrus period
before fourth AI, using disposable needles (21x1.5 mm) and vacutainer tubes. After centrifugation
at 1700 g for 15 min, separated sera were stored at -20°C until analysis. BHV–1 antibodies were
determined by using a commercial available ELISA kit (Institute Pourquire IBR-ELISA). ELISA
was performed according to procedure described by the manufacturer. Test results were expressed as
positive and negative.
Statistics analyses: The mean values and standard errors of means were calculated for both
BHV–1 serologically-positive and BHV–1 serologically-negative groups. The data were determined
by Chi-square test and student’s t-test, and values of P<0.05 were regarded as significant (SPSS
software, version 11.0).
RESULTS
BHV–1 seroprevalence was 9.25% (10/108) in RB cows in Burdur province. Conception rate
was higher in BHV–1 serologically negative cows (58.62%) than BHV–1 serologically positive RB
cows (50.00%) but was not statistically significant (P>0.05). Average for OD (open days) of BHV–1
serologically-positive RB cows (344.00 ± 35.11d) were different from those of BHV–1 serologically
negative cows (184.37 ± 5.96d) and was statistically significant (P<0.01). The difference for CFIDI
between seropositive and seronegative non-pregnant RB cows was found significant (P<0.01). OD
of seropositive and seronegative pregnant RB cows was not statistically different (P=0.114). Also, no
significant difference was detected between ages of seropositive and seronegative RB cows. But, this
difference between seropositive and seronegative pregnant RB cows was found significant (P<0.001).
The difference between ages of seropositive and seronegative non-pregnant animals was statistically
insignificant (P=0.091). Reproductive parameters of BHV–1 seropositive and seronegative RB cows
are presented in Table 1. and 2.
Table 1. Reproductive parameters of RB cows with BHV-1 (seropositive) and BHV-1 (seronegative)
BHV-1 (seropositive) BHV-1 (seronegative)

Parameters n=10 n=98 P<
COWS
ODa 344.00 ± 35.11 184.37± 5.96 P=0.001**
Age (day) 2448.00 ± 316.58 1738.78 ± 58.57 P=0.053 NS
CRb 50.0 58.62 P=0.37 NS
a
Open days (day), b Conception rate (%), NS= not significant, **P<0.01, Values are mean ± SE.
Table 2. Reproductive parameters of pregnant and non-pregnant RB cows with BHV-1 (seropositive) and BHV-1
(seronegative)

Parameters n=4 n=54 P<
PREGNANT COWS
ODa 319.25± 60.00 187.03 ± 8.61 P=0.114 NS
Age (day) 1800.00±0.00 1586.67± 55.91 P=0.000***
Parameters P<
n=6 n=44
NON-PREGNANT COWS
CFIDIb 373.28 ± 40.97 182.14 ± 9.00 P=0.003**
Age (day) 2880.00 ± 455.37 1925.45 ± 105.05 P=0.091 NS
a
Open days (day), b Calving to fourth insemination date interval (CFIDI), NS*= not significant, **P<0.01,
***P<0.001 Values are mean ± SE.
DISCUSSION
IBR/IPV is a important disease treating genital tract and causing the problems of infertility in cows as
a result of this. Consequently, it cause substantial production and economic losses in livestock/dairy
cattle industry.
Up to now, several studies have been done to detect the relationship between IBR infections and
infertility problems of cows (especially RB cows) in Turkey and the world.
Çabalar and Akça (1994) collected 624 serum samples from cows with infertility problems (repeat
breeder, metritis, abortion) and tested for the presence of IBR/IPV antibodies by microneutralization
assay. They found to be 425 (68.10%) of 624 serum samples for IBR/IPV virus neutralizing antibodies.
They suggested that IBR virus may be an etiological agent in infertility problems of cows since high
incidence against IBR/IPV virus had been detected at herds.
Özkul et al. (1995) collected 538 serum samples from cows with infertility problems (repeat
breeder, abortion, metritis ) which were housed in 19 closed dairy herds and tested by serum
neutralisation (SN) for the presence of neutralizing antibodies against IBR/IPV virus. They found to
be seropositive 113 (21%) of 528 serum samples tested for IBR/IPV virus. They reported that IBR/
IPV virus might cause infertility in cows produced in closed dairy herds.
Bulut et al. (2003) collected serum samples from 120 RB cows and 85 healthy cows to investigate
frequency of BHV–1 infections in RB cows and tested by ELISA. They found that 85 (70.8%) of
120 RB cows and 59 (73.7%) of 85 healthy cows were seropositive for BHV–1. According to the
result of investigation, they concluded that there was no significant relation between seropositivity of
BHV–1 and repeat breeder statistically (P>0.05).
Biuk-Rudan et al. (1999) investigated the prevalance of antibodies to IBR and BVD viruses in
dairy cows (mostly RB cows) with reproductive disorders in four different farms. For this purpose,
they collected serum samples from 73 cows with reproductive disorders and 47 cows without
reproductive disorders and examined for IBR and BVD viruses by SN. They found that seroprevalance
of IBR was 8.2% (6/73) in cows with reproductive disroders where as seroprevalance of IBR was
14.9 (7/47) in cows without reproductive disroders. In tested all cows, they found that seroprevalance
of IBR was 85.8. Also, they found that 80.8% of cows with reproductive disorders and 46.8% cows
without reproductive disorders had antibodies to both IBR virus and BVD virus. They reported
that differences in antibody prevalance among groups with/without reproductive disorders was
statistically significant (P<0.01) and suggested to be a connection between reproductive disorders
and simultaneous infections with IBR and BVD viruses in dairy cows.
In this study, it was determined the seroprevalenceof BHV–1 and investigate the relation between
BHV–1 infection and fertility in RB cows. The seroprevalence of BHV-1 in RB cows was detected as
9.25% (10/108). Although this rate detected was found in agreement with the rate detected by Biuk-
Rudan et al. (1999), it was found lower than ones by reported Çabalar and Akça (1994), Özkul et al.
(1995) and Bulut et al. (2003). That is why sensivity of tests used as well as many factors such as the
structure and size of herd sampled, individual and regional differences.
Magana-Urbina et al. (2005) investigated the risk factors affecting serological prevalence such
as age, flooring type, origin of replacement heifers (same location, different location), herd size,
abortion history. They reported that the highest risk of IBR positive serology was found in animals
>4 years, in herds with >10 cows and in herds which replacement heifers come from other locations.
However, they explored that IBR serological prevalence increased as animal age increased. In the
current study, it was not in agreement with the results of Magana-Urbina et al. (2005) since factor
of age among seropositive and seronegative cows was statically insignificant (P=0.053). But, all
seropositive cows were aged 4 years and older as reported by Magana-Urbina (2005). In this study,
the other reason of low seroprevalence of IBR virus can be related to be chosen from small herds
(from herds with <10 cows) with low population densities and not to be entered animals from other
herds.
According to restriction endonuclease analysis (REA), BHV-1 has been reported to be three
different subtypes (1, 2 and 3). Types 2 are divided into subtypes 2a and 2b. BHV-1 subtypes 1 and 2a
are the main causes of the respiratory form of the disease and abortion. Sub-type 2b is responsible for
the venereal form of disease (IPV and IPB). Common serological tests do not discriminate between
the different BHV-1 subtypes. The BHV-1 detected are described as IBRV’s (Buik-Rudan et al. 1999,
Hage et al. 1998, Miller et al. 1991). Since BHV-1 causes infections in both respiratory and genital
system, the presence of antibody detected in this study might not be originated from an infection only
in genital system.
Miller et al. (1988) and Chiang et al. (1990) have described a decrease in the CR of initially
seronegative animals after experimental BHV-1 infection. Elazhary et al. (1980) reported that the
reason of the low CR and the high number of services per pregnancy in a herd having abortion
and infertility problems could be due to the virus infection of the embryo resulting in its death and
absorption in the early stage of pregnancy. But, Hage et al. (1998) reported that it is doubtful that
early pregnancies are terminated by BHV-1 infection although they detected a significant decrease in
the number of successful insemination in seronegative and seropositive dairy cows in a study which
they carried out.
Allan et al. (1975) reported that BHV-1 infection was no effects on pregnancy. In a study carried
out by Ata et al. (2006) in Burdur province, it was reported that the difference for CR among these
groups was statistically insignificant although CR was higher in BHV-1 serologically negative cows
than BHV-1 positive cows. Our result was in agreement with with the results reported by Ata et al.
(2006) in this study, a difference for CR between seropositive and seronegative animals was not
found statistically. It was concluded that BHV-1 seropositivity did not affect CR of RB cows.
In a study carried out by Ata et al. (2006), it was reported that there was a difference for open days
(OD) between seropositive and seronegative cows and BHV-1 serologically positive cows required
a longer time to conceive. But, in a study done by Magana-Urbina et al. (2005) in Mexico, it was
found no difference for OD between seropositive and seronegative cows. Our results agreed with the
results of Ata et al. (2006), concerning the OD. It has reported that Holstein cow is profitable if she
has a calving interval of 12 to 13.5 months, if milk yield exceeds 13.500 kg milk per lactation and the
ideal number of OD is 90. Among animals examined herein, the numbers of OD in seropositive and
seronegative cows were too long than this time stated (Jainudeen and Hafez 2000).
In conclusion, the results of this study showed that there was a close relation between BHV-1
infections and fertility in RB cows and seropositivity for BHV-1 in these animals affected the fertility
of herds negatively. Especially, in this study, since OD period is found long (P<0.01) in seropositive
RB cows, we consider that BHV-1 infections cause substantial economic losses by prolonged the
calving interval.
REFERENCES
Ackermann M, Wyler R, 1984, The DNA of an IPV stain of bovid herpesvirus-1 in sacral ganglia during latency
after intravaginal infection, Vet Microbiol, 9, 53-63.
Allan PJ, Dennett DP, Johnson RH, 1975, Studies on the effects of infectious bovine rhinotracheitis virus on
reproduction in heifers, Aust Vet J, 51, 370-3.
Ata A, Kale M, Yavru S, Bulut O, Buyukyoruk U, 2006, The Effect of subclınıcal bovıne herpesvırus 1 infectıon
on fertılıty of cows and heıfers, Acta veterinaria,56, 267-273
Biuk-Rudan N, Cvetníc S, Madic J, Rudan D, 1999, Prevalence of antibodies to IBR and BVD viruses in dairy
cows with reproductive disorders, Theriogenology, 51, 875-81.
Bulut H, Rısvanlı A, Tonbak S, Gulactı I, Azkur K, Bolat Y, 2003, Dol tutmayan ineklerde bovine virus 1
infeksiyonlarının sıklıgı, F U Saglık Bil Derg, 17, 23-6.
Chiang BC, Smith PC, Nusbaum KE, Stringfellow DA, 1990, The effect of infectious bovine rhinotracheitis
vaccine on reproductive efficiency in cattle vaccinated during oestrus, Theriogenology, 33, 1113–1120.
Çabalar M, Akça Y, 1994, Fertilite problemli ineklerde enfeksiyöz bovine rhinotracheitis/ enfeksiyöz pustular
vulvovaginitis (IBR/IPV) virus izolasyonu ve seropidemiyolojisi. Ankara Üniv Vet Fak Derg, 41 (3–4),
337–349.
Domecq JJ, Skidmore AL, Lloyd JW, Kaneene JB, 1997, Relationship between body condition scores and
conception of first artificial insemination in a large dairy herd of high yielding Holstein cows, J Dairy Sci,
80, 113-20.
Elazhary MASY, Lamothe P, Silim A, Roy RS, 1980, Bovine herpes virus type 1 in the sperm of a bull from a
herd with fertility problems. Can Vet J, 21, 336–339.
Hage JJ, Schukken YH, Dijkstra TH, Barkema HW, Van Valkengoed PHR, Wentink GH, 1998, Milk production
and reproduction during a subclinical bovine herpesvirus 1 infection on a dairy farm, Prev Vet Med, 34,
97–106.
Jainudeen MR, Hafez ESE, 2000, Cattle and buffalo, In: Hafez ESE, Hafez B, editors, Reproduction in Farm
Animals, 7th edition, Lippincott Williams & Wilkins. Maryland, USA, 159-71.
Kendrick JW, McEntree K, 1987, The effect of artificial insemination with semen contaminated with IBR/IPV
virus. Cornell Vet, 57, 3-11.
Loeffler SH, de Vries MJ, Schukken YH, de Zeeuw AC, Dijkhuizen AA, de Graaf FM, Brand A,, 1999, Use of
technician scores for body condition, uterine tone and uterine discharge in a model with disease and milk
production parameters to predict pregnancy risk at first AI in Holstein dairy cows. Theriogenology, 51,
1267–1284.
Magana-Urbina A, Rivera JLS, Segura-Correa JC, 2005, Infectious bovine rhinotracheitis in dairy herds in the
Cotzio-Tejaro region of Michoacan, Mexico, Tec Pecu Mex, 43, 27-37.
Miller JM, Van der Maaten MJ, Whetstone CA, 1988, Effects of a bovine herpesvirus 1 isolate on reproductive
function in heifers: classification as a type-2 infectious pustular vulvovaginitis virus by restriction
endonuclease analysis of viral DNA, Am J Vet Res, 49, 1653–56.
Miller JM, 1991, The effects of IBR virus infection on reproductive function of cattle, Vet Med, 95-98.
Murphy FA, Gibbs EPJ, Horzinek MC, Studdert MJ, (1999), Herpesviridae, Vet Virol, Third Edition, Chapter
18, 301-311.
Özkul A, Çabalar M, Bilge S, Akça Y, Burgu İ, 1995, Süt sığırcılığı işletmelerinde rastlanan IBR ve BVD virus
enfeksiyonlarının infertilite olgularındaki rolü, Ankara Üniv Vet Fak Derg, 42, 381-387.
Pastoret PP, Thiry E, Brochier B, Derboven G, Vindevogel H, 1984, The role of latency in the epizootology
of infectious Bovine Rhinotracheitis. In: Witteman, G., Gaskell, R.M., Rziha, H.J. (Eds.), Latent Herpes
Virus Infections in Veterinary Medicine. Nijhoff Martinus, Dordrecht, 211-227.
Straub OC, 1990, Infectious bovine rhinotracheitis virus, Virus Infections of Ruminants, Edited by Z Dinter and
Morein B, Chapter 11, 71-109.
PrPsc ANALISYS IN SICILIAN SCRAPIE OUTBREAKS
Analiza PrPsc kod pojave svrbeža u ovaca na siciliji
Tiziana Lupo, Daniele Macrì, Vitale Maria, Antonella Migliazzo, Stefano Reale,
Fabrizio Vitale
Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri” – Palermo, Italy
AIM OF THE STUDY

The analysis with rapid test for the presence of prion protein revealed positive animals in more
then 35 outbreaks in Sicily. The initial outbreaks had been managed by stamping out the entire flocks
but lately the genetic analysis on prion gene had been performed to eliminate only the animals with
genotypes sensitive to the TSE. Moreover a genetic selection plan has also started in Sicily involving
autochthon breed since 2 years. The identification and genetic selection of resistant animals will be
useful to the sanitary qualification of the flocks targeted to important implications of commercial
nature and represents the new sanitary management of the ovine TSE within the Europe. The genetic
selection is based on molecular tests revealing some polymorphic sites in the PrP gene targeting the
susceptibility or the resistance status. The aim of this work is the increasing of the frequency for the
genetic resistance in the ovine population. It could be useful for the eradication of the TSE ovine and
to the selection of flocks with “low risk level” for the safeguard of human and animal health. The
Decision (EC) 2003/100 of the European Commission starts the realization in the Member States, of
regional plans of genetic selection in ovine and the guidelines concerning the sanitary monitoring of
the breeding and the genetic test for the selection of the subjects with resistant genotype.
BACKGROUND
Transmissible Spongiform Encephalopathy are natural degenerative neural disorders present
in human but also in several other animal species and in ruminant. The disorders have long time
period incubations and so only aged animals can manifest symptoms since the etiological agent is
represented by a different structure of a protein (Prion protein) naturally present in many different
tissues. The protein is specie-specific and passage from one animal specie to other one is a very rare
event in experimental conditions. But The prion strain of the Bovine Spongiform Encephalopathy
(BSE) showed to be particularly virulent and passed from cows to man as showed by the appearance
of the new variant of Creuzfeldt Jacobs. The Scrapie is a tissue disorder of sheep and goat analogous
to the BSE for the neural aspects but it doesn’t seem to be transferable to the man. The illness takes
the name from an intense itch that induces animals to rub against any surface. In Italy eradication
planning has included the scrapie in the list of the impeachable infectious illnesses from 1991 and
the first case was officially notified in 1995. The causative agent of Scrapie is a protein called PrP;
the illness is influenced by the charge of the PrP and the susceptibility of the individual. In sheep
the susceptibility is linked to the genetic profiles at the PrP gene of the single ovine subjects as
confirmed by experimental infections studies first and the analysis of data coming from the active
surveillance on TSE, lately. The aminoacids at positions 136, 154 and 171 of sheep prion protein
are particularly important and the genotype ARR/ARR is the more resistant to TSE disease. For this
reason the European Community decided a plan for genetic selection for TSE resistance on ovine
flocks in Europe.
In Sicily samples collections for molecular screening have been carried out in the IZS laboratories
in collaboration with Veterinary Organizations competent in the countryside.
The used method is based on the DNA extraction from whole blood with EDTA. DNA was
extracted from the blood samples by Gene Elute mammalian kit ( Sigma cat N° G1N- 350) following
manufacture’s instructions. The DNAs, after electrophoresis on agarose gel, were amplified by three
different primer sets targeted to the polymorphic sites. The amplicons were employed in reverse
hybridization tests using special strips exposing specific biotinylated labelled probes homologue
to allelic discriminants. Moreover A Real time test based on allelic discrimination, was applied on
the dubious cases too, to confirm the previous results. This method permitted us to distinguish the
homoziogote or heterozygote status by comparison of detected fluorescence signal.
RESULTS AND CONCLUSIONS

The tests were performed in Molecular Biology Department of the IZS Institute in Palermo. 3400
animals were tested during a period from 2005 to 2007.
The general percentages of PrP genotypes are described in Figure 1
Figure 1. Percentage of Scrapie genotype in general populations
The results in the general population showed that the resistance genotypes ARR/ARR is present
at 19,7% and the heterozygous ARR/ARQ is present at 41,8%. These percentages are quite high and
so it is possible that genetic selection can be reached in a short time.
New genetic analysis was finalized to the individuation of resistant animal subjects as reproducers
and in different Sicilian autochthon breeds: Comisana, Valle del Belice and Pinziritta
Analysis on individuals of specific autochthon breeds showed differential percentages but still
quite high presence of the “good genotypes” as shown in figure 2
It is noteworthy that highest percentages for resistant genotypes (class 1 ARR/ARR) are present
in Comisana and Pinzeritta breeds while in Valle del Belice that derived by a cross with Sarda sheep
also, is reduced to 11%
The project will allow to realize in brief times the genetic selection for the resistance to the
scrapie
Figure 2: Distribution of relative genotypes in individuals of pure breeds present in Sicilian territory.
REFERENCES
1) Bossers A, Schreuder BEC, Smits MA (1996) PrP genotype contributes to determinino survival times of
sheep with natural scapie J.Gen. Virol 77: 2669-2673.
2) Hunter N (1997) PrP genetics in sheep and the implications for scrapie and BSE. Trends Microbiol 5: 331-
334
3) Vaccari G., Petraroli R., Agimi U., Eleni C., Perfetti M.G., Perfetti M.A., Di Bari M.A., Morelli L., Ligios
C., Busani L., Nonno R. and Di Guardo G.. 2001: PrP Genotype in Sarda breed sheep and its relevance to
scrapie. Arch Virol. 146: 2029-2037
ACKNOWLEDGEMENTS: The authors wish to thank Dr. Alberti Placido and Mr. Giangrosso Ezio for
technical assistant.
SEROLOGICAL, VIROLOGICAL AND HAEMATOLOGICAL
EXAMINATION OF CORONAVIRUS INFECTION IN CALVES WITH
DIARRHEA AND THEIR DAMS
Serološka, virusološka i hematološka pretraga na

koronavirusnu infekciju u teladi s proljevom te
njihovih majki
S. YAVRUa,*, O. YAPICIa, M. KALEb, Ş. ŞAHİNDURANc, F. PEHLİVANOĞLUd, M.K.

ALBAYc, O. AVCIa
Selçuk University, Faculty of Veterinary Medecine, Dept. of Virology, 42075, Konya-TURKEY. b Mehmet Akif
a
Ersoy University, Faculty of Veterinary Medecine, Dept. of Virology, 15100, Burdur-TURKEY. c Mehmet Akif
Ersoy University, Faculty of Veterinary Medecine, Dept. of Internal Medecine, 15100, Burdur-TURKEY. d Me-
hmet Akif Ersoy University, Faculty of Veterinary Medecine, Dept. of Microbiology, 15100, Burdur-TURKEY.
*
Corresponding author. E-mail: sibelyavru@gmail.com
ABSTRACT
In this study, following clinical examination of 3500 cattle and their calves from 25 number of dairy farms.
184 calves (<1 - ≤6 months age, a twin calf) with diarrhea and their dams (183) (≥2 - ≤6 age) were sampled for
coronavirus presence by ELISA (investigated for antigen in faecal samples and antibody in blood serum samples
of calves and only antibody presence in blood samples of their dams). Additionally, all blood samples were
examined by hematological methods. One hundred seventy two (%93.99) cows and 172 (%93.99) calves were
found seropositive. While the high level of antibodies for coronaviruses were detected as 36.05 % in dams 6
years and older ages, the lower level of antibodies were detected in ages between ≥2 - <3 and ≥5 - <6. In the
calves, Ab to coronavirus were found at the highest level (25.26%) in the female calves ≥5 - ≤6 months age but
the lowest level (11.69%) antibody was found in the male calves ≥2 - <4 months of ages. Coronavirus (Ag) was
detected in only faecal sample of a (%0.54) calf. hen the haematological parameters were compared between Ab
(+) and Ab (-) dams, only White Blood Cell (WBC) values were found statistically significant (p<0.05). When
the haematological parameters were compared between Ab (+) and Ab (-) calves, WBC (p<0.05), Lymphocyte
(p<0.01) and Granulocyte (p<0.01) values were found statistically important. When haematological parameters
were compared between each positivity degrees of coronavirus Ab (+) dams and Ab (+) calves no statistical
difference were detected. When the haematological parameters were compared between coronavirus Ab (+)/Ag
(+) and Ab (-)/Ag (-) calves, both lymphocyte and granulocyte values were statistically important (p< 0.01).
Acoording to haematological parameters, Ab (+) calves had lymphocytosis when compared to Ab (-) calves.
Sažetak
U ovom pokusu praćeno je 3500 krava i njihova telad s 25 mliječnih farmi. 184 teleta (<1 - ≤6 mjeseci starosti,
blizanci) s proljevom te njihove majke (183) (≥2 - ≤6 ??? starosti) uključeno je u pretragu na koronaviruse ELISA
metodom (dokazivanje antigena u uzorku fecesa i antitijela u uzorcima krvnog seruma teladi te dokazivanje samo
prisutnosti antitijela u organizmu njihovih majki). Dodatno, na svim uzorcima krvi sprovedena je hematološka
pretraga krvi. Sto i sedamdeset i dvije (%93.99) krave i 172 (%93.99) teleta uključenih u ovu pretragu su
bili seropozitivni. Dok je visoka razina antitijela za koronaviruse otkriven u 36,05 % krava starih 6 godina i
starijih, niža razina antitijela je otkrivena u krava starih između ≥2 - <3 i ≥5 - <6 godina. U teladi, antitijela za
koronaviruse pronađena su u najvećem postotku (25,26 %) u ženske teladi starosti 5 – 6 mjeseci, dok je najniža
razina antitijela (11,69 %) pronađena u muške teladi starosti 2 – 4 mjeseca. Koronavirus (antigen) je otkriven
samo u uzorku fecesa u 0,54 % teladi. Kada su parametri hematološke pretrage uspoređeni između Ab(+) i Ab(-)
teladi, samo su vrijednosti bijelih krvnih stanica (WBC) bili statistički signifikantni (p<0.05). Kada su parametri
hematološke pretrage uspoređeni između Ab(+) i Ab(-) teladi, vrijednosti bijelih krvnih stanica (WBC), limfocita
(p<0.01) i granulocita (p<0.01) su bili statistički značajni. Kada su parametri hematološke pretrage uspoređeni
između koronavirusa Ab(+)/Ag(+) i Ab(-)/Ag(-) u teladi, vrijednosti i limfocita i granulocita su bili statistički
značajni (p< 0.01).
Ključne riječi : Koronavirus, proljev, serološka pretraga, virusološka pretraga, hematološka pretraga, mliječna
goveda.
INTRODUCTION
Coronaviruses, described the first time with EM in 1968 (Mostl, 1990), are in Nidovirales
(Van Regenmortel et al., 2000) order Coronaviridae family (Park et al., 2006, Park et al., 2007a).
Coronaviruses posses the largest genome among RNA viruses and linear, nonsegmented, single
stranded, positively polaritated (De Viries et al., 1997, Kapil et al., 1999). Virions have had 5 major
proteins, nucleokapsid (N) protein, peplomer (S), transmembrane (M) and small transmembrane (E)
glycoprotein, and hemagglutinin-esterase (HE) (Lai and Cavanagh, 1997, Chouljenko et al., 1998).
Coronaviruses, identified as a diarrhetic agent in calves the first time by Mebus et al. (1972) in
1973 in USA, cause diarrhea in calves (Cho et al., 2000, Bridger et al., 1978), winter dystenteria in
adult cattle (Durham et al., 1989, Benfield and Saif 1990, Saif et al., 1991, Clark, 1993, Fukutomi et
al., 1999, Cho et al., 2000, Park et al., 2007b), and respiratory system infections in various aged cattle
(McNulty et al., 1984, Hasoksuz et al., 2005).
In this study, the presence of Coronaviridae infections in both calves and their dams in private dairy
managements with diarrhea problems. Additionally, the animals were evaluated haematologically.

FECAL SAMPLES- The fecal samples were collected from 184 calves with diarrhea signs
determined with clinical examinations in 25 private cattle managements in Burdur. The fecal samples
were transferred under cold chain in a cooler to the laboratory and kept at -80ºC until tested.
SERUM SAMPLES- The blood samples were collected from 184 calves with diarrhea signs
determined with clinical examinations and their dams in 25 private cattle managements in Burdur.
The blood samples collected in normal sterile vacuum tubes were transferred under cold chain in a
cooler to the laboratory and santrifuged at 2000-3000 rpm for 10 min. for serum separation. Then, the
serum samples were inactivated at 56ºC for 30 min. and kept at -80ºC until tested.
ELISA- Serum samples of both calves and their dams were analyzed for presence of antibody
to coronaviruses by indırect ELISA (Bio-X Diagnostics,Belgium) according to test prosedure. The
fecal samples of calves were thawed and tested for presence of coronavirus antigen by direct ELISA
(Bio-X Diagnostics, Belgium).
HAEMATOLOGICAL PARAMETERS- The blood samples were collected in the sterile tubes
with EDTA from v. jugularıs. For determination of blood parameters, MS9 Cell Counter Equipment
(USA) was used. The samples were tested at the same day.
RESULTS
While the highest amount of antibody to coronavirus was detected in female calves with ≥ 5 - ≤6
months of age, the lowest amount of antibody was detected in male calves ≥2- <4 months of age.
Coronavırus antigen was detected in only one calf fecal sample (0.54%) among 184 fecal samples
by direct ELISA.
Total 172 (93.99 %) calves and 172 (93.99 %) cows were found seropositive to coronaviruses.
While the highest seropositivity (36.05 %) was detected in the dams with 6 years and older ages, the
lowest antibody level (11.05%) was found in the dams ≥2- <3 and ≥ 5-<6 years of ages.
According to haematological outcomes, total leucocyte counts increased in antibody positive
dams and calves (p<0.05). Lymphocyte (%) rate did not change in dams but the rate (%) was higher
in Ab (+) calves than Ab(-) calves (p<0.01). While no change was seen in granulocytes in Ab (+) and
Ab (-) dams, the number of the granulocytes decreased in Ab(+) calves as compared the number of
granulocytes in Ab (-) calves (p<0.01).
When haematological parameters of Ab (+)/Ag (+) and Ab(-)/Ag (-) calves were compared, Ab
(+)/Ag (+) calves had decreased lymphocytes (%) and increased granulocytes (%), Ab (-)/Ag (-)
calves had increased lymphocytes (%) and decreased granulocytes. Between two groups, statistically
important difference was detected (p<0.01).
When haematological parameters were compared between each positivity degrees of coronavırus
Ab (+) dams/Ab (-) dams and Ab (+) calves/ Ab (-) calves no statistical difference were detected.
DISCUSSION Coronavirus infectıon is one of the infections causing important economical

loses in cattle managements (Bridger et al.,1978, Saif 1993).
ELISA used for detection of antibodies to coronaviruses can also be used for detection
of coronavirus antigen (Gaber and Kapil 1999, Hasoksuz et al., 2005, Reynolds et al., 1984,
Schoenthaler and Kapil 1999). Sato and Akashı (1993) have been stated that ELISA can be used
both rutin coronavirus detection in fıeld fecal samples and virus isolation from diarrhetic faeces. The
researchers (Sato and Akashi, 1993) examined 202 fecal samples with ELISA and found 40 fecal
samples positive for coronavirus antigen.
Abraham et al. (1992) stated that the probability of calves to succumb to BCV infection in the
fırst 5 weeks of their life is quite high and especially in the fırst week antigen detection rate was
51.5%. The researchers examined 108 fecal samples from diarrhetic calves by ELISA and found
38.9% of the samples were positive for coronavirus antigen.
Snodgrass et al. (1986) examined 302 fecal samples from diarrhetic calves from 32 farms and 11
samples were found positive for coronavirus antigen.
In Turkey, cattle coronavirus infections was reported the first time by Alkan (1998). The researcher
collected 83 fecal samples from diarrhetic calves (1-30 days of age) in 6 managements and 15 calves
were found positive by ELISA to BCV antigen. Eight of them had coronavırus alone and 7 of them
had bovine rotavirus together with coronavirus.
In this study, 184 calves feces were tested by ELISA and only one fecal samples was found
positive for coronavirus antigen. The reason of low antigenity can be related to maternal antibodies
gained their dam.
In the study, the highest antibody to coronavirus was found in 5 - ≤6 months of age female calves
and the lowest antibody was found in ≥2- <4 months of age male calves.
Alkan et al. (2003) examined 116 fecal samples from adult cattle in 5 dairy mamagements for
coronavirus antigen by ELISA, and 919 blood serum samples from adult cattle in 9 managements
by microneutralısation. The researchers did not detect any positive cattle for coronavirus antigen by
ELISA and but in these managements the seropositivity changed between 4.4 -100%.
In our study, 172 calves and 172 dams were found seropositive. While the highest seropositivity
rate was found in the cattle 6 years and older, the lowest antibody presence was found in ≥2- <3 and ≥
5-<6 years old dams. The reason of high seropositivity in calves can be related to maternal antibodies
gained their dam, but not infection.
Hasoksuz et al. (2005) allocated the diarrhetic cattle in 29 managements in 23 villages to 3 age
groups (0-30 days, 4-12 months, 2-7 years). The fecal samples from these animals were tested by
using 3 different monoclonal antibodies by indirect antigen capture ELISA. At the end of the study,
fecal shedding rates of the virus were found as 37.1% in 0-30 days group, as 25.6% in 4-12 months
group and as 18.2% in 2-7 years group.
Hasırcıoglu (2005) tested the fecal samples from 63 calves and 77 adult cattle by ELISA and
found 3% seropositivity in calves and no seropositivity in adult cattles. Hasırcıoglu (2004) found
25% seropositivity in 36 calves blood sera and 76% seropositivity in 46 dam blood sera.
Important haematological changes does not occur in coronavirus infections. But, if the infection
courses with persistent dystenteria more for more than one day, anemia can develop. In this situation,
blood clots can be seen in feces of the cattle (Murray and Guard 1990). In our study, no fecal clot was
seen in any of the fecal samples collected. Also, anemia was not detected in any animals. However, in
our study, leucocytes (%) in seropositive calves were found higher than leucocyte (%) in seronegative
calves. This increase depends on the increase in lymphocytes (%). From this data, we can conclude
that in Ab (+) calves had lymphocytosis when compared to Ab (-) calves.
Hematological investigations showed that in the conventionally contaminated Trakai district the
levels of erythrocytes, hemoglobin, leukocytes and segmented neutrophiles were decreased, while
those of eosinophil and methemoglobin (2–4% by total hemoglobin) increased in the blood of healthy
bovine and in coronavirus-infected cows (P < 0.05) than those in the conventionally clearer Ukmergë
district (Dringeliene et al., 2004). When haematological values of Ab+/Ag+ and Ab-/ Ag- calves
are compared, in Ab+/Ag+ calves lymphocyte (%) decreased and granulocyte (%) increased. In Ab-
/ Ag- calves, lymphocyte increased and granulocyte decreased. This was also found statistically
important (P<0.01). This results is compatible with the results of the study conducted by Dringeliene
et al. (2004).
REFERENCES
Abraham G, Roeder PL and Zewdu R (1992) Agents associated with neonatal diarrhoea in Ethiopian dairy
calves,Trop Anim Hlth Prod, 24, 74-80.
Alkan F (1998): Buzağı ishalllerinde rotavirus ve coronavirusların rolü Ankara Üniv Vet Fak Derg, 45, 29-37.
Alkan F, Bilge-Dağalp S, Can Şahna K, Özgünlük İ (2003) Sığırlarda coronavirus enfeksiyonunun epidemiyolojisi.
Ankara Üniv Vet Fak Derg, 50, 59-64.
Benfield DA and Saif LJ (1990) Cell culture propagation of a coronavirus isolated from cows with winter
dysentery, J Clin Microbiol, 28, 1454-1457.
Bridger JC, Woode GN and Meyling A (1978) Isolation of coronaviruses from neonatal calf diarrhoea in Great
Brıtain and Denmark,Vet Microbiol, 3, 101-113.
Cho KO, Halbur PG, Bruna JD, Sorden SD, Yoon KJ, Janke BH, Chang KO, Saif LJ (2000) Detection and
isolation of coronavirus from feces of three herds of feedlot cattle during outbreaks of winter dysntery-like
disease. J.Am.Vet.Med.Assoc.217, 1191-1194.
Chouljenko VN, Kousoulas KG, Lin X, Storz J (1998) Nucleotide and predicted amino acid sequences of all
genes encoded by the 3ı genomic portion (9.5 kb) of respiratory bovine coronaviruses and comparisons
among respiratory and enteric coronaviruses. Virus Genes, 17, 33-42.
Clark MA (1993) Bovine Coronavirus. Br Vet J, 149:51-70.
De Vries AAF, Horzinek MC, Rottier PJM, De Groot RJ (1997) The genome organization of the Nidovirales:
Similarities and differences between Arteri-, Toro-, and Coronaviruses. Semin. Virol., 8, 33-47.
Durham PJK, Hasard LE, Armstrong KR and Naylor JM (1989) Coronavirus- associated diarrhea (Winter
dysentery) in adult cattle, Can Vet J, 30, 825-827.
Dringeliene, A., Markevieius A., Aeite, J. (2004). Cellular immunity of coronavirus-infected bovine from
ecologically different districts of Lithuania. Ekologija, 4, 1-5.
Fukutomi T, Tsunemitsu H, Akashi A (1999): Detection of bovine coronaviruses from adult cows with epizootic
diarrhea and their antigenic and biological diversities. Arch Virol, 144, 997-1006.
Gaber F and Kapil S (1999) Development of antigen spot test for detection of coronavirus in bovine fecal
samples, Clin Diag Lab Immunol, 6, 542-544.
Hasöksüz M, Kayar A, Dodurka T and Ilgaz A (2005) Detection of respiratory and enteric shedding of bovine
coronaviruses in cattle in Northwestern Turkey, Acta Veterinaria Hungarica, 53, 1, 137-146.
Hasırcıoğlu S. (2005) Buzağılarda enterik bovine coronavirus enfeksiyonlarının araştırılması ve epidemiyolojide
klinik olarak sağlıklı sığırların rolü. S.Ü. Sağlık Bilimleri Enstitüsü, Konya, pp. 1-59.
Kapil S, Richardson KL, Maag TR and Goyal SM (1999) Characterization of bovine coronavirus isolates/from
eight different states in the USA, Vet Microbiol, 67, 221-230.
Lai MMC and Cavanagh D (1997) The molecular biology of coronavirus, Adv Virus Res, 48, 1-100.
McNulty MS, Bryson DG, Allan GM and Logan EF (1984) Coronavirus infection of the bovine respiratory tract,
Vet Microbiol, 9, 425-434.
Mebus CA, White R, Stair EL, Rhodes MB, Twiehaus MJ (1972): Neonatal calf diarrhea: results of a trial using
a reo-like virus vaccine. Vet.Med/Small Anim Clin, 67, 173-178.
Mostl K (1990) Coronaviridae, Pathogenetic and Clinical Aspects: An Update, Comp Immun Microbiol Infect
Dis, 13, 4, 169-80.
Park S. J., G. K. Lim, S. I. Park, H. H. Kim, H. B. Koh and K. O. Cho (2007a) Detection and Molecular
Characterization of Calf Diarrhoea Bovine Coronaviruses Circulating in South Korea during 2004–2005.
Zoonoses and Public Health, 54, 223–230.
Park SJ, Kim GY, Choy HE, Hong YJ, Saif LJ, Jeong JH, Park SI, Kim HH, Kim SK, Shin SS, Kang MI, Cho
KO (2007b). Dual enteric and respiratory tropisms of winter dysentery bovine coronavirus in calves. Arch
Virol.;152(10):1885-900. Epub 2007 Jun 14.
Reynolds DJ, Chasey D, Scott AC, Bridger JC (1984) Evaluation of ELISA and electron microscopy for the
detection of coronavirus and rotavirus in bovine feces. The Veterinary Record, 114, 397-401.
Saif LJ, Brock KV, Redman DR, Kohler EM (1991): Winter dysentery in dairy herds: electron microscopic and
serological evidence for an association with coronavirus infection. Vet Rec, 128, 447-449.
Saif LJ (1993) Coronavirus immunogens, Vet Microbiol, 37, 235-297.
Sato M and Akashi H (1993) Detection of bovine coronavirus by ELISA using monoclonal antibodies, J Vet
Med Sci, 55, 5, 771-774.
Schoenthaler SL and Kapil S (1999) Development and Applications of a Bovine Coronavirus Antigen Detection
Enzyme-Linked Immunosorbent Assay. Clinical and Diagnostic Laboratory Immunology, 6 (1), 130-132.
Snodgrass DR, Terzolo HR, Sherwood D, Campbell I, Menzies JD, Synge BA (1986) Aetiology of diarrhoea in
young calves. The Veterinary Record, 119, 31-34.
Park Su-Jin, Cheol Jeong, Soon-Seek Yoon, Hyoun E. Choy, Linda J. Saif, Sung-Hee Park, You-Jung Kim, Jae-
Ho Jeong, Sang-Ik Park, Ha-Hyun Kim, Bong-Joo Lee, Ho-Seong Cho, Sang-Ki Kim, Mun-Il Kang, and
Kyoung-Oh Cho (2006) Detection and Characterization of Bovine Coronaviruses in Fecal Specimens of
Adult Cattle with Diarrhea during the Warmer Seasons. Journal Of Clınıcal Mıcrobıology, 44 (9). 3178–
3188.
Van Regenmortel MHV, Fauquet CM, Bishop DHL, Cartens EB, Estes MK, Lemon SM, Maniloff J, Mayo MA,
McGeoch DJ, Pringle CR, Wickner RB (2000) Virus Taxonomy. Academic pres, San Diago, CA, 827.
Murray, M.J., Guard, C. (1990). Diseases of Alimentary System. In Ed. Smith, B.P. Large Animal Internal
Medecine, C.V. Mosby Company, Missouri, USA. pp. 816-817.
GH and some haematochemical parameters variation
during the first two months of lactation in mouflon
(Ovis gmelini musimon)
GH I VARIJACIJE NEKIH HEMATOKEMIJSKIH PARAMETARA

TIJEKOM PRVA DVA MJESECA LAKTACIJE U MUFLONA
(OVIS GMELINI MUSIMON)
Carcangiu V. 1, Mura M.C. 1, Vacca G.M. 1, Parmeggiani A. 2, Pazzola M. 1, Dettori M.L.

1
, Bini P.P. 1
1
Dipartimento di Biologia Animale, Università degli Studi di Sassari, Via Vienna 2, Sassari;
2
DIMORFIPA, Università degli Studi di Bologna, Via Tolara di Sopra 50, Ozzano dell’Emilia (BO)
ABSTRACT
The aim of the research is, starting to one of the most important physiological phases of the mouflon, such
as lactation, to observe the behaviour of GH, PRL and some metabolic parameters. Eighteen female mouflon
were used (10 lactating and 8 dry) aged between 5 ± 3 years. The animals were kept in a large roofed pen, where
they were fed with 400 g/die of concentrate food for ovine. The female lambed, between March and April, only
one cub (Group A), which was suckled for the whole period of the observation. Following the 7th day after
lambing, for two months, every week, from each animal blood samples was taken. The same procedures, with
regular blood samples, were followed for the females that did not lambed (Group B). GH plasma level were
dosed by radioimmunassay. Concentration of glucose, triglycerides, total cholesterol, total protein, albumin,
urea, Ca, P, Mg, Fe, Cu, Zn, Cl, were quantified with colorimetric method, Na and K were quantified using
flame spectrophotometer. The results were subjected to statistical analysis (ANOVA). GH blood concentrations
within the dry group animals showed a constant state, while in lactating animals there was a marked increase
in the second, fifth, and seventh blood samples. Moreover the lactating animals presented higher values of GH
compared to the dry. The blood levels of glucose proved to be higher in the dry animals, with significant statistical
differences compared to the other group at the first, third, fifth, seventh and eighth blood sample for P<0.05 and
at the second and fourth blood sample for P<0.01. The triglycerides plasmatic levels showed variations (P<0.01)
among the blood samples in the lactating animals only, while between the two groups significant differences
were noticed for P<0.01 at the first and fourth blood sample, and for (P<0.05) at the fifth and eighth blood
sample. The total cholesterol, the total protein and the albumin have not shown variations, neither among the
blood samples, nor between the groups, while urea levels presented differences in both groups (P<0.01) among
the blood samples. The minerals examined in the lactating animals showed variations on: Ca (P<0.05), Mg
(P<0.01), Zn, (P<0.01), while the other group of animals presented variations on Mg (P<0.01) and Zn (P<0.01).
The comparison between the two groups of animals demonstrated significant results within the values of Ca at
the first and second blood sample, Mg at the first and at the fifth, and Fe at the first and last blood samples. With
regards to Cu and Zn the higher values were recorded in the dry animals with significant differences for all the
samples (P<0,01). P, Cl, Na and K remained constant for all the observation period without significant variation
in both groups. The differences detected during examination in the GH plasmatic concentrations, and in many
other parameters, as above evidenced, show how the lactating mouflon are subjected to an intense organic effort
with the aim to produce milk for their lambs. Therefore, in order to guarantee an optimal management of this
faunistic patrimony it is to be hoped that there will be interventions for assure and improve availability of food,
which, as proved here, is absolute necessary during lactation for the animal wellbeing.
Sažetak
Cilj istraživanja bio je, počevši sa jednom od najvažnijih fizioloških faza u muflona, kao što je laktacija,
proučiti kretanje GH, PRL i nekih metaboličkih parametara. Korišteno je 18 ženki muflona (10 u laktaciji i 8 u
zasušenju) u dobi od 5 ± 3 godine. Životinje su držane u velikom natkritom oboru te su hranjene sa 400g/dan
koncentrata za ovce. Ženke su janjile, između ožujka i travnja, samo jedno mlado (Grupa A), koje je sisalo
cijelo vrijeme trajanja istraživanja. Počevši sa 7-im danom nakon janjenja, uzimana je krv svim životinjama
svaki tjedan tijekom 2 mjeseca. Isti postupak primjenjen je i na ženke koje se nisu janjile (Grupa B). Nivo GH
u plazmi je određivan RIA-om. Koncentracije glukoze, triglicerida, ukupnog kolesterola, ukupnih bjelančevina,
albumina, ureje, Ca, P, Mg, Fe, Cu, Zn i Cl su određivane kolorimetrijski, Na i K plamenim spektrofotometrom.
Rezultati su podvrgnuti statističkoj obradi (ANOVA). Koncentracije GH u krvi životinja koje se nisu janjile
imale su stalnu razinu, dok su u životinja u laktaciji zabilježeni značajni porasti u 2., 5. i 7. uzorku krvi. Štoviše,
životinje u laktaciji imale su više vrijednosti GH u usporedbi s onima koje se nisu janjile. Razine glukoze u
krvi bile su više u životinja van laktacije, sa znakovitim statističkim razlikama (P<0,05) u usporedbi sa drugom
skupinom u 1., 3., 5., 7. i 8. uzorku krvi te sa P<0,01 za 2. i 4. uzorak. Razine plazmatskih triglicerida su
pokazale varijacije (P<0,01) između uzoraka samo unutar skupine životinja u laktaciji, dok je između skupina
utvrđena razlika P<0,01 u 1. i 4. uzorku krvi te P<0.05 u 5. i 8. uzorku. Ukupni kolesterol, bjelančevine i
albumini nisu pokazali varijacije niti između uzoraka krvi, niti između grupa, dok je razina ureje pokazala
razlike u objema grupama (P<0.01) između krvnih uzoraka. U životinja u laktaciji utvrđena je varijacija u
sljedećim mineralima: Ca (P<0,05), Mg (P<0,01) i Zn (P<0,01), dok je druga skupina imala razlike u Mg
(P<0,01) i Zn (P<0,01). Usporedbom među grupama utvrđena je znakovita razlika unutar razina Ca u 1. i 2.
uzorku, Mg u 1. i 5. te Fe u 1. i zadnjem uzorku krvi. Glede Cu i Zn zabilježene su više vrijednosti u životinja
van laktacije, sa znakovitom razlikom u svim uzorcima (P<0,01). P, Cl, Na i K su zadržali stalnu razinu tijekom
cijelog istraživanja bez znakovitih razlika među grupama. Razlike utvrđene tijekom istraživanja u plazmatskoj
koncentraciji GH te u mnogim drugim parametrima, kako je gore zabilježeno, su pokazale da su muflonke
u laktaciji podvrgnute snažnom pritisku na organe s ciljem produkcije mlijeka za janjad. Stoga, kako bi se
osiguralo optimalno rukovođenje ovog faunističkog naslijeđa, neophodno je intervenirati kako bi se osigurala
i poboljšala dostupnost hrani, koja je, kako se pokazalo ovdje, neophodna tijekom laktacije za zadovoljenje
dobrobiti životinja.
INTRODUZIONE
Lo sfruttamento agricolo e industriale della superficie terrestre ha provocato cambiamenti
ambientali tali che hanno determinato una selezione restrittiva nei confronti di diverse popolazioni di
animali selvatici. Infatti, la riduzione e la frammentazione delle aree da loro occupate e il conseguente
ridotto scambio genetico, ha provocato la scomparsa di alcune importanti specie di animali silvestri e
la riduzione numerica di molte altre. Gli effetti dell’antropizzazione hanno sortito, anche in Sardegna,
notevoli modificazioni ambientali con una diminuzione della già scarsa mammofauna presente.
Tra queste specie il muflone (Ovis gmelini musimon) riveste un ampio interesse faunistico, che
non è circoscritto solo alla nostra isola ma si estende a tutto il bacino del mediterraneo, in quanto
solo in Sardegna e in Corsica è sopravvissuto all’estinzione (Cugnasse, 1994). Per questo motivo,
tale ovino, suscita l’interesse di molti ricercatori sensibili alla conservazione di questa biodiversità
(Shackleton e Lovari, 1997). Infatti, molti sono stati i progressi fatti per la salvaguardia di questo
patrimonio genetico ma occorre, senza dubbio, una conoscenza maggiore dei loro ritmi biologici, dei
loro assetti metabolici ed ormonali al fine di migliorarne le condizioni di vita. Questo monitoraggio
risulta particolarmente utile per gli animali selvatici che vivono allo stato libero, nei quali non è facile
verificare con certezza la qualità e la quantità di alimento introdotto, e per quelli tenuti in cattività,
per le particolari condizioni alle quali si devono adattare. La conoscenza dell’assetto metabolico e
minerale assume un’ulteriore importanza in particolari stadi fisiologici quali la lattazione. Quindi, lo
scopo della ricerca è quello di studiare, il comportamento del GH e di diversi parametri metabolici
in mufle in lattazione e in asciutta.
MATERIALI E METODI
Per la ricerca sono state utilizzate 18 mufle (10 in lattazione e 8 in asciutta) dell’età di 5 ± 3
anni. Gli animali venivano tenuti presso la Facoltà di Medicina Veterinaria in un ampio recinto,
provvisto di tettoia, dove ricevevano 400 g/die di concentrato del commercio, l’acqua e il fieno
erano ad libitum. Le mufle avevano partorito tra Marzo e Aprile, un solo redo, e lo allattavano per
tutto il periodo delle osservazioni. A partire dal settimo giorno dopo il parto, per due mesi, a cadenza
settimanale, da ciascun animale, sono stati effettuati prelievi di sangue dalla vena giugulare. Con la
stessa cadenza sono stati eseguiti anche i prelievi agli animali che non avevano partorito (Gruppo 2).
Il sangue veniva subito centrifugato e il plasma ottenuto veniva congelato a -20 °C fino al momento
delle analisi. Le concentrazioni plasmatiche del GH sono state quantificate è stato dosato mediante
metodica radioimmunologica (Gaiani e Mongiorgi, 1984). Il glucosio, trigliceridi, colesterolo
totale, proteine totali, albumine, urea, Ca, P, Mg, Fe, Cu, Zn e Cl sono stati definiti con metodiche
colorimetriche (Sentinel Chemical, Milano); il Na e K con spettrofotometro a fiamma. I dati sono
stati sottoposti ad analisi della varianza (ANOVA).
RISULTATI
Le concentrazioni ematiche del GH in entrambi i Gruppi hanno mostrato un andamento costante
durante le osservazioni (Grafico 1). Nel confronto trai due Gruppi quello in lattazione ha presentato
i valori maggiori di GH (P<0,01), in tutti i prelievi, rispetto a quelli in asciutta. I tassi plasmatici
del glucosio risultano più alti nei soggetti in asciutta con differenze statisticamente significative
rispetto all’altro gruppo al primo, terzo, quinto, settimo ed ottavo prelievo per P<0,05 e al secondo e
quarto per P<0,01 (Tabella 1). I livelli plasmatici dei trigliceridi hanno mostrato variazioni (P<0,01)
tra i prelievi solo negli animali in lattazione mentre tra i gruppi sono state riscontrate differenze
significative
9 per P<0,01 al primo e al quarto prelievo e per P<0,05 al quinto e all’ottavo.
8
5
GH ng/ml
0
1 2 3 4 5 6 7 8
S a m p le
G ru p p o A G ru p p o B
Figure 1 – Andamento del GH nei due gruppi nel corso dell’osservazione in osservazione
Il colesterolo totale, le proteine totali e le albumine non ha mostrato variazioni ne tra i prelievi ne
tra i gruppi mantenendo un andamento costante per tutta l’osservazione (Tabella 1, 2). I tassi ematici
dell’urea hanno presentato differenze significative in entrambi i gruppi (P<0,01) e tra i prelievi
(Tabella 2), mentre tra i gruppi non si è osservata alcune differenza. Tra i minerali esaminati nel
Gruppo 1 hanno mostrato variazioni il Ca (P<0,05), il Mg (P<0,01), lo Zn (P<0,01) mentre nell’altro
gruppo il Mg (P<0,01) e lo Zn (P<0,01) (Tabelle 3, 4). Nel confronto tra i due gruppi sono risultati
significativi i valori del Ca al primo (P<0,05) e secondo prelievo (P<0,01), del Mg al primo (P<0,05)
e al quinto (P<0,01) prelievo. Invece, per quanto riguarda il Cu e lo Zn i valori maggiori sono stati
registrati negli animali in asciutta con differenze significative (P<0,01). Il P, il Cl, il Na e il K (Tabelle
3, 4, 5) si sono mantenuti costanti per tutto il periodo delle osservazioni senza variazioni significative
in entrambi i Gruppi.
Tabella 1 - Valori medi del glucosio, trigliceridi e colesterolo totale.
Glucosio (mg/dl) Trigliceridi (mg/dl) Colesterolo totale (mg/dl)

Prel. Gruppo 1 Gruppo 2 Gruppo 1 Gruppo 2 Gruppo 1 Gruppo 2
1 93,25 * 187,53 16,22A ** 61,27 41,18 n.s. 39,47
2 83,42 ** 139,57 10,82A n.s. 17,10 56,85 n.s. 50,20
3 106,95 * 165,40 27,35AB n.s. 37,84 47,83 n.s. 40,86
4 102,42 ** 168,98 13,52A ** 40,96 56,65 n.s. 47,22
5 94,58 * 163,46 12,58A * 28,44 71,25 n.s. 62,82
6 116,67 n.s. 125,42 39,67AB n.s. 40,10 83,40 n.s. 49,82
7 87,35 * 147,74 51,08B n.s. 65,10 54,55 n.s. 43,60
8 81,42 * 146,88 18,77A * 46,12 54,30 n.s. 47,00
Sulle colonne lettere maiuscole indicano differenze significative per P<0,01. Sulle righe * = P<0,05; ** =
P<0,01; n.s. = non significativo.
Tabella 2 - Valori medi delle proteine totali, albumine e urea.
Proteine totali (g/dl) Albumine (g/dl) Urea (mg/dl)
Prel. Gruppo 1 Gruppo 2 Gruppo 1 Gruppo 2 Gruppo 1 gruppo 2

1 6,58 n.s. 6,20 4,05 n.s. 4,03 13,96A n.s. 16,03A
2 6,80 n.s. 5,97 3,70 n.s. 3,85 12,88 A
n.s. 16,30A
3 6,80 n.s. 6,42 3,70 n.s. 3,88 16,19 B
n.s. 22,62B
4 7,15 ns 6,52 4,03 n.s. 4,52 24,82C n.s. 27,23C
5 7,05 n.s. 6,76 3,68 n.s. 4,04 17,26B n.s. 18,02A
6 6,87 n.s. 6,66 3,98 n.s. 4,24 22,42C n.s. 24,05B
7 7,52 n.s. 6,90 4,15 n.s. 4,24 27,32 C
n.s. 31,28C
8 6,91 n.s. 6,58 4,40 n.s. 4,38 29,64 C
n.s. 35,47C
Sulle colonne lettere maiuscole indicano differenze significative per P<0,01; minuscole per P<0,05. Sulle righe
* = P<0,05; n.s. = non significativo.
Tabella 3 - Valori medi del calcio, fosforo e magnesio.
Calcio (mg/dl) Fosforo (mg/dl) Magnesio (mg/dl)
Prel. Gruppo 1 Gruppo 2 Gruppo 1 Gruppo 2 Gruppo 1 gruppo 2

1 7,20a * 8,47 6,85 n.s. 5,83 1,82 C
* 1,40B
2 7,10a ** 8,15 4,87 n.s. 5,00 1,12A n.s. 1,07A
3 7,82a n.s. 8,96 3,75 n.s. 5,38 1,37A n.s. 1,26A
4 8,20b n.s. 8,24 5,45 n.s. 4,92 1,20A n.s. 1,26A
5 8,62b n.s. 8,22 4,63 n.s. 4,60 1,40B ** 1,10A
6 7,95b n.s. 8,28 3,05 n.s. 3,40 1,10A n.s. 1,12A
7 8,55b n.s. 9,04 3,45 n.s. 3,60 1,52B n.s. 1,56B
8 8,01b n.s. 8,42 4,30 n.s. 4,78 1,45B n.s. 1,38B
* = P<0,05; ** = P<0,01; n.s. = non significativo.
Tabella 4 - Valori medi (± d.s.) del ferro, rame e zinco.

Ferro (µg/dl) Rame (µg/dl) Zinco (µg/dl)
Gruppo Gruppo Gruppo Gruppo Gruppo Gruppo
Prel.
1 2 1 2 1 2
1 193,25 n.s 182,67 73,28 ** 91,53 71,45A ** 89,53A
2 181,75 n.s. 189,75 76,27 ** 90,67 73,03A ** 89,52A
3 173,50 n.s. 09,60b 76,42 ** 94,32 72,15A ** 90,18A
4 167,50 n.s. 194,60 82,87 ** 93,72 74,90A ** 91,24AB
5 131,00 n.s. 156,20 81,50 ** 93,90 71,97A ** 92,01AB
6 175,75 n.s. 195,80 78,72 ** 93,96 78,52B ** 90,94AB
7 210,00 n.s. 211,80 84,17 ** 98,18 81,42B ** 95,06B
8 189,50 n.s. 191,60 82,85 ** 95,80 82,85B ** 96,40B
* = P<0,05; ** = P<0,01; n.s. = non significativo.
Tabella 5 - Valori medi (± d.s.) del cloro, sodio e potassio.
Cloro (mEq/l) Sodio (mEq/l) Potassio (mEq/l)

Prel. Gruppo 1 Gruppo 2 Gruppo 1 Gruppo 2 Gruppo 1 Gruppo
2
1 93,28 n.s. 96,30 141,45 n.s. 139,53 4,04 n.s. 4,15
2 98,22 n.s. 97,45 133,03 n.s. 135,52 3,85 n.s. 3,87
3 96,95 n.s. 96,14 142,15 n.s. 140,18 4,12 n.s. 4,08
4 95,98 n.s. 96,98 134,90 n.s. 131,27 4,01 n.s. 3,95
5 96,97 n.s. 99,30 131,97 n.s. 139,21 3,95 n.s. 4,01
6 99,40 n.s. 99,84 138,52 n.s. 140,24 4,03 n.s. 4,10
7 100,67 n.s. 103,34 131,42 n.s. 135,36 3,92 n.s. 3,98
8 101,52 n.s. 98,88 142,85 n.s. 138,34 4,25 n.s. 4,00
n.s. = non significativo.
DISCUSSIONE
Nella lattazione dei ruminanti una funzione abbastanza importante viene svolta dalla somatotropina
che attraverso il suo effetto omeoretico favorisce la secrezione mammaria (Bauman and Currie, 1980).
Infatti, questo ormone determina una condizione anabolica del metabolismo favorendo appunto la
produzione lattea (Chilliard et al., 1998a). Tale effetto viene esplicato, principalmente, contrastando
l’azione dell’insulina, inibendo appunto il trasporto del glucosio all’interno delle cellule (Vernon
e Finley, 1988). Inoltre, questo ormone fa si che l’animale possa andare in bilancio energetico
negativo attraverso la mobilizzazione di sostanze di deposito al fine di soddisfare la richiesta della
ghiandola mammaria (Bauman e Vernon, 1993). Pertanto, i livelli maggiori di GH riscontrati nelle
mufle in lattazione sono da imputare a questa importante funzione svolta dal GH nel favorire la
produzione lattea. Tale comportamento della somatotropina è in accordo con quanto si rileva anche
negli ovini domestici (Carcangiu et al., 2004). I livelli più bassi di glucosio osservati negli animali
in lattazione sono da ricondurre ad un maggiore utilizzo della mammella di questo substrato per la
formazione del lattosio (Manunta, 1981). Inoltre, i tassi riscontrati risultano elevati in entrambi i
gruppi, particolarmente in quello in asciutta, e possono essere dovuti all’azione stressante causata
dal confinamento degli animali in uno spazio ristretto per poter facilmente effettuare la cattura e il
prelievo. Infatti, la glicemia viene modificata notevolmente durante lo stress, in quanto gli ormoni
che intervengono in queste condizioni hanno spiccata azione iperglicemizzante (Carcangiu et al.,
2004). I tassi di proteine totali e albumine sono risultati simili a quanto ritrovato nella medesima
specie da Naitana et al. (1988) e leggermente più bassi di quanto riscontrato da Coda et al. (1987).
I livelli del Ca e del P si sono tenuti nei limiti fisiologici per la specie (Naitana et al., 1988). I tassi
più bassi del Ca negli animali in lattazione sono dovuti alla notevole escrezione di questo minerale
nel latte. Infatti, il Ca è il minerale che presenta le più alte concentrazioni nel latte e svolge un ruolo
importante nella stabilizzazione delle micelle caseiniche (Naitana et al., 1992). Le concentrazioni più
basse del rame e dello zinco negli animali in lattazione sono da attribuire alla secrezione di questi
minerali con il latte (Cousin, 1985). Cl, Fe, P, Na e K si sono mantenuti costantemente nei limiti
fisiologici in entrambi i gruppi senza subire variazioni legate allo stato produttivo degli animali.
Le differenze riscontrate per le concentrazioni plasmatiche di GH, di glucosio, trigliceridi, Ca,
Cu e Zn evidenziano come anche le mufle in lattazione siano soggette ad un intenso sforzo organico
al fine di garantire la produzione del latte per i loro redi. Pertanto, per una ottimale gestione di
questo patrimonio faunistico, anche per gli animali allo stato libero, sono auspicabili mirati interventi
sull’alimentazione, ancor più necessari nel periodo in cui vi sono soggetti in lattazione.
BIBLIOGRAFIA
Naitana S., Nuvole P., Marongiu A. (1992) La lattazione. In: Aguggini G., Beghelli V., Giulio L.F. Fisiologia
degli animali domestici con elementi di etologia. pp 781-806 UTET, Torino
Bauman D.E., Currie W.B. (1980). Partitioning of nutrients during pregnancy and lactating: A review of
mechanism involving homeostasis and homeorhesis. J.Dairy Sci. 63, 1514-1529;
Bauman, D. E., and R. G. Vernon. 1993. Effects of exogenous bovine somatotropin on lactation. Annu. Rev.
Nutr. 13:437.
Carcangiu V., Vacca G.M., Parmeggiani A., Mura M.C., Fanari U., Bini P.P. (2004). Relazioni tra GH, BCS e
livelli produttivi in ovini di razza sarda durante la lattazione. S.I.P.A.O.C., XVI Siena 29/9-2/10 2004, in
c.d.s.
Chilliard, Y., F. Bocquier, and M. Doreau. 1998a. Digestive and metabolic adaptations of ruminants to
undernutrition, and consequences on reproduction. Reprod. Nutr. Dev. 38,131–152.
Coda S., Ximenes L., Petruzzi V., Tarantini S., Varia G., Bolla G. (1987) Il nuovo Progresso Veterinario, 22, 3-6;
Carcangiu V., Vacca G.M., Parmeggiani A., Mura M.C.;
Dettori M.L., Bini P.P. (2004). Effect of age and sex on plasmatic levels of cortisol and some haematic parameters
in sheep subjected to shearing. Procedings of the 55th EAAP, 2004, 148.
Cousin R.J. (1985) Physiol. Rev., 65, 238-309; Manunta G. (1981) Tinarelli, Bologna. 1565-1662; Cugnasse
J.M., 1994. Révision taxonomique des mouflons des iles méditerraées. Mammalia 58, 507-512
Gaiani R., Mongiorgi S., 1984. GH, PRL and insulin variation in lactating goats. Proceeding of Annual Meeting
Società Italiana delle Scienze Veterinarie XLI, 269-273
Naitana S., Ledda S., Loi P., Bomboi G., Falchi S. (1988) La Clinica Veterinaria, 111(3), 158-162.
Shackleton D.M., Lovari S., 1996. Conservation of Eurasian wild sheep. An overview. Proceding of the second
International symposium on meditettanean mouflon, 2, 20-36
Vernon R.G., Finley E, (1988). Roles of insulin and growth hormone in the adaptations of fatty acid synthesis in
white adipose tissue during the lactation cycle in sheep.Biochem J. 256, 873-878.
Serological detection of a Bovine herpesvirus 1 related
infection in buffaloes (Bubalus bubalis) by using BoHV-1
blocking ELISA
Serološko otkrivanje goveđeg herpesvirusa 1

povezanog s infekcijom u bufala ((Bubalus bubalis)
Romero Tejeda A., Thiry J.1, Preziuso S., Thiry E. 1, Petralia P., Valente C. 2, Cuteri V.*
Department of Veterinary Science, Faculty of Veterinary Medicine, University of Camerino, Italy

1
Department of Infectious and Parasitic Diseases, Virology and Immunology, Faculty of Veterinary Medicine,
University of Liege, Belgium.
2
Department of Diagnostic Pathology and Veterinary Clinic, Faculty of Veterinary Medicine, University of
Perugia, Italy.
ABSTRACT
Among the subfamily alphaherpesvirinae, Bovine herpesvirus 1 (BoHV-1) is responsible for genital and
respiratory tract infections in cattle. The infectious bovine rhinotracheitis (IBR) is one of the most important
causes of economical losses in the cattle industry in association with the related Bovine herpesvirus 5. The
BoHV-1 envelope includes at least ten glycoproteins (g), where gB, gC and gD are present in large amounts,
meanwhile the less abundant gE is important for virus cell-to-cell transmission. To control the disease, IBR
marker vaccines based on gE deletion mutants of BoHV-1 and BoHV-1 blocking ELISA detecting specifically
gB or gE antigens have been developed in Europe and used in different voluntary eradication programs in order
to differentiate between infected and vaccinated animals. Several ruminant alphaherpesviruses have been shown
to be antigenically and genetically closely related to BoHV-1. These viruses are not restricted to their natural
host species. Thus, buffaloes can be successfully cross-infected with BoHV-1 under experimental conditions and
can express high antibody levels against BoHV-1 as demonstrated in cattle. Recently, the host specific Bubaline
herpesvirus 1 (BuHV-1) has been isolated after a latency reactivation treatment with dexamethasone in Italy
and has been shown responsible of a subclinical genital infection in buffaloes. Taking into account the close
relationship between BoHV-1 and BuHV-1, it can be hypothesised that a BoHV-1 gB blocking ELISA could
detect a BoHV-1 related infection in buffaloes. Thus, the prevalence of such infection has been investigated
in 415 unvaccinated buffaloes from Central Italy. Knowing that gE is genetically less conserved than gB, a
BoHV-1 blocking gE ELISA has been used to try to discriminate BuHV-1 and BoHV-1 infections. The apparent
seroprevalences obtained were 95.66% and 72.05% for gB and gE respectively, meanwhile 72.05% of animals
were positive to both tests. In other hand, 16.87% of animals were positive to gB and negative to gE, presuming
that these animals are probably infected with BuHV-1 due to the lack of gE antibodies production, converting
the serology in a possible tool to differentiate between infections. These results demonstrate a high prevalence of
a ruminant alphaherpesvirus infection in buffaloes in Central Italy. This suggests a previous contact of animals
with BoHV-1 or the closely related BuHV-1. Due to the detection of antibodies against both glycoproteins,
a BoHV-1 cross-infection of buffaloes can be suggested although, as BoHV-1 and BuHV-1 are genetically
closely related, a BuHV-1 infection is currently the most consistent hypothesis. The survey of the prevalence
and the differentiation of both viruses could offer important knowledge about the herpesvirus epidemiology
in buffalo, and for that purpose it is necessary to complete the differentiation between BoHV-1 and BuHV-
1 infections using molecular methods. BoHV-1 infection in buffalo could interfere systematically with the
serologic diagnosis developed for the IBR control programs. These animals could be a dangerous reservoir of
BoHV-1 for uninfected bovines, mainly in regions where the disease has been previously eradicated. At the same
time, and for the closely phylogenetic relationship of BuHV-1 with BoHV-5, an evaluation of the susceptibility
of BoHV-5 infection in buffaloes could be an interesting research to develop in the future.
Sažetak
Unutar subfamilije Alphaherpesvirinae, goveđi herpes virus je odgovoran za infekcije spolnog i dišnog
sustava goveda, pogotovo goveđeg rinotraheitisa (IBR), koji je zajedno s goveđim herpesvirusom 5, jedan od
najznačajnijih uzroka ekonomskih gubitaka u govedarskoj industriji. Ovojnica se goveđeg HV-1 sastoji od deset
glikoproteina (g), od kojih su gB, gC i gD prisutni u velikim kojičinama, dok s manjeprisutni gE važni prilikom
prenošenja na druge stanice. Kako bi se bolest kontrolirala, u Europu su uvedene marker vakcine dobivene od
delecijom mutiranih gE goveđeg HV-1, kao I ELISA analize kojima se detektiraju specifični gB I gE antigeni
korištene u različitim eradikacijskim programima kako bi diferencirali inficirane od vakciniranih životinja.
Više se vrsnonespecifičnih goveđih alfaherpesvirusa pokazalo antigenskii genetski povezanim s goveđim
herpesvirusom. Tako se bufali mogu zaraziti križnom infekcijom s goveđim herpes virusom i razviti viši titar
antitijela od goveda. Nedavno je herpesvirus bufala izoliran u Italiji nakon latentne reaktivacije terapijom
deksametazona , te se smatra de je taj virus bio odgovoran za subklinički spolnu infekciju bufala. Uzevši u
obzir usku povezanost BoHV-1 i BuHV-1, smatra se da bi BoHV-1 gE detektirani ELIS-om mogli detektiratu
istu i kod bufala. Tako je istražena prisutnost ove infekcije u 415 nevakciniranih bufala u centralnoj Italiji.
Znajući da je gE genetskii promjenjljiviji od gB, BoHV-1 blocking gE ELISA se koristila za razlikovanje
BuHV-1 and BoHV-1 infekcija. Utvrđena seroprevalencija iznosila je 94,7% i 72,05% za gB i gE, dok je 71,8%
životinja bilo pozitivno na oba testa. S druge strane, 16,87% životinja bilo je pozitivno nag B I negativno nag E
, predpostavljajući da su te životinje bile inficirane sa BuHV-1 zbog manjka stvaranja gE protutijela, što dovodi
do mogućnosti korištenja serologije u diferencijaciji infekcija. Na osnovu ovih rezultata možemo dokazati
prisutnost visoke koncentracije alfaherpesvirusa preživača u bufalaCentralne Italije. Pretpostavlja se prijašnji
kontakt s životinjama koje su imale BoHV-1, ili pak neki njemu vrlo sličan virus. Pomoću dokaza protutijela
protiv oba glikoproteina, može se predpostaviti I kros-infekcija s BoHV-1, s obzirom da su BoHV-1 i BuHV-1
genetski vrlo srodni, no hipoteza s BuHV-1 je prihvatljivija. Pregled učestalosti pojave i razlikovanja dvaju
virusa donosi važna saznanja o epidemiologiji herpesvirusa u bufala. Stoga je važno diferencirati BoHV-1 i
BuHV-1 koristeći molekularne metode. Infekcija BoHV-1 bufala može utjecati na serološku dijagnostiku koja se
koristi kod IBR kontrolnih programa. Te životinje mogu biti opasni rezervoari BoHV-1, pogotovu u područjima
gdje je virus eradiciran. Zbog bliske filogenetske povezanosti između BuHV-1i BuHV-5, buduća bi istraživanjea
bilo zanimljivo provesti na osjetljivosti bufala na BuHV-5
INTRODUCTION
Herpesviridae family is formed by double-stranded DNA viruses, which includes nearly two
hundred viruses isolated from different hosts as molluscs, fishes, amphibians, reptiles, birds and
mammals. In nature most herpesvirus are closely associated with a single host species, and almost
all the animal hosts investigated so far support infections by at least one herpesvirus species 15-18. All
members of the family Herpesviridae share a common virion morphology based on an icosahedral
capsid symmetry, a cell-derived envelope containing virally encoded membrane proteins and a
protein-made matrix 6,10. Viral glycoproteins (g) of herpesviruses play an important role in the
interactions between these viruses and their host-cells and they are involved in several steps of the
viral cycle, such as the attachment, penetration and maturation. Most of the Bovine herpesvirus 1
(BoHV-1) glycoproteins have already been characterised. The gB, gC and gD are present in large
amounts, meanwhile the less abundant gE is important for virus cell-to-cell transmission 6,14.
According to their biological behaviour, members of the family Herpesviridae have been
classified into three subfamilies, the Alpha-, Beta- and Gamma- herpesvirus. The alpha-herpesvirinae
are characterised by a rapid replication, lysis of the infected cells and the establishment of latency
mainly in neurones of sensory ganglia 6,17. Seven ruminant alpha-herpesviruses form a cluster of
antigenically and genetically related viruses. BoHV-1, a cattle pathogen associated with infectious
bovine rinotracheitis (IBR), infectious pustular vulvovaginitis, balanopothitis and abortion, is the
prototype. The cluster is formed by Bovine herpesvirus 5 (BoHV-5) causing meningoencephalitis in
calves, Caprine herpesvirus 1 (CpHV-1) inducing systemic disease in kids and abortion in adults,
Cervid herpesvirus 1 (CvHV-1) responsible for conjunctivitis in red deer, Cervid herpesvirus
(CvHV-12), Elk herpesvirus 1 (ELKHV-1) causing subclinical genital infections in reindeer and elk
respectively, and Bubaline herpesvirus 1 (BuHV-1) responsible for subclinical infections in water
buffaloes 15-18.
Phylogenetic studies of conserved herpesvirus sequences showed that BoHV-5 and BuHV-1 are
most closely related to BoHV-1, followed by ElkHV-1, CvHV-1, CvHV-2 and CpHV-1 18. BoHV-1
related ruminant alphaherpesviruses are not always restricted to their natural host species, indeed,
goat, sheep, red deer, reindeer and buffalo are successfully infected with BoHV-1 under natural and
experimental conditions18. The cross-serological relationship between these viruses and BoHV-1 was
also demonstrated by seroneutralization and ELISA 6,18. Cross-infection studies have been performed
in order to gain greater knowledge about risks of acute and latent infections in cattle with other
ruminant alphaherpesviruses and about potential BoHV-1 reservoirs among ruminant species other
than cattle. In this case, serological studies have suggested that buffalo is susceptible to BoHV-1
and can be successfully cross-infected with BoHV-1 under experimental conditions, expressing high
antibody levels as demonstrated in cattle 4,18. A study using the seroneutralization test to indicate a
BoHV-1 infection in 43 different species from 7 countries of Southern Africa wildlife showed that
high antibodies levels against BoHV-1 were found in buffalo, revealing that this animal plays an
important role in the maintenance of the virus 8. In Italy, few serological surveys have been realized
about the BoHV-1 infection in buffalo, even if infection is present in this country 4.
In the other hand, not only serologic evidence of BoHV-1 infection in buffalo has been reported.
BoHV-1 has been isolated in 1971 from prepuces and semen from healthy water buffalo in Australia
7
and Malaysia 9. However, the identification of the specific-buffalo’s herpesvirus (BuHV-1) closely
correlated to BoHV-1 has been demonstrated in different researches, where using Restriction
Endonuclease DNA Fingerprints, and Restriction Fragment Patter Analysis, it was concluded that
BuHV-1 presented a different DNA migration profile comparing with bovine strains1,2. In Egypt,
7.3% of buffaloes were BoHV-1 positive using a Nested-PCR in isolated viruses from clinical
samples, however, the nested-PCR negative viral isolates were regarded as antigenically ruminant
Herpesviruses related5. Recently, BuHV-1 was isolated from nasal swabs in two buffaloes after a
latency reactivation treatment for five consecutive days with dexamethasone in Italy4. Only slight
diarrhoea and serous nasal discharge were observed. Unfortunately, there are few data to clarify the
pathogenic role of the BuHV-1, knowing that is responsible of subclinical infections18.
Due to the preceding results obtained about serological positivity in buffalo, the propose of a
previous contact with the BoHV-1 and the possibility of the contemporary presence in the animals
of both related viruses, BoHV-1 and BuHV-1, must be studied, also because for the important
immunological benefit for BoHV1, that masks the antibodies production against BuHV-1. For
this reason and taking into account the close genetically relationship between both viruses, it can
be hypothesised that a BoHV-1 gB blocking ELISA could detect a BoHV-1 related infection in
buffaloes. In the other hand, a PCR assay based on the amplification of a DNA fragment of the gE
gene in different Herpesvirus strains have demonstrated that the expected fragment is not amplified
in BuHV-1 and other correlated alphaherpesvirus13. Based on this understanding and knowing that
gE is genetically less conserved than gB18, gE blocking ELISA could be used as a tool to identify
animals that are probably infected with BuHV-1 due to the lack of gE antibodies production and the
contemporary presence of gB antibodies, converting the serology in a possible tool to differentiate
between both infections.
In other hand, the properties shared by BoHV-1 related alphaherpesviruses could unfortunately
interfere with the IBR eradication program in cattle since the buffalo could be a potential reservoir
for the virus8,18. In this context, and when the risk of infection for cattle is high, a better knowledge
of these alphaherpesviruses is essential to successfully eradicate IBR, which causes important
economical losses in the cattle industry6,10. In Italy the breeding of buffalo is increasing, principally in
Central-South parts of the Country, reaching about 360.000 animals, and in some cases the buffalo’s
milk production and transformation is more profitable than milk obtained from dairy cows12.
Experimental data confirm that BuHV-1 affects the Italian buffalo population 4, and the identification,
differentiation and survey of the prevalence of both BuHV-1 and BoHV-1 infections in these animals
could offer important knowledge about the herpesvirus epidemiology.
MATERIALS AND METHODS

a) Animals
Four hundred fifteen female unvaccinated buffaloes belonging from 7 farms in central Italy, with
an average age between 18 months and 20 years old were sampled. In order to simplify the data,
animals were stratified in 2 groups according to their age: younger and older than 2 years. According
to this categories, 178 and 237 animals corresponded to each group respectively.
b) Serological Test
In order to obtain sera samples, 6 ml of blood were collected in tubes without anticoagulant
and centrifuged at 2500 rpm for 20 minutes. The sera were tested immediately or stored at 4°C until
their use. Samples were tested with two ELISA Antibody test kit (IBR gB / gE IDEXX Herd Check
Laboratories) in order to detect antibodies to the BoHV-1 gB and gE. The serological tests were
carried out following the manufacturer’s instructions, having both BoHV-1 blocking ELISA’s the
same principle. Briefly, the sera incubation in antigen-coated wells for 1 hour in case of gB ELISA
and overnight for gE ELISA was required. After washing unbound materials, a competitive reaction
was obtained using a peroxidise-conjugated antibody directed to the BoHv-1 gB or gE coated in
the plate. This antibody does not bind to the BoHv-1 antigen when the antigenic determinant has
been previously blocked by antibodies present in the serum. Following this incubation period, the
un-reacted conjugate is removed by washing, and a substrate/chromogen solution is added. In the
presence of enzyme, the substrate is converted to a product which reacts with the chromophore to
generate a blue colour if no gE/gB antibodies are present in the sample. The substrate-chromogen
reaction was measured using a spectrophotometer (Labsystem Multiscan) at a single wavelength of
450 nm for gB ELISA and 650 nm for gE ELISA.
RESULTS
The serological survey carried out in buffaloes from central Italy demonstrated that from a total
number of 415 animals sampled, 397 (95.66%) were positive to BoHV-1 gB and 299 (72.05%)
were positive to BoHV-1 gE. In other hand, 17 (4.09%) and 85 (20.48%) animals were negative to
gB and gE ELISA respectively (Table 1). The serology results obtained according to the age were
that in the group of animals younger than 2 years, 171 (96.06%) of animals were positive to gB
ELISA, meanwhile 109 (61.23%) were positive to gE. In the group of animals older than 2 years, 226
(95.35%) and 190 (80.16%) were positive to gB and gE ELISA respectively (Table 2).
Table 1. General serological results using blocking ELISA gB and gE in buffaloes
No. of animals BoHV-1 gB BoHV-1 gE

+ - +/- + - +/-
415 397 17 1 299 85 31
Table 2. Serological results according to the age group using blocking ELISA gB and gE in buffaloes
Animals Total BoHV-1 gB BoHV-1 gE

+ - +/- + - +/-
↓ 2 years
178 171 6 1 109 53 16
old
↑ 2 years
237 226 11 0 190 32 15
old
Total 415 397 17 1 299 85 31
In addition, 299 (72.05%) of animals were positive meanwhile 14 (3.37%) were negative to both
tests. In other hand, 70 (16.87%) of animals were positive to gB and negative to gE (Table 3). In the
case of group of animals younger than 2 years, 109 (61.23%) were positive to both tests, meanwhile
6 (3.37%) were negative. In the same group, 46 (25.84%) animals were positive to gB and negative
to gE. In the second group of animals older than 2 years, 190 (80.16%) were positive to both tests,
meanwhile 8 (3.37%) were negative. Twenty four (10.12%) animals were positive to gB and negative
to gE ELISA (Table 4).
Table 3. General BoHV-1 gB and gE serological results.
BoHV-1 gB Total
+ - +/-
+ 299 0 0 299
BoHV-1 gE
- 70 14 1 85
+/- 28 3 0 31
Total 397 17 1
Table 4. BoHV-1 gB and gE serological results by group of age.
BoHV-1 gB Total
↓2 years old ↑2 years old
+ - +/- + - +/-
+ 109 0 0 190 0 0 299
BHV-1 gE - 46 6 1 24 8 0 85
+/- 16 0 0 12 3 0 31
Total 171 6 1 226 11 0
DISCUSSION
Several researches have demonstrated that buffalo is susceptible to BoHV-1 infection in natural
and experimental conditions 4,6,18. In Italy, even the few serological surveys that have been realized
to study this phenomena, it has been demonstrated that buffaloes are infected with BoHV-1, and
also with the specie-specific BuHV-11,2 which has been isolated from nasal swabs in experimental
immunosuppressed animals 4. Due to the lack of prevalence reports and to the high risk of interference
that could represent buffaloes in the IBR eradication program, the main objectives of this research
were the use of both blocking BoHv-1 ELISA gB and gE in buffalo in order to study the relative
prevalence of BoHv-1 infection in these animals, and the possible use of serology to differentiate
between BoHv-1 and BuHv-1 infections. Taking into account the close relationship between both
viruses, it can be hypothesised that a BoHV-1 gB blocking ELISA could detect a BoHV-1 related
infection in buffaloes. Knowing that gE is genetically less conserved than gB and that this glycoprotein
is not expressed in BuHv-1, a BoHV-1 blocking gE ELISA has been used to try to discriminate
between infections.
It is important to consider that in order to exclude interferences in the seroprevalence evaluation,
all animals included in this research were unvaccinated. The relative seroprevalence obtained were
94.70% and 72.05% for gB and gE respectively. These results strongly demonstrate the presence of a
ruminant alphaherpesviruses infection in buffaloes in Central Italy at a high prevalence, suggesting
also a previous contact of animals with BoHV-1 or the closely related BuHV-1, due to the detection of
antibodies against both viral glycoprotein. Few researches have been carried out in Italy about BoHv-
1 prevalence in buffalo, reporting a gE seroprevalence of 31.94% in buffaloes from Salerno (Italy),
but the discrimination between both viruses using serology was not realized4. In other hand, different
and important seroprevalence have been reported in Africa wildlife, concluding that buffalo is an
important reservoir of the BoHV-15,8. About gB / gE results of seroprevalence obtained by groups
of age, in animals younger than 2 years showed a 96.06% and 61.23%, meanwhile in the second
group, animals showed a 95.35% and 80.16% of prevalence respectively. There is not significantly
difference between gB prevalence between groups, but younger animals presented a lower gE
seroprevalence than older animals. This phenomena could be due to that possibly adults animals
have been more exposed in their life to others related alphaherpesviruses than younger animals, but
in some way, the presence of antibodies in young animals could corroborate the presence of recent
and the maintenance of infections within farms.
In other hand, a high percentage of animals (72.05%) were positive to both tests, meanwhile
16.87% (70/415) of a total number of animals were positive to gB and negative to gE. Due to this fact,
we presume that these animals are probably infected with BuHV-1 due to the lack of gE antibodies
production and the contemporary presence of gB antibodies, and although, BoHV-1 and BuHV-
1 are genetically closely related, a BuHV-1 infection is currently the most consistent hypothesis.
Some works have reported the lack of amplification of an expected product of the gE gene by PCR
in different Herpesvirus strains, including BuHV-1 and other correlated alphaherpesvirus13. This
phenomena possibly converts the serology in a possible tool to discriminate between infections. The
same methodology, using both blocking ELSA’s has been applied to discriminate between BoHv-1
and BoHv-5 infection in cattle, but the sensibility and specificity have been tested only on a very
limited number of samples17,18. The survey of the prevalence and the differentiation of both viruses
could offer important knowledge about the herpesvirus epidemiology in buffalo, and for that purpose
it is necessary to complete and confirm the differentiation between BoHV-1 and BuHV-1 infections
using molecular methods as Restriction Endonuclease Analysis, Restriction Fragment Patter Analysis
and Phylogenetic analyses by sequencing PCR products1,2,4,18
In the case of the results obtained according to the group of age, younger animals showed a lower
percentage (61.23%) of positive animals to both tests than group of older animals (80.16%). The
contrary was observed about animals positive to gB and negative to gE ELISA, showing a 25.84%
in contrast with 10.12% in older animals. This significantly difference probably could demonstrate
that younger animals are more frequently infected by the specie-specific BuHV-1, meanwhile older
animals could be infected with both related viruses.
IBR is a disease of major economic concern in many parts of the world especially in European
countries, where control programs are achieving. Because ruminant alphaherpesviruses are not
restricted to their natural host species, and buffaloes can be successfully cross-infected with BoHV-
1, we believed that it is important to study the role of buffaloes in the epidemiology of the IBR.
Experimental data confirm that BuHV-1 affects the Italian buffalo population4 and in addition, the
results obtained in this research allow to conclude that buffaloes in central Italy are expressing high
levels of antibodies against BoHV-1 glycoprotein, suggesting a previous contact with the BoHV-1
and the contemporary presence in the animals of both related virus, BoHV-1 and BuHV-1. This
situation could interfere with the IBR eradication program in cattle since the buffalo could be a
potential reservoir for the virus, being more important the risk in regions where the disease has been
previously eradicated8,18,19. In this context, and when the risk of infection for cattle is high, a better
knowledge of these alphaherpesviruses is essential to successfully eradicate IBR. The identification,
discrimination and survey of the prevalence of both BuHV-1 and BoHV-1 infections in these animals
will offer important knowledge about their infection and epidemiology.
In the same way, diagnostic tools, including molecular protocols, able to distinguish between
ruminant alphaherpesviruses related to BoHV-1 and BoHV-1 itself are of great interest to reduce the
false negative or positive diagnosis. Finally and for the closely phylogenetic relationship of BuHV-
1 with BoHV-5, an evaluation of the susceptibility of BoHV-5 infection in buffaloes could be an
interesting research to develop in the future.
REFERENCES
1. Brake F. and Studdert MJ. Molecular epidemiology and pathogenesis of ruminant herpesviruses including
bovine, buffalo and caprine herpesviruses 1 and bovine encephalitis herpesvirus. 1985. Aust. Vet. J. Oct;
62 (10):331-4.
2. Bulach DM and Struddert MJ. Comparative genome mapping of bovine encephalitis herspervirus, bovine
herpesvirus 1 and buffalo herpesvirus. 1990. Arch. Virol. 113(1-2): 17-34.
3. Claus MP, Alfieri AF, Folgueras-Flatschart AV, Wosiacki SR, Medici KC, Alfieri AA. Rapid detection and
differentiation of bovine herpesvirus 1 and 5 glycoprotein C gene in clinical specimens by multiplex-PCR.
2005. J Virol Methods. Sep;128(1-2):183-8.
4. De Carlo E, Re GN, Letteriello R, Del Vecchio V, Giordanelli MP, Magnino S, Fabbi M, Bazzocchi C, Bandi
C, Galiero G. Molecular characterization of a field strain of bubaline herpesvirus isolated from buffaloes
(Bubalus bubalis) after pharmacological reactivation. 2004. Vet Rec. Feb 7;154(6):171-4.
5. El-Kholy AA. Molecular and immunological detection of bovine herpesvirus-1 in clinical specimens. 2005.
Egypt J. Immunology. 12 (2): 125-136
6. Engels M, Ackermann M. Pathogenesis of ruminant herpesvirus infections. Vet Microbiol. 1996 Nov;53(1-
2):3-15.
7. George TD and Philpott M. Isolation of infectious bovine rhinotracheitis virus from the prepuce of water
buffalo bulls in Australia. 1972. Aust Vet J. Mar;48(3):126.
8. Hedger RS and Hamblin C. Neutralizing antibodies to bovide herpesvirus 1 (infectious bovine rhinotracheitis
/infectious pustular vulvo-vaginitis) in African wildlife with special reference to the cape buffalo (Syncerus
capper). 1978. Journal of comparative pathology. April, 88 (2): 211-218
9. Ibrahim A, Saw SP, Fatimah I, Saharee AA. Isolation of infectious bovine rhinotracheitis virus from buffalo
in Malaysia. 1983. Vet Rec. Mar 26;112(13):303-4.
10. Muylkens B, Thiry J, Kirten P, Schynts F, Thiry E. Bovine herpesvirus 1 infection and infectious bovine
rhinotracheitis. 2007. Vet Res. Mar-Apr;38(2):181-209.
11. Ros C, Belak S. Characterization of the glycoprotein B gene from ruminant alphaherpesviruses. Virus
Genes. 2002 Mar;24(2):99-105.
12. Rosati A and L.D Van Vleck. Estimation of genetic parameters for milk, fat, protein and mozzarella cheese
production for the Italian river buffalo Bubalus bubalis population. 2002. Livestock Production Science.
(74): 185-190
13. Schynts F., Baranowsky E, Lemairy M and Thiry E. A specific PCR to differentiate between gE negative
vaccine and wildtype bovine herpesvirus type 1 strains. 1999. Veterinary Microbiology, 66: 187-195.
14. Thange S, G Vanroose1, A Van Soom, L Duchateau, M T Ysebaert, P Kerkhofs, E Thiry, S van Drunen
Littel-van den Hurk, P Van Oostveldt and H Nauwynck. Inhibition of bovine sperm–zona binding by bovine
herpesvirus-1. 2005. Reproduction. 130: 251–259
15. Thiry E, Muylkens B, Meurens F, Gogev S, Thiry J, Vanderplasschen A, Schynts F. Recombination in the
alphaherpesvirus bovine herpesvirus 1. 2006. Vet Microbiol. Mar 31;113(3-4):171-7.
16. Thiry E, Meurens F, Muylkens B, McVoy M, Gogev S, Thiry J, Vanderplasschen A, Epstein A, Keil G,
Schynts F. Recombination in alphaherpesviruses. 2005. Rev Med Virol. Mar-Apr;15(2):89-103.
17. Thiry J, Widen F, Gregoire F, Linden A, Belak S, Thiry E. Isolation and characterization of a ruminant
alphaherpesvirus closely related to bovine herpesvirus 1 in a free-ranging red deer. 2007. BMC Vet Res.
Sep 28;3(1):26
18. Thiry J, Keuser V, Muylkens B, Meurens F, Gogev S, Vanderplasschen A, Thiry E. Ruminant alphaherpesviruses
related to bovine herpesvirus 1. 2006. Vet Res. Mar-Apr;37(2):169-90.
19. Thiry J, Tempesta M, Camero M, Tarsitano E, Bellacicco AL, Thiry E, Buonavoglia C. A live attenuated
glycoprotein E negative bovine herpesvirus 1 vaccine induces a partial cross-protection against caprine
herpesvirus 1 infection in goats. 2006. Vet Microbiol. Mar 31;113(3-4):303-8.
Epidemiological data of intrammamary infection in
cattle - a quantitative analysis of published data and
comparison with data in Croatia
Epidemiološki podatci rasprostranjenosti mastitisa u

goveda – analiza publiciranih podataka i usporedba s
podatcima pojave mastitisa u Hrvatskoj
Marina Pavlak1, Miroslav Benić2, Denis Cvitković1, Marko Tadić1

1
Department of Veterinary Economics and Analytic Epidemiology, School of Veterinary Medicine, University
of Zagreb
2
Croatian Veterinary Institute
Abstract
Mastitis is defined as an inflammatory reaction of udder tissue to bacterial, chemical, thermal or mechanical
injury. It is a common disease in dairy herd in many different counties and the most costly one in dairy cattle
breeding causing serious economic losses due to the decreasing milk production and lower quality of milk.
The aim of this study is to summarise the literature data on the prevalence and incidence level of spontaneous
intramammary infection in dairy cattle and to compare it with the epidemiological data of cattle intramammary
infection in Croatia. Analysed data include 118 available published papers on the Current Contents database
in the10-years period (from 1997 to 2007) describing epidemiological methods for determining occurence of
intrammamary infection worldwide. The data relating to occurrence of mastitis in Croatia have been collected
from Croatian Livestock Center, Laboratory for Milk Control, Križevci, Croatian Veterinary Institute, Zagreb
and Department for Veterinary Science, Ministry of Agriculture, Fisheries and Rural Development from 2002 to
2007. Three main categories of comparison were used: the frequency of intrammamary infection (subclinical and
clinical mastitis), the frequency of pathogen specific mastitis and the somatic cell count (SCC). In 55 countries,
about 30% the prospective studies of incidence rate, about 46% studies of prevalence rate and about 26% studies
of molecular epidemiology and risk factors were done. The level of subclinical mastitis varied from 9% to 70%
and clinical mastitis from 6.1% to 63.49% depending on milk gland status (dry or lactation period) and a parity.
The most frequently isolated pathogens from infected quarters were Staphylococcus aureus, and Streptococcus
uberis, followed by coagulase-negative staphylococci, Streptococcus agalactiae, Streprococcus dysgalactiae and
coliform bacteria. Staphylococcus aureus, Streptococcus agalactiae and Streptococcus dysgalactiae occurred
more often in herds with a high bulk milk SCC but coliform bacteria in herds with a low bulk milk SCC. In
Croatia SCC as well as number of pathogens from 2003 to 2007 decreased. Mean SCC in 2003 and 2007 were
209.063 and 165.216 respectively and mean number of pathogens microbes in raw milk were 236.958 and
54.049 respectively. In 1996 number of intrammamary infections caused by contagious-pathogens were 14.6%
and by environmental pathogens 5.9%, but in 2004 they were 13.6% and 8.4% respectively.
Sažetak
Mastitis je bolest mliječne žlijezde uzrokovana mikrobiološkim, kemijskim, toplinskim ili mehaničkim
čimbenicima. To je bolest koja se učerstalo javlja u mliječnih krava i dovodi do značajnih ekonomskih gubitaka
koji se izražavaju smanjenom proizvodnjom i kvalitetom mlijeka. Zbog velikih gospodarskih gubitaka koje
mastitis uzrokuje, a u cilju sprječavanja nastalih šteta, važno je poznavati epidemiološko stanje mastitisa u
zemlji. Stoga je cilj ovog rada bio sakupiti i obradititi podatke prevalencije i incidencije prirodnih infekcija
mliječne žlijezde u svijetu i usporediti ih s epidemiološkim podatcima u Hrvatskoj. Analizirano je i obrađeno
118 radova objavljenih u Current Contents bazi podataka zadnjih 10 godina. (od 1997. do 2007.) koji opisuju
rasprostranjenost i učestalost pojavljivanja mastitisa u svijetu. Ti podatci su uspoređeni s podatcima prikupljenih
za Hrvatsku (podatci dobiveni od Laboratorija za kontrolu mlijeka Hrvatskog stočarskog centra, Hrvatskog
veterinarskog instituta i Uprave za veterinarstvo Ministarstva poljoprivrede, ribarstva iruralnog razvoja) od
2002. do 2007. godine. Uspoređivani podatci odnosili su se na: stopu prevalencije i incidencije subkliničkog i
kliničkog mastitisa, učestalost pojavljivanja mastitisa prema uzročniku, učestalost pojavljivanja mastitisa prema
broju somatskih stanica. Ustanovljeno je da se oko 30% radova odnosilo na istraživanje stope incidencije
mastitisa, 46% na istraživanje prevalencije i oko 26% radova može se svrstati u područje molekularne
epidemiologije i procjene rizika. Stopa prevalencije subkliničkog mastitisa kretala se od oko 9% do 70%, a
kliničkog mastitisa od 6.1% do 63.49% ovisno o rizičnim čimbenicima (stanje mliječne žlijezde, broj parenja,
dob životinje). S etiološkog gledišta najveći broj mastitisa uzrokovan je s bakterijama vrsta Staphylococcus
aureus i Streptococcus uberis, te koagulaza negativnim stafilokokima kao i nekim streptokokima poglavito
vrstama Streptococcus agalactiae i Streprococcus dysgalactiae. Podatci su pokazali da mastitis uzrokovan sa
Staphylococcus aureus, Streptococcus agalactiae i Streptococcus dysgalactiae učestalije se javlja u krava s
povećanim brojem somatkih stanica u stajskom uzorku mlijeka, dok su koliformne bakterije češće uzročnik
infekcije u krava koje imaju manji broj somatskih stanica. Uspoređujući navedene podatke s podatcima za
Hrvatsku može se vidjeti da su podatci za Hrvatsku u okviru svjetskih podataka te da od 2003 do 2007 ukupan
broj somatskih stanica se smanjivaoo kao i ukupan broj mikroorganizama. Godine 1996. u Hrvatskoj je bilo
14.6% mastitisa uzrokovanih kontagioznim uzročnicima, dok je 2004. godine taj broj iznosio 13.4%., dok je
broj mastitisa uzrokovan okolišnim čimbenicima nešto rastao, od 5.9% na 8.4%.
Introduction
Mastitis is defined as an inflammatory reaction of udder tissue to bacterial, chemical, thermal or
mechanical injury. Clinical mastitis, in wich abnormal milk is detected, as well as subclinical mastitis,
in which no changes in milk are apperent, are common diseases in dairy herds in many different
countries. Both mastitis are the most costly in dairy cattle breeding causing serious economic losses
due to the decreasing milk production and lower quality of milk (White et al., 2001; Gröhn et al.,
2004; Wolfowa et al., 2006). Some epidemiological data indicated that mastitis is the most important
cause of culling. In Swiss dairy herds, up to 13% of all culling are duo to mastitis (Aeberhard et al.,
1997). In Ethiopia 27% of cows were removed from herds because of intramammary infection (IMI)
(Degraaf and Dwinger, 1996; Workineh et al., 2002). Therefore, in order to reduce the occurrence of
IMI in dairy herds as well as the overall cost of the udder health problem, in many countries mastitis
control program have been implemented (Kaneene and Hurd, 1990; Ekesbo et al., 1994; Bartlett et
al., 2001; Sviland and Waage, 2002; Sommerhauser et al., 2003). Information about the distribution
of IMI as well as specific pathogen mastitis in the dairy cows is of great importance for strategic
decision-making and optimal planning of mastitis control programs. However, the epidemiological
characterisation of mastitis pathogens is important for implementation of IMI control measures.
Therefore numerous epidemiological studies in many countries have been performed in order to
monitor a frequency of IMI occurrence as well as to identify reservoirs of specific pathogens and
the route of infection.
The aim of this study is to summarise the literature data on the prevalence and incidence level of
spontaneous intramammary infection in dairy cattle and to compare it with the epidemiological data
of cattle intramammary infection in Croatia.
Material and methods

Analysed data include 118 available published papers on the Current Contents database indexed
from 1997 to 2007 describing epidemiological methods to determine occurence of IMI worldwide.
The data relating to occurrence of mastitis in Croatia have been collected from Croatian Livestock
Center, Laboratory for Milk Control, Križevci, Croatian Veterinary Institute, Zagreb and Department
for Veterinary Science, Ministry of Agriculture, Fisheries and Rural Development from 2002 to
2007. Three main categories of comparison were used: the frequency of IMI (subclinical and clinical
mastitis), the frequency of pathogen specific mastitis and the somatic cell count (SCC). Key words
used in the search included IMI, mastitis, epidemiology, incidence and prevalence. The papers taken
into consideration were original studies and reports on the incidence of spontaneous IMI cases.
Results and discussion

Table 1. Epidemiological studies of prevalence of IMI (subclinical mastitis) in some countries compared with
available data in Croatia
Time of the Number of herds/cows/quarters/

Country Prevalence rate Authors
study tests included into study
34 farms/250 cows/1000 quarters 1996 - 34%
CROATIA 1996 and 2004 Benić, 2005
47 farms/304 cows/1204 quarters 2004 - 28.7%
1999 - 16.2% Sampimon et al., 2007
Denmark 1999 and 2000
2000 - 42.2%
Aarestrup and Jensen,
20 herds/180 cows/3382 quarters* 1997
4495 i 2648 cows/17111 i 10410 1988 - 47.8%

Finland 1988 and 1995 Myllys et al., 1998
samples 1995 - 37.8%
Pitkala et al., 2004
2001 216 herds/3282 cows/12661 quarters 31%
47% of the herds

Switzerland 1995-1997 118 herds/1816 samples Burnens et al., 1999
6.1% of cows
21,2 and 34,5%
1997 152 herds/1907 cows** Busato et al. 2000
Germany 1990-1996 10 herds/1074 cows 21.6% Fleicher et al, 2001

1389 heifers
1997 Edinger et al., 1999
(5 weeks after calving)
Tenhagen et al., 2006
2529 cows/9919 samples 26.4%
Haltia et al., 2006

Estonia 25 herds/3166 cows 52.7%
Out of 374
environmental Todhunter et al., 1995
USA (Ohio) 1985-1991 542 cows
steptococcal IMI -
45.2% CM
Brazil 26 cows*** 59.9% *** Benites et al., 2003
46 cows/185 mammary gland 69.5% Benites et al., 2002
Chile 1998 523 herds 55.3% Tadich et al., 2003
40.4% (CM: 37.1%,
Ethiopia 1996-1997 162 herds/307 cows Dego and Tareke, 2003
SCM: 62.9%)
* 4 weeks before and 4 weeks after calving; ** 7-100 and 101-305 day after calving; ***94 samples of milk,
184 samples of mammary gland, 168 samples of gland and 168 samples of teat cistern :positive results:
67% of the milk ; 70.1% of mammary parenchymas; 55.7% of gland cistern; 48.8% of teat cistern
Table 2. Epidemiological data of prospective studies of incidence rate of clinical mastitis in some countries
Country Time of the Number of herds/cows/ Rate Authors

study quarters/tests included
into study
Great Britain 1992-1993 32.1 saces/100 cow year at risk
1994-1996 144 cows 39.9 cases/100 cows year at risk Kossaibati et al., 1998
France 1990-2001 20084 cows 20.1 cases/100 cows yr Barnouin et al., 2005
1995-1997 205 herds 44.1 cases /100 cows year at risk Fourichon et al., 2001
Denmark 1993-1994 2146 herds 36-48 cases/100cows year at risk Barlet et al., 2001
0.263 cases/365 cow days at risk
274 herds/5827 cows/7594
Netherlands mean number of CM cases per herd Barkema et al, 1999
quarters
during 1.5-yr period =30.8
171 herds 12.7 cases/100 cow year at risk Elbers et al., 1998
Norway 1992-1995 49 cases/100 cows year at risk Sviland and Waage 2002
New Zealand 28 herds 12.70% McDougall et al., 2007
137 periparturient Holstein
USA 1990-1991 cows 28% of tests Detilleux et al., 1995
1084 tests
Makovec and Ruegg,
USA 20.6 -9.5%
1994-2001 77.172 samples 2003
(Wisconsin)
85 herds/318 cows/6057 38.4 cases/100 quarters year at risk

Tanzania 2003/05 Kivaria et al., 2007
quarters or 43.4 cases/100 cow year ar risk
Gianneechini et al.,
40 cows and 1077 CM: 1.2 cases/100 cows year at risk
Uruguay 2002
cows/4300 quarters * SCM: 52.4% of cows
*4 weeks before and 4 weeks after calving
Out of 118 analysed papers, 71 (60.2%) covered epidemiological studies of incidence and
prevalence of IMI, in 15 (12.7%) papers risk factors have been studied and in 12 (10.2%) studies
of molecular epidemiology have been done. Out of 71 papers studying occurrence of IMI in
different countries, in 57 papers prevalence of IMI have been investigated covering 25 countries.
Epidemiological studies of incidence or incidence rates of clinical mastitis (CM) in 15 countries are
described in 34 articles. Most articles describing molecular epidemiology analysis had references
to genomic typing of Staphylococcus aureus and Streptococcus uberis followed by Escherichia
coli and coagulase negative staphyloccoci (CNS). Most frequently analysed risk factors were
influence of hygiene, management practises, feeding, dry therapy, breed, age, parity, lactation
stage, teat stage, body condition, leaking milk, type of milking system and seasons.
Overview of occurrence of intrammamary infection (IMI)
Epidemiological data of occurrence of IMI and clinical mastitis in some countries are presented
in Tables 1 and 2. Subclinical (SCM) and clinical mastitis (CM), according to these data, have
been present in dairy cows during the whole period of lactation as well as in dry period. However,
especially high incidence of SCM and CM in dairy cows has been found in the peripartutient
period when the immune response is impeded and cows are metabolically stressed. Dego and
Tareke (2003) found that prevalence of mastitis was significantly higher in non-lactating than
Table 3. The most frequently isolated pathogens in cows with subclinical intramammary infection (SCM) and
clinical mastitis (CM) in some countries compared with available data in Croatia
Time of
Country the The most frequently isolated pathogens Authors
study
Contagious pathogens: 14.6 % and 13.6%
CROATIA SCM Benić, 2005
Environmental pathogens: 5.9% and 8.4%
Sampimon et al., 2007
Denmark SCM CNS 7.3 and 14.1%
Staph. aureus: 2% before and 16-48% after partus

Aarestrup and Jensen, 1997
SCM Str. dysgalactiae: 20% before and 3-35% after partus; Str.
chromogenes
CNS: 26.6 and 49.7%;
Finland SCM Myllys et al., 1998
Staph. aureus: 36.9 and 63.6%
CNS; Pitkala et al., 2004
SCM
C. bovis
Switzerland SCM Burnens et al., 1999
Staph. aureus: 16.% and 7.4%;
SCM Busato et al. 2000
C. bovis: 25.7% and 45.1%
Germany SCM Fleicher et al, 2001
Streptococci 12%;
SCM Staphylococci 69% Edinger et al., 1999
E coli 5%
CNS 9.1%;
C. bovis 7.3%; Tenhagen et al., 2006
SCM
Staph.. aureus : 5.7% (21.8% of positive);
Str uberis : 1% (3.7% of positive)
Staph. aureus; CNS; Str. uberis;
Netherlands CM Barkema et al, 1999
Str. agalactiae; Str. dysgalactiae
CM Staph. aureus Elbers et al., 1998
Staph. aureus, CNS, Str. agalactiae, Str. dysgalactiae, Haltia et al., 2006
Estonia SCM
C. bovis
New Zealand CM Str. uberis McDougall et al., 2007
USA CM CNS -23.7% of tests and 86% of positive tests Detilleux et al., 1995
Staph aureus : 17.7 – 9.7%
U S A CNS : 12.7-17.5 % Makovec and Ruegg, 2003
CM
(Wisconsin) Str. agalactiae : 8.1-3.0 %
E. coli : 3.1-6.7%
Staph. aureus : CM: 37.5% SCM 62.8%
Str, agalactiae: CM 5%; SCM 1.3% Gianneechini et al., 2002
Uruguay CM
Str. uberis : CM 2.5%, SCM 6.4%
E. coli : CM 12.5%, SCM 1.5 %
Brazil SCM CNS 35.7%; CPS 12.2%; C. bovis 2.4% Benites et al., 2003
SCM CNS 53.8%; CPS 7.6% Benites et al., 2002
Chile SCM Tadich et al., 2003
Staph. aureus 36.7% ; Str. agalactiae 13.1% ;
Ethiopia SCM Dego and Tareke, 2003
E. coli 10.1%; Str. dysgalactiae 5.6%; Str. uberis 5.1%
Table 4. Distribution of pathogens isolated in cow with IMI in some Europena coutries
Enterobacteriace
Country S. aureus S. agalactiae S. uberis S. dysgalactiae Authors
koliform
E. coli 1.69-6.56%
P.aeruginosa 0-0.77%
CROATIA 20.85 -33.36% 1.41-4.20% Klebsiella spp. 0.14- Benić, 2003
0.73
Ferguson et al.,
Italy 22.6% 2.30% 2.9%
2007
Serratia marcescens
Guardo et al.,
20.8% - corelation with
1997
SCC higher than
500000cells/ml
Stefel and
Germany 24% 30%
Philipp, 2007
5.7%
1% (3,7% of
(21.8% of
positive Tenhagen et al.,
positive 29% of herds
samples) 2006
samples)
Einger et al.,
E. coli 5%
1999
Busato et al.,
Schwizerland 7.4-16 % E. coli 0.4 – 1 %
2000
10.2 % heifers E. coli 16.7% in heifers
Netherland Haas et al., 2002
6.7 % cow and 21.5% in cows
Koivula et al.,
Finland 18.26%
2007
Myllys et al.,
36.9 i 63.6%
1998
Whist et al.,
Norwey 54.9-65.9% 14.2-15.2%
2007
8.2% at quarter 0,4% at 1.2%, at quarter
level, quarter level level Osteras et al.,
22.2% at cow 1.42 % at 1.17% at cow 2006
level cow level level
22.7% -in
correllation Reksen et al
with culling 2006
20% prior partus
4-6%
Denmark 3-35% Aarestrup and
postpartus Jensen , 1997
E. coli 52.30%
P. aeruginosa 3.60%
K. pneumoniae 4.10%
E. cloacae 3.60%
Poland
S. marcescens 3.10% Malinowski et
8.60% 50% 19.70% P. mutocida 3.10% al., 2006
Acinetobacter lwofti
3.10%
Aniiulis et al.,
Litva 20.32%
2003
Table 5. Frequency of contagious and environmental pathogens isolated in dairy cows in Croatia
(Benić, 2003,2005)
Year 1990 1991 1992 1994 1995 1996 1998 2001 2002 2004
No of samples 2068 839 641 1046 1067 1537 6853 8704 11566 1197
% of positive
47.14 44.46 44.77 43.78 41.71 46.52 40.33 38.68 36.54 22.0
samples
Contagious
37.57 32.42 30.9 32.89 23.43 24.72 26.4 24.71 24.3 13.6
pathogens (%)
Staph. aureus
33,36 29.32 26.7 28.68 22.02 21.05 24.78 20.85 20.31 ...
(%)
Str. agalactiae
4.21 3.1 4.2 4.21 1.41 3.67 1.62 3.86 3.99 ...
(%)
Other
Streptococci 6.09 8.58 8 5.64 9.75 7.37 8.56 10.06 7.56 ...
(%)
Environmental
9.61 11.92 13.03 10.9 18.28 10.6 13.91 13.77 11.56 8.4
pathogens (%)
E. coli (%) 1.69 2.26 2 3.63 6.56 2.36 3.03 2.2 2.4 ...
P. aeruginosa
0.24 0.36 0 0.29 0.28 0.39 0.77 0.55 0.42 ...
(%)
Klebsiella spp.
0.14 0.24 0.73 0.38 0.47 0.28 0.51 0.34 0.39 ...
(%)
C. pyogenes
0.04 0.12 0.3 0.1 0.19 0 0.07 0.02 0 ...
(%)
Table 6:Data of of the milk quality cotrol based on the BMSCC and TBC (Dakić et al., 2007)
2003 2004 2005 2006 2007

BMSCC 209.063 185.468 169.546 166.728 165.216
TBC 236.958 180.515 111.089 76.122 59.049
Epidemiological data of prevalence of SCM (Tab. 1) showed that this IMI is present in many
countries both developed and developing. The level of prevalence of IMI in some European countries
varied approximately from 9-53%. However, in other countries, especially developing ones like
Ethiopia (Dego and Tareke, 2003) and Tansania (Mdegela et al., 2004), prevalence of SCM increased
up to 70%. The level of occurrence of IMI in Croatia according to data studied by Benić (2005) in
1996 and 2004 (Tab. 1 and 3) stayed within the framework of the frequency of occurrence of IMI in
European countries. According to the paper report of Croatian Department for Veterinary Science,
Ministry of Agriculture, Fisheries and Rural Development on the performed California mastitis test
(CMT) in 2007 (from Semptember until December), the following was found: out of 31.813 samples
examined on the IMI infection using CMT, 12.975 (40.79%) were CMT positive. Out of 15.689
samples examined bacteriologically, 9795 (62.43%) samples were positive. Out of 6947 control
samples (samples taken after therapy and carence period), 1845 (26.56%) were positive.
Since the occurrence of IMI also depends on management system and a type of farming, studies
of influence of conventional and organic farms on the prevalence of IMI were done. Prevalence of
SCM in the organic farms in Switzerland at the cow level were 47.8% to 61.5% depending on the
period (days) postpartum. (Busato et al., 2000). Roesch at al. (2007) also showed higher prevalence
of California mastitis test (CMT)-positive quarter in cows from organic farms. The most SCM were
caused by Staphylococci, Streptocococi, Escherichia coli and Corynebacterium bovis (Tab. 1).
According to data by Jayarao et al. (1999), Str. uberis was the main pathogen isolated in cow with
SCM in the United States. The most frequent causes of IMI in Croatia were contagious pathogens
including Staphylococcus aureus and Streptococcus agalactiae (Benić, 2005).
According to analysed data, incidence rate for CM varied approximately from 20 to 50 cases per
100 cow-years at risk (Tab. 2). Reported data were very similar in European countries as well as
other countries like the United States or Tansania and Uruguay (Detilleux et al., 1995; Gianneechini
et al., 2002; Makovec and Ruegg, 2003; Kivaria et al., 2004, 2007). Therefore, it could be concluded
that SCM is more prevalent than CM in developing countries, as reported by Karimuribo et al.
(2006). On the other side, in developed countries with incorporated control program, prevalence
of SCM was reduced but CM continues to be a great problem (Barkema et al., 1998). In Croatia no
epidemiological data of prospective studies of incidence rate of CM were found.
There are many risk factors causing CM. Several studies have investigated CM risk factors (Elbers
et a., 1998; Barkema et al., 1999a; 1999b; Waage et al., 1998; Peeler et al., 2003; Giovannini and
Zecconi, 2002; Mungube et al., 2004; Barnouin et al., 2005). High milk production, very low bulk-
milk SCC, leaking milk and use of post milking teat disinfection are the main factors associated with
increased incidence of CM. Study of influence of close monitoring of dairy cows on the incidence of
CM and SCM in Croatia performed by Cergolj et al. (2004), showed promising results in prevention
and eradication of SCM.
Overview of the frequency of pathogens cousing IMI
According to epidemiological characteristics, the bacterial pathogens responsible for IMI
are divided into two main categories: contagious and environmental pathogens. Infection with
contagious pathogens results in clinical illness as well as strong inflammatory responses and reduces
milk production. Environmental pathogens usually cause sublinical intramammary infection. The
most important contagious mastitis pathogens spreading rapidly within a herd and resulting in a large
number of infected quarters are Staphylococcus aureus, Streptococcus agalactiae and Mycoplasma
spp. Environmental pathogens include coliform bacteria and environmental Streptococci. The most
frequent coliform bacteria causing IMI are E. coli and Klebsiella and the most prevalent environmental
Streptococci isolated from udder are S. uberis, S. dysgalactiae (Benić, 2003).
Distribution and frequency of pathogens isolated from cow with SCM or CM in some European
countries are presented in Table 3. Presented data covered the period from 1990 to 2004. From the
data presented in the Table it could be seen that the obtained results showed very similar data of
frequency of pathogens in Europe, except of the data on the frequency of Staph. aureus in Finland
and Norway (Myllys et al., 1998; Whist et al., 2007). Percentage of isolated mastitis pathogens in
Croatia were also very similar to the results obtained in other European countries (Tab. 3 and 4). The
data of epidemiological studies performed in Croatia from 1990 to 2002 reported by Benić (2003,
2005) are presented in Table 5.
The frequency of Staph. aureus in Finland and Norway obtained in the studies performed by
Myllys et al. (1998) and Whist et al. (2007) were higher than in the papers by other authors (Table
3). In Norway in 95% of 178 dairy herds, Staph. aureus was isolated and the prevalence of Staph.
aureus at the herd level was about 18% (Whist et al., 2007). Reksen et al. (2006) reported that Staph.
aureus is predominant mastitis pathogens in Norway and is estimated to be responsible for 47% of
clinical cases of mastitis. Except in Europe, Staph. aureus is also predominant mastitis pathogen in
the United States where it causes significant mastitis in heifers. In the United States the prevalence of
mastitis in dairy heifers (n=233) was 56.5% at the quarter level and 15.4% of quarters were infected
with Staph. aureus (Owens et al., 2001). In Croatia during the whole observed period from 1990 to
2002 Staph. aureus was the most frequently isolated pathogen from udder secretion (Topolko and
Benić, 1997; Benić, 2003).
Analysing the risk factors for Staph. aureus mastitis Zadoks et al. (2001) showed that Staph.
aureus infection was higher in bovine herpesvirus 4-seropositive cows, in right quarters, in quarters
that had recovered from Staph. aureus or Str. uberis infection and in quarters with extremely callused
teat ends.
Prevalence of Str. agalactiae in European countries was up to 6%, but the higher prevalence
(17.7%) has been reported in 1992 in Canada (Keefe et al., 1997). In Croatia, prevalence rate of Str.
agalactiae between 1990 and 2002 varied from 1.41 to 4.2% (table 4), which is in accordance with
the results of other authors.
The most commonly isolated Coagulase negative staphylococci (CNS) worldwide are Staph.
chromogenes, Staph. epidermidis and Staph. similans. In heifers 3 weeks before and 3 weeks after
parturition Staph. chromogenes was isolated in 15 % and both Staph. similans and Staph. epidermidis
in 1-3% of quarters (Aarestrup and Jansen, 1997). The proportion of Staph. epidedimis-infected cows
in Sweden was 22-31% (n=145 cows) (Thorberg et al., 2006). Although the Staph. epidermidis is
not very often found in the normal bacterial flora of bovine skin or mucosal membranes (White et
al., 1989), from epidemiological point of view, Staph. epidermidis has the great importance because
it is most prevalent staphyloccoci found on human skin. Therefore it has been suggested that bovine
Staph. epidermidis mastitis may be a zoonosis with human origin. (Thorberg et al., 2006).
The most important environmental pathogens causing IMI are Str. uberis, Str. dysgalactiae and
coliform pathogens including Escherichia coli and Klebsiella spp. (Tab. 1-3). From the data presented
in the Table 3, it could be seen that there are different results of prevalence of study of Str. uberis
and Str. dysgalactiae. Pankey et al (1996) found that about 90% of total cases of environmental
streptococcal mastitis (12.2%) in heifers in the first 5 days of lactation were caused by Str. uberis.
Aarestrup and Jansen (1997) isolated Str. uberis (n=180 heifers) much higher in the first 4 weeks of
lactation than in last 2 weeks prepartum. Jayarao et al. (1999) reported that the prevalence of Str.
uberis IMI was higher in cow with 4 or greater lactations than in cow with 3 or lower lactation. In
the United States the percentage of cows infected with Str. uberis ranged from 12 to 18% of cow/year
(Todhunter et al., 1995; Jayarao et al., 1999) and more than 50% of total IMI were coused by Str.
uberis (Todhunter et al., 1995). In Norwey out of 178 dairy herds, 45% of the herds showed Str.
dysgalactiae positive cows (Whist et al., 2007).
The Enterobacteriaceae is classified as a opportunistic environmental pathogens causing IMI,
especially in the dry period. In the United States 60% of all new IMI occurred in the dry period
(Todhunter et al 1995). Study of enterobacterial IMI in the dry period (3 weeks precalving and
postcalving) performed in Great Britain by Bradley and Green (2002) showed that out of 153 CM
(n= 629), 40.5% of these mastitis cases were caused by enterobacterial species including E. coli,
Klebsiella spp, Serratia spp and Citrobacter spp (Bradley and Green, 2000). The prevalence of
the Enterobacteriaceae in some countries are presented in Table 3. In Croatia the most frequently
isolated Enterobacteriaceae are E. coli, P. aeruginosa and Klebsiella spp. The prevalence rates of
these pathogens during observed period (1990-2002) is presented in the Table 5. Comparing this data
with the data of other authors, it could be concluded that the prevalence rate of these pathogens was
in correspondence with this data.
From the epidemiological point of view, the dry period is the very important for environmental
streptoccocal mastitis because the rate of IMI in this period is approximately 5.5-fold greater than
the rate in lactating period and about 55% of environmental streptococcal IMI present in the first half
of the dry period persist to lactation. (Todhunter et al., 1995).
Epidemiological study performed in Germany in period between 2001 and 2002 showed that out
of 26.4% (n=2614) of samples contained mastitis pathogens, Corynebacterium bovis with CNS was
predominant findings, accounting for 62.2% of the positive samples (Tenhagen et al., 2006). In Croatia
were isolated Corynebacterium pyogenes (Table 4) with a very low prevalence rate. Comparing the
microbiological status of different sites (milk (n=94), mammary parenchima (n= 184), gland cystern
(n=168) and teat cistern (n=168)) collected from slaughtered naturally infected dairy cows, (positive
results were obtained in 67.0%, 70.1%, 55.9% and 48.8% respectively), Corynebacterium bovis was
the predominant pathogen in milk compared to other sites (Benites et al., 2002).
Overview of the somatic cell count (SCC)
In the most breeding programs, SCC was used as indicator for mastitis susceptibility (Emanuelson
and Funke, 1991; Wilson et al., 1997). The dairy industry worldwide has imposed regulatory limits
for bulk milk somatic cells count (BMSCC). This limit in Croatia is 400.000 cells/ml (NN 102/2000
and NN 134/2007), in Chile 330.000 cells/ml (Tadich et al., 2003), in th USA 750.000 cells/ml
(Wilson et al., 1997). In the Netherlands arithmetic mean BMSCC per herd ranged from 67.000
cells/ml to 422.000 cells/ml for the 274 herds (average 204.000 cells/ml) (Barkema et al., 1998).
Factors associated with the high BMSCC are infection status of the quarter, number of quarters
infected, age of cows, stage of lactation, season of the year, stress, management (Wilson et al., 1997;
Barkema et al., 1999b). De Haas et al. (2002) showed that SCC was high shortly after parturition and
in the end of the lactation. Multiparous cows had generally higher SCC than heifers. CM caused by
Gram-negative pathogens such as E. coli, Klebsiella spp or Pseudomonas spp occurred much more
in herds with low BMSCC (Barkema et al., 1998). Therefore, low SCC herds are considered to have
higher levels of environmental mastitis or CM caused by Staph aureus has been observed much
more in herds with BMSCC lower than 150.000 cells/ml (Erskine et al., 1988; Elbers et al., 1998).
Barkema et al. (1998) also found lower values in BMSCC in cows infected with Staph aureus in the
study. In bacteriologically positive cows in Swiss (n=142) having from 190.000 to 566.000 cells/
ml Staph aureus (28.9%) and Coagulase-negative streptococci (28.2%) were the most frequently
isolated pathogens (Roesch et al., 2007). Although the IMI caused by contagious pathogens like
Staph. aureus and Str. agalactiae has been associated with high BMSCC (Keefe et al., 1997; Wilson,
et al., 1997; Tadich et al., 2003), some studies suggested that low SCC was also associated with high
incidence rate of CM (Elbers et al., 1998; Beaudeau et al., 2002). These opposite results depend on
many factors such as the accuracy of CM evaluation (Peeler et al., 2003), SCC measurement level
(Beaudeau et al., 2002) or management practices (Elbers et al., 1998). Erskine et al. (1988) compared
herds with a very high BMSCC (>700.000 cells/ml) and with a low BMSCC (<150.000 cells/ml)
and found a higher incidence of CM in herds with the low BMSCC. According to type of farm
management or management practices statistical higher values in SCC was found in organic than in
conventional farms (Roesch et al., 2007).
In Swiss, SCC showed linearly increase with increasing numbers of CMT-positive quarters and
there was close association between SCC and the number of CMT-positive quarters. About 85% of
the analyzed milk samples ranging from 190.000 to 566.000 cells/ml were bacteriologically positive
(Roesch et al., 2007). Suriyasathaporn et al. (2000) and Beaudeau et al. (2002) have noted that herds
with high proportion of cows with low SCCs appeared to be at increased risk of CM. Herds infected
with Str. agalactiae had higher BMSCC than uninfected herds (Keefe et al., 1997)
In some countries has been noted a decrease in BMSCC in dairy herds in recent years. In Dutch
dairy industry has been noted a decrease in BMSCC from 310.000 cells/ml in 1985 to 221.000
cells/ml in 1995 (Barkema et al., 1998). Osteras et al. (2006) also observed decreas in BMSCC from
173.000 to 113.000 cells /ml, but incidence of CM has increased. The reason for this is targeted
therapy of cows with the high SCC.
The same situation was observed in Croatia where SCC as well as total bacterial count (TBC)
decreased from 2003 to 2007 (Table 6). Mean SCC in 2003 and 2007 were 209.063 and 165.216
respectively and total bacterial count in raw milk 236.958 and 54.049 respectively (Dakić et al,
2007). According to the data of Laboratory for Milk Control in Križevci it could be seen that during
the observed period (2003-2007), about 70-80% of bulk milk contained less than 400.000cells/ml.
In 2003 and 2004 about 15% of samples had more than 600.000cells/m, but in 2005 and 2006 this
percentage was about 10%. During this period the mean of TBC of bulk tank milk samples containing
less than 100.000 was increased from about 25% in 2003 to about 65% in 2006. In January 2003 was
noted the highest percentage (about 70%) of milk samples containing TBC more than 400.000. In
December 2006 this percentage was about 20% (Dakić at al., 2007).
Influence of season on the level of BMSCC has been also observed. Busato et al. (2000) showed
that BMSCC in SCM in organic herds ranged from 79.000 to 142.000 cells/ml depending on season
of year and management. In winter BMSCC was lower (79.000 cells/ml) than in summer (94.000
cells/ml). In 300 Dutch dairy farms (Riekernik et al., 2007) the highest BMSCC was found in August
and September, but individual cow SCC was the highest in August and May. Dakić et al. (2007) also
reported seasonal variation in milk quality. Number of milk samples which fulfil the standards of EU
quality, was the highest in March and in December.
Conclusion
Accordinig to analysed epidemiological data, it could be concluded that the IMI is present in many
countries both developed and developing. The level of prevalence of SCM in some European countries
varied approximately from 9-53% but in developing countries increased up to 70%. Incidence rate
for CM varied approximately from 20 to 50 cases per 100 cow-years at risk. In developed countries
with incorporated control program, prevalence of SCM was reduced but CM continues to be a great
problem. On the other side, in developing countries SCM is more prevalent than CM. The level of
occurrence of IMI in Croatia stayed within the framework of the frequency of occurrence of IMI in
European countries. The most SCM were caused by Staphylococci, Streptocococi, Escherichia coli
and Corynebacterium bovis. The most frequent causes of IMI in Croatia were Staphylococcus aureus
and Streptococcus agalactiae. The most commonly isolated Coagulase negative staphylococci (CNS)
worldwide are Staph. chromogenes, Staph. epidermidis and Staph. similans. From the epidemiological
point of view, the dry period is the very important for environmental streptoccocal (Str. uberis and
Str. dysgalactiae) mastitis as well as for the Enterobacteriaceae (E. Coli, Klebsiella spp, Serratia
spp and Citrobacter spp) classifing as a opportunistic environmental pathogens. In Croatia the most
frequently isolated Enterobacteriaceae are E. coli, P. aeruginosa and Klebsiella spp.
In the most breeding programs, SCC was used as indicator for mastitis susceptibility. Factors
associated with the high BMSCC are infection status of the quarter, number of quarters infected, age
of cows, stage of lactation, season of the year, stress, management. CM caused by Gram-negative
pathogens such as E. coli, Klebsiella spp or Pseudomonas spp occurred much more in herds with
low BMSCC. IMI caused by contagious pathogens like Staph. aureus and Str. agalactiae has been
associated with high BMSCC, but some studies suggested that low SCC was also associated with
high incidence rate of CM caused by these pathogens. In some countries has been noted a decrease
in BMSCC in dairy herds in recent years. The same situation was observed in Croatia.
Despite of the decreasing trend some pathogen IMI in dairy cows, CM as well as streptococcal
and staphylococcal mastitis remain the most common IMI. The most important risk factors associated
with increased prevalecne of SCM are early lactation period, lesions on the skin of teat and /or udder,
rainy season, at least 8 parities and poor body conditions. The main risk factors associated with
increased incidence of CM are high milk production, very low bulk-milk SCC, leaking milk and
use of post milking teat disinfection. Obtained results differ in different counties because of specific
climatic, housing and dairy breed conditions. Since the results of risk analysis depend on country to
country, it could be useful to perform studies of risk analysis for IMI in Croatian climatic, housing and
dairy breed conditions. Although in Croatia some epidemiological studies were done, there is still a
need for additional epidemiological observational studies on risk for IMI as well as on prevalence of
SCM and incidence rate of CM in order to prevent udder health problem in dairy herds in Croatia.
References
1. Aeberhard K., R. Bruckmaier, J. W. Blum (1997): High-yielding dairy cows in Schwizerland. Agraforschung
4, 277-280
2. Aarestrup F. M., N. E. Jensen (1997): Prevalence and duration of intramammary infection in Danish heifers
during the peripartum period. Journal of Dairy Science. 80(2):307-312
3. Barkema H.W., Y. H. Schukken, T. J. G. M. Lam, M. L. Beiboer, G. Benedictus, A.Brand (1998): .
Management practice associated with low, medium and high somatic cell count in bulk milk. Journal of
Dairy Science. 81(7):1917-1927.
4. Barkema H.W., Y. H. Schukken, T. J. G. M. Lam, M. L. Beiboer, G. Benedictus, A.Brand (1999a):
Management practices associated with the incidence rate of clinical mastitis Journal of Dairy Science.
82(8):1643-1654
5. Barkema H.W., J. D. Van der Ploeg, Y. H. Schukken, T. J. G. M. Lam, G. Benedictus, A. Brands (1999b):
Management style and its association with bulk milk somatic cell count and incidence rate of clinical
mastitis Journal of Dairy Science. 82(8):1655-1663
6. Barnouin J, S. Bord, S.Bazin, M. Chassagne (2005): Dairy mamagement practices associated with
incidenece rate of clinical mastitis in low somatic dell score herds in France. J Dairy Sci 88, 3700-3709
7. Bartlett P.C., G. Y.Miller, S. E. Lance, L. E. Heider, (1992): Clinical mastitis and intramammary infections
on Ohio dairy farms. Prev Vet Med 12, 59-71
8. Beaudeau F., C. Fourichon, H. Seegers, N. Bareille (2002): Risk of clinical mastitis in dairy herds with a
high proportion of low individual milk somatic-cell countsVeterinary Medicine. 53(1-2):43-54
9. Benić, M. (2003): Mikrobiološki nalazi uzročnika upala mliječne žlijezde. Veterinarski dani 2003. Šibenik,
9-12. 10. 2003. Zbornik radova, 125-131
10. Benić, M. (2005): Učestalost mastitisa prije i nakon donošenja Pravilnika o kakvoći svježeg sirovog
mlijeka. Veterinarska stanica, 4, 233-238.
11. Benites, N. R., J. L. Guerra, P. A. Melville, E. O. Costa (2002): Aetiology and histopathology of bovine
mastitis of espontaneous occurence. J. Vet. Med. B, 49, 366-370
12. Benites, N. R., P. A. Melville, E. O. Costa (2003): Evaluation of the microbiological status of milk and
various structures in mammary glands from naturally infected dairy cows. Tropical Animal health and
Production, 35, 301-307
13. Bradley A. J., M. J. Green (2002): A study of the incidence and significance of intramammary enterobacterial
infections acquired during the dry period. Praktische Tierarzt. 83(8):724
14. Burnens A. P., P. Bonnemain, U. Bruderer, L. Schalch, L. Audige, D. Le Grand, F. Poumarat, J. Nicolet (1999):
Study on the seroprevalence of infections by Mycoplasma bovis in Swiss cattle including epidemiological
analysis of risk factors in a local population (Jura region). Schweizer Archiv fur Tierheilkunde. 141(10):455-
460
15. Busato A., P. Trachsel, M. Schallibaum, J. W. Blum (2000): Udder health and risk factors for subclinical
mastitis in organic dairy farms in Switzerland. Preventive Veterinary Medicine, 44(3-4):205-220
16. Cergolj, M., A. Tomašković, J. Grizelj, N. Prvanović, M. Benić, I. Curik, N. Maćešić, N.; Z. Geci (2004):
Influence of close monitoring of dairy cows on the incidence of clinical and subclinical mastitis // The 5th
middle-european buiatrics congress / Brydl, Endre (ur.),Budimpešta: Szolgaltato Kft, 2004. 352-354
17. Dakić, A., K. Kuterovac, I. Jakopović, D. Blažek, N. Pintić-Pukec, D. Lončar, D. Stručić, I. Runtić (2007):
Sustav kontrole mlijeka u RH od ideje do realizacije. Povodom 5. obljetnice rada. Hrvatski stočaski centar,
Križevci,
18. Degraaf T., R. H Dwinger (1996): Estimation of milk production losses dou to sub-clinical mastitis in
dairy cattle in Costa Rica . Preventive Veterinary Medicine, 26(3-4):215-222
19. Dego O. K., Tareke F (2003): Bovine mastitis in selected areas of southern Ethiopia Tropical Animal
Health & Production, 35(3):197-205.
20. Detilleux J. C., M. E. Kehrli, A. E. Freeman, L. K. Fox, D. H. Kelley (1995): Matitis of periparturient
Holstein cattle- a phenotypic and genetic study. Journal of Dairy Science. 78(10):2285-2293.
21. De Haas Y., H. W., Barkema, R. F. Veerkamp (2002):The effect of pathogen-specific clinical mastitis on the
lactation curve for somatic cell count. Journal of Dairy Science. 85(5):1314-1323
22. Edinger D., B. A. Tenhagen, W. Heuwieser, P. Kalbe, G. Klunder, B. Baumgartner (1999): Effect of early
puerperal mastitis in primiparous cows on production, somatic cell count and culling. Deutsche Tierarztliche
Wochenschrift. 106(11):470-474
23. Elbers A. R.W. J. D. Miltenburg, D. Delange, A. P. P. Crauwels, H. W. Barkema, Y. H. Schukken (1998):
Risk factor for clinical mastitis in a random sample of dairy herds from the southern part of the Netherland.
Journal of Dairy Science. 81(2):420-426
24. Ekesbo I., P. A. Oltenacu, B. Vilson , J. Nilsson (1994): A disease monitoring system for dairy herds. Vet
Rec 134, 270-273
25. Emanuelson U., H. Funke (1991): Effect of milk yield on the relatrionship between bulk somatic cell count
and prevalernce of mastitis. J Dairy Sci 74, 2479-2483.
26. Erskine, R. J., R. J. Eberhart, L. J. Hutchinson, S. B. Spencer, M. A. Cambell (1988): Incidence and type of
clinical mastitis in dairy herds with high and low somati cell counts. JAVMA 190:761-765
27. Ferguson J. D., G. Azzaro, M. Gambina, G. Licitra (2006): Prevalence of mastitis pathogens in Ragusa,
Sicily, from 2000 to 2006 Journal of Dairy Science. 90(12):5798-5813
28. Fourichon C., F Beaudeau, N. Bareille, H. Seegers (2001): Incidence of health disorders in dairy farming
systems in western France. Livestock Production Science, 68 (2-3):157-170.
29. Gianneechini R., C. Concha, R. Rivero, I. Delucci, J. M. Lopez (2002): Occurrence of clinical and sub-
clinical mastitis in dairy herds in the West Littoral Region in Uruguay Acta Veterinaria Scandinavica.
43(4):221-230
30. Giovannini G., A.Zecconi (2002): Field study on epidemiology of clinical mastitis in five Italian dairy
herds Milchwissenschaft-Milk Science International. 57(1):3-6
31. Gröhn Y. T., D. J.Wilson, R. N. Gonzalez, J. A. Hertl, H. Schulte, G. Bennett, Y. H. Schukken (2004):
Effect of pathogen-specific clinical mastitis on milk yield in dairy cows. Journal of Dairy Science.
87(10):3358-3374, 2004 Oct.
32. Guardo G. D., A. Battisti, U. Agrimi, R. Forletta,M. E. Reitano, P. Calderini (1997): Pathology of Serratia
marcescens mastitis in ccattle. Journal of Veterinary Medicine Series B. 44(9):537-546
33. Haltia L., T. Honkanen-Buzalski, I. Spiridonova, A. Olkonen, V. Myllys (2006):A study of bovine mastitis,
milking procedures and management practices on 25 Estonian dairy herds. Acta Veterinaria Scandinavica.
48:22
34. Jayarao B. M., B. E. Gillespie, M. J. Lewis, H. H. Dowlen, S. P. Oliver (1999): Epidemiology of
Streptococcus uberis intramammary infections in a dairy herd Journal of Veterinary Medicine Series B.
46(7):433-442
35. Kaneene J.B., H. S. Hurd (1990): The National Animal Health Monitoring System in Michigan. I Design,
data and frequencies of selected dairy cattle diseases. Prev Vet Med 8, 103-114
36. Karimuribo E. D., J. L. Fitzpatrick, C. E. Bell, E. S. Swai, D. M Kambarage, N. H. Ogden, M. Bryant, N. P.
French (2006): Clinical and subclinical mastitis in smallholder dairy farms in Tanzania: Risk, intervention
and knowledge transfer Preventive Veterinary Medicine. 74(1):84-98
37. Keefe G. P., I. R. Dohoo, E. Spangler (1997):Herd prevalence and incidence of Streptococcus agalactiae
in the dairy industry of Prince Edward Island . Journal of Dairy Science. 80(3):464-470
38. Kivaria F., B. Kabula, A. Manjurano, T. Loken, D. M. Kambarage (2994): Prevalence and determinants of
mastitis and milk-borne zoonoses in smallholder dairy farming sector in Kibaha and Morogoro districts in
eastern Tanzania Journal of Veterinary Medicine Series B. 51(3):123-128
39. Kivaria F. M., J. P. T. M. Noordhuizen, M. Nielen (2007): Interpretation of California mastitis test scores
using Staphylococcus aureus culture results for screening of subclinical mastitis in low yielding smallholder
dairy cows in the Dar es Salaam region of Tanzania Preventive Veterinary Medicine. 78(3-4):274-285
40. Kossaibati M. A., M. Hovi, R. J. Esslemont (1998): Incidence of clinical mastitis in dairy herds in England
Veterinary Record. 143(24):649-653
41. Makovec J. A., P. L. Ruegg (2003): Results of milk samples submitted for microbiological examination in
Wisconsin from 1994 to 2001 Journal of Dairy Science. 86(11):3466-3472.
42. Malinowski E., H. Lassa, A. Klossowska, S. Smulski, H. Markiewicz, A. Kaczmarowski (2006): A.
Etiological agents of dairy cows’ mastitis in western part of Poland Polish Journal of Veterinary Sciences.
9(3):191-194
43. McDougall S., D. G. Arthur, M. A. Bryan, J. J. Vermunt, A. M. Weir (2007): Clinical and bacteriological
response to treatment of clinical mastitis with one of three intramammary antibiotics New Zealand
Veterinary Journal. 55(4):161-170
44. Mdegela R.H., L. J. M. Kusiluka, A. M. Kapaga, E. D. Karimuribo, F. M. Turuka, A. Bundala, F. Kivaria,
B. Kabula, A. Manjurano, T. Loken, D. M. Kambarage (2004): Prevalence and determinants of mastitis
and milk-borne zoonoses in smallholder dairy farming sector in Kibaha and Morogoro districts in eastern
Tanzania Journal of Veterinary Medicine Series B. 51(3):123-128
45. Mungube E.O., B. A. Tenhagen, T. Kassa, F. Regassa, M. N. Kyule, M. Greiner, M. P. O. Baumann
(2004): Risk factors for dairy cow mastitis in the central highlands of Ethiopia Tropical Animal Health &
Production. 36(5):463-472
46. Myllys V., K. Asplund, E. Brofeldt, V. Hirvelakoski, T. Honkanenbuzalski, J. Junttila, L. Kulkas, O.
Myllykangas, M. Niskanen, H. Saloniemi, M. Sandholm, T. Saranpaa (1998): Bovine mastitis in Finland
in 1988 and 1995 – changes in prevalence and antimicrobial resistance. Acta Veterinaria Scandinavica.
39(1):119-126.
47. Osteras O., L. Solverod, O. Reksen (2006): Milk culture results in a large Norwegian survey - Effects of
season, parity, days in milk, resistance, and clustering Journal of Dairy Science. 89(3):1010-1023
48. Owens W.E., SD. C. Nickerson, R. L. Boddie, G. M. Tomita, C. H. Ray (2001): Prevalence of mastitis in
dairy heifers and effectiveness of antibiotic therapy Journal of Dairy Science. 84(4):814-817
49. Pankey J. W., R. P. Pankey, B. M. Barker, J. H. Williamson, M. W. Woolford, (1996): The prevalence of
mastitis in primiparous heifers in eleven Waikato dairy herds. N. Z. Vet. J. 44, 41-44.
50. Peeler E.J., M. J. Green, J. L. Fitzpatrick, L. E. Green (2003): The association between quarter somatic-cell
counts and clinical mastitis in three British dairy herds Preventive Veterinary Medicine. 59(3):169-180
51. Pitkala A., M. Haveri, S. Pyorala, V. Myllys, T. Honkanen-Buzalski (2004): Bovine mastitis in Finland 2001
- Prevalence, distribution of bacteria, and antimicrobial resistance Journal of Dairy Science. 87(8):2433-
2441
52. Reksen O., L. Solverod, A. J. Branscum, O. Osteras (2006): Relationships between milk culture results and
treatment for clinical mastitis or culling in Norwegian dairy cattle Journal of Dairy Science. 89(8):2928-
2937
53. Riekerink R. G. M. O., H. W. Barkema, H. Stryhn (2007): The effect of season on somatic cell count and
the incidence of clinical mastitis Journal of Dairy Science. 90(4):1704-1715
54. Roesch M., M. G. Doherr, W. Scharen, M. Schallibaum, J. W. Blum (2007): Subclinical mastitis in dairy
cows in Swiss organic and conventional production systems Journal of Dairy Research, 74(1):86-92
55. Sampimon O. C., J. C. A. Vernooij, D. J. Mevius, J. Sol (2007): Sensitivity to various antibiotics of
coagulase-negative staphylococci isolated from samples of milk from Dutch dairy cattle Tijdschrift voor
Diergeneeskunde. 132(6):200-204
56. Sommerhauser J., B Kloppert, W. Wolter, M. Zschock, A. Sobiraj, K. Failing (2003): The epidemiology
of Staphylococcus aureus infections from subclinical mastitis in dairy cows during a control programme
Veterinary Microbiology. 96(1):91-102
57. Steffl M., W. Philipp (2007): Experience in eliminating Staphylococcus aureus intramammary infections
from a high yielding dairy herd.Tieraerztliche Umschau. 62(5):255-261
58. Suriyasathaporn W., C. Heuer, E. N. Noordhuizen-Stassen, Y. H. Schukken (2000): Hyperketonemia and
the impairment of udder defense: a review . Veterinary Research. 31(4):397-412
59. Sviland S., S. Waage (2002): Clinical bovine mastitis in Norway Preventive Veterinary Medicine. 54(1):65-
78.
60. Tadich N., J. Kruze, G. Locher, L. E. Green (2003): Risk factors associated with BMSCC greater than
200,000 cells/ml in dairy herds in southern Chile Preventive Veterinary Medicine. 58(1-2):15-24
61. Tenhagen B. A., G. Koster, J. Wallmann, W. Heuwiese (2006): Prevalence of mastitis pathogens and their
resistance against antimicrobial agents in dairy cows in Brandenburg, Germany Journal of Dairy Science.
89(7):2542-2551
62. Thorberg B. M., I. Kuhn, F. M. Aarestrup, B. Brandstrom, P. Jonsson, M. L. Danielsson-Tharn (2006):
Pheno- and genotyping of Staphylococcus epidermidis isolated from bovine milk and human skin Veterinary
Microbiology. 115(1-3):163-172
63. Todhunter D. A., K. L. Smith, J. S. Hogan (1995):Environmental Streptococcal intramammary infection of
the bovine mammary gland. Journal of Dairy Science. 78(11):2366-2374.
64. Topolko S., M. Benić (1997.):Aktualni problemi i epizootiološko stanje subkliničkih mastitisa u
minifarmskoj proizvodnji mlijeka. (Actual problems and epizootiological state of subclinic mastites in
mini-farm milk production). Praxis veterinaria 45 (1-2) 69-76
65. Waage S., S. Sviland, S. A. Odegaard (1998): Identification of risk factors for clinical mastitis in dairy
heifers. Journal of Dairy Science. 81(5):1275-1284
66. Watts, J. L., W. E. Owens (1989): Prevalence od staphylococcal species in four dairy herds. Res. Vet. Sci.
41, 1-4
67. Whist, A. C., O. Osteras, L. Solverod (2007): Staphylococcus aureus and Streptococcus dysgalactiae
in Norwegian herds after introduction of selective dry cow therapy and teat dipping Journal of Dairy
Research. 74(1):1-8.
68. White, D. G., R. J. Harmon, J. E. S Matos, B. E. Langlois (1989): Isolation and identification of colagulase
negative Staphyloccocus species from bovine sites and streak canals of nulliparous heifers. J. Dairy Sci,
72, 1886-1892.
69. White L. J., Y. H. Schukken. T. J. Lam, G. F. Medley, M. J. Chappell (2001): A multispecies model for
the transmission and control of mastitis in dairy cows Epidemiology & Infection, 127(3):567-576
70. Wilson D. J., R. N. Gonzalez, H. H. Das (1997): Bovine mastitis pathogens in New York and Pennsylvania:
Prevalence of effects on somatic cell count and milk production. Journal of Dairy Science. 80, 2592-2598
71. Workineh S., M. Bayleyegn, H. Mekonnen, L. N. D Potgieter (2002): Prevalence and aetiology of
mastitis in cows from two major Ethiopian dairies. Tropical animal health and production, 34(1):19-25
72. Wolfova, M., : Stipkova, J. Wolf (2006): Incidence and economics of clinical mastitis in five Holstein
herds in the Czech Republic Preventive Veterinary Medicine. 77(1-2):48-64
73. Zadoks R. N., H. G. Allore, H. W. Barkema, O. C. Sampimon, G. J. Wellenberg, Y. T. Grohn , Y. H.
Schukken (2001): Cow- and quarter-level risk factors for Streptococcus uberis and Staphylococcus aureus
mastitis Journal of Dairy Science. 84(12):2649-2663
Bovine MHC Class II Structure-Function Relationships:
Implications for Vaccine Development
ODNOSI GRAĐE I ULOGE GOVEĐIH MHC KLASE II: IMPLIKACIJE

ZA RAZVOJ VAKCINE
1
Immunology Section, Department of Pathobiology, Faculty of Veterinary Medicine,&3Biotechnology research
institute, Ferdowsi University of Mashhad, Iran. alireza_haghparast@yahoo.com
2
Department of Immunology, Institute of Infectious Diseases & Immunology, Utrecht University, Netherlands
Abstract
T cell mediated immunoregulation plays an important role in protective immunity. The central molecular
interaction, which dictates the selection of the specificity of T cells, depends on the interaction between MHC
molecules and peptides derived from degraded antigenic structures. Here, we studied this interaction between
bovine MHC class II molecules and peptides derived from foot and mouth disease virus (FMDV). Progress
during the last decade in our understanding of the mechanisms underlying antigen recognition by T lymphocytes,
opens the possibility to apply this knowledge in new approaches for the development of vaccines.
Key words: BoLA-DR molecules, MHC-peptide binding assay, T cell epitopes, FMDV
Sažetak
Imunoregulacija posredovana T stanicama ima važnu ulogu u imunosti. Središnja molekulska interakcija,
koja određuje vrstu specifičnosti T stanica, ovisi o interakciji između MHC molekula i peptida koji potječu
od razgrađenih antigenih struktura. U ovoj studiji proučavane su interakcije goveđih MHC molekula klase II i
peptida nastalih od virusa slinavke i šapa (FMDV). Napredak ostvaren tijekom zadnjeg desetljeća u shvaćanju
mehanizama koji su temelj antigenog prepoznavanja od strane T limfocita, otvara mogućnost primjene tog
znanja u novim pristupima za razvoj vakcina.
Ključne riječi: BoLA-DR molekule, test vezanja MHC-peptida, epitopi T stanice, FMDV
Introduction:
Progress during the last decade in our understanding of the mechanisms underlying antigen
recognition by T lymphocytes, opens the possibility to apply this knowledge in new approaches for
the development of vaccines. Vaccines induce protective immunity: a status of long-lasting pathogen-
specific immunological memory protecting against disease caused by the pathogen. T cell mediated
immunoregulation plays an important role in protective immunity. This paper highlights fundamental
aspects of T cell mediated immunity in the bovine species. The central molecular interaction, which
dictates the selection of the specificity of T cells, depends on the interaction between MHC molecules
and peptides derived from degraded antigenic structures. Here, we studied this interaction between
bovine MHC class II molecules and peptides derived from foot and mouth disease virus (FMDV).
Although bovine immunology does not offer us all the tools and reagents that are available in species
like man and mouse, cattle and FMDV together offer a unique combination of tools for our goals.
FMDV is a disease causing a major threat to cattle farming, and extensive efforts have been made to
control the disease, including attempts to use vaccines prepared from short peptides covering areas
of the virus where dominant antibody binding sites are located. As a matter of fact, cattle is the only
species with so many reported studies on vaccination with peptides. This information is instrumental
for our approach. The MHC in cattle is well defined, and our access to animals homozygous for
their MHC haplotypes is instrumental. When animals are heterozygous, and therefore two different
haplotypes are expressed, it is almost impossible to analyse the function of individual molecules at
the molecular level. The combination of FMDV and cattle allows us to study the vaccination against
a viral disease in its natural host from the molecular level in vitro up to in vivo immunisation and
challenge. Previous work on the use of peptides derived from the protein VP1 of FMDV, containing
the major B cell epitope of the virus, which lack solid protection, has generated the question whether
an anti-viral T cell helper response is required for protection against FMDV at the time of challenge.
Bovine T cell responses against. Several T cell epitopes of FMDV were defined and studied by us
in the context of animals homozygous for their MHC. By applying an in vitro priming-restimulation
assay with bovine T cells, the potential T cell epitopes of FMDV were identified in the context of
three frequently expressed BoLA-DRB3 alleles. Furthermore we studied whether these epitopes can
stimulate a T cell response cross-reactive with virus as antigen, in our opinion a prerequisite for
protection. At least one T cell epitope, namely VP4 [20-34] appeared to be cross-reactive with the
virus and also to be promiscuous in the context of the three haplotypes tested.
Materials & Methods:
The animals used in this study were Holstein-Frisian cattle, homozygous for both MHC class I
and II haplotypes. Viral antigen was prepared as described by Van Lierop et al. The sequence of all
peptides used in this study was based on the published sequence of FMDV strain A10Holland.. They
were prepared by automated simultaneous multiple peptide synthesis (SMPS). In vitro priming of T
lymphocytes and lymphocyte proliferation assays were performed as described by Haghparast et al.
The purification of bovine DR molecules and the development of a MHC class II-peptide binding
assay was performed as described by Haghparast et al.
Results & Discussion:
The first major issue that we addressed in the present study was to determine the restriction on
antigen presentation by bovine MHC class II molecules in relation to their polymorphism. In order
to study the molecular interactions between antigenic peptides and bovine MHC class II DR (BoLA-
DR) molecules, we developed a competitive MHC class II-peptide binding assay with bovine MHC
class II molecules. Emphasis was given to DR molecules, since previous studies from our laboratory
suggested that the presentation of the T cell epitopes of FMDV was primarily mediated by BoLA-DR
molecules. The suggestion was substantiated by blocking experiments with a monoclonal antibody
specific for BoLA-DR molecules. For the conclusive results, the MHC-peptide binding assay was
used. Restriction of the T cell epitopes to certain MHC class II haplotypes was indeed reflected at the
level of MHC-peptide interaction. Besides the fact that we developed a tool that can contribute to the
improvement of our knowledge on bovine immunology, it confirmed our previous hypothesis on the
presentation of the defined T cell epitopes of FMDV at the molecular level. This explained that the
bovine MHC molecules can dictate whether an epitope becomes available for recognition or not in
the context of that MHC haplotype. This has direct consequences for the use of peptides in outbred
species, as vaccine candidates as well as in other applications.
The mimicry of T cell responses induced by the retro-inverso(RI) peptides corresponding to
the defined T cell epitopes of FMDV and whether this response might be cross-reactive with the L-
peptides and the virus was also analysed in this study. Due to their higher resistance to proteolytic
degradation and their ability to induce high and cross-reactive antibody titers, RI-peptides seemed to
be interesting candidate structures to mimic the cognate epitopes and thereby persist in the biological
fluid for longer periods of time. The successful attempt of Muller to induce high antibody titers by
the RI-VP1 [141-159] peptide, which were cross-reactive with the natural L-peptide and the virus,
stimulated us to use this concept in the context of T cell mediated immunity. To explore the possibility
to generate T cell responses against RI-peptide and to study cross-reactivity to the natural epitope,
we used the same strategy that was applied in the first part of this study. An extremely poor T cell
response and lack of mimicry to the natural L-peptides was found. Consequently, we investigated the
RI-peptides by our established competitive MHC-peptide binding assay. We analysed the interaction
of RI-analogues of the FMDV derived peptides with purified bovine DR molecules in all possible
combinations, and showed that the weak T cell response and lack of mimicry was accompanied by
an insufficient MHC-peptide interaction. Our study showed that the RI-peptides are not suitable to
be used as peptidomimetics of T cell epitopes, because of poor binding to MHC class II molecules,
which is a prerequisite for T cell stimulation. However, one can not exclude their application as
therapeutic agents when targeted to other interactions than with the MHC molecules. In the context
of the previously successful attempts on antibody induction by the RI-peptides, our findings suggest
that the help for the antibody response in those cases most likely came from the carrier molecules
that were coupled to these peptides.
The experimental lack of mimicry between the natural L-peptides of defined T cell epitopes of
FMDV and their RI-counterparts due to insufficient MHC-peptide binding was analysed in more
detail by molecular modelling. Employing this approach, we were able to elucidate in more detail,
how RI-peptides interact with MHC class II molecules. First, the three dimensional structure of the
bovine MHC class II was modelled. The BoLA structures were modelled using the knowledge of
the crystal structure of HLA-DR1 complexed with the influenza haemagglutinin (HA) epitope. We
observed that it was possible to use the bovine MHC class II models as a basis to design peptide
binding motifs. The prediction of the motifs for the three BoLA-DR structures was based only
on MHC structural information. There was no defined motif for bovine MHC class II molecules
reported so far. The biological properties of the predicted motifs were verified by the competitive
MHC-peptide binding assay. The structural and biological results were compatible and correlated in
three out of four motifs. This implied that the models could be used for further analysis. Molecular
analysis of interaction patterns of RI-peptides with MHC class II molecules revealed loss of both
energy interactions and hydrogen bonding patterns of RI-peptides with MHC class II molecules.
A motif prediction based solely on MHC structure can pave the way for further applications
in more species, and it might have an impact on finding potential candidate epitopes for vaccine
development.
References:
1. Batalia, M. A., and E. J. Collins. 1997. Peptide binding by class I and class II MHC molecules. Biopolymers.
43:281-302.
2. Benkirane, N., M. Friede, G. Guichard, J. P. Briand, M. H. Van Regenmortel, and S. Muller. 1993.
Antigenicity and immunogenicity of modified synthetic peptides containing D-amino acid residues.
Antibodies to a D-enantiomer do recognize the parent L-hexapeptide and reciprocally. J Biol Chem.
268:26279-85.
3. Benkirane, N., G. Guichard, J. P. Briand, S. Muller, F. Brown, and M. H. Van Regenmortel. 1996.
Mimicry of viral epitopes with retro-inverso peptides of increased stability. Dev Biol Stand. 87:283-91.
4. Benkirane, N., G. Guichard, M. H. Van Regenmortel, J. P. Briand, and S. Muller. 1995. Cross-
reactivity of antibodies to retro-inverso peptidomimetics with the parent protein histone H3 and chromatin
core particle. Specificity and kinetic rate-constant measurements. J Biol Chem. 270:11921-6.
5. Briand, J. P., N. Benkirane, G. Guichard, J. F. Newman, M. H. Van Regenmortel, F. Brown, and S.
Muller. 1997. A retro-inverso peptide corresponding to the GH loop of foot-and-mouth disease virus elicits
high levels of long-lasting protective neutralizing antibodies. Proc Natl Acad Sci U S A. 94:12545-50.
6. Briand, J. P., G. Guichard, H. Dumortier, and S. Muller. 1995. Retro-inverso peptidomimetics as new
immunological probes. Validation and application to the detection of antibodies in rheumatic diseases. J
Biol Chem. 270:20686-91.
7. Chorev, M., and M. Goodman. 1995. Recent developments in retro peptides and proteins--an ongoing
topochemical exploration. Trends Biotechnol. 13:438-45.
8. Fletcher, M. D., and M. M. Campbell. 1998. Partially Modified Retro-Inverso Peptides: Development,
Synthesis, and Conformational Behavior. Chem. Rev. 98:763 - 795.
9. Jameson, B. A., J. M. McDonnell, J. C. Marini, and R. Korngold. 1994. A rationally designed CD4
analogue inhibits experimental allergic encephalomyelitis. Nature. 368:744-6.
10. Jardetzky, T. S., J. H. Brown, J. C. Gorga, L. J. Stern, R. G. Urban, J. L. Strominger, and D. C. Wiley.
1996. Crystallographic analysis of endogenous peptides associated with HLA- DR1 suggests a common,
polyproline II-like conformation for bound peptides. Proc Natl Acad Sci U S A. 93:734-8.
11. Jensen, P. E. 1997. Peptide binding and antigen presentation by class II histocompatibility glycoproteins.
Biopolymers. 43:303-22.
12. Marino, M., A. Ippolito, and G. Fassina. 1999. Inhibition of experimental autoimmune encephalomyelitis
in SJL mice by oral administration of retro-inverso derivative of encephalitogenic epitope P87-99. Eur J
Immunol. 29:2560-6.
13. Muller, S., G. Guichard, N. Benkirane, F. Brown, M. H. Van Regenmortel, and J. P. Briand. 1995.
Enhanced immunogenicity and cross-reactivity of retro-inverso peptidomimetics of the major antigenic site
of foot-and-mouth disease virus. Pept Res. 8:138-44.
14. Stern, L. J., J. H. Brown, T. S. Jardetzky, J. C. Gorga, R. G. Urban, J. L. Strominger, and D. C. Wiley.
1994. Crystal structure of the human class II MHC protein HLA-DR1 complexed with an influenza virus
peptide. Nature. 368:215-21.
15. Van Lierop, M. J., P. R. Nilsson, J. P. Wagenaar, J. M. Van Noort, J. D. Campbell, E. J. Glass, I. Joosten,
and E. J. Hensen. 1995. The influence of MHC polymorphism on the selection of T-cell determinants of
FMDV in cattle. Immunology. 84:79-85.
16. van Lierop, M. J., K. van Maanen, R. H. Meloen, V. P. Rutten, M. A. de Jong, and E. J. Hensen.
1992. Proliferative lymphocyte responses to foot-and-mouth disease virus and three FMDV peptides after
vaccination or immunization with these peptides in cattle. Immunology. 75:406-13.
17. van Lierop, M. J., J. M. van Noort, J. P. Wagenaar, V. P. Rutten, J. Langeveld, R. H. Meloen, and E.
J. Hensen. 1994. T cell-stimulatory fragments of foot-and-mouth disease virus released by mild treatment
with cathepsin D. J Gen Virol. 75:2937-46.
18. van Lierop, M. J., J. P. Wagenaar, J. M. van Noort, and E. J. Hensen. 1995. Sequences derived from the
highly antigenic VP1 region 140 to 160 of foot-and-mouth disease virus do not prime for a bovine T-cell
response against intact virus. J Virol. 69:4511-4.
19. Van Regenmortel, M. H., G. Guichard, N. Benkirane, J. P. Briand, S. Muller, and F. Brown. 1998. The
potential of retro-inverso peptides as synthetic vaccines. Dev Biol Stand. 92:139-43.
20. Van Regenmortel, M. H., and S. Muller. 1998. D-peptides as immunogens and diagnostic reagents. Curr
Opin Biotechnol. 9:377-82.
21. Haghparast A, Wauben MH, Grosfeld-Stulemeyer MC, van Kooten P, Hensen EJ. 2000. Selection of
T-cell epitopes from foot-and-mouth disease virus reflects the binding affinity to different cattle MHC class
II molecules. ImmunogeneticsJul;51(8-9):733-42.
Parasitology
Parazitologija
ANALYSIS OF THE PREVALENCE AND PARASITIC INTENSITY BY
LUNG NEMATODA IN ROE DEER (Capreolus capreolus) HUNTED
IN GALICIA (NW SPAIN): EFFECT OF AGE
ANALIZA POJAVNOSTI I INTENZITETA INVAZIJE PLUĆNIM

NEMATODIMA U SRNA (Capreolus capreolus) ODSTRIJELJENIH
U GALICIJI (SZ ŠPANJOLSKA): UTJECAJ DOBI
Díez-Baños, P., Dacal, V., Vázquez, L., Pardo, M., Cienfuegos, S., Díez-Baños, N. **,
López, C., Panadero, R., Morrondo, P.
Parasitología y Enfermedades Parasitarias. Dpto. Patología Animal. Facultad de Veterinaria. Universidad de

Santiago de Compostela. 27002. Lugo.
** Parasitología y Enfermedades Parasitarias. Dpto. Sanidad Animal. Facultad de Veterinaria. Universidad
de León. 24071. León.
ABSTRACT
Total of 75 roe deer hunted in different forest districts in Lugo province (NW Spain) within May – October
2007, were necropsied and the respiratory tracts examined for bronchopulmonary nematodes. The recovery
of lung nematodes was realized by longitudinally opening the trachea and big bronchia to collect adults of
Dictyocaulidae. Lung surface was also examined, and the localization and distribution of the lesions caused
by nematode Protostrongylidae were recorded. Finally, the lesion areas tissue were cut up into small pieces,
weighed and homogenized prior to use the Baermann-Wetzel method to recover the 1st stage larvae (L1) and to
assess the number of L1 per gram of lung (lpg). Data were analyzed by taking into account the age of animals,
considering three groups: G-1 (< 3 yr), G-2 (3-5 yr) and G-3 (>6 yr). On the pulmonary surface, especially in
the apexes of caudal lobes, macroscopic lesions characteristic of V. capreoli infection were observed in 90.
3% of the animals. Nor lesions or broncopulmonary nematoda larvae were observed in the other lungs. The
prevalence of D. noerneri was 16% by the larval migration probe, and a low infection intensity was achieved.
When considering age, a similar percentage of infection was obtained in young animals (G-1= 16. 7%) and in
the adult ones (G-2= 19. 2%). However, a low nematode larvae burden was recovered. D. noerneri larvae were
not observed in roe deer from G-3. Fifty-one percent of the animals had L1 of V. capreoli and no significant
differences were achieved by considering the age of roe deer. The number of lpg was significantly higher in G-1
and G-2 than in G-3.
Sažetak
Sveukupno je razudbom pretražen nalaz bronhopulmonarnih nematoda u dišnom sustavu 75
srna odstrijeljenih u različitim šumovitim područjima, u provinciji grada Luga (sjeverozapadna
Španjolska) od svibnja do listopada 2007. Plućni nematodi dobiveni su longitudinalnim otvaranjem
traheje i velikih bronha kako bi se dobili adulti Dictyocaulidae. Pretraživana je površina pluća, te
su bilježene lokalizacija i raspored lezija uzrokovanih nematodima Protostrongylidae. Na kraju,
tkivo u području lezija je isecirano u male komadiće, izvagano i homogenizirano prije nego li je
primijenjena Baermann - Wetzel metoda dobivanja ličinki 1 stupnja (L1) i određen broj L1 po gramu
pluća (lpg). Podatci su analizirani uzimajući u obzir dob životinja, koje su u tom smislu podijeljene
u 3 skupine: G1 (<3 god.), G2 (3-5god.) i G3 (>6god.). Na površini pluća, posebno u apeksima
kaudalnih režnjeva, primijećene su makroskopske lezije karakteristične za invaziju V. capreoli u
90,3% životinja. U preostalim plućima nisu primijećene ni lezije ni ličinke bronhopulmonarnih
nematoda. Utvrđena je pojavnost D. noerneri probom migracije ličinki od 16%, pri čemu je intenzitet
invazije bio nizak. Glede dobi, slični postotci invadiranosti primijećeni su u mladih (G1 = 16,7%)
i u odraslih životinja (G2 = 19,2%). Ipak, dobiveno je malo ličinki nematoda. Ličinke D. noerneri
nisu primijećene u skupini srna iz skupine G3. 51% životinja imalo je L1 V. capreoli pri čemu nisu
primijećene znakovite razlike glede dobi srna. Broj lpg bio je znakovito viši u skupinama G1 i G2,
nego u G3.
INTRODUCTION
Roe deer, the smallest of Spanish cervids, are widespread in the northwest of Spain and especially
in Galicia, where roe deer are of considerable economic value as a source of meat. In addition, they
are a sport hunting species, which also generates economic advantages.
The main lungworms of roe deer are Dictyocaulus noerneri, located in the bronchi and
bronchioles, and Varestrongylus capreoli found in the lung tissue parenchyma. Both nematodes were
reported for the first time in Spain by Carrillo et al. (1995).
The work described herein is part of a larger study examining the parasite fauna of roe deer in
northwest Spain. The main objective was to establish the prevalence and intensity of infection by
bronchopulmonary nematodes in roe deer, as well as the influence of age of animals.

Between May and October 2007, a total of 75 roe deer were necropsied and the respiratory tracts
examined for bronchopulmonary nematodes.
The respiratory tract, including lungs and trachea, was recovered from each animal. The trachea
and main bronchi were opened longitudinally with a pair of scissors, carefully examined and, after
placing them under running water, the lavage was poured into a container to collect the larvae present.
A visual inspection of dorsal and basal edges of the lungs was carried out and the presence and
distribution of verminous nodules were recorded. After that we dissected carefully the pulmonary
parenchyma, specially damaged areas, under a dissecting microscope to extract specimens adults of
V. capreoli. Immediately after we, cut up then tissue pulmonary into small pieces and placed in 8–10
small bags, using the Baermann–Wetzel method to assess the number of first stage larvae (L-1) per
gram (lpg). The L-1 count was carried out using Favati or McMaster chambers.
Data were analyzed by taking into account the age of animals, considering three groups: G-1 (<
3 yr), G-2 (3-5 yr) and G-3 (>6 yr).
RESULTS
As reflected in Table 1 when considering age, a similar percentage of infection by D. noerneri
was obtained in young animals and in the adult ones, and the same results are seen so in the parasitic
burden. Statistical differences in the prevalence and intensity of infection by V. capreoli by taking
into account the age of the roe deers were not recorded.
Table 1: Lungworm infection in roe deer from Galicia during 2007
Prevalence (%) Intensity (lpg)

Age
D. noerneri V. capreoli D. noerneri V. capreoli
G-1 16. 7 50 1. 7 5. 7
G-2 19. 2 50 1. 5 4. 9
G-3 0 54. 5 0 0. 2
On the pulmonary surface, especially on the border of caudal lobes, macroscopic lesions (Figure
1) characteristic of V. capreoli infection were observed in 90. 3% of the examined animals.
Figure 1: Locations of the main spot lesions caused by Varestrongylus capreoli
The prevalence (16%) and intensity of infection ( x = 1. 6 lpg) of D. noerneri was low that of V.
capreoli (51%, x = 3. 6 lpg).
Discussion
In this study, we have identified two different species of bronchopulmonary nematodes in roe
deer: V. capreoli and D. noerneri. Both species are considered highly specific for roe deer. Those
species were previously reported in Spain by Carrillo et al. (1994, 1995), and Panadero et al. (2001).
These results agree with those of Drózdz et al. (1992), who also recorded these two species in roe
deer from Poland.
V. capreoli is considered a specific parasite of roe deer, in which it causes important
pathomorphological changes in their lungs. The distribution and intensity of the lesions found in the
lungs are in agreement with previous studies developed in the same area (Carrillo et al., 1994, 1995,
Panadero et al., 2001).
V. capreoli was much more abundant than D. noerneri. The tendency of prevalence to increase
with host age seems to be a common pattern in Protostrongylids parasitizing domestic ruminants.
Bidoveç et al. (1985) reported that the lungs of the oldest animals were the most parasitized. This
is of great epizootiologic interest, since the oldest roe deer would play a very active part in the
maintenance of the infection, among young animals.
In the case of Dictyocaulus, an acquired immunity could have two consequences first becoming
effective against establishment of reinfection, and secondly can affect the mortality rate of developing
larvae (Scott et al. 1996), so this would explain the low infection rate and larval counts found in this
study. Larvae from Dictyocaulus were not found in the oldest roe deer, which agrees with previous
data on bronchopulmonary parasites in chamois (Rupicapra rupicapra), (Díez-Baños et al., 1990).
The absence of Dictyocaulus in chamois was related to the age of examined animals
Our results seem to indicate that the youngest animals had the greatest prevalence and
intensity of infection by D. noerneri and V. capreoli. Besides this, although the high prevalences of
bronchopulmonary nematodes in roe deer from Galicia, parasitic burdens are at low levels, and in
general, do not represent a direct risk for their lives. However, it is possible that lung lesions, caused
by the former worms, facilitate the appearance of problems due to other pathogen agents that reduce
the respiratory function in the animals.
ACKNOWLEDMENTS
We are grateful to Food and Agrarian National Technology Institute (MEC), Spain by the concession of the
Research Project FAU2006-00006-00-00, and Xunta de Galicia (Spain) by the Research Project 07MRU034261PR
and especially to Galician hunters and Federación Galega de Caza.
REFERENCES
Bidoveç, A., Valentincić, S., Kuses, M. (1985). Parasitic pneumonia in chamois (Rupicapra rupicapra L.) in
Slovenia. In: Lovary, S. (Ed.), The Biology and Management of Mountain Ungulates. pp. 240–242.
Carrillo, E. B., Morrondo, P., Díez-Baños, N., Díez-Baños, P., López, J. L. (1994). First report of Dictyocaulus
noerneri Railliet et Henri, 1907 (Nematoda: Trichostrongyloidea) in Spain. Research and Reviews in
Parasitology, 54: 265–267.
Carrillo, E. B., Díez-Baños, N., Morrondo, P., López, J. L., Díez-Baños, P. (1995). Infección por Varestrogylus
capreoli (Stroh and Schmid, 1938) Dougherty, 1945, en pulmones de corzo (Capreolus capreolus) en
Galicia. IV Congreso Ibérico de Parasitología. Santiago de Compostela, España. 24-28 julio 1995.
Díez-Baños, P., Díez-Baños, N., Morrondo, M. P., Cordero Del Campillo, M., (1990). Bronchopulmonary
helminths of chamois (Rupicapra rupicapra parva) captured in northwest Spain: assessment from first
stage larvae in faeces and lungs. Annales de Parasitologie Humaine et Comparée, 65: 74–79.
Drózdz, J., Demiaszkiewicz, A. W., Lachowicz, J. (1992). The helminth fauna of the roe deer Capreolus
capreolus (L.) in a hunting area inhabited by red deer, elk and European bison (Borecka Forest, Poland)
over the yearly cycle. Acta Parasitologica Polonica, 37: 83–88.
Panadero, R., Carrillo, E. B., López, C., Díez-Baños, N., Díez-Baños, P., Morrondo, P. (2001). Bronchopulmonary
helmintos of roe deer (Capreolus capreolus) in the northwest of Spain. Veterinary Parasitology, 99: 221-
229.
Scott, C. A., McKeand, J. B., Devaney, E. (1996). A longitudinal study of local and peripheral isotype/subclass
antibodies in Dictyocaulus viviparus-infected calves. Veterinary Immunology and Immunopatholog, 53:
235–247.
INFLUENCE OF THE LIVER FLUKE-CONTROL PRACTICES ON THE
PREVALENCE AND EGG-OUTPUT IN SEMIEXTENSIVE BEEF CATTLE
HERDS
UTJECAJ POSTUPAKA KONTROLE JETRENIH METILJA NA

POJAVNOST I POLUČIVANJE JAJAŠACA U SEMIEKSTENZIVNO
DRŽANIH STADA TOVNIH GOVEDA
Díaz, P., J. Pedreira, J. L. Suárez, R. Sánchez-Andrade, R. Panadero, A. Paz-Silva,

P. Díez-Baños, P. Morrondo
Animal Pathology Department. Faculty of Veterinary Medicine. University of Santiago of Compostela.

Campus Universitario s/n. 27002 LUGO (Spain). E-mail: mopela@lugo.usc.es. Tel. 34982285900.
ABSTRACT
In order to assess the influence of the parasite-control methods on the Fasciola hepatica-prevalence and egg-
excretion values, 1158 faecal samples were collected from 173 semiextensive beef cattle farms. Samples were
directly taken from the rectum of each animal, and they were examined by means of the sedimentation technique.
A questionnaire was developed that asked producers for information on their parasite control practices. It was
showed that the only control practice used in the farms was chemotherapy, and 31% of the owners reported to
never use dewormers. Most of the farmers followed the veterinary advice (98%) for choosing the anthelmintic
product, mainly benzimidazoles (80%) in autumn (59%). Nevertheless, it must be pointed out that none of
the interviewed owners carried out coprological examinations neither before nor after anthelmintic treatments,
and quarantine is not a usual management measure.Herd-level prevalence was slightly lower in farms where a
fasciolicide was administered (62%) than in those where an anthelmintic with no efficacy against the trematode
was employed (65%). On the contrary, egg-output values were higher in herds dewormed with fasciolicides
(Me= 9 epg) than in the rest of farms (Me= 6 epg). The limited fasciolicide efficacy detected in the present study
is due to the no adoption of suitable complementary measures for the control of fasciolosis. For this reason,
application of integrated control measures is needed, just as a correct diagnosis of the disease, employment of
suitable treatments and an appropriate management for control of F. hepatica external stages. It is worth noting
the importance of the application of management measures which change the habitats of the intermediate host,
the freshwater snail Lymnaea spp., as draining or whitewashing of humid or flooded pastures.
Sažetak
U svrhu određivanja učinkovitosti antiparazitskih tretmana na pojavnost Fasciola hepatica i količinu
polučenih jajašaca, sakupljeno je 1158 uzoraka fecesa sa 173 farme semiekstenzivno držanih tovnih goveda.
Uzorci su uzimani izravno iz rektuma svake od životinja te su pretraženi sedimentacijskom tehnikom. Izrađena
je anketa za farmere u svezi informacija o provođenim antiparazitskim tretmanima. Utvrđeno je kako je jedini
postupak bio (kemo)terapijski, a 31% vlasnika je potvrdilo da nikada nije koristilo antiparazitike. Većina je
farmera prihvatila veterinarski savjet (98%) u izboru antihelmintika, uglavnom benzimidazola (80%) u jesen
(59%). Ipak, važno je istaknuti da nijedan od intervjuiranih vlasnika nije proveo koprološku pretragu kako prije,
tako niti nakon antihelmintskog tretmana te da karantena nije uobičajena mjera u upravljanju farmom. Razina
pojavnosti na razini stada je bila lagano niža na farmama gdje je apliciran fasciolicid (62%), nego na onima gje
je apliciran antihelmintik neučinkovit prema trematodima (65%). Nasuprot tome, količina izlučenih jajašaca bila
je viša u stadima tretiranim fasciolicidima (Me = 9epg), nego na preostalim farmama (Me = 6epg). Ograničena
učinkovitost fasciolicida koja je utvrđena u ovoj studiji posljedica je nepostojanja prikladnih komplementarnih
mjera za kontrolu fascioloze. Zbog toga je neophodna primjena sustavnih kontrolnih mjera, jednako kao i
korektna dijagnoza bolesti, korištenje prikladnog tretmana te prikladnog upravljanja kontrolom vanjskih stadija
F. hepatica. Bitno je istaknuti važnost primjene mjera koje mijenjaju habitat domaćinu posredniku, vodenom
pužu Lymnaea spp., isušivanjem ili kloriranjem vlažnih ili naplavnih pašnjaka.
INTRODUCTION
Rubia Gallega is an autochthonous beef cattle breed which is located mostly in Galicia (NW
of Spain). Its meat has an excellent quality and it is employed to make good use of mountainous
pastures because its rusticity and easy adaptation to difficult environments. These animals are mainly
managed in a semiextensive system of breeding, and for this reason, the risk of parasite infection is
high.
Fasciolosis is a parasitic disease caused by the trematode Fasciola hepatica, which has an
important negative impact on the animal health, producing substantial economic losses (González-
Lanza et al., 1989; Díaz et al., 2001).
High prevalences by F. hepatica were detected in cattle from Spain, and particularly from Galicia
(Díez et al., 1994; Morrondo et al., 2003; Paz et al., 2003; Díaz, 2006). However, there are no studies
about methods to keep under control this important parasitic disease. For this reason, a questionnaire
was developed to know the parasite control methods employed and the possible relationship between
the application of different anthelmintics and the prevalence of infection by F. hepatica in Rubia
Gallega cattle from Galicia.

From 2002 to 2004, 1158 faecal samples of autochthonous Rubia Gallega cattle breed were taken
in 173 semi-extensive farms from Lugo (NW Spain). The period elapsed between the last deworming
treatment and the collection of the samples was never inferior to six months.
Sedimentation technique was employed to determine the F. hepatica egg output (Tienpont et al.,
1979); the results were expressed as number of eggs per gram of faeces (epg). The sensibility of the
technique was 3 epg.
An epidemiologic survey was designed with the aim of obtaining information about the main
parasitic control measures used. So, in the present work we solicited answers from the farm owners in
a questionnaire with questions about frequency of treatment per year, time of treatment, anthelmintic
used, advice for the election of the drug and dosage calculation. Cooperation with the farmers was
fully satisfactory, and all of them participated in the survey. The answers refer to the year before the
sampling.
The statistical analysis was performed by means of the chi-square and the Kruskal-Wallis tests,
performed by the statistical package SPSS (v.14). Median (Me) was determined as tendency marker
and the lower and upper quartiles (Q1 and Q3) as dispersion measures.
RESULTS
The results obtained in the present work showed that the only parasitic control measure used
were the application of anthelmintic treatments (69%), following the veterinary advice (98%). Most
of farmers administered a benzimidazole (80%), mainly in autumn (59%). The dosage was always
calculated depending on the age of the animals. It is worth mentioned that eighty nine percent of the
owners who applied a treatment employed a product effective against the trematode. The different
drugs used by the farmers are summarized in Table 1.
Table 1. Classification of the drugs employed by the farmers depending on their effectiveness against the liver
fluke Fasciola hepatica.
FASCIOLICIDE NO EFFECTIVE AGAINST F. hepatica

Albendazole Ivermectin
Fenbendazole Eprinomectin
Triclabendazole Moxidectin
Netobimin Levamisole
Oxyclozanide
Clorsulon
Finally, none of the surveyed farmers asked for a coprological analysis either before the treatment
or after. Owners neither routinely use coprological examinations to ascertain the presence of parasites
nor deworm new animals before introducing them onto the farm.
Individual percentage of infection by F. hepatica, as well as herd-level prevalence, was lower
in farms where a fasciolicide treatment was administered (Table 2), but the differences were no
significant.
Table 2. Percentages of infection by F. hepatica taking into account the administration of an effective an-
thelmintic treatment.
INDIVIDUAL
TREATMENT HERD-LEVEL PREVALENCE
PREVALENCE
No effective anthelmintic 26% 65%
Fasciolicide 23% 62%
When the possible relation between the intensity of egg excretion (epg) and the application of
different anthelmintics were investigated (Table 3), slightly higher values of Me, Q1 and Q3 were
observed in the farms where a fasciolicide was used.
Tabla 3. F. hepatica egg output al taking into account the administration of an effective anthelmintic treatment.
TREATMENT Me (epg) Q1 (epg) Q3 (epg)

No effective anthelmintic 6 3 12
Fasciolicide 9 6 15
DISCUSSION
Our results are similar to those reported in cattle from Sardinia (Italy) by Scala et al. (2001), who
observed a higher prevalence and egg output in treated than in no dewormed animals.
The high F. hepatica prevalences despite of the administration of a fasciolicide drug could be
due to the application of no measures for the control of the external phase of the trematode biologic
cycle. Previous works showed that the likelihood of cattle reinfection was very high when animals
still grazing in pastures contaminated with F. hepatica-metacercariae (Díaz et al., 2001; Sánchez-
Andrade et al., 2001). Nevertheless, these results could also be due to the appearance and development
of anthelmintic resistance, as a result of the repetitive application of drugs like triclabendazole or
albendazole (Kilgore et al., 1985; Moll et al., 2000, Elitok et al., 2006; Vara del Río, 2007).
Data obtained in the current work show the need for the application of integrated F. hepatica
control measures. Farmers must employ measures to change the trematode intermediate host habitats
–like liming or draining of humid or flooded pastures- in addition to the collection of samples for a
suitable diagnose of the disease and the administration of a proper treatment. The application of these
control measures would reduce the values of prevalence and intensity of excretion by F. hepatica in
beef cattle from Galicia maintained in a semiextensive management system.
ACKNOWLEDGEMENTS
This work was supported by the Research Project PGIDT04RAG261009PR (Xunta de Galicia, Spain).
REFERENCES
Díaz, P.; Arias, M.; Pedreira, J.; Moledo, J.A.; Paz-Silva, A.; Suárez, C.; Panadero, R.; Sánchez-
Andrade, R. (2001). Incidencia de la fasciolosis. El boletín de A.C.R.U.G.A., 15: 12-14.
Díaz, P. (2006). Estudio epidemiológico de las principales endoparasitosis del ganado vacuno
de raza Rubia Gallega de la provincia de Lugo. Tesis Doctoral. Universidade de Santiago de
Compostela.
Díez-Baños, P.; Morrondo, P.; Sánchez-Andrade, R.; Prieto, M.; López, C.; Panadero, R. (1994).
Prevalencia de infestación por diferentes formas parasitarias en el ganado vacuno de lugo. IV
Congreso Nacional de Buiatría, La Coruña, 10-12 Marzo.
Elitok, B.; Elitok, O.M.; Kabu, M. (2006). Field trial on comparative efficacy of four fasciolicides
against natural liver fluke infection in cattle. Veterinary Parasitology, 135: 279-285.
González-Lanza, C.; Manga, Y.; Del Pozo, P.; Hidalgo, R. (1989). Dynamics of elimination of the
eggs of Fasciola hepatica (Trematoda, Digenea) in the faeces of cattle in the Porma Basin,
Spain. Veterinary Parasitology, 34: 35-43.
Kilgore, R.L.; Williams, M.L.; Benz, G.W.; Gross, S.J. (1985). Comparative efficacy of clorsulon
and albendazole against Fasciola hepatica in cattle. American Journal of Veterinary Research,
46: 1553-1555.
Moll, L.; Gaasenbeek, C.P.; Vellema, P.; Borgsteede, F.H. (2000). Resistance of Fasciola hepatica
against triclabendazole in cattle and sheep in The Netherlands. Veterinary Parasitology, 91: 153-
8.
Morrondo, P.; Díaz, P.; Pedreira, J.; Paz-Silva, A.; Sánchez-Andrade, R.; Suárez, J.L.; Arias, M.;
Díez-Baños, P. (2003). Digestive parasitosis affecting to the autochthonous Rubia Gallega cattle.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
(Fe.Me.S.P.Rum.), Olbia (Sassari).
Paz-Silva, A.; Sánchez-Andrade, R.; Suárez, J.L.; Pedreira, J.; Arias, M.; López, C.; Panadero, R.;
Díaz, P.; Díez-Baños, P.; Morrondo, P. (2003). Prevalence of natural ovine fasciolosis shown by
demonstrating the presence of serum circulating antigens. Parasitology Research, 91: 328-331.
Sánchez-Andrade Fernández, R.; Suárez, J.L.; Paz-Silva, A.; Panadero, R.; Martínez, M.J.; Pedreira,
J.; Díez-Baños, P.; Morrondo, P. (2001). Seroprevalence of Fasciola hepatica by direct-ELISA
(enzyme-linked immunosorbent assay) and indirect-ELISA of bovine from Galicia (NW
Spain) according to their origin. Revista Ibérica de Parasitología (Research and Reviews in
Parasitology), 61: 97-101.
Scala, A.; Carfagna, G.; Uras, P.; Poglayen, G.; Gianetto, S.; Gaglio, G. (2001). Rilievi parassitologici
in bovini allevati in Gallera (Sardegna). 18th Internacional Conference of The World Association
for the Advancement of Veterinary Parasitology (WAAVP). Stresa, Italy.
Tienpont, D.; Rochette, F.; Van Parjis, O. (1979). Diagnóstico de las verminosis por el examen
coprológico. Janssen Research Foundation.
Vara Del Río, M.P. (2007). Control de la Fasciolosis ovina: estudio sobre la fasciolosis ovina y
desarrollo de técnicas para su detección y métodos de control. Tesis Doctoral. Universidad de
León.
ROE DEER (Capreolus capreolus) AS A RESERVOIR OF
PARASITIC INFECTIONS IN DOMESTIC RUMINANTS UNDER FIELD
CONDITIONS IN GALICIA
SRNA (Capreolus capreolus) KAO REZERVOAR PARAZITSKIH

INVAZIJA ZA PAŠNO DRŽANE DOMAĆE PREŽIVAČE U GALICIJI
Morrondo, P., Vázquez, L., Pardo, M., Dacal, V., Díaz, P., Paz, A., Sánchez-Andrade, R.,
Arias, M.S., Uriarte, J.*, Díez-Baños, P.
Parasitología y Enfermedades Parasitarias. Dpto. Patología Animal. Facultad de Veterinaria. Universidad de

Santiago de Compostela. 27002 Lugo (Spain).
*Centro de Investigación y Tecnología Agroalimentaria de Aragón. 50059 Zaragoza (Spain).
ABSTRACT
From May to October 2007 individual faecal samples from the rectum of 184 roe deer were collected. The
alimentary tracts examined were dissected out of the animals killed during hunts in different forest districts from
NW Spain. The presence of coccidian oocysts and gastrointestinal nematode and cestode eggs was identified by
the flotation technique, trematode eggs by using the sedimentation test and that of bronchopulmonary nematode
by migration. Results were expressed as the number of oocysts per gram of faeces (opg), the number of eggs
per gram (epg) and the number of larvae per gram (lpg). The presence of infection by coccidian, gastrointestinal
nematoda and cestoda was diagnosed in 74% of the animals; trematode infection was not detected, and these
results disagree with that from previous investigations carried out in ruminants from Galicia maintained in
pastures. The lowest prevalence was achieved in cestoda (3.3%) and the intensity of infection was moderate (308
epg). Higher values for the prevalence and infection intensity for Eimeria coccidian were observed (54.1%).
The percentage of roe deer with lung nematoda was elevated (54.1%). We observed 25.7% of the animals had
larvae from Dictyocaulus and 44.8% from Varestrongylus. In both cases, low infection intensity was obtained
(14 lpg and 3.9 lpg, respectively). The highest prevalence was obtained in gastrointestinal nematode (66.3%)
with a moderate egg-output ( x = 136 epg). We identified eggs from Trichostrongylidae (64.7%; x = 132 epg),
Nematodirus (2.7%; x = 80 epg), Trichuris (2.7%; x = 50 epg) and Capillaria (2.2%; x = 75 epg).
Sažetak
Sakupljani su pojedinačni uzorci fecesa iz rektuma 184 srne od svibnja do listopada 2007. godine.
Pretraživani probavni trakt je egzenteriran iz životinja odstrijeljenih tijekom lova u različitim šumskim
područjima sjeverozapadne Španjolske. Prisutstvo kokcidijskih oocista, gastrointestinalnih nematoda i jajašaca
cestoda je utvrđivano tehnikom flotacije, jajašca trematoda testom sedimentacije, a ona bronhopulmonarnih
nematoda migracijom. Rezultati su izraženi kao broj oocista po gramu fecesa (opg), brojem jajašaca po gramu
(epg) te brojem larvi po gramu (lpg). Prisutstvo invazije kokcidijama, gastrointestinalnim nematodima i
cestodima je dijagnosticirano u 74% životinja; invazija trematodima nije utvrđena, a ti rezultati nisu u skladu
s onima prethodnih istraživanja provedenih u pašno držanih preživača u Galiciji. Najnižu pojavnost su imali
cestodi (3,3%) pri čemu je intenzitet invazije bio umjeren (308epg). Više vrijednosti pojavnosti i intenziteta
invazije primijećene su za Eimeria kokcidije (54,1%). Postotak srna sa plućnim nematodima je bio povišen
(54,1%). Primijetili smo da je 25,7% životinja imalo larve Dictyocaulus, a 44,8% Varestrongylus. U oba slučaja
intenzitet invazije je bio nizak (14 lpg i 3,9 lpg). Najveću su pojavnost imali gastrointestinalni nematodi (66,3%)
sa umjerenim nalazom jajašaca ( x = 136 epg). Pronašli smo jajašca Trichostrongylidae (64,7%; x = 132 epg),
Nematodirus (2,7%; x = 80 epg), Trichuris (2,7%; x = 50 epg) i Capillaria (2,2%; x = 75 epg).
INTRODUCTION
Galicia is the Community of Spain with a most roe deer density, although are territorial differences
to concern their density, and Lugo is the Spanish and Galician province with a more number of roe
deer, because of it, in current season permit to hunting already of 4.500 these specimens. Because of
it, to deduce that in Galicia we have a population more than 22,500 roe deer.
In studies carried out in Spain and in other European countries showed up that parasitic infections
are the principal reason of diseases in cervids and roe deer is the most sensible ungulate to parasitic
process.
In Galicia, roe deer and extensive domestic ruminants share pasture and it can be favourable
to exchange the parasitic forms. Because of it, we suspect that wild ruminants and, specifically roe
deer, can be a reservoir of parasitic diseases of domestic ruminants in extensive management. In
consequence, the knowledge of parasitic species that share roe deer and domestic ruminants will be
important and will contribute some solves for cattle and other ruminants that employ the pastures
and improve their health.

Individual faecal samples were collected between May to October of 2007. The faecal samples
were collected directly of intestine of 184 roe deer hunting in different hunting reserves of the
province of Lugo.
The coprologic analyses (flotation, sedimentation and migration) were made (MAFF, 1986) with
faecal samples. Flotation technique was used to demonstrate coccidian ooquists and gastrointestinal
eggs of cestoda and nematoda; while sedimentation technique was used to detect eggs of trematode
and the method of larvae migration to obtain and to count pulmonary nematode larvae.
Later, each sample was examined to the microscope with McMaster cameras, and it calculated
the number of ooquists by gram of faeces (opg), the number of eggs by gram of faeces (hpg) and also
larvae by gram of faeces (lpg).
RESULTS
In 74% of the analyzed faeces samples we obtain, in different amounts, ooquists of protozoa,
gastrointestinal eggs of cestoda and nematoda and larvae of broncopulmonary nematoda; on the
contrary, in no one of studied samples were eggs of trematoda.
As it is observed in Table 1, the animals presented a high prevalence and intensity of infection by
Eimeria, whereas the prevalence and intensity of infection by eggs of cestoda were little.
Table 1: Percentage of infected animals and parasitation intensity.
Prevalence Intensity
(%) (opg/hpg/lpg)
PROTOZOA Eimeria 34.8 913
CESTODA Moniezia 3.3 308
PULMONARY Dictyocaulus 25.7 14
NEMATODA Varestongylus 44.8 3.9
Trichostrongylidae 64.7 132
GASTROINTESTINAL Nematodirus 2.7 80
NEMATODA Trichuris 2.7 50
Capillaria 2.2 75
Also, in Table 1 details to prevalence and intensity of infection of main genera of broncopulmonary
and gastrointestinal nematoda. However, it was observed that prevalence of infection of
broncopulmonary nematoda was elevated (54.1%), the intensity of infection was low (10 lpg); on the
contrary, the animals presented a high prevalence of infection by gastrointestinal nematoda (66.3%)
and the intensity of infection was considered like moderate (136 epg).
DISCUSION
When comparing the results obtained in this study with previous found by us (DÍAZ et al., 2005,
2007) in extensive cattle of Galicia, we verified that, as wild ruminants as domestic ones, eliminated
coccidian ooquists and cestoda and gastrointestinal nematoda eggs and pulmonary nematoda larvae.
In the roe deer, the prevalence and intensity of coccidian infection and cestoda were inferior to
found by DÍAZ et al. (2005) in cattle of Rubia Gallega in Lugo province (79.8%, x = 44.9 opg for
Eimeria and 26%, x = 33,4 hpg for Moniezia).
Strongilid infection prevalence in roe deer was less to obtained by DÍAZ et al. (2007) in Rubia
Gallega cows (96%); on the contrary, in cattle, DÍAZ et al. (2007) indicates infection prevalences for
Nematodirus (1%), Trichuris (1%) and Capillaria (9%) similar to found ones in the samples coming
from roe deer.
In infected cattle for nematodes have not been observed broncopulmonary nematoda
(Dictyocaulus), possibly must that not collected calves smaller than one year themselves they are
more parasited generally for pulmonary nematoda. On the contrary, high prevalence of Dictyocaulus
noerneri in roe deer can be caused because this species of broncopulmonary nematoda does not
produce a protective immunity as happens to Dictyocaulus viviparus in the cattle.
In roe deer, trematode infection was not detected, and these results disagree with that from
previous investigations (DÍAZ et al., 2007; MORRONDO et al., 2005) carried out in Rubia Galega
cattle (24% Fasciola hepatica; 12.9% Calicophoron daubneyi and 6.2% Dicrocoelium dendriticum)
from Galicia maintained in common or near pastures with roe deer.
Although it is necessary to continue deepening in parasitic species that affect roe deer, in this
study we have verified when roe deer and cows share common habitats have identified more genera
of protozoan, cestoda and nematoda of which it is possible to be deduced that roe deer could act like
reservoir of parasitic infections that affect cattle when it is maintained in extensive pastures.
Our findings support the interest for studies about cross-infections and their epidemiological
consequences which are needed to be known to get a better control.
ACKNOWLEDMENTS
We are grateful to Food and Agrarian National Technology Institute (MEC), Spain by the concession of the
Research Project FAU2006-00006-00-00, and Xunta de Galicia (Spain) by the Research Project 07MRU034261PR
and especially to Galician hunters and Federación Galega de Caza.
REFERENCES
DÍAZ, P.; PEDREIRA, J.; ARIAS, M.S.; LOMBA, C.; SUÁREZ, J.L.; PAZ, A.; MORRONDO, P. (2005).
Infecciones parasitarias en vacas de raza Rubia Gallega de la provincia de Lugo: influencia de la edad.
Buiatría Española, 10: 231-234.
DÍAZ P, PEDREIRA J, ARIAS M, PAINCEIRA A, LOMBA C, SANCHEZ-ANDRADE R, MORRONDO
P, DIEZ-BANOS P. (2007). Prevalencia de infección por nematodos gastrointestinales en vacas Rubia
Gallega explotadas en semiextensivo. Información Técnica Económica Agraria (ITEA), Volumen: Extra
(28): 549-551.
DÍAZ P, PAZ-SILVA A, SÁNCHEZ-ANDRADE R, SUÁREZ JL, PEDREIRA J, ARIAS M, DÍEZ-BAÑOS P,
MORRONDO P. (2007). Assessment of climatic and orographic conditions on the infection by Calicophoron
daubneyi and Dicrocoelium dendriticum in grazing beef cattle (NW Spain). Veterinary Parasitology, 149:
285-289.
MAFF, (1986). Manual of Veterinary Parasitological Laboratory Techniques. Ministry of Agriculture, Fisheries
and Food, Technical Bulletin Nº18, London, HMSO, 2-67.
MORRONDO, P.; DÍAZ, P.; PEDREIRA, J.; SANCHEZ-ANDRADE, R.; PAZ, A.; DÍEZ-BAÑOS, P. (2005).
Trematodosis prevalence in Rubia Gallega cattle from different climatic areas. 13 Congresso Internazionale
della Federazione Mediterranea Sanità e Produzione Ruminanti (Fe.Me.S.P.Rum). Bari (Italia), 1-3
Septiembre 2005.
A SEROEPIDEMIOLOGICAL SURVEY OF BOVINE
PARAMPHISTOMOSIS BY USING THE Cd2 ELISA
SEROEPIDEMIOLOŠKO ISTRAŽIVANJE GOVEĐE

PARAMFISTOMOZE METODOM Cd2 ELISA
Francisco, I., M. Arias, J. Pedreira, A. Paz-Silva, R. Francisco, R. Sánchez-Andrade,

P. Díaz, J. L. Suárez, P. Díez-Baños, P. Morrondo.
Parasitology and Parasitic diseases, Animal Pathology Department, Veterinary Faculty, Santiago de
Compostela University. Campus Universitario s/n. 27002-Lugo, SPAIN. E-mail: adolpaz@lugo.usc.es. Tel.
34982285900
Abstract
With the aim of gaining more knowledge about the epidemiology of the bovine paramphistomosis, a
serological survey was conducted in beef cattle maintained under field conditions. From February 2006 to
February 2007, blood samples were collected from 453 autochthonous Rubia Gallega cattle in NW Spain.
These are cattle kept under field conditions in semi-extensive management, going out to grazing areas daily and
brought into the paddocks during the night. The prevalence of paramphistomosis was calculated by means of
an ELISA test to the detection of IgG antibodies against Calicophoron daubneyi. For this purpose, excretory/
secretory antigens (CdES) were fractionated by electrophoresis and a 52-kDa protein recovered by electroelution
(Cd2). Data were analyzed by taking into account the age of animals, grazing area, number of cattle in the
farm, administration of antiparasites and frequency of chemotherapy. The overall percentage was 63% (59,
67). The highest seroprevalence was observed in the youngest animals (71%; 67, 75). When the percentages
of paramphistomosis were analyzed by considering the grazing area, the greatest values were observed in the
coastal region (84%; 81, 87) and the lowest in the mountainous ones (62%; 58, 66). By using the Chi square test,
significant differences were achieved (χ2= 6.380, p= 0.041). The analysis of the effect of the number of cattle
in the farms on the seroprevalence showed higher percentages of paramphistomosis on flocks with more than
25 animals (96%; 94, 98) and lower in that with 15-25 (73%; 69, 77), and these differences were significant
(χ2= 6.763, p= 0.046). The seroprevalence was significantly greater in farms where an antiparasitic treatment
was administrated (82%; 78, 86) (χ2= 5.977, p= 0.048). Finally, the frequency of deworming did not affect to
the infection by C. daubneyi, and similar percentages (82%; 78, 86) were obtained by treating 1 or 2 times per
year.
Sažetak
U cilju dobivanja novih spoznaja o epidemiologiji goveđe paramfistomoze, izvedeno je serološko
istraživanje na pašno držanim tovnim govedima. Uzorci krvi uzimani su od veljače 2006. do veljače 2007., na 453
goveda autohtone Rubia Gallega pasmine u sjeverozapadnoj Španjolskoj. Goveda su držana semiekstenzivno,
tijekom dana na pašnjacima, a noću u štalama. Pojavnost paramfistomoze računata je ELISA testom kojim su se
određivala IgG antitijela za Calicophoron daubneyi. U tu svrhu frakcionirani su ekskretorni/sekretorni antigeni
(CdES) elektroforezom, a 52-kDa bjelančevina elektroelucijom (Cd2). Podatci su analizirani uzimajući u obzir
dob životinja, pašne površine, broj životinja na farmi, aplikaciju antiparazitika i učestalost terapije.Sveukupni
postotak iznosio je 63%. Najviša je seroprevalencija primijećena u najmlađih životinja (71%). Kada su postotci
paramfistomoze analizirani uzimajući u obzir pašnu površinu, najviše su vrijednosti primijećene u obalnoj regiji
(84%), a najniže u planinskim (62%). Korištenjem Chi square testa dosegnute su signifikantne razlike (χ2= 6,380;
p=0,041). Analiza utjecaja broja goveda na farmi na seroprevalenciju pokazala je viši postotak paramfistomoze
u stadima sa više od 25 grla (96%), a niži u onima sa 15-25 grla (73%), a te su razlike bile signifikantne (χ2=
6,763, p= 0,046). Seroprevalencija je bila znakovito viša na farmama gdje se primjenjivao antiparazitski tretman
(82%; χ2= 5,977, p= 0,048). Napokon, učestalost antiparazitskih tretmana nije utjecao na invaziju C. daubneyi,
a slični su postotci (82%) dobiveni i kod tretmana 1 ili 2 puta godišnje.
Introduction
The infection by the Paramphistomum spp is frequente in areas with oceanic climate, where
mild temperatures and frequent rainfall throughout the year provide the adequate conditions for the
survival of Lymanaea spp snails, their intermediate host.
Calicophoron daubneyi (Digenea: Paramphistomidae) is a gastric trematode affecting young
ruminants especially. The immature stages of Paramphistomidae can cause severe pathology and
even kill the host in heavy infections, because they are attached to the wall of the small intestine
causing important inflammation, characterized by focal infiltration of macrophages and lymphocytes
in the lamina propia and in the interstitial tissue of Brunner’s gland (Silvestre et al., 2000). Digestion
and absorption are damaged, and appetite is also depressed, resulting in diarrhoea, anorexia, anaemia
and weakness (Spence et al., 1996). There is little evidence regarding the pathogenicity of the adult
worms to their hosts, but severe damage to the mucosa of the rumen is provoked in heavy infections
(Rolfe et al., 1994).
In the present work, the IgG humoral immune response against C. daubneyi in bovine from
Galicia (NW Spain), where mild temperatures and high precipitations are present throughout the
year, allowing the development of C. daubneyi (Abrous et al., 1999). For this reason, C. Daubneyi
excretory/secretory antigens were obtained and purified by electrophoresis and electroelution. A
serological epidemiology was developed by using an ELISA test and a 52 kDa protein to the detection
of IgG antibodies in cattle under field conditions.

The present investigation was developed in Galicia (NW Spain) with mild temperatures and
high precipitations, which favour the proliferation of Lymnaea snails, the intermediate host for
Paramphistomidae flukes (Augot et al., 1996). From February 2006 to September 2007, blood
and faecal samples were randomly collected at the same time from 453 female Rubia Gallega
autochthonous breed cattle in Lugo (Northwest of Spain) (42º 20’ – 43º 45’ N, 6º 49’ – 8º 00’ W).
These are animals kept under field conditions, most of flocks are maintained outside and are only
brought into the paddocks during the night. The grazing flock is generally fed on natural pastures,
characterised mainly by annual grass species.
The results obtained with the ELISA were analyzed by taking into aacount the age of the animals
(G-1, <3 years old; G-2, 3-6); G-3, >6); grazing area (coastal, center and mountainous); number of
animals per farm (C1, 0-15; C2, 15-25; C3, >25); chemoprophilaxys and frequence of antiparasitic
treatment.
The IgG humoral immune response was analyzed by means of an ELISA test with a 52-kDa
protein (Díaz et al., 2006). For this purpose, excretory/secretory antigens from adult C. daubneyi
were obtained and purified by electrophoresis and electroelution (Francisco et al., 2006).
Results
By using the immunoenzymatic probe, a seroprevalence of 63% was obtained. The influence of the age on the
prevalence of paramfistomosis is drawn in Figure 1. The highest seroprevalence was observed in the youngest
animals (71%), whereas a similar percentage in the animals of the G-2 (3-8 years old) and G-3 (older than 8
years old) was obtained. No significant differences were proved related to the age of the cattle.
47%
71%
G -1 (< 3) G -2 (3-8) G -3 (> 8)

44%

Figure 1. Prevalence of cattle paramhistomosis according to the age of the animals.
As can seen in figure 2, a percentage of 84% prevalence was achieved in the samples form the
coastal areas, whereas the prevalence in mountainous ones was 62%. By using the Chi square test,
significant differences were achieved (χ2= 6.380, p= 0.041).
%
100
87% 84%
90
80
70 62%
60
50
40
30
20
10
0
Coas t Centre Mountain
Fig. 2. Prevalence of cattle paramphistomosis by considering the grazing area.

The highest percentage of seroprevalence was obtained in the flocks with more than 25 animals
(Fig. 3), and the lowest in that with 15-25 cattle. These differences were significant by means of the
Chi square test (χ2= 6.763, p= 0.046).
Fig. 3. Prevalence of paramphistomosis according to the number of cattle per flock.
The seroprevalence was significantly greater in farms where an antiparasitic treatment was
administrated (82%;) than in that without chemoprophylaxis (60%) (χ2= 5.977, p= 0.048). We also
observed that the frequency of deworming did not affect to the infection by C. daubneyi, and similar
percentages were obtained by treating 1 or 2 times per year (82 and 83%, respectively).
Discussion
In the current investigation a survey to get more knowledge about the prevalence of cattle
paramphistomosis was developed by using an ELISA with a 52 kDa protein from C. daubneyi
excretory/secretory antigens. A notable seroprevalence of cattle paramphistomosis was observed,
which is in agree with data obtained in the same area of study by using native C. daubneyi excretory/
secretory antigens (Díaz et al., 2006). In previous reports a widespread distribution of L. truncatula
has been noted in the area of study (Morrondo et al., 1994), which explains the elevated prevalence
of F. hepatica-infected cattle (Sánchez-Andrade et al., 2000, 2002). The snail Lymnaea truncatula
acts as an intermediate host in the life cycle of the trematoda C. daubneyi and F. hepatica (Augot et
al., 1996).
It is remarkable that bovine were maintained in the pastures where usually they graze for allowing
their reinfection. Neverhteless, strong immunity to Paramphistomidae-infections is developed in cattle
(Urquhart et al., 1996), and repeated infections generally produce an almost complete immunity,
resulting in a marked reduction in the fluke burdens from challenge infection. In bovine trematodosis
as fasciolosis, dicrocoeliosis or schistosomosis, the presence of elevated IgG values has been also
noted (Wedrychowicz et al., 1995; Boulard et al., 1995).
Our results proved an important percentage of cattle contacted to this trematode in the area of
study, and suitable measures for preventing this relationship must be considered. The infection of
cattle with C. daubneyi enhances a notable IgG response assessable by an ELISA, which can be
estimated by using purified antigens like the 52-kDa CdES protein. This seems to be very useful
because of the possibility for standarization of the ELISA tests to the detection of infections by the
C. daubneyi trematode.
Acknowledgements
This work was partly supported by the Research Project XUGA PGIDT04RAG261009PR (Xunta de Galicia,
Spain).
References
Abrous, M., Rondelaud, D., Dreyfuss, J., Cabaret, J., 1999. Infection of Lymaea truncatula and Lymnaea glabra
by Fasciola hepatica and Paramphistomum daubneyi in farms of central France. Vet. Res., 30:113-118
Augot, D., Abrous, M., Rondelaud, D., Dreyfuss, G., 1996. Paramphistomum daubneyi and Fasciola hepatica:
the redial burden and cercarial shedding in Lymnaea truncatula subjected to successive unimiracidial cross-
exposures. Parasitol. Res., 82: 623-627
Boulard, C., Carreras, F., Van Gool, F., 1995. Evaluation of nitroxynil and closantel activity using ELISA and
egg counts against Fasciola hepatica in experimentally and naturally infected cattle. Vet. Res., 26: 249-
255.
Díaz, P.; Lomba, C.; Pedreira, J.; Arias, M.; Sánchez-Andrade, R.; Suárez, J.l.; Díez-Baños, P.; Morrondo,
P.; Paz-Silva, A. (2006). Analysis of the IgG antibody response against Paramphistomidae trematoda in
naturally infected cattle. Application to serological surveys. Vet. Parasitol., 140: 281-288.
Francisco, I.; Lomba, C.; Pardo, M.; Pedreira, J.; Suárez, J.L.; Sánchez-Andrade, R.; Díaz, P.; Arias, M.; Paz-
Silva, A.; Morrondo, P.; Díez-Baños, P. (2006). Getting parasitic antigens for the diagnosis of bovine
trematodoses by electroelution. 14th Congress of the Mediterranean Federation for Health and
Production of Ruminants. Lugo (Spain), 12-15 July.
Morrondo-Pelayo, P.; Sánchez-Andrade, R.; Díez-Baños, P.; Pérez-Verdugo, L.; López-Sández, C. (1994).
Dynamics of Fasciola hepatica egg elimination and Lymnaea Truncatula populations in cattle farms in
Galicia (North-West Spain). Reasearch and Reviews in Parasitology, 54: 47-50.
Rolfe, P.F., Boray, J.C., Collins, G.H., 1994. Pathology of infection with Paramphistomum ichikawai in sheep.
Int. J. Parasitol., 24: 995-1004.
Sánchez-Andrade, R., Paz-Silva, A., Suárez, J., Panadero, R., Díez-Baños, P., Morrondo, P., 2000. Use of a
sandwich-enzyme-linked immunosorbent assay (SEA) for the diagnosis of natural Fasciola hepatica
infection in cattle from Galicia (NW Spain). Vet. Parasitol., 93: 39-46.
Sánchez-Andrade, R., Paz-Silva, A., Suárez, J.L., Panadero, R., Pedreira, J., López, C., Díez-Baños, P.,
Morrondo, P., 2002. Influence of age and breed on natural bovine fasciolosis in an endemic area (Galicia,
NW Spain). Vet. Res. Commun., 26: 361-370.
Silvestre, A., Sauvé, C., Cabaret, J., 2000. Caprine Paramphistomum daubneyi (Trematoda) infection in Europe.
Vet. Rec., 146: 674-675.
Spence, S.A., Fraser, G.C., Chang, S., 1996. Response in milk production to the control of gastro-intestinal
nematode and paramphistome parasites in dairy cattle. Austral. Vet. J., 74: 456-459.
Urquhart, G. M., Armour, J., Duncan, J.L., Jennings, F.W., Dunn, A.M., 1996. Veterinary Parasitology, Blackwell
Science Inc., Oxford (UK).
Wedrychowicz, H., Ducommun, D., Gorski, P., Pfister, K., 1995. Somatic antigens of adult Dicrocoelium
dendriticum recognised by bile antibodies of naturally infected cattle. Vet. Parasitol., 56: 47-56.
OCURRENCE OF TREMATODE EGGS IN SHEEP FROM GALICIA
(N.W. SPAIN)
Učestalost nalaza jajašaca metilja u ovaca iz pokrajine

Galicija ( sjevero-zapadna Španjolska)
Vázquez, L.; Dacal, V.; Cienfuegos, S.; Díaz, P., Lago, N., Panadero, R., Fernández, G.,
Morrondo, P., López, C.
Área de Sanidad Animal del Departamento de Patología Animal. Facultad de Veterinaria. Universidad de
Santiago de Compostela. 27002 Lugo. SPAIN. mopela@lugo.usc.es
ABSTRACT
From February to December 2007, a total of 1403 faecal samples were collected from 59 ovine farms. All the
examined animals were older than 3 months and they were maintained in a semi extensive management system.
Coprological examinations were conducted by the Sedimentation method and the egg output was quantified
using the modified McMaster technique. Sheep from 31 farms (52.5%) were positive for trematodes, although
the individual prevalence was much lower (7.5%), with a mean intensity of parasitation of 106.3±18.49 eggs per
gram (e.p.g.). When considering the different Genera, the liver fluke, Fasciola was the most common, present
in 42.4% of the examined flocks, with an individual prevalence of 6.3%. Dicrocoelium eggs were present in
only 11 animals from 7 farms. Eggs from a ruminal fluke of the Family Paramphistomidae were found in 10
animals, with a prevalence per farm of 8.5%. This is the first citation of this trematode in ovines from Galicia.
The mean intensity of egg output in infected animals was 111.6±22.07, 76.1±22.09 and 68.0±12.27 for Fasciola,
Dicrocoelium and Paramphistomidae, respectively. Co infection was only detected in 2 animals, belonging to
the same flock, that were infected simultaneously by Fasciola and Paramphistomidae. In general, we can affirm
that the oldest animals were more infected by trematodes, however the differences between the prevalences and
the intensities of parasitation of the different age groups were not significant (P>0.05).
Sažetak:
U razdoblju od veljače do listopada 2007. godine skupljeno je 1403 uzorka fecesa sa 59 farmi ovaca. Sve
životinje su bile starije od 3 mjeseca a držane so poluekstenzivno. Koprološka pretraga izvedena je pomoću
sedimentacije a dobivena jajašca su kvantificirana pomoću McMasrer metode. KodUkupno (52.5%) ovaca
nađena su jajašca metilja sa srednjom razimon invazije od 106+/-18.49 jajašaca po gramu. Uzevši u obzir različite
rodove metilja, Facciola je bila najučestalija sa 42.2 % pretraženih uzoraka. Jajašca Dicrocoeliuma nađena su
kod samo 11 životinja sa 7 farmi. Paramphistomidae su nađene kod 10 životinja prilikom pretrage buragovog
sadržaja. Ovoj je prvi nalaz ovih metilja u ovaca iz Galicije. Srednji intenzitet izlučivanja jajašaca u invadiranih
životinja bio je 111.6±22.07, 76.1±22.09 i 68.0±12.27 za Fasciolu, Dicrocoelium I Paramphistomonidae.
Mješovita invazija sa Fasciolom I Paramphistomom zamijećena je kod 2 životinje. Zaključujemo, da su odrasle
životinje više invadirane metiljima a također nema signifikantne razlike u učestalosti paratitarnih invazija kod
različitih dobnih skupina (P>0.05).
INTRODUCTION
Trematodosis are important parasitic diseases with negative effects over the health and sheep
production. The most common trematodes of sheep in Spain are the liver flukes Fasciola hepatica
and Dicrocoelium dendriticum. The distribution and abundance of both parasites depends on the
environmental requirements of their intermediate hosts, an aquatic snail (Lymnaea sp.) for Fasciola
and a land snail and an ant for Dicrocoelium. Whilst in humid regions of Northern Spain Fasciola is
the most prevalent (Paz et al., 2003) in dry regions predominates Dicrocoelium (Hernández, et al.,
2000; Dominguez et al., 2000; Díez et al., 2006).
Sheep are more susceptible to Fasciola than cattle, and acute disease has long been associated
with high mortality in sheep flocks. Dicrocoelium located in the bile ducts of liver cause less damage
but in severe infections there may be extensive hepatic cirrhosis and distension of the bile ducts.
Paramphistomidae are gastric trematodes whose immature stages can cause severe damages and
even kill the host in heavy infections. Fasciola hepatica and Paramphistomidae have a similar life
cycle and the periods of high risk are also analogous. The first citation of rumen flukes in sheep from
Spain was made by Martínez-Gómez and Hernandez (1971) in Córdoba. Recently, Morrondo et al.
(2003) have cited for the first time the presence of Paramphistomum spp-eggs in cattle from Galicia.
Soon after, this parasite was identified as Calicophoron daubneyi (Díaz et al. 2006). While the
distribution of Fasciola and Dicrocoelium is well defined in sheep from most Spanish regions, to our
knowledge there are only one previous report signalling the parasitation of ovine by Paramphistomidae
(Martínez-Gómez and Hernández, 1971). According to recent reports its prevalence is increasing in
cattle from temperate areas (Szmidt-Adjidé et al., 2000 and Mage et al, 2002), thus in our opinion its
presence in Spain could be underestimated.
The main purpose of this study was to determine the prevalence and intensity of infection by the
trematodes Fasciola, Dicrocoelium and Paramphistomidae in sheep from Galicia (N.W. Spain).

From February to December 2007 a total of 1.403 faecal samples were collected from 59 ovine
farms. Samples were individually collected from the rectal ampoule and individually examined.
Coprological examinations were conducted by the Sedimentation method and the egg output was
quantified using the modified McMaster technique. The egg-counts are presented as the number of
eggs per gram of faeces (e.p.g.). The different Trematoda eggs were identified according to Tienpont
et al. (1979).
All the examined animals were older than 3 months and in order to study the influence of the
age, 3 groups were considered: 3-12 month-old (G-1), 13-48 month-old (G-2) and >48 month-old
(G-3). Generally, those animals received antiparasitic treatment in spring and fall after coprological
analysis.
Data were analysed using the SPSS, Version 13.0 (SPSS Inc., Chicago, IL). The Chi-squared
test (χ2) was used to determine significant differences in prevalence when considering the age of the
animals. ANOVA was used to find out differences in the intensity of infestation when considering the
different age groups (P< 0.05). When the ANOVA test revealed differences the Bonferroni multiple
comparison test was applied to localize these differences.
RESULTS AND DISCUSSION

Sheep from 31 farms (52.5%) were positive for trematodes, although the individual prevalence
was much lower (7.5%), with a mean intensity of parasitation of 106.3±18.49 e.p.g.
50
Floc ks Indiv idual
40
30
Prevalence
20
10
0
Fas c iola Dic roc oelium Paramphis tomidae
Fig. 1. Percentage of flocks and animals infected by Fasciola, Dicrocoelium and Paramphistomidae.
When considering the different Genera, Fasciola was the most common, present in 42.4% of
the examined flocks, with an individual prevalence of 6.3%. Dicrocoelium eggs were present in only
11 animals (0.8%) from 7 farms (11.9%). Those results are consistent with climatic conditions in
Northern Spain that favoured the development of the life cycle of Fasciola. But the epidemiology of
fasciolosis is also influenced by the grazing habits of the animals; so, sheep grazing in wet marshy
areas, habited by Lymnaea, are more likely to become infected.
The relation Fasciola/Dicrocoelium found in Galicia (6.3/0.8%) is inverted in the study by Díez
et al. (2006) in the drier province of León (9.3%/14.45%) and by Hernández in the Mediterranean
area (9.4%/32.3%). It must be pointed that in the study by Domínguez et al. (2000) in sheep from
Central Spain Dicrocoelium was the only trematode with a prevalence of 3.4%.
Eggs from a ruminal fluke of the Family Paramphistomidae were found in 10 animals (0.7%),
with a prevalence per farm of 8.5%. It must be pointed that this is the first citation of this trematode
in ovines from Galicia. Taking into consideration that the species infecting cattle in Galicia was
identified as Calicophoron daubneyi (Díaz et al, 2006) it is probable that this species also parasites
sheep; nevertheless further studies are necessary for a properly identification.
The mean intensity of egg output in infected animals was 111.6±22.07, 76.1±22.09 and
68.0±12.27 for Fasciola, Dicrocoelium and Paramphistomidae, respectively. Compared with the
results obtained by Hernández, et al. (2000); Domínguez et al. (2000) and Díez et al. (2006) in
other regions of Spain, the mean egg output of infected sheep can be considered as elevated. That
finding has clinical and epidemiological importance, because those animals will contribute to the
maintenance and dispersion of the life cycle of these trematodes, and, in the case of fasciolosis, the
course of the disease is determinated by the number of metacercariae ingested over a short period
of time. In sheep, acute fasciolosis occurs seasonally and is manifested by a distended, painful
abdomen, anemia, and sudden death. Chronic fasciolosis is seen in all seasons; signs include anemia,
unthriftiness and submandibular edema. Sheep do not appear to develop resistance to infection, and
chronic liver damage is cumulative over several years.
200
150
Intensity
100
50
0
Fig. 2. Intensity of parasitation by different trematodes in sheep from Galicia
Mix infections were only detected in 2 animals from the same flock, which were infected
simultaneously by Fasciola and Paramphistomidae. Coinfection by Fasciola and Paramphistomidae
could be considered as normal because they have a similar life cycle and the periods of high risk are
also analogous (Díaz et al., 2006).
30
25
20
Prevalence
15
10
0
3-12 months 13-48 months >48 months
Fig. 3.- Prevalence of trematode eggs in faeces of ovine with different ages.
As we can observe in Fig. 3 the infection by trematodes was more frequent in adults than in
lambs. However, those differences were no significant (χ2= 2.782; p=0.249).
400
300
Intensity
200
100
0
Fig. 4.- Intensity of parasitation by trematode eggs in faeces of ovine with different ages.
Contrary to the prevalence, faecal egg counts were more elevated in young animals (Fig. 4).
However, as occurred with the prevalence the differences between groups were no significant (F=
0.753; p=0.474).
30
25
20
Prevalence
15
10
0
Fig. 5.- Prevalence by different Genera of trematodes in sheep with different ages.
When considering the different Genera, we observed that Fasciola was more prevalent in
adults (Fig 5). Those results agree with several authors (Morrondo et al., 1997; Sanchez-Andrade
et al. 2002) who found in cattle that the prevalence in calves was lower than in adults, whereas the
intensity of elimination (Fig. 6) was more elevated in calves. According to Sanchez-Andrade et al.
(2002) adults are more frequently infected by Fasciola because they spend more time on pasture or
because they are feed with grass or hay contaminated with metacercariae, whereas young animals
have less opportunities to become infected. However, the development of an acquired resistance with
age provokes that adults have an inferior faecal egg output.
400 3-12 months
13-48 months
>48 months
300
Intensity
200
100
0
Fig. 6.- Intensity of parasitation by different genera of trematodes in sheep with different ages.
With respect to Dicrocoelium, according to Otranto and Traversa (2002) there is no correlation
between age and the susceptibility to the infection by this trematode. However, most studies carried
out in cattle pointed out higher prevalence in adults than in calves. In our study is remarkable the
absence of Dicrocoelium in animals between 3-12 months old.
Despite the scarce number of studies working on the relation between age and the prevalence
by Paramphistomidae, all of them in cattle, it is considered that adults are more frequently infected
by this trematode. The absence of infection in lambs between 3-12 months of age found in our study
could be due to the long prepatent period of this fluke or to the fact that they had fewer opportunities
to become infected on pasture.
In general, we can affirm that adults were more frequently infected by trematodes, although the
differences between the prevalences and the intensities of parasitation of the different age groups
were not significant (P>0.05).
Taking into account that the infection by Fasciola, considered the most pathogenic for ovine,
is the most prevalent in flocks from Northwestern Spain, it is necessary to establish a control plan
involving appropriate therapeutic and prophylactic measures against this trematode.
ACKNOWLEDGEMENTS
Authors are very grateful for the collaboration of shepherds and veterinarians of the Asociación de
criadores de ganado ovino y caprino de Galicia (OVICA). This study was supported by the research project
PGIDIT06RAG26101PR (Xunta e Galicia).
REFERENCES
Díaz, P.; Lomba, C.; Pedreira, J.; Arias, M.; Sánchez-Andrade, R.; Suárez, J.L.; Díez-Baños, P.; Morrondo,
P.; Paz-Silva, A. (2006). Análisis of the IgG antibody response against Paramphistomidae trematoda in
naturally infected cattle. Application to serological surveys. Veterinary Parasitology, 140 (3-4): 281-288.
Díez-Baños, N.; Martínez-Delgado, A.; Hidalgo-Argüello, M.R. (2006). Estudio parasitológico del ganado
ovino en la provincia de León (España) mediante análisis coprológico. En: Veinte años de Buiatría. Edita
Universidad de Santiago de Compostela: 380-383.
Domínguez, I.A.; Gómez, M.T.; De la Fuente, C.; Carpintero, M.; Cuquerella, M.; Alunda, J.M. (2000) Parasitosis
gastrointestinales en ganando ovino de la zona centro: modelo de estructura poblacional y distribución
etaria. Medicina Veterinaria, 17(6): 147-154.
Hernández, S.; Muela, N.; Ferre, I. (2000). Helmintos parásitos del ganado ovino en la Comunidad Valenciana.
Medicina Veterinaria, vol 17(3): 69-74.
Mage, C.; Bourgne, H.; Toullieu, J.M.; Rondelaud, D.; Dreyfuss, G. (2002). Fasciola hepatica and
Paramphistomum daubneyi: changes in prevalences of natural infections in cattle and in Lymnaea truncatula
from central France over the past 12 years. Veterinary research, 33: 439-447.
Martínez-Gómez, F. and Hernández-Rodríguez, S. (1971). Helminth parasites from sheep (Ovis ovis) in Córdoba
(Spain). 1er Multicol. Europ. Parasit., Rennes: 344-346
Morrondo, P.; Díaz, P.; Pedreira, J.; Paz, A.; Sánchez-Andrade, R.; Suárez, J.L.; Arias, M.; Díez-Baños, P. (2003).
Digestive parasitosis affecting to the autochthonous Rubia Gallega cattle. XI Congresso Internazionale
Della Federazione Mediterranea de Sanitá e produzione Ruminanti (Fe.mes.S.P.Rum), Olbia (Sassari).
Morrondo, P.; Moledo, J.A.; Paz, A.; Sánchez-Andrade, R.; Díez-Baños, P. (1997). Estudio de la distribución
de la infección por Fasciola hepatica en el ganado vacuno de las provincias gallegas por medio del ensayo
inmunoenzimático ELISA. Medicina Veterinaria, 14: 234-239.
Otranto, D.; Traversa, D. (2002). Dicrocoeliosis of ruminants: a little known fluke disease. Trends in Parasitology,
19: 12-15.
Paz, A.; Sánchez-Andrade, R.; Suárez, J.L.; Pedreira, J.; Arias, M.S.; López, C.; Panadero, R.; Díaz, P.; Díez, P.;
Morrondo, P. (2003). Prevalence of natural ovine fasciolosis shown by demostrating the presence of serum
circulating antigens. Parasitology Research, 91 (8-9): 328-331.
Sánchez-Andrade, R.; Paz, A.; Suárez, J.L.; Panadero, R.; Pedreira, J.; López, C.; Díez-Baños, P. Morrondo, P.
(2002). Influence of age and breed on natural ovine fasciolosis in an endemic area (Galicia, NW Spain).
Veterinary Research Communications, 26: 361-370.
Szmidt-Adjide, V.; Abrous, M.; Adjide, C.C.; Dreyfuss, G.; Lecompte, A.; Cabaret, J.; Rondelaud, D. (2000).
Prevalence of Paramphistomum daubneyi infection in cattle in central France. Veterinary Parasitology, 87:
133-138.
Tienpont, F; Rochette, F.; Van Parjis, O. (1979). Diagnóstico de las verminosis por el examen coprológico. Ed.
Cansen Research Foundation.
INFECTION BY INTESTINAL CESTODES IN SHEEP FROM GALICIA
(N.W. SPAIN)
Infekcija ovaca iz područja Galicije crijevnim

trakavicama
Dacal, V., Vázquez, L., Cienfuegos, S., Panadero, R., Pato, J., Fernández, G.,
Díez-Baños, P., López, C.
Área de Sanidad Animal del Departamento de Patología Animal. Facultad de Veterinaria. Universidad de
Santiago de Compostela. 27002. Lugo. Spain. dibapa@lugo.usc.es
ABSTRACT
In this study we investigate the presence of tapeworms in 1549 ovine faecal samples from 59 ovine farms
in Galicia (N.W. Spain). In this region, sheep are maintained on pasture for most part of the year. In order to
study the influence of the age, 3 groups were considered: 3-12 month-old (G-1), 13-48 month-old (G-2) and >48
month-old (G-3). Coprological examinations were conducted by visual inspection of faeces to detect proglottids
and by the Flotation in saturated saline solution method, the egg output was quantified using the modified
McMaster technique. Sheep from 31 farms (52.5%) were positive for cestode eggs, being Moniezia the only
Genus identified. Seventy-one animals out of 1549 (4.6%) eliminated Moniezia eggs in their faeces, with a
mean intensity of infection of 376.0±89.64 eggs per gram. Four animals from 2 farms eliminated spontaneously
individual segments in the faeces that were identified as Moniezia expansa proglottids. When considering the
different age groups, we observed that prevalence in lambs (G-1, 11.3%) was higher than in adults (3.8% and
4.2% for G-2 and G-3, respectively) with significant statistical differences. In the same manner, the intensity of
parasitation was significantly more elevated in lambs than in adults.
Sažetak
Mali preživači, a osobito njihova mladunčad mogu biti invadirani različitim vrstama trakavica iz pododice
Anoplocephalidae. U našem radu istraživali smo prisustvo trakavica u 1549 uzoraka ovčjeg fecesa sa 59 ovčjih
farmi u Galiciji????.U ovom području, ovce se većinom godine drže na ispaši. Odlučili smo istražiti utjecaj dobi
na invadiranost životinja. Životinje su bile podijeljene u 3 skupine: 1. skupina- od 3-12 mjeseci starosti, 2. skupina
od 13-48 mjeseci starosti, 3. skupina jedinke starije od 48 mjeseci.Koprološka pretraga bila je potkriepljena
vizualim pregledom fecesa I pomoću flotacije. Konačni rezultat koprološke pretrage kvantificiran je pomoću
modificirane McMaster metode. U ovaca sa 31 farme (52.5%) pronađena su jajašca trakavice Moniezia??.
Sedamdeset I jedna životinja izlučivala je jajašca Moniezae u svom izmetu a prosječni intenzitet infekcije je bio
376.0+/- 89.64 jajašca u gramu izmeta. Četiri životinje sa 2 farme spontano su fecesom izlučivale proglotide
koje su kasnije identificirane kao Moniezia expansa. Uzimajući u obzir različite dobne skupine, primjetili smo
da je prevalencija u janjadi ( 1. skupina, 11.3&) veća nego u odraslih jedinki ( 3.8% I 4.2% za 2. I 3. skupinu)
sa statistički značajnom razlikom P=0.0001, F=16.973). Također, intenzitet parazitarne invazije je statistički
značajan ( P=0.03, F=3.691) u janjadi ( 766.8+/-1019.8) naspram odraslih (326.4+/-920.0 I 178.1 +/-246.2 za 2.
I 3. skupinu). Naši rezultati ukazuju na potrebu prihvaćanja mjera kontrole kako bi se smanjio rizik pojavnosti
jakih infekcija sa trakavicama, posebno u mladih životinja.
INTRODUCTION
Galicia is a humid region in the Northwest of Spain with around 240.000 sheep distributed
in more than 24.000 flocks. Traditionally, in this region sheep are maintained in an extensive or
semiextensive husbandry system that increases the probability of acquiring some parasitic infections.
Small ruminants, especially young animals between 1-6 months, can be affected by different
tapeworm Genera of the family Anoplocephalidae (Moniezia, Avitellina, Thysaniezia and Stilesia)
which are localized in the small intestine, being the most prevalent and pathogenic Moniezia sp. The
pathogenic action of these cestoda depends on the number of adults in the small intestine and the
nutritional state of the animal.
Animals became infected when they feed on grass that harbours mites of the Oribatid Family
containing cisticercoid larvae. The activity of oribatids is seasonal under template conditions and
especially in cool climates. Tapeworm segments can be visible in the faeces, with a white rice grain-
like appearance. Adult worms, often up to a meter or more in length, can also be seen on post-mortem
or, when expelled, as passed in the environment, typically in yards or other areas where sheep are
concentrated. This species have a mechanical, irritative and nutritional-subtractive effect on its hosts,
and can cause considerable economic losses, especially in young animals. Normally, they provoke a
chronic process with intestinal disturbs, lack of appetite and emaciation.
Tapeworm eggs can be detected in faecal samples using the standard worm egg count procedure.
Those of the Moniezia Genus have a typical tri- or quadrangular shape with a characteristic piriform
apparatus.
In the last years, there is a continued and increasing evidence of significant resistance to
anthelmintics used in sheep. For this reason the inclusion of tapeworm control in a flock health plan
would require evidence of their deleterious effect over the health and the production of the animals.
The purpose of this study was to study the prevalence and intensity of parasitation by adult
cestodes in sheep from Galicia in order to determine the necessity of including routinely tapeworm
control measures in our flocks.
From February to December 2007 we took a total of 1.549 ovine faecal samples from 59 ovine
flocks from Galicia (N.W. Spain). Faecal samples were taken individually from de rectum to avoid
contamination. Coprological examinations were conducted by macroscopic inspection of faecal
material to detect proglottids and by the Flotation in saturated saline solution method (ρ= 1.2); the
egg output was quantified using the modified McMaster technique. The egg-counts are presented as
the number of eggs per gram of faeces (epg). Moniezia eggs were identified according to Tienpont
et al. (1979).
In order to study the influence of the age, 3 groups were considered: 3-12 month-old (G-1), 13-48
month-old (G-2) and >48 month-old (G-3).
Data were analysed using the SPSS, Version 13.0 (SPSS Inc., Chicago, IL). The Chi-squared
test (χ2) was used to determine significant differences in prevalence when considering the age of the
animals. ANOVA was used to find out differences in the intensity of infestation when considering the
different age groups (P< 0.05). When the ANOVA test revealed differences the Bonferroni multiple
comparison test was applied to localize these differences.
In our study, a high number of flocks (31 out of 59) were positive for cestode eggs (Figure 1),
whereas only 71 out of 1.549 sheep (Figure 2) eliminated cestode eggs in their faeces, with a mean
intensity of infection of 376.0±89.64 eggs per gram.
p o sitive
4,6%
n e g a tive
47,5%
p o sitive
52,5%
n e g a tive
95,4%
Fig. 1. Farms infected by Moniezia Fig. 2. Animals infected by Moniezia

All cestode eggs that were detected in this study were identified as Moniezia eggs. Moreover,
four animals from 2 farms eliminated spontaneously individual segments in the faeces that were
identified as Moniezia expansa proglottids. Confirming that in sheep from the Northwest of Spain
Moniezia expansa is the most prevalent tapeworm. Those results agree with those of Hernández et al.
(2000), Domínguez et al. (2000), Díez-Baños et al. (2006) and others, who identified Moniezia as the
unique Cestode eliminated by ovines in different regions of Spain.
The high percentage of flocks that eliminate Moniezia eggs can be propitiated by the fact that
in Galicia sheep are maintained on pasture for most part of the year, facilitating the ingestion of the
intermediary hosts. Moreover, humid conditions present in Northern Spain can favour the survival of
eggs in the environment and the activity of mites acting as intermediate hosts.
Despite the high prevalence per flock, the total number of infested animals is scarce, being
inferior to the 6.29% found by Díez-Baños et al. (2006) in the neighbouring province of León and
the 9.97% observed by Dominguez et al. (2000) in sheep from central Spain, but higher to the 1.04%
found by Hernández, et al. (2000) in the Mediterranean area.
When considering the different age groups, we observed that prevalence in lambs (G-1; 11.3%)
was higher than in adults (3.8% and 4.2% for G-2 and G-3, respectively) with significant statistical
differences (P<0.001, χ2=16.973).
12
10
8
PREVALENCE %
0
G-1 G-2 G-3
Figure 3.- Prevalence of Moniezia in the different groups of age
It is well known that young lambs, 1 to 3 month-old are more intensely parasitized than older
animals. Reduction of levels of parasitation with the age is related with the development of a partially
protector immune response. According to Elliot (1986) lambs between 4 to 5 months of age commonly
pass proglotids or mass of whole worms and tend to expel infection. Those results are in agreement
with our findings where both, prevalence and intensity of parasitation are more elevated in young
animals. The fact that young lambs were the most infected could be the cause of the scarce number
of parasitized animals found in this study, as we only sampled animals older than 3 months of age.
Surprisingly, Domínguez et al. (2000) did not detect Moniezia in the group of lambs younger than 1
year, being animals between 1-2 years the most parasitized.
In the same manner, the intensity of parasitation was significantly (P=0.03, F=3.691) more
elevated in lambs (766.8±1019.8) than in adults (326.4±920.0 and 175.1±246.2 for G-2 and G-3,
respectively).
Cordero et al. (1999) affirmed that the scarce presence of these parasites in ovine is generally
harmless, although the coincidence in spring of high concentration of oribatids and young animals
on pasture could provoke the apparition of some clinical cases. Adult sheep show a certain degree of
resistance, so that it is unusual to find infections with more than 1-2 specimens/animal, whereas young
lambs can harbour a greater number (more than 10-12 tapeworms) with very high egg outputs.
2000
1800
1600
INTENSITY OF PARASITATION (EPG)
1400
1200
1000
800
600
400
200
0
G-1 G-2 G-3
Figure 4.- Intensity of parasitation by Moniezia considering the age of the animals
Taking into consideration our results, it would be necessary to adopt some prophylactic or
control methods to avoid the risk of apparition of massive infections in young animals that could be
presented under favourable epidemiologic conditions for oribatid mites. Those measures would be
orientated to reduce the contamination of pastures and could include strategic treatments to pregnant
ewes and 1-2 month-old lambs. It must be also taken into consideration that, despite its low levels of
infection, adults act as a constant source of contamination, making necessary their treatment in fall
and spring and the adoption of control measures to avoid the contamination of pastures with faeces
from those treated animals.
ACKNOWLEDGEMENTS
Authors are very grateful for the collaboration of shepherds and veterinarians of the Asociación de
criadores de ganado ovino y caprino de Galicia (OVICA). This study was supported by the research project
PGIDIT06RAG26101PR (Xunta de Galicia).
REFERENCES
Cordero del Campillo, M. (1985). Principales problemas parasitarios debidos al pastoreo del Ganado ovino en
la cuenca del Duero. Comunicaciones INIA. Serie Higiene y Sanidad (11): 19-35.
Díez-Baños, N.; Martínez-Delgado, A.; Hidalgo-Argüello, M.R. (2006). Estudio parasitológico del ganado
ovino en la provincia de León (España) mediante análisis coprológico. En: Veinte años de Buiatría. Edita
Universidad de Santiago de Compostela: 380-383.
Domínguez, I.A.; Gómez, M.T.; De La Fuente, C.; Carpintero, M.; Cuquerella, M.; Alunda, J.M. (2000)
Parasitosis gastrointestinales en ganando ovino de la zona centro: modelo de estructura poblacional y
distribución etaria. Medicina Veterinaria, 17(6): 147-154
Elliot, D.C. (1986). Tapeworm (Moniezia expansa) and its effect on sheep production: the evidence reviewed.
New Zealand Veterinary Journal, 34: 61-65.
Hernández, S.; Acosta, I.; Becerra, C. (2003). Cestodosis imaginales. En: Enfermedades parasitarias del ganado
ovino y caprino. Ediciones Gea, Barcelona. 176pp.
Ramajo, V.; Muro, A. (1999). Cestodosis digestivas. En: Parasitología Veterinaria. Edit McGraw-Hill
Interamericana, Madrid: 229-235.
Tienpont, F.; Rochette, F.; Van Parjis, O. (1979). Diagnóstico de las verminosis por el examen coprológico. Ed.
Cansen Research Foundation.
Toxoplasma gondii screening, by molecular and
serological methods, in a farm with a rural
management in Sicily
Istraživanje Toxoplasmae gondii molekularnim i

serološkim metodama na farmama sa zastarijelom
tehnologijom na području Sicilije
Vitale Maria, Scatassa Maria Luisa, La Giglia Maria, Giangrosso Giuseppe, Currò Vit-
toria, Vitale Fabrizio, and Caracappa Santo
Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri” Palermo, Italy
AIM OF THE WORK:

The purpose of this work was to establish a pilot study on a farm with a high rural management
and poor hygienic conditions, for comparison on Toxoplasma gondii detection by serology and
molecular biology methods. The farm is family managed, and contains sheep, goats and cows in the
same place and cats and dogs that are freely running. All these conditions determine a favourable
environment for the oocysts spreading and the parasite circulation among different animal species.
Sažetak:
Cilj ovoga rada bio je provesti ishodišnu studiju na farmama sa lošim higijenskim uvjetima te to komparirati
sa učestalošću nalaza Toxoplasmae gondii putem seroloških i molekularnih metoda. Istraživanje smo proveli
obiteljskim gospodarstvima na kojem zajedno obitavaju ovce, koze, krave te psi i mačke koji nisu pod nadzorom.
Svi tu uvjeti doprinose širenju oocista i širenju parazita među različitim vrstama životinja.
Toxoplasma gondii je protozoa koja može inficirati sve toplokrkvne životinje i različite vrste tkiva kod
njih. Zbog toga je seroprevalencija te bolesti u svijetu od 20 do 80% i kod ljudi i kod životinja. U životnom
ciklusu T. gondii postoji seksualna i aseksualna faza. Tahitoiti predstavljaju invazijski oblik ovog parazita ( brzo
se razmnožavaju a akutnoj fazi infekcije ), bradizoiti ( stvaraju ciste u tkivima), i konačno sporulirane oociste
koje u okoliš dospijevaju mačijim fecesom. Toksoplazmoza se širi ingestijom encistiranih bradizoita u tkivima,
unosom hrane iv ode koje su kontaminirane mačjim fecesom koji sadrži sporulirane oociste ili transplacentalno.
Infekcija najčešće protiče asimptomatski ali može biti opasna za fetus tijekom gravidnosti.U koza i ovaca može
uzrokovati pobačaj i probleme pri porodu.Serološkim istraživanjem populacija ovaca na Siciliji utvrđeno je
preko 60% pozitivnih životinja što je bilo u svezi sa dobi i držanjem istih te prisustvu mačaka.
Materijali i metode: Uzorci su uzimani na nasumično odabranoj farmi sa lošim higijenskim uvjetima te su
skupljani od različitih životinja tijekom cijele godine. Molekularan analiza provedena je putem PCR metode.
Rezultati i rasprava: Prosječna dob ovaca bila je oko 2 godine. Istraživanje je započelo na ovcama u laktaciji
zbog toga što se PCR-om dobivaju pozitivni rezultati za vrijeme jutarnje mužnje i negativni rezultati kod
poslijepodnevne mužnje. Metodom ELISA-e utvrđeno je 40% pozitivnih životinja.PCR analiza krvi i seruma
istih 20 ovaca dala je negativne rezultate. Zboč činjenice da se tahizoiti nalaze u krvi samo u akutnoj fazi bolesti
ili u reaktiviranoj toksoplazmozi rezultati upućuju da su inficirane životinje vjerojatno u kroničnij fazi bolesti
što će biti potvrđeno PCR metodom nakon uzimanja uzoraka tkiva nakon klanja životinja. Konačno u tijeku
je razvoj metode za analizu individualnog uzorka mlijeka seropozitivnih životinja u različitim vremenskim
razmacima.
BACKGROUND:
Toxoplasma gondii is a coccidian protozoa that can infect all warm blood animals and all
different cells. For this reason seroprevalence ranging from 20 to 80 % is quite spread world wide in
both human and animals. The protozoa perform a sexual life cycle in the intestine of felids, while an
asexual life cycle is present in all animals resulting in tissues cysts formations. The infectious forms
are represented by tachyzoites, (rapidly dividing in the acute phase of the infection), bradyzoites
(slowing growing inside tissue cysts) and sporulated oocysts eliminated in the faeces of infected
felines. (1)
Evidences from multi-centres analysis have shown that the major risk factors for T. gondii
transmission in humans are connected with contaminated food and water assumption (2).
Toxoplasmosis can be spread by ingestion of tissue with encysted bradyzoites, ingestion of food or
water contaminated by sporulated oocysts, and transplacental transmission. Infections are quite often
asymptomatic but can be particularly dangerous for the foetus when the primary infection occurs
during pregnancy (congenital toxoplasmosis). In both sheep and goats congenital toxoplasmosis can
cause abortion and birth defects. Because of the Sicilian territorial characteristics a number of small
farms is present in which few cows are maintained with sheep and goats in a rural type, family run
management.
A general serological screening on ovine populations, revealed positive serology up to more then
60% in several ovine flocks depending from the age of the animals, the type of the management and
the presence of cats (3).

The farm was chosen among several for the type of management and the poor hygienic
conditions.
Collection of samples from all different animals are planned in different time period all year
around.
The first screening was performed winter time in sheep bulk milk samples and animal sera.
Molecular analysis were performed by a nested PCR targeting the rRNA region on both sera, blood
and milk samples.
DNA was extracted from the different samples by Gene Elute mammalian kit ( Sigma cat N°
G1N- 350) following manufacture’s instructions. Analyses were performed by a first direct PCR using
NC 18S RNA sense primer (5’TGCGGAAGGATCATTCACACG 3’, Invitrogen) and NC25S RNA
antisense primer (5’CCGTTACTAAGGGAATCATAGTT3’, Invitrogen). The amplified fragment is
approx. 1000bp.This PCR was performed for 7 min at 95°C followed by 40 cycles of 40 s at 94°C, 30
s at 58°C, 1 min at 72°C and a final extention of 7 min at 72°C. A nested PCR using Toxo ITS1sense
primer(5’GATTTGCATTCAAGAAGCTGATAGTAT 3’, Invitrogen) and Toxo ITS1 antisense pri
mer(5’AGTTAGGAAGCAATCTGAAAGCACATC, Invitrogen) was performed for 7 min at 95°C
followed by 40 cycles of 40 s at 94°C, 30 s at 60°C, 1 min at 72°C and a final extention of 7 min at
72°C. The fragment amplified approx. is 333bp. Amplifed products were loaded on 2% agarose gel
and visualised on chemi doc (BIORAD).
The sera samples (10 µl) were assayed by the Toxoplasmosis indirect multi-specie ELISA
diagnostic kit (ID.VET, code TOXOS 0907) following manufacture’s instructions.
RESULTS AND DISCUSSION.

The average age of the sheep are almost 2 years. The screening started on lactating sheep only
because PCR analysis on bulk milk samples gave positive results on morning milking and negative
results in afternoon milk. (Figure 1).
Figure 1: PCR on ovine bulk milk samples taken in morning (m) and afternoon milking (a): Negative control
with water only (k-) and DNA toxoplasma positive control (k+). DNA molecular ladder of 100bp (M)
The different results between morning and afternoon milking is not clear and further analysis
will be performed in the same farm and in other farms as well.
The results by ELISA on the 25 lactating ewes showed 44% positive animals. (table 1)
Table 1: Results of Elisa screening.
Total sera 25 %
Positive 11 44
Negative 14 56
Further analysis will be performed on sera of the goats and the cows present also in the farm.
PCR analysis on blood and sera of the same 25 sheep gave negative results. Since T. gondii
tachyzoites are circulating in the blood only in acute phase or reactivation following immuno-
depression, the results indicate that infected animals are probably in a stage of chronic toxoplasmosis
and tissue sampling for PCR analysis will be performed whenever some animals will be slaughtered.
Moreover analysis are in progress on individual milk samples from the seropositive animals and in
different time period.
The focusing on a farm with a highly rural type of management, with animal promiscuity and
poor hygienic conditions that favours Toxoplasma gondii spreading can be propedeutic not only for
epidemiological analysis but also for the setting up of highly sensitive methods to detect the parasite
on different sources.
Reference
1) D. Correa, I. Cañedo-Solares, L. B. Ortiz-Alegría, H. Caballero-Ortega, C. P. Rico-Torres (2007) Congenital
and acquired toxoplasmosis: diversity and role of antibodies in different compartments of the host. Parasite
Immunology 29 (12) , 651–660
2) A J C Cook, R E Gilbert,W Buffolano, J Zufferey, E Petersen, P A Jenum, W Foulon, A E Semprini, and D
T Dunn, 2000 Sources of toxoplasma infection in pregnant women: European multicentre case-control
study BMJ. July 15; 321(7254): 142–147.
3) Vesco, G; Buffolano, W; La Chiusa, S; Mancuso, G; Caracappa, S; Chianca, A; Villari, S; Currò, V; Currò,
V; Liga, F; Petersen, E (2007) Toxoplasma gondii infections in sheep in Sicily, southern Italy Veterinary
Parasitology, 146(1)
ACKNOWLEDGEMENTS: The authors wish to thank Mr. Salvatore Marceca and Mr. Giulio Verro for
sampling collection.
Genetical markers of resilience to tick borne diseases
(TBD) - a research project for the improvement of sheep
breeding and management strategies
Genetski markeri rezistencije na bolesti prenosive

krpeljima (BPK)-istraživački project sa ciljem napredka
uzgoja ovaca i srategija upravljanja
Pieragostini E1., Alloggio I1., de Ruvo G1., Rubino G2., Petazzi F2.
1
Dept. PROGESA- Università di Bari. Via Amendola, 165/A, Bari (BA) - Italy.
2
Dept. SBA - Università di Bari - Strada provinciale per Casamassima km 3 - 70010 Valenzano (Bari) – Italy
Abstract
Traditional phenotype-based selection methods have been very successful in improving traits
that are easily recorded, such as milk yield and growth rates. Little progress has been also made in
traits that are more difficult to measure such as response to disease and reproductive competence.
Indeed, the intensive selection for increased production has resulted in a decline in other commercially
important traits eg in Holstein cattle there has been a steady decline in fertility that mirrors the
increase in milk production. The selection for high yielding animals potentially creates management
problems where individuals have a higher production capacity than they are able to sustain, leading
to metabolic stress, which in turn results in decreased efficiency of production, high disease incidence
and impaired reproductive success. Therefore, it is important that in the future selection strategies do
not focus on production traits alone, but consider the whole animal.
Sažetak
Tradicionalne selekcijske metode, bazirane na fenotipu, korisne su u poboljšanju obilježja koja se
jednostavno bilježe, poput dobitka mlijeka i prirasta. Mali napredci su također dobiveni kod obilježja koja
su teže mjerljiva, poput otpornosti na bolesti i rasplodne sposobnosti. Naprotiv, intenzivna selekcija prema
povećanoj prduktivosti je dovela do pada ostalih komercijalno vrijednih svojstava. Npr. kod holsteinskih krava
nađeno je smanjenje stupnja plodnosti što odražava povećanje mliječnosti. Selekcija prema visokom stupnju
mliječnosti može dovesti do problema kada jedinke imaju potencijal proizvodnje koji nadmašuje mogućnosti
njihovog organizma, te dolazi do metaboličkog stresa, što pak naposlijetku dovodi do smanjenja produkcije,
učestalosti oboljenja i smanjenja reproduktivnih sposobnosti. Stoga je važno da se se buduće strategije selekcija
ne usredotočuju jedino na reprodukcijska obilježja, već da uzmu u obzir životinje u cjelini.
Introduction
A project, aiming to the improvement of animal breeding by the use of molecular genetics and
lasting from 2007-2010, has been sponsored by the Italian Ministry for Agriculture and Forestry
Policy (MIPAF). A part of this project concerns the resistence to stress and diseases in various domestic
animal species and this work describe the activity plan of the part concerning the improvement of
sheep breeding by the use of genetical markers of resilience to TBD. Apulian native sheep show
the ability to thrive in areas of high tick borne disease (TBD), but attempts to improve the their
productivity by crossing them with exotic breeds has failed due to the high mortality in generations
F1 and F2, as a result of TBD. Since now there are indications suggestive of factors which may limit
the effects of the infection; particularly, the phenomenon seems to be linked to the ability to cope
with anaemia per se as well as to the presence of extra α-globin genes. However, the response to TBD
diseases like Trypanosomosis and Theileriosis are known to be under multi-factorial regulation. In
this study Apulian and exotic breeds as well as sheep characterized by different alpha and beta globin
genotypes will be used as a model for investigating genetic responses to the disease obtained by an
experimental infection with Babesia ovis.
The timing of activities are being managed starting from the research of animals suitable for
the trials which will include, first an experimental infection of Apulian native sheep and sheep of
Northeren exotic breeds, then, Apulian native sheep characterized by different alpha and beta globin
genotypes.
The selection of individuals belonging to native breeds and carrying the appropriate alpha globin
haplotypes will be performed by a population survey.
Animals. Forty selected animals less than one year of age will be involved in this study. They
will be purchased and housed at the Medical Clinics of the Department of Animal Health and
Welfare of the University of Bary. Upon arrival at the Faculty of Veterinary Medicine, the animals
will be weighed, and faecal samples will be obtained to establish their worm burdens. The feet will
be checked as to foot rot. The animals will be dewormed with a broad spectrum anthelmintic. All
animals will be housed in a tick proof isolation unit.
Parasites. Babesia ovis will be isolated from a sheep immunosuppressed with high-dose cortisone
treatment and allowed to be naturally infected pasturing in tick areas. At the peak of parasitaemia in
the sheep, a blood sample will be obtained from the jugular vein and parasitaemia estimated by the
buffy coat method. Thirty/fifty ml of blood will be then obtained from the donor sheep and 10 sheep
of each group will be inoculated i/v with 2 ml of infected blood by the jugular route.
Experimental design The 40 animals of Apulian and exotic breeds as well as sheep characterized
by different alpha and beta globin genotypes will be divided into four groups according to their breed
and hemoglobin genotype. Ten weeks after arrival at the isolation unit, 5 animals of each group will
be infected with B. ovis by i/v injection via the jugular vein while the other 5 animals will act as
uninfected controls. All animals will be weighed once a week using a sheep weighing scale and 5
ml of blood will be collected into tubes containing ethylene diamine tetra acetic acid (EDTA) as an
anticoagulant 3 times a week. Following microhaematocrit centrifugation, the PCV will be measured
and parasites will be identified and quantified by examination of the buffy coat.
Clinical evaluation will be done on a daily basis and rectal temperatures will be recorded every
morning for 4 weeks post inoculation. Blood and serum samples will be collected regularly during
the observation period.
The host responses in different sheep groups artificially infected will be compared mainly on
typical high fever periods, microscopic observation, antibody response. Particular attention will be
given to native sheep carriers of alfa globin extra genes and to their behaviour under experimental
infection when compared to that of native and imported sheep with normal alfa gene arrangement.
Uvod
Projekt (2007-2010) s ciljem poboljšanja produkcijskih obilježja uporabom molekularne genetike,
sponzoriran od strane talijanskog ministarstva poljoprivrede i šumarske djelatnosti (MIPAF). Dio se ovog projekta
odnosi na odpornost prema stresu i bolestima različitih domaćih životinja i ovaj rad opisuje plan napredka
uzgoja ovaca uporabom genetskih markera otpornosti na bolesti prenosive krpeljima. Apulijanske izvorne ovce
pokazuju sposobnost napredka u područjima s visokom učestalošću bolesti prenosive krpeljima, ali su pokušaji
križanja takvih ovaca sa egzotičnim pasminama doveli do povećanog mortaliteta u F1 i F2 generacijama,
kao posljedica BPK. Do sada postoje predpostavke da određeni faktori spriječavaju infekciju. Ova se pojava
posebice odnosi na mogućnost borbe protiv anemije po sebi ili kao prisutost posebnih α-globin gena. Kako god,
poznato je da je osjetljivost na bolesti prenosive krpeljima, poput tripanosomijaze i tajlerioze, multikauzalne
regulacije. U ovom istraživanju su korištene apulijanske i egzotične pasmine, kao i ovce s razlličitim alfa i
beta globinskim genotipovima kao modeli u istraživanju genetskog odgovora na eksperimentalno uzrokovanu
infekciju Babesiom ovis.
Početak istraživanja bio je usredotočen na pronalazak najprimjenljjivijih jedinki koje su podvrgnute
prvo eksperimentalnoj infekciji apulijanske izvorne ovce, karakterizirane različitim alfa i beta globinskim
halotipovima, i ovce sjevernih egzotičnih pasmina. Odabir jedinki izvornih pasmina sa odgovarajućim alfa
globinskih halotipovima proveden je istraživanjem populacije.
Životinje. U ovom ćese istraživanju koristiti četrdeset životinja starosti do godinu dana. Životinje će biti
nabavljene, te smještene u Klinikama Zavoda za zdravlje I dobtrobit životinja , fakulteta u Bariju. Dolaskom
na fakultet, životinje će se biti izvagane, uzet će im se uzorak az koprološku pretragu, pregledat će im se
papci. Izvršit će se dehelmintizacija antiparazitikom širokog spectra. Sve će životinj ebiti smještene u nastambe
provjereno slobodne od krpelja.
Paraziti. Babesia ovis će biti izolirana iz ovce koja je predhodno imunosuprimirana viisokim dozama
kortizonai puštena prirodnoj infekciji na infestirani pašnjacima. Na vrhuncu parazitemije ivce, iz jugularne
vene će se uzeti uzorak krvi i potvrdit će se parazitemija uporabom “buffy coat” metodom. Trideset do pedeset
mililitara krvi će se uzeti iz ovce donora u deset ovaca iz svake skupine će se u venu jugularis aplcirati po 2 ml
inficirane krvi.
Opis postupka. 40 životinja apulijske i egzotičnih pasmina , kao i one karakterizirane različitim alfa i beta
globinskim genotipovima, bit će podijeljene u 4 grupe, s obzirom na pasminu i hemoglobinski genotiop. Deset
tjedana nakon dolaska u izolacijsku jedinicu, inficirat će se 5 životinja iz svake skupine intravenskom aplikacijom
u venu jugularis, ostalih 5 životinja u skupine koristit će se kao kontrolna skupina. Ovce će biti vagane jednom
tjednoi, a tri puta tjedno će se 5ml krvi uzeti u EDTA epruvete. Nakon centrifugiranja mikrohematokrita, odredit
će se hematokrit i paraziti će se identificirati uporabom “buffy coat “ medode. Klinički pregled će se vršiti
svakodnevno, rektalna temperature će se bilježiti svako jutra u 4 tjedna nakon inokulacije. Za to će se vrijeme
redovito sakupljati uzorci krvi i seruma. Odgovor organizma u različitim grupama usporedit će se s obzirom
na razdoblja visoke temperature, mikroskopske nalaze, odgovore protutijela. Posebna će se pozornost posvetiti
ovcama s alfa globinskim genima i njihovom ponašanju u uvjetima eksperimentane infekcije, te ih usporediti sa
nativnim i uvezenim ovcama s normalnim rasporedom alfa gena.
PASSIVE MONITORING EXPERIENCES ON CYSTIC
ECHINOCOCCOSIS IN ITALY
ISKUSTVA PASIVNOG MONITORINGA CISTIČNE EHINOKOKOZE U

ITALIJI
Poglayen Giovanni*, Stancampiano Laura*, Varcasia Antonio**, Anna Paola Pipia**,

Caterina Bio***, Costanza Romanelli*
*Dipartimento di Sanità Pubblica Veterinaria e Patologia Animale, Ozzano dell’Emilia, Bologna -

Italy.,**Dipartimento di Biologia Animale, Sassari -Italy; *** AUSL 8 Arezzo - Italy,
Introduction – Cystic Echinococcosis (CE) due to Echinococcus granulosus is still the main
parasitic zoonoses, typical of the Mediterranean basin (Eckert et al, 2001). Recent updating of the
Italian situation (Garippa, 2006) shows different prevalence levels that led to divide the territory in
sporadic (north) endemic (center) and hyper endemic (south and islands). With the aim to have more
epidemiological information on sporadic and endemic areas this paper reports the results of passive
monitoring of CE arising from the analysis of the slaughter data of a small abattoir in Tuscany. For
a better definition of the circulating strains, the collection of some specimen in order to perform
biomolecular analysis completed the work.
Sažetak
Uvod-Cistična ehinokokoza, uzrokovana Echinococcus granulosus je i dalje najčešća parazitarna zoonoza,
tipična za mediteranske krajeve (Eckert et al, 2001). Noviji podaci stanja u Italiji (Garippa 2006) ukazuju na
različite stupnjeve prevalencije čime se područje dijeli na sporadična (sjever),endemska (centar) i hiperendemska
( jug i otoci). S ciljem dobivanja više epidemioloških podataka o sporadičnim i endemskim područjima ovaj
rad govori o rezultatima pasivnog monitoringa CE dobivenih na osnovu analiza potataka pri klanju u jednoj
maloj klaonici u Toskani. Kako bi dobili uvid u rasprostranjenost sojeva, izvršene su i biomolekularne analize
nekih uzoraka. Materijali i metode-Analizom podataka o klanju u razdoblju od tri godine (2004-2005-2006)
obuhvaćene su 1271 odrasle ovce iz 464 farme, 1209 (95%) domaćih i 62(5%) uvezene (Austrija, Francuska,
Njemačka, Nizozemska, Poljska). Ukupan broj ovaca iznosio je 16.999, 14982 (88%) domaćih i 2.017 uvezenih
ovaca. Kao što je I bilo za očekivati, ženskih jedinki je u našemi straživanju bilo više (9959. Statistička anliza
provedena je u skladu sa Armitageom (1971). Iz dva uzorka germinativnog sloja protoskoleksa sa šest farmi,
dobiveno je jedanaest cisti iz kojih je komercijalnim kitom izolirana DNA i PCR protokolom (Dinkel i sur. 2004)
razlikovane pojedine skupine sojeva E. granulosus (Eckert i sur. 2001). Rezultati dobiveni PSR-ompotvrđeni su
slijedom COI i NADH mitohondrijskih gena (Bowles J, Mcmanus DP, 1993, Int.; Bowles J et al, 1994).
Rezultati i diskusija-S obzirom na organizaciju rada u klaonici, podaci o jetri I plućima odnosili su se na
skupine, a ne na pojedine životinje. Korelacijska analiza je pokazala pozitivnu korelaciju između broja pozitivnih
uzoraka u skupini Pearson’s r 0.82 P<0.001). Ipak ,učestalost pozitivnih uzoraka je bila viša kod pluća (37,5%),
odnosno značajno viša (Χ 2 =7639 P< 0.001) nego kod uzoraka jetre (24,5%). Prevladavanje pozitivnih uzoraka
pluća razlikovao se od 27,2 % (inozemstvo) do čak 40%u centralnom dijelu i Sardiniji, no te razlike nestaju u
nacionalnim razmjerima (Χ 2 = 4.39 P>0.1). Naši rezultati potvrđuju usko razlikovanje sojeva PCR protokolom
(Dinkel i sur. 2004), čime su identificirana 11Eg uzorka iz skupine G1-G2-G3. Sekvenca mitohondrijskih gena
NADH i COI, dokazala je da svi uzorci pripadaju skupini G1 (obične ovce), osim dva uzorka koji pripadaju
G3, ili Bufalo skupini. Sa sociološkog, no i praktičnog stajališt, možemo reći da je proširenost CE visoka gdje
postoji neuravnoteženost socio-ekonomskog razvoja I broja uzgajanih ovaca. Svijet uzgajivača se uvijek čini
nepropusan za zdravstvenu edukaciju što dovodi do komunikacijskih poteškoća prema veterinarskim službama.
Materials and methods – The analysis of three years (2004 – 2005 – 2006) of slaughter data
allowed to check 1271 stocks of adult sheep coming from 464 farms, 1209 (95%) of national
origin and 62 (5%) from abroad (Austria, French, Germany, Holland, Poland). The total number of
inspected sheep was 16.999, 14982 (88%) of national origin and 2.017 (12 %) from foreign countries.
As expected, the female are more represented (99%) in our sample. Statistical data analysis was
performed according to Armitage (1971).
Two specimen of germinal layer and protoscoleces from six farms was collected and from
eleven viable cysts DNA was extracted with a commercial kit (High pure PCR template preparation
kit, Roche) and PCR protocols pointed out by Dinkel A et al (2004) applied for discrimination of the
various clusters of strains of E. granulosus (Eckert J et al, 2001). Nested PCR results were confirmed
by sequencing of COI and NADH mithocondrial genes (Bowles J, Mcmanus DP, 1993, Int.; Bowles
J et al, 1994).
Results and discussion – Due to the work organization in the abattoir the data about livers
and lungs was collected for each stock and not for each animal but the correlation analysis showed
a positive correlation between the number of positive livers and lungs in stocks (Pearson’s r 0.82
P<0.001). However the observed lung prevalence (37,5%) resulted significantly higher (Χ 2 =7639
P< 0.001) than the liver one (24.5%). Lung prevalences calculated for different areas ranged from
27,2 % (abroad) to almost 40 % in center and Sardinia but this difference disappears as national
areas only were considered (Χ 2 = 4.39 P>0.1).
Our data confirming the higher Strain typing obtained by PCR protocols pointed out by Dinkel
A et al (2004) lead us to identify the 11 Eg sampleas as belonging to the G1-G2-G3 Cluster. The
subsequently sequencing of mithocondrial genes NADH and COI, has determined that all samples
belong to G1 (common sheep) strain except for 2 samples that belongs to the G3 or Buffalo strain.
Strain typing obtained by PCR protocols pointed out by Dinkel A et al (2004) lead us to identify the
11 Eg sample as belonging to the G1-G2-G3 Cluster. The subsequently sequencing of mithocondrial
genes NADH and COI, has determined that all samples belong to G1 (common sheep) strain except
for 2 samples that belongs to the G3 or Buffalo strain.
From a sociological, but also operative, point of view the key of lecture of these results highlights
the CE diffusion with high prevalence levels everywhere sheep are bred independently of the socio-
economic development of the area and the number of sheep raised. The breeder world appear to be
always impervious to health education and it is a considerable communication trouble for veterinary
services but also for category associations that do not reach to realize control programs even if of
low profile
A Field Report to Compare the Responses in calves
with diarrhoea associated with Cryptosporidiosis
when treated with Electrolytes with or without
Betacyclodextrin
USPOREDBA ODGOVORA NA TERAPIJU PROLJEVA POVEZANOG SA

KRIPTOSPORIDIOZOM PROVEDENU ELEKTROLITIMA SA I BEZ B-
CIKLODEKSTRINA
Bruce Pauling
B.V.Sc., Director, Professional Veterinary Distributors Ltd., Titirangi, New Zealand & Richard Tiddy B.V.Sc.,
M.Sc., Vet Resource, Te Awamutu, New Zealand
Aim
A double blind trial to examine whether a commercial electrolyte with added β-cyclodextrin will
improve the rate of recovery of diarrhoea from natural field infections of Cryptosporidium parvum
in a commercial calf rearing unit.
Background:
Calves affected with cryptosporidiosis diarrhoea are reported to exhibit clinical signs typically
lasting 7 days or more (Fayer et al 1998; Castro-Hermida et al 2002). Farmers offer supportive fluid
replacement therapy until the calves start to improve. β-Cyclodextrin activity against Cryptosporidium
parvum has been reported in vitro and in vivo in a range of species including mice, lambs, and calves
(Castro-Hermida et al, 2000-2004). On many calf units infections are complicated with significant
death rates attributed to mixed infections. β-Cyclodextrin is reported as ‘virtually tasteless’ and
should be readily palatable to a young calf with reduced appetite.
Hypothesis
Diarrhoeic, dehydrated calves with cryptosporidiosis when treated with an electrolyte
supplemented with betacyclodextrin will have an improved rate of recovery compared with a non-
supplemented electrolyte. It was proposed that the improved rate of recovery will be measured with
an earlier return of appetite and a reduced volume of electrolyte to reach full recovery onto a full
milk diet.
Materials
Two electrolyte formulations were prepared, one a commercial isotonic electrolyte (“Enervade™”)
with soluble dietary fibre (resistant maltodextrin) added (Ep) and the second being an identical
electrolyte mix to which 10 gm betacyclodextrin was also added (EpBCD).
Method
A commercial calf unit raising 1600 Jersey/Friesian cross calves per year with a history of
cryptosporidial diarrhoea presented 25 simultaneously diarrhoeic calves for the study. The presence
of cryptosporidial oocysts was confirmed in cases prior to the trial, in subsamples of enrolled calves,
and sentinel calves were also monitored to a limited extent for cryptosporidial oocysts and other
pathogens associated with neonatal calf diarrhoea. The calves were typically aged 6 – 12 days of
age, and weighed 24-32 kg. Treatments were blinded to both the herd manager and trial monitor and
randomised. Following assignment, calves were placed alternately into one of two adjacent hospital
pens and fed from communal electrolyte/milk feeders. Treatment started by withholding milk for 24
hours. Calves in each pen were then offered one of either electrolyte treatments at least twice daily
for 24 hours according to “demand” (ie consumption rate). Calves were then offered milk twice
daily to assess the return of appetite, and were fed milk if they desired, otherwise electrolyte was
continued. Each group continued to receive the assigned electrolyte at least once daily over a three
day period. Voluntary electrolyte consumption was encouraged.
Results
Cryptosporidiosis was confirmed among affected diarrhoeic calves. Calves treated with β-
cyclodextrin electrolyte (EpBCD) recovered their appetite more quickly than the control electrolyte
(Ep) (P < 0.001), and the total electrolyte volume required was significantly lower in the EpBCD
formulation - 33% less on day 5, (95% CI 25-40%) . Relapse diarrhoea cases occurred in each group
following the re-introduction of milk.
G r a p h Sh o w in g Pr o p o r tio n o f C a lv e s r e tu r n e d to
s o le ly m ilk fe e d s
1 .0
p = .0 0 1
returned to solely milk
0 .8
Proportion of calves
0 .6 Ep
feeds
0 .4 EpBC D
0 .2
0 .0
1 2 3 4 5 6
Da y
Av e r a g e Ele c tr o lyte C o n s u m p tio n o f v a r io u s

Ele c tr o lyte s p e r c a lf s u r v iv in g to 6 d a ys
16
se
consumed per calf over 6 days
14
Average Litres of Electrolyte
12
10 se
8 L itre s C o n s u m e d
6
4
2
0
Ep EpBC D
Legend Ep – Commercial electrolyte without β-cyclodextrin. EpBCD – commercial electrolyte with β-cy-
clodextrin.. Death rates were 5/13 in Ep electrolyte, and 3/12 in the EpBCD group being typical of the death
rates on the property for this type of case.
Conclusions
There was
1. A significant increase in the rate of recovery of appetite in the group of calves treated
with the electrolyte formulation containing betacyclodextrin compared with the control electrolyte
formulation.
2. A significant (33%) reduction in the total volume of electrolyte used in the time to full
calf recovery onto a milk diet.
3. No significant difference in death rates between treatment groups, however numbers were
low and numerically, fewer EpBCD affected calved died.
*** Don’t know that this is important here – might be better leaving high impact statements
alone at end. Some of this could go in the intro. Loss of appetite for milk feeds is common in calves
with cryptosporidiosis, and is an important sign that increases weight loss and slows recovery. An
improvement in the rate of recovery is an important factor for farmers in reducing the impact of this
disease in calves. During recovery and at re-introduction of milk feeds some effort may be required
to only offer small volumes of milk.
* corresponding author; # Kryptade is a registered veterinary medicine in New Zealand
USPOREDBA ODGOVORA NA TERAPIJU PROLJEVA POVEZANOG

SA KRIPTOSPORIDIOZOM PROVEDENU ELEKTROLITIMA SA I BEZ B-
CIKLODEKSTRINA
Bruce Pauling
* B. V. Sc., Director, Professional Veterinary Distributors LTD; Titirangi, New Zeland & Richard
Tiddy B. V. Sc., M. Sc., Vet Resource, Te Awamutu, New Zeland
Cilj: Dvostruka slijepa proba za određivanje komercijalnog elektrolita uz dodavanje ß-cyclodextrin

će poboljšati stupanj oporavka od proljeva uzrokovanog prirodnom infekcijom Cryptosporidium
Parvum u zemaljskom uzgoju.
Opis slučaja: Prijavljano je da telad pogođena kriptosporidiozom pokazuje kliničke znakove
u trajanju od 7 dana ili više (Fayerlet al 1998; Castro-Hermida et al 2002). Uzgajivači primjenjuju
potpornu terapiju tekućinama dok telad ne počne pokazivati znakove oporavka. Aktivnost ß-
cyclodextrina protiv Cryptosporidium Parvum-a se pokazala efektivnom in vitro i in vivo u više
životinjskih vrsta, uključujući miševe, janjad i telad (Castro-Hermida et al, 2000-2004). U mnoštva
teladi prijavljene su komplikacije sa visokom smrtnošću pripisane miješanim infekcijama. ß-
cyclodextrin navodno je bez okusa, te se može upotrijebiti peletiran čak i u teladi sa smanjenim
apetitom.
Hipoteza: Dehidrirana telad sa riptosporidijama uzrokovanom dijarejom pokazuju kod terapije
elektrolitima sa ß-cyclodextrinom pojačan stupanj oporavka od neterapirane. Predloženo je da
se brzina oporavka mjeri ranijim povratkom apetita i količinom utrošena elektrolita do potpunog
povratka na prehranu mlijekom.
Materijal: Pripremljene su dvije vrste elektrolita – komercijalni izotonični elektrolit („Enervade
TM“) sa dodanim otopljenim dijetnim vlaknima (otporni maltodekstrin) (Ep), i, kao drugo, isti taj
elektrolit sa dodanih 10 g/ml ß-cyclodextrina (EpBCD).
Metoda: Komercijalni uzgoj sa 1600 Jersey/Friesian križane teladi sa povijesti kriptosporidijske
dijareje odvojio nam je 25 bolesne teladi koja su počela pokazivati simptome u isto vrijeme, za
istraživanje. Prisutnost oocisti kriptosporidija dokazana je prije početka pokusa, u umatičene i
kontrolne teladi u koje je također utvrđena manja količina oocisti kriptosporidija i ostalih patogena
utvrđenih u neonatalnim dijarejama. Telad je bila stara 6-12 dana i težine 24-32 kg. Terapije su davane
nasumično i bez informiranosti upravitelja stada i mjerača rezultata. Terapirani su u oba veterinarska
centra (lječilišta) i hranjeni iz hranilica koje se uobičajeno koriste. Terapija je počela uskraćivanjem
mlijeka 24 sata. U oba centra nakon toga im je ponuđen jedan od dva elektrolita dva puta na dan u
24 sata, ovisno o želji. Nakon toga nuđeno im je mlijeko 2x dnevno za procjenu povratka apetita, te
im je isto dano ukoliko su ga htjeli, a u suprotnom je nastavljena terapija elektrolitima. Obje grupe
nastavile su dobivati elektrolite barem jednom na dan kroz period od 3 dana. Poticano je dobrovoljno
uzimanje elektrolita.
Rezultati: Kriptosporidioza je potvrđena u teladi pogođenom dijarejom. Telad tretirana ß-
cyclodextrinom u elektrolitu (EpBCD) povratila je apetit znatno brže nego telad koja je primila
kontrolni elektrolit (Ep) (P<0,001), a ukupna količina utrošenog elektrolita je značajno manja u
EpBCD grupi – 33% manje petog dana, (95% CI 25-40%). Recidivi su se pojavili u obje skupine
prilikom ponovnog uvođenja mlijeka u prehranu.
Metabolic Diseases - Nutrition
Metaboličke bolesti - Hranidba
NEUROLOGICAL MANIFESTATIONS AND LIVER DISEASE IN DAIRY
COWS
Neurološki poremećaji i bolesti jetre u muznih krava
Marisa Masucci, Michela Pugliese, Alessio Scardillo, Antonio Sutera*; Ferrantelli V.*,
Giuseppe Licitra**
Departement of Veterinary Pubblic Health, University of Messina - *Zooprophilactic Institute of Palermo-

**ASL n. 7 – Ragusa (Italy)
Summary
The liver cannot be examinated directly in large animals and the signs of liver disease – among them the
hepatic encephalopathy - caused by failure of its functions may not appear in the early stages of disease or may
be very subtle. Many blood constituents may be altered because of failure of the metabolic functions of the liver
and of hepatocyte damage. This study evaluates the relationship between serum parameters changes indicative
of hepatic damage and alterated nervous system functions in dairy cows.
Sažetak
Jetru je nemoguće direktno pregledati u velikih životinja pa je ponekad teško na vrijeme prepoznati bolesti
jetre kao što je npr. hepatička encefalopatija koja nastaje zbog poteškoća u funkciji jetre jer su simptomi vrlo
blagi ili ih uopće nema. Različiti sastojci krvi mogu biti promijenjeni usljed metaboličkih poremećaja jetre i
oštećenja hepatocita. Svrha ovog rada je utvrditi povezanost između promjena u krvi koji ukazuju na oštećenje
jetre sa poremećajima živčanog sustava u mliječnih krava.
Introduction
Hepatic encephalopathy is a clinical syndrome, characterized by neurological symptomatology,
that occurs when portal blood bypasses the liver (congenital or acquired shunts) or when the blood
goes through an inadequately functioning liver (hepatic insufficiency) (Pearson, 2002; Lorenz and
Kornegay, 2004). It occurs because the liver cannot adequately metabolize and detoxify substances
that are normally absorbed form the gastrointestinal tract (ammonia, mercaptans, short-chain fatty
acids, aromatic amino acids) and thus their blood levels increase (Pearson, 2002; Lorenz and
Kornegay, 2004). They cross the blood-brain barrier and act as false neurotransmitters or alter the
balance between inhibitory and excitatory neurotrasmitters (Pearson, 2002; Lorenz and Kornegay,
2004). A variety of clinical signs may be present: lack of coordination, beahvioural changes, mental
status alterations (hyper-excitability or depression, stupor or coma), seizures, blindness (Pearson,
2002; Lorenz and Kornegay, 2004). Signs of hepatic encephalopathy are often subtle and not specific
and frequently the clinical picture waxes and wanes (Pearson, 2002; Lorenz and Kornegay, 2004).
The goals of this study is evaluate a possible relationship between serum parameters changes
indicative of hepatic damage and neurological signs in dairy cows.

Eighty-nine cows, between the 4th and the 74th week of lactation, were examined: 83 Friesian, 3
Red-dappled, 2 Brown, 1 Friesian – Red-dappled cross.
All the animals were healty in herdsmen’s opinion.
Neurological examination (observation of posture, gait, mental status and examination of cranial
nerves) was carried out in all the animals.
In all the cows the following serum parameters were determinated: urea, aspartate aminotransferase
(AST), γ-glutamyl transferase (GGT), total and conjugated bilirubin, triglycerides, cholesterol, total
proteins and electrophoresis of proteins.
The following ranges were considered normal: urea: 10-45 mg/dl; AST: 0-130 U/l; GGT: 2-18
U/l; total bilirubin: 0.01-0.5 mg/dl; conjugated bilirubin: 0.04-0.44 mg/dl; triglycerides: 15-45 mg/
dl; cholesterol: 80-140 mg/dl, total proteins: 6-8 g/dl; albumin 3.1-3.7 g/dl; α1 globulins: 0.1-0.3 g/dl;
α2 globulins 0.5-0.7 g/dl; β globulins: 1-1.6 g/dl; γglobulins: 1.8-2.5 g/dl; albumin/globulins ratio:
0.4-1.2 (Fioretti et al., 1983; Kaneko, 1989b).
Statistical analysis was made using the Fisher’s exact test and linear regression test. Differences
were considered to be significant when P< 0.05.
Results
Eight cows (9%) showed neurological deficit: pelvic limbs proprioceptive ataxia (3 animals),
hyper-reactivity to environmental stimuli (1 animal), bilateral amaurosis (1 animal), monolateral
amaurosis (3 animals).
The animals with neurological signs had the following biochemical alterations:
• decreased amounts of: cholesterol (2 cows), triglycerides (6 cows), albumin (6 cows), β
globulins (2 cows), γ globulins (2 cows);
• increased levels of: GGT (5 cows), AST (2 cows), cholesterol (7 cows), total proteins (4
cows), α1 globulins (8 cows), α2 globulins (4 cows), γ globulins (1 cow).
There was a statistically significant difference between animals with neurological signs (group
A) and without neurological signs (group B) with regard to:
• hypotriglyceridemia (P = 0.0162), which was found in 75% of the animals of group A (X
13.6 + 5.4) and in 30% of the animals of group B (X 17.4 + 5.4);
• hypocholesterolemia (P = 0.0072), which was found in 25% of the animals of group A (X
182 + 75.8) and in any animal of group B (X 188 + 60.7);
• increased levels of AST (P = 0.0205), which was found in 25% of the animals of group A
(X 89 + 31) and in 1% of the animals of group B (X 74 + 17).
There was no significant difference for the prevalence of high levels of: GGT (62% of the cows
of group A and 85% of group B), cholesterol (87% of the cows of group A and 79% of group B),
total proteins (50% of the cows of group A and 21% of group B ), α1 globulins (100% of the cows
of group A and 99% of group B), α2 globulins (50% of the cows of group A and 54% of group B), γ
globulins (12% of the cows of group A and 10% of group B). There was no significant difference for
the prevalence of decreased amounts of: albumin (75% of the cows of group A and 52% of group
B), β globulins (25% of the cows of group A and 48% of group B), γ globulins (25% of the cows of
group A and 60% of group B).
There was a positive linear regression between:
• triglyceride and α2 globulins ( r = 0.3645, P = 0.0004)
• cholesterol and urea (r = 0.3369; P = 0.0012)
• cholesterol and albumin (r = 0.6482; P < 0.0001)
• AST and total proteins ( r = 0.2999; P = 0.0043)
• AST and γ globulins ( r = 0.2689; P = 0.0108)
There was a negative linear regression between:
• trygliceride serum levels and GGT (r = - 0.2675; P = 0.0113)
• cholesterol and total bilrubin (r = - 0.2368; P = 0.0263)
• cholesterol and total proteins (r = - 0.3930; P = 0.0001).
Discussion
The results show a significantly higher prevalence of hypotrigliceridemia, hypocholesterolemia
and high levels of AST in the cows with neurological signs and a significant correlation between this
and other serum parameters indicative of hepatic damage.
Triglyceride serum levels are sometimes lower in hepatic lipidosis, because of the inability of
the liver to secrete them, that are deposited within the epatocytes (Pearson, 2002; Aubadie-Ladrix,
2004). The liver secretes triglycerides as VLDL lipoproteins, which migrate in to the α2 globulins
position (Kaneko, 1989a). This explains the positive correlation between triglyceride serum levels
and α2 globulins. GGT in cattle is the most valuable serum marker for disorders of the hepatobiliary
system (cholestasis, hepatic lipidosis, hepatocyte necrosis) (Verrièle and Bedouet, 2000). The
negative regression between GGT and triglycerides may be due to a progressive decrease in blood
triglycerides when the hepatic damage increases.
The low cholesterol levels are due to its decreased hepatic synthesis and/or its inability to leave
the liver (Schouvert, 2001; Pearson, 2002). Urea provides a non toxic means of excreting ammonia
generated by amino acid catabolism and the intestinal microflora and its production occurs almost
exclusively in the liver (Carlson, 2002). Albumin is synthesized by liver too. The failure of the
metabolic hepatic functions may be a determining factor of decrease in blood cholesterol, urea and
albumin and of positive regression betwen cholesterol and urea and cholesterol and albumin. The
negative regression between cholesterol and bilirubin may be due to a impairment of excretory
function of the liver associated with failure of metabolic functions. The negative regression between
cholesterol and total proteins may be due to association between hepatic failure and inflammatory-
infectious diseases.
AST is used rather ALT in cattle (liver of large animals contain only insignificant amounts of
ALT) and, althoug it is not liver specific, is useful in measuring hepatic necrosis, although is not liver
specific (Cornelius, 1989). The positive regression between AST and total proteins and γglobulins
may be due to association between hepatic damage and inflammatory-infectious diseases.
This study suggests a relationship between hepatic damage and neurological manifestations
and shows a significantly higher prevalence of hypotrigliceridemia and hypocholesterolemia in the
cows with neurological signs.It would be interesting to clarify if these lipidic disorders are simply
a marker of liver failure, responsible of neurological symptoms (hepatic encephalopathy), or if you
do not have a direct role in the symptoms (lipids are a very important role in formation of structural
neuronal membranes and mielinic sheaths.
The subtle clinical signs showed by animals were not perceived by herdsmen or in a superficial
observation and were detected only by an accurate neurological examination. So it is likely that the
neurological system involvement in hepatic failure is under-estimated, and that it may occur not only
in the terminal stages of disease (Lorenz and Kornegay, 2004).
References
1. Aubadie-Ladrix M. Esami biochimici ematici nella bovina da latte. Summa numero monotematico: Esami
complementari in clinica bovina, 2004, n.9, pp.13-19.
2. Carlson G.P: Clinical Chemistry Tests. In: Smith B.P. Large animal internal medicine. Third edition, Mosby,
St Louis, 2002, pp. 389-412.
3. Cornelius C.E.: Liver function. In: Kaneko J.J. Clinical biochemistry of domestic animlas. Academic Press,
Inc., San Diego, 1989, pp. 364-391.
4. Fioretti M., Antonimi S., Bertoli M. Diagnostica in medicina veterinaria. Attualità in laboratorio. Edi-
Ermes, Milano 1983
5. Kaneko J.J. Serum proteins and dysprotidemias. In: Kaneko J.J. Clinical biochemistry of domestic animlas.
Academic Press, Inc., San Diego, 1989a, pp. 142-165.
6. Kaneko J.J. Appendixes. In: Kaneko J.J. Clinical biochemistry of domestic animlas. Academic Press, Inc.,
San Diego, 1989b, pp. 877-901.
7. Lorenz M.D., Kornegay J.N. Handbook of veterinary neurology. Fourth edition. Saunders, St Louis 2004.
8. Pearson E.G. Diseases of the hepatobiliary system. In: Smith B.P. Large animal internal medicine. Third
edition, Mosby, St Louis, 2002, pp. 790-823
9. Schouvert F. La steatosi epatica nella vacca da latte. Summa, 2001, n.8, pp. 21-27
10. Verrièle M., Bedouet J.: Gli esami ematici nei bovini. 1. Le chiavi per utilizzare la biochimica clinica.
Summa, 2000, n.5, pp. 27-31
Effects of sex on histological characteristics of skin
in Lori sheep
Utjecaj spola na histološke osobitosti kože u Ovaca

pasmine lori
ABBASI, M1, and GHARZI, A.2

1
Department of Basic Sciences, School of Veterinary Medicine, University of Lorestan,Khorram-Abad, Iran
2
Department of Biology, Faculty of Basic Sciences, University of Lorestan, Khorram-Abad, Iran
Abstract
Skin is a remarkable and versatile organ, which not only covers the whole body but also has a number of
other important functions. About 15% of the body weight in mammals is skin. This organ is composed of two
principle layers, epidermis and dermis. Epidermis is ectodermal in origin and forms most of the cutaneous
appendages including glands, nail, hair and wool follicles. It consists mainly of a multilayer of keratinocytes.
Beneath of the epidermis is dermis a thick and tough layer of connective tissue. It has been indicated that the
detailed anatomy and histology of the skin and its appendages varies not only in different species but various
parts of the body in an individual also shows considerable changes regarding these factors. In present study we
aimed to compare some characters of skin, including the epidermis and dermis thickness, density and diameter
of primary and secondary wool follicles (PF & SF), in the various parts of skin in male and female of Lori sheep.
To fulfill this task we were provided 20 sheep skin and removed our samples as small pieces from their different
regions. The samples were first observed by a binocular microscope to examine the density of wool fibers per
square millimeter. Afterwards, they were fixed in formalin saline and processed for more histological scrutiny.
To improve our survey, we stained the 7 µm cut sections with H&E method. The sections were observed under a
light microscope equipped with a graded graticule (to the nearest 1 µm) and several informative characters, which
were already mentioned, were recorded. Observations, which were made here, showed that the mean density
of wool fiber in this breed is 6 per mm2. Moreover, although no significant difference was observed regarding
the thickness of epidermis and dermis, some clear differences were showed in the case of follicles diameters
between two sexes. In general, we demonstrated here that in lori sheep the sex influences on quantitative and
qualitative characters of skin and its main epidermal appendages namely, wool follicles.
Key words; Sheep, Skin, Histology
Sažetak:
Koža je svestran organ koji ne samo da pokriva čitavo tijelo nego sadrži mnogo važnih funkcija. Otprilike
15% tjelesne mase sisavaca čini koža. Načelno ovaj organ se sastoji od dva osnovna sloja: epiderme i derme.
Epiderma je ektodermalnog podrijetla i čini većinu kutanih tvorbi uključujući, žlijezde, nokte, kosu i dlačne
folikule. Sastoji se uglavnom od višeslojnih keratinocita. Ispod epiderme i derme leži debeo i čvrst sloj vezivnog
tkiva. U ovom istraživanju željeli smo usporediti neke osobitosti kože, uključujući debljinu epiderme i derme,
gustoću i promjer primarnih i sekundarnih dlačnih folikula na različitim dijelovima kože mužjaka i ženki
pasmine Lori. Kako bi izvršili ovu zadaću dostavljeno nam je 20 ovaca kojima smo uzeli male uzorke kože
i različitih dijelova tijela.Uzorci su prvotno pregledani binokularnim mikroskopom kako bi ispitali gustoću
vunenih vlakana u kvadratnom milimetru.Rezovi su pretraženi svjetlosnim mikroskopom koji je mikronsku
skalu, a neke od značajnih promjena su primljene. Naša zapažanja su pokazala da je prosječna gustoća vunenog
vlakna u ove pasmine 6 mikrona u kvadratnom milimetru. Štoviše, iako nije uočena signifikantna razlika
između debljine epidermisa i dermisa uočena je jasna raznolikost u promjeru dlačnih folikula među spolovima.
Općenito uzevši dokazali smo da se utjecaj spola na kvantitativne i kvalitativne karakteristike kože lori ovaca
manifestiraju kroz dimenzije dlačnih folikula.
Introduction
Skin is a remarkable and versatile organ which not only covers the whole body but also has
plays a number of other important roles for the body (Dellman, 1993). This organ is composed of
two principle layers, epidermis and dermis. Epidermis is ectodermal in origin and forms most of
the cutaneous appendages including glands, nail, hair and wool follicles. It consists mainly of a
multilayer of keratinocytes. Beneath of the epidermis is dermis a thick and tough layer of connective
tissue ( Junqueira and Camerio, 2003).
One of skin appendages in mammals is wool that covers the body of sheep and some others in
this class. The wool fiber is product of wool follicles, an epidermal appendage which penetrates deep
into the underling dermis (Carter, 1955). Histologically, there are two types of wool follicles: primary
follicles which produce thicker fibers than their secondary counterparts (Brown et al, 1968). Of main
characters that determine quality and quantity of wool produced by sheep are density of follicles and
the ratio of secondary to primary follicles (the so-called S/P ratio). There are some documents that
in sheep sex affects the density of follicles (P & S) as in females is higher than males and this is a
reflection of having more weight and greater skin surface in female (Buttler, 1981).
One of main area in breeding of sheep in Iran is Lorestan province in southwest of the country.
The sheep which is bred in this region is called Lori sheep. In this research we aimed to investigate
some characters relating the skin of this breeds. It was also tried to find whether the sex has any
impact on quality of produced wool or not?

Twenty reproductively mature Lori sheep (10 ewes and 10 rams) were identified according to their
phenotypic features. The sheep were killed in a local slaughterhouse and their skins were dissected
out. By using a punch, small pieces, with total area of 2 cm2, were removed from different regions
of the skin, including left and right flanks, left and right shoulders, left and right hips and mid-back.
The specimens were immediately placed in formalin saline. Afterwards, by a binocular microscope
the total number of wool follicles (P & S) in these pieces was counted. The specimens were then
processed through a serial steps for histology examinations. Hematoxylin and eosin method were
used for staining of histological sections. The sectioned were examined under a microscope which
was equipped with a graded graticule by which the diameter of follicles (P & S) and the thickness of
epidermis and dermis layers were measured. In general, 8 parameter, including density of wool fibers
per mm2 (FD), number of primary follicles (PFN) and secondary follicles (SFN) per mm2, diameter
of primary follicles (PFD) and secondary follicles (SFD), thickness of epidermis (ET) and dermis
(DT) as well as the S/P ratio in both sexes in above-mentioned regions were measured (Humason,
1979).
The data provided were later analyzed statistically. All statistic analyses were processed in SAS
software (SAS Institute, 1998).
Results
After examining the punched pieces with a total area of 6 cm2 under a binocular microscope and
counting the wool fibers which exist in this area we found a mean density of 6.063 per mm2 (with
a standard error of 0/166). Considering sex and region, no significant differences were observed in
fiber density between two sexes and different regions (P > 0.05).
Epidermis in both male and female and also in different regions shows a thickness between
minimum 8 and maximum 45 µm with an average of 17.54 µm. The highest thickness of epidermis
is seen in female (18.69 µm) and the thinnest epidermis exists on the hip region (16.63 µm). The
epidermis is made of 3-8 cell layers and regarding its thickness a significant difference was observed
between two sexes (P < 0.0082). In general, the epidermis in female is thicker than its counterpart
in male.
Dermis is a tough and thick (1- 4.9mm) connective tissue that forms projections termed papillae
which interdigitate with downward projections of epidermis. Within the dermis wool follicles, sweet
and sebaceous glands and arrector pilli muscle are clearly observed. Compared to female, the male
shows a thicker dermis. The wool follicles are seen in groups and each group consists of a large
primary follicle and several smaller secondary follicles. The sex has a distinct effect on the number
of secondary follicles (P < 0.05) and S/P ratio (P <0.01) but not on the primary follicles number (P >
0.05). The mean value of both factors was higher in female compared to male. Moreover, sex showed
a clear outcome on the diameter of primary (P < 0.01) and secondary (P < 0.05) follicles. In regard to
the diameter of primary follicles, a significant discrepancy was observed at various regions of skin (P
< 0.01) as in back region the follicles were thicker. However, such correlation was not seen in case
of secondary follicles (P >0.05).
Discussion
It has been shown that the structure and the thickness of skin vary in different breeds of sheep.
For example, in Bulgarian breeds, Native Karnoboat and Karakachen, skin has a 3.3 and 2.5 mm
thick, from which the epidermal layer forms on average 18 µm (Stankov et al, 2004), while in Merino
sheep, the epidermis constitutes 24.9 µm of whole skin (Britt et al 1985). We here demonstrated
that in lori sheep the skin on average is 2.4 mm thick including a 18 µm epidermis the remaining is
composed of the dermis. Also, in relation to epidermis thickness, a significant difference was found
between two sexes as in females this layer is thicker than its counterpart in male. Moreover, in
female, dermis was also thicker than male. However, regarding the thickness of the dermis in various
portions of the skin, a distinct difference was not observed between these parts.
It has been documented that the quality of wool depends on the SF/PF ratio so that a higher
ratio means a better quality for the wool (Hynd, 1995 and Clarke et al 1997) and the highest ratio is
found in Merino sheep which mounts to 16.5. In other breeds this ratio is lower as a six months old
Awassi fat-tailed sheep displays a ratio of 4.2. Another point revealed by these researchers in this
particular sheep was that the SF/PF ratio in male has been higher than male (Fayez et al, 1976). There
are some indications that this ratio is hereditary but diet can have an effect on it too (Gifford et al,
1995). In present study, we showed that in lori sheep the mean SF/PF ratio is 2.26, which means in
comparison to other breeds, such as Barki, Sannen and Togenburg that show a ratio of 2.4, 3.9 and
2.4 respectively, the quality of the produced wool is nearly satisfactory but is not ideal, of course, if
compared to Merino sheep. Moreover, in female this ratio was higher than male, once again a clear
discrepancy was not observed in different parts of skin. The undesired quality of the wool in lori
sheep is also reflected in a low density of wool fiber per mm2 (6/mm2) since this density is much
higher in well-known breeds.
Considering the diameter of wool follicles, the current study showed that in male sheep the
follicles are thicker and since there is a straight relationship between follicle diameter and fiber
thickness, it can be concluded that in lori sheep the females grow and produce finer or better wool.
Again various parts of skin in both sexes are closely similar and for this parameter and no considerable
difference was seen in these regions.
In general, in this survey, we introduced macroscopic and microscopic characters of lori sheep
skin and showed that in these aspects there are some differences among male and female. However,
the quality of the wool produced in this specific breed is not very satisfactory and is comparable with
many endemic uro-asian breeding.
Acknowledgement
The authors would like to thank research department of Lorestan University for financial support.
References
Britt, A.G., Cotton, C.L., Kellet, B.N., Pitman, I. and Traska, A.J. (1985): Structure of the epidermis of Australian
merino sheep over 12-month period. Aus. J. Bio. Sci. 38: 165-174.
Brown, G.H., Turner, N.H. and Dolling, C.H.S. (1968): Vital statistics for an experimental flock of merino
sheep. V. the effects of age of ram, maternal handicap and year of measurement on 10 wool and body
charactristics for unselected rams. Aust. J. Agric. Res. 19: 825-835.
Buttler, L.G. (1981): Effect of sex and birth status on the wool folicle polpulation in unselected Corridale sheep.
Anim. Prod. 33: 67-70.
Carter, H.B. (1955): The hair follicle group in sheep. Anim. Breed. Abst. 23(2): 101-116.
Clarke, C., Roberts, G., Behrend, R., Marland, D. and Dolling, M. (1997): Quality management for wool
growers: Sheep Breeding and Selection. Ararar, DNRE, Victoria.
Dellman, H.D.(1993): Text book of veterinary histology. 4th ed .,Lea and Febiger, Philadelphia.USA. pp:285-
295.
Fayez, I., Marai, M. and Taha, A.H.(1976): Wool follicle characteristics in the Awassi fat-tailed sheep. Acta
Anat. 96(1): 55-69.
Gifford, D. R., Ponzoni, R. W., Anoell, M. C., Hynd, P. I., Walkley, R. W. and Grimson, R. J. (1995): Genetic
studies on wool quality and skin characters of Merino. Wool Technology and Sheep Breeding, 43(1): 24-
29.
Humason, G.L.(1979): Animal tissue techniques. 4th ed.,W.H.Freeman and Commpany, Sanfrancisco,USA.
pp:113-118.
Hynd, P. I. (1995): Skin and follicle-based selection for wool production and quality. Wool technology and sheep
breeding. 43: 15-23.
Junqueira, L.C. and Camerio.J.(2003): Basic histology. 10th ed, The McGraw-Hill Companies,USA.pp: 368-
381.
SAS Institute. (1998): SAS user’s guide. Rev. G. 04, SAS Institute, Cary, NC.
Stankov, I., Tjankov, S., Slavov, R. and Pamukova, D.(2004): Study of the histological structure of the skin of
lambs from aboriginal breeds in Bulgaria. Trakia journal of sciences. 2(2): 49-51.
Metabolic profile determination in calves from
different management in NW Spain
ODREĐIVANJE METABOLIČKOG PROFILA TELADI S RAZLIČITIH

UZGOJA SJEVEROZAPADNE ŠPANJOLSKE
Blanco-Penedo, I.1; López-Alonso, M.1; Miranda, M.2; Castillo, C.1, Hernández, J.1,
Prieto Montaña, F.3, Benedito, J. L.1
1
Universidade de Santiago de Compostela, Departamento de Patoloxía Animal, Facultade de Veterinaria,
27002 Lugo, Spain
2
Universidade de Santiago de Compostela, Departamento de Ciencias Clínicas Veterinarias, Facultade de
Veterinaria, 27002 Lugo, Spain
3
Universidad de León, Departamento de Patología Animal: Medicina, Cirugía y Anatomia Veterinaria. Fac-
ultad de Veterinaria, León, Spain
ABSTRACT
Blood biochemical parameters were used to identify constraints on farm type, geographical area and age in
beef-cattle in NW Spain. Blood samples (n = 199) of calves aged between 2 to 10 months and reared on farms
with different feeding strategies and management (intensive, organic, conventional) were collected during their
whole life cycle production. Levels of glucose (GLU), total serum protein (TP), urea (PUN), creatinine (CRE),
cholesterol (C), albumin (Alb), total billirrubin (TBIL), triglycerides (TG) and non-esterified fatty acids (NEFAs)
and activities of the liver specific enzymes aspartate transaminase (GOT), glutamate dehydrogenase (GLDH)
and creatin kinase (CK); were determined. In general all groups of calves presented safe blood metabolite ranges
according with references. The study of blood metabolites can help in understanding the peculiar features of
animals in many different physiological, environmental and management conditions in order to adjust farming
and feeding systems to animals needs. Feed ration must be appropriately constituted for ruminants in all the life
cycle and animal requirement should be covered to keep physiology balance on the animals.
Sažetak
Krvni biokemijski parametri korišteni su u određivanju stupnja obuzdanosti tovnih goveda u sjeverozapadnoj
Španjolskoj, u različitim farmskim uvjetima, zemljopisnim područjima i dobi. Uzorci krvi (n=199) teladi, u
dobi od 2 do 10 mjeseci, držanih na farmama sa različitim hranidbenim protokolima i uzgojem (intenzivni,
organski, uobičajeni) uzimani su tijekom cijelog proizvodnog ciklusa. Određivane su razine glukoze (GLU),
ukupnih serumskih bjelančevina (TP), ureje (PUN), kreatinina (CRE), kolesterola (C), albumina (Alb), ukupnog
bilirubina (TBIL), triglicerida (TG), neesterificiranih masnih kiselina (NEFA) te aktivnosti specifičnih jetrenih
enzima aspartat transaminaze (GOT), glutamat dehidrogenaze (GLDH) i kreatin kinaze (CK). Sveukupno
gledajući, sve skupine teladi imale su normalne razine krvnih metabolita, u skladu s referentnim vrijednostima.
Analiza krvnih parametara može pomoći u shvaćanju osobitosti životinja u različitim fiziološkim okolišnim
i uzgojnim uvjetima kako bi se sustavi držanja i hranidbe prilagodili potrebama životinja. Obroci krmiva za
preživače moraju biti prikladno sastavljeni u svim životnim ciklusima. Moraju se zadovoljiti životinjske potrebe
kako bi se održala fiziološka ravnoteža životinja.
INTRODUCTION
Animal welfare is becoming essential for achieving an integrated animal health, that implies
a good quality of life and the possibility to perform a natural behaviour getting feed suitable to its
physiology (Lund, 2006; Haas et al., 2007). This is one of the goals of organic farming approach,
where ruminant diet should be based on locally or in-farm produced forage with a low concentrate
feed-supplementation (IFOAM, 2002).
It is well assumed that grazing offers a quality of diet to cover cattle and calf requirements
when these are well matched with grass growth (Andrews, 1991; Bengtsson et al., 2003). In fact,
the nutritional value of well-managed grass is high and on good quality pasture a cow’s welfare can
be maintained with low levels of concentrate supplementation or even none (Kennedy et al., 2006).
However, during seasonal deficiencies, the limited feed stuffs can cause imbalances in the diets
(Sundrum, 1997) expecting to have negative effects on animals if it causes an increasing mobilisation
of body reserves and a more negative energy balance (Buttler and Smith, 1989). In this respect,
there is a conflict in the basic organic ideology between the aim of good individual animal health
and welfare versus environmental concerns and food safety. During such situation, supplemental
or replacement feeding is necessary to meet production goals (Mathis and Sawyer, 2007), so, the
supplementation of organically grazing cattle can be used to fill the gaps and provide nutrients that
are inadequate or missing in the forage (Loy, 2007).
In conventional farms supplementary extra concentrate feeding is routinely given to achieve
an economic production level, even tough when the quality (and quantity) is high. Nevertheless,
this concentrate feed supplementation can be uneconomic if the supply of good quality pasture is
sufficient to meet herd demand and the increased concentrate mostly substitutes grass.
On the opposite situation than organic and conventional farming are intensive production systems
where diets are based on high levels of concentrate feed without any grazing. In regards to nutrition,
the main energy source for calves fed with a high-concentrate feed is non-structural carbohydrates
(NSC) instead fibber from pasturage in grazing cattle. With the introduction of cereal grains into the
diet, the principal substrates for microbial fermentation are no longer slowly digested plant-cell-
wall components (e.g. cellulose and hemicellulose), but rather rapidly digested starch. Consequently,
these diets often induce unstable fermentation conditions that favour the accumulation of acids in
the rumen and lead to ruminal dysfunction (Owens et al., 1998). The excessive production of acid in
the rumen is often either the cause of or a significant contributing factor to metabolic and nutritional
disorder in feedlots. It is known that decreasing the percentage of highly fermentable concentrates
in feedlot diets by increasing roughage level or limiting feed intake should decrease the incidence of
these disorders (Galyean and Rivera, 2003).
It has been stated that the study of blood metabolites can help in understanding the peculiar
features of animals in many different physiological, environmental and management conditions in
order to adjust husbandry and feeding practices to animals needs (Grasso et al., 2004). In connection
with this, blood chemistry can give us such information on many metabolic processes and the welfare
of the animal which otherwise would be difficult or impossible to know due to subclinic courses
(Mannimen et al., 2007). The aim of this study is to determine the influence of different management
and feed practices (organic, conventional and intensive) on blood parameters in beef-cattle in NW
Spain.

Farm selection. Livestock practices are highly standardised in intensive beef-cattle farms in NW
Spain; basically the feed ration consists of a high-grain diet based on 80-90% concentrate (ca. 16
%CP-DM basis and 5-8 %CF-DM basis) and 10-20% of roughage with an indoor management. On
conventional and organic farms, on the contrary, milk intake dominates calf performance in the first
3 months; during the growing phase (3-6 months) calves were fed with ryegrass/clover pasture with
different rotation on each farm, milk and a small percentage of concentrate and the based finishing
diets is roughage (fresh grass or harvested) and concentrate (5-30%).
Farm selection was made in the districts of Baralla (latitude 42º52´, longitude 7º23), Montederramo
(latitude 42º16´, longitude 7º30´) and Vilalba (latitude 43º18´, longitude 7º40´). In each district, an
organic, conventional and intensive farm located in the neighbourhood were selected, finding farms
and conditions that were similar in other respects for the comparison. All the components of the diet
were in according to the practices and legislation of each system.
Sample collection. Blood samples were collected during one year corresponding to whole life
cycle of calves with age-range from 2 to 11 months. All blood samples (10 ml approximately) were
taken from the jugular vein using heparinised vacutainer tubes. Serum was obtained by centrifugation
(3,000 g for 15 minutes) of clotted samples within 6 hours after collection. Three aliquots of serum
were stored in acid-washed (10% nitric acid) tubes at -20ºC until analyzed, except enzymatic
determinations which were refrigerated and analyzed within 7 hours after collection.
Weight of carcass were collected when the animals were slaughtered.
Sample analysis. Glucose (GLU), total serum protein (TP), urea (PUN), creatinine (CRE),
cholesterol (C), albumin (Alb), total billirrubin (TBIL), triglyceride (TG), were determined by
enzymatic-colorimetric methods, employing standards kits (Spinreact Laboratories, Spain; Human
HR Laboratories, Germany; Gernon Laboratories, Spain). Serum non-esterified fatty acids (NEFAs)
was assayed by an enzymatic technique using a standardized method (Randox Laboratories, United
Kingdom). Activities of the liver specific enzymes aspartate transaminase (GOT), glutamate
dehydrogenase (GLDH) and creatin kinase (CK) were measured in serum by using commercial
diagnostic kits (Gernon Laboratories, Spain).
Data analysis.All statistical analyses were done using the program SPSS for Windows (v.15.0).
Normal distribution of data was checked using Kolmogorov-Smirnov test. Analysis of variance
(general linear model) was used to evaluate the influence of type of farm (intensive, organic,
conventional), zone (Baralla, Montederramo, Vilalba), and age on the metabolic profiles in calves;
with farm, zone as fixed-effect factors and age (in months) as a covariate. Tukey´s honest significant
difference (HSD) test were used to determine the significance of differences in the metabolic profile
between farm type and zone. Pearson rank correlation was used to analyse the relationship between
metabolic parameters concentrations and proportion of concentrate on the ration and weight carcass.
In all analyses statistical significance was taken to be indicated by p<0.05.

Blood metabolic parameters assessed in calves from intensive, organic and conventional farms
in this study are presented in Table 1. Most of the calves in all farms were within physiological
limits. The concentrations of glucose were little higher than the range described by Kaneko et al.
(1997), Radostits et al. (2002) and Smith (2007) for this specie (45-75 mg/dL) and similar than
previously reported for grazing and housing beef calves by Aoki et al. (2006) and Doornenbal et al.
(1988) for beef calves. Total serum protein, urea and creatinine levels in our study were within the
ranges described by Kaneko et al. (1997), Radostits et al. (2002) and Smith (2007). Mean Alb levels
registered on this study were within the range described by Kaneko et al. (1997) for this specie (4-4.4
mg/dL). All triglycerides levels assessed on this study were higher than the range described (0-14
mg/dL) by Kaneko (1997) and similar than those previously reported by Arai et al. (2006) for calves.
Cholesterol levels were on the range described by Radostits et al. (2002) for this specie (65-220
mg/dl). All the groups presented levels of total billirrubin within the reference levels (Radostits et al.
2002; Smith, 2007). NEFAs were within the range described for this specie (0-0.6 mmol/L; Radostits
et al.; 2002). In relation with hepatic enzymes, GLDH and CK were within the references levels of
our laboratory. GOT levels were lower than the references levels for this specie (Kaneko et al., 1997)
but similar than previous studies for calves (Gregory et al., 1999; Castillo et al., 2008).
Table 1. Metabolic parameters in calves from this study.
N Media GSE Median Minimum Maximum CV

Glucose (mg/dL) 199 87.2 (85.7-88.5) 85.4 45.8 157.6 22.1
Total Protein (g/dL) 199 6.98 (6.93-7.03) 6.95 5.56 9.84 10.4
Urea (mg/dL) 199 22.1 (21.8-22.4) 21.4 8.13 33.7 20.9
Creatinine (mgdL) 199 1.16 (1.15-1.17) 1.18 0.74 1.61 13.4
Triglycerides (mg/dL) 199 27.5 (26.9-28.1) 26.6 15.4 72.9 31.2
Cholesterol (mg/dL) 199 129 (128-131) 126 77.9 193 16.8
Albumin (mg/dL) 199 4.09 (4.09-4.10) 4.1 3.55 4.45 2.67
Total Bilirubin (mg/dL) 199 0.412 (0.407-0.416) 0.4 0.28 0.66 15.7
Nonesterified fatty acids
185 0.389 (0.385-0.394) 0.39 0.26 0.53 15.5
(mEq/mL)
Glutamate
dehydrogenase (UI/L) 132 7.07 (6.98-7.15) 7.19 5.16 9.05 13.4
Aspartate
aminotransferase (UI/L) 188 35.6 (34.9-36.2) 33.4 19.9 54.2 24.6
Creatine kinase (UI/L) 188 133 (131-134) 138 87.3 160 13.6
Table 2. Results of the general linear model analysis of metabolic parameters with factors zone and farm type
and the covariate age.
R2 Age Farm Zone Interactions

GLU 0.132 F(1,199)=0.885 F(2,199)=1.242 F(2,199)=3.389* F(4,199)=4.423**
TP 0.161 F(1,199)=0.313 F(2,199)=11.16*** F(2,199)=2.207 F(4,199)=2.744*
PUN 0.032 F(1,199)=0.094 F(2,199)=1.531 F(2,199)=1.278 F(4,199)=0.132
CRE 0.078 F(1,199)=2.124 F(2,199)=5.721** F(2,199)=0.855 F(4,199)=0.523
TG 0.040 F(1,199)=2.114 F(2,199)=1.225 F(2,199)=0.521 F(4,199)=0.640
C 0.105 F(1,199)=0.325 F(2,199)=5.281** F(2,199)=0.518 F(4,199)=2.780*
Alb 0.012 F(1,199)=0.051 F(2,199)=0.066 F(2,199)=0.093 F(4,199)=0.411
TBIL 0.123 F(1,199)=0.177 F(2,199)=9.274*** F(2,199)=0.489 F(2,199)=2.819*
NEFAs 0.014 F(1,185)=0.545 F(2,185)=0.299 F(2,185)=0.025 F(4,185)=0.281
GLDH 0.057 F(1,132)=0.957 F(2,132)=0.938 F(2,132)=1.099 F(4,132)=0.075
GOT 0.783 F(1,188)=3.761 F(2,188)=275*** F(2,188)=1.734 F(4,188)=0.587
CK 0.357 F(1,188)=78.12*** F(2,188)=0.084 F(2,188)=0.132 F(4,188)=0.142
The results of the general linear modelling to determine if the type of farm (intensive, organic,
conventional) in the different zones (Baralla, Montederramo, Vilalba) was a significant source of
variation in metabolic profiles of calves in this study are presented in Table 2. Significant interactions
between type of farm and zone were observed for glucose, total serum protein, cholesterol and total
billirrubin concentrations, which indicates that variation of these metabolites in calves in our study
showed a different behaviour by farm in the different zones, and for this reason is not possible to
CRE
1,24
1,22
1,2
1,18
1,16
1,14
1,12
1,1
1,08
1,06
1,04
1,02
int Org Conv
GOT
50
45
40
35
30
25
20
15
10
5
0
int Org Conv
Figure 1. Effect of farm on CRE and GOT concentrations on calves from intensive, organic and conventional
farms.
establish a common metabolic pattern related to the farming type. Zone by itself was not a significant
factor for any of the parameters analysed in this study Type of farm was a significant factor in
the analysis for creatinine (p<0.01) and GOT (p=0.000). Significantly lower creatinine levels were
observed in calves from organic farms (7%) compared to the other groups (Figure 1). The significant
differences among organic and conventional or intensive groups for creatinine probably are indicative
of differences on muscle mass due to the origin of the amount of creatinine released on blood that
is the striated muscle (Doornenbal et al.; 1988); in fact, significant correlations were found between
creatinine levels vs percentage of concentrate on the ration (p=0.004) and between creatinine levels
vs. the weight of the carcass (Rs=0.163, p=0.021). With regard to GOT activity, significantly higher
enzymatic activities were found in intensive farms (151-155 %; p=0.000) compared to the other
groups. Mori et al. (2007) pointed out higher levels of GOT on beef calves fed on larger amount
of concentrate diet than fed on pasture, and may indicate slight liver damage by slightly acidotic
conditions associated to diet, as a consequence of accelerated function of liver for more nutrients
metabolism. Furthermore, as it was mentioned before, the source of energy on concentrate (NSC) is
a significant contributing factor to metabolic disorders in feedlot (Galyean and Rivera, 2003). These
pronounced higher concentrations of GOT on intensive farms could be explained for the higher
demand on hepatic metabolism fed with a high-concentrate feed, for this reason, higher activity
of this enzyme was positive strongly correlated with higher percentage of concentrate on the diet
of calves of our study (Rs=0.730, p=0.000). A significant effect of age on calves as a covariate in
the analysis was observed on CK activity, a downward trend on CK levels being observed with the
progress of the age (p=0.000) in all groups (Figure 2).
180
160
140
120
(UI/l)
CK (UI/l)
100
80
CK
60
40
20
0
2 3 4 5 6 7 8 9 10
age ((months
months )
Figure 2. CK downtrend progress with the age of calves of our study.
CONCLUSIONS
Our results indicate that feeding practices is the factor that projects the bigger differences on
the metabolic profiles of calves for different farm systems in our study. These results may represent
a useful tool for the improvement on the formulating diets and the prevention of possible disorders
conditioned for the diet and followed by the management.
REFERENCES
Andrews, T. (1991). Suffering animals in a green landscape? Dairy Farmer 38, 26-28.
Aoki, Y.; Nakanishi, N.; Yamada, T. (2006). Basal levels and responses to glucose infusion of plasma glucose
and insulin in beef steer before and after the end of the growing phase on pasture. Anim. Sci. J. 77: 338-
346.
Arai, T.; Tanaka, Y.; Urabe, S.; Kusaba, A.; Tazaki, H., Ozawa, T.; Kimura, N.; Jung, K.; Waragaya, K.; Yuyama,
T.; Haseba, Y.; Imai, S. (2006). Changes in peripheral leukocytes enzymes activity and plasma metabolite
concentrations in growing Holstein calves. Res. Vet. Sci. 81: 19-23.
Bengtsson, H.; Öborn, I.; Jonsson, S.; Nilsson, I.; Andersson, A. (2003). Field balances of some mineral nutrients
and trace elements in organic and conventional dairy farming—a case study at Öjebyn, Sweden. Eur J
Agron 20:101-116.
Buttler, W.R:; Smith, R.D. (1989). Interrelationships between energy balance and postpartum reproductive
function in dairy cattle. J. Dairy Sci. 72: 767-783.
Castillo, C.; Benedito, J.L., Pereira, V.; Méndez, J.; Vázquez, P.; López-Alonso, M.; Hernández, J. (2008).
Effects of malate supplementation on acid-base balance and productive performance in growing/finishing
bull calves fed a high-grain diet’, Arch. Anim. Nutr. 62(1): 70 - 81
Doornenbal, H.; Tong, A.K.W.; Murray, N.L. (1988). Reference values of blood parameters in beef cattle of
different ages and stages of lactation. Can J Vet Res 52: 99-105.
Galyean, M.L. and Rivera, J.D. (2003). Nutritionally related disorders affecting feedlot cattle. Can J Anim Sci
83(1): 13-20.
Grasso, F.; Terzano, G.M.; De Rosa, G.; Tripaldi, C.; Napolitano, F. (2004). Influence of housing conditions and
calving distance on blood metabolites in water buffalo cows. Ital. J. Anim. Sci. 3: 275-282.
Gregory, L.; Birgel, E.H.; Mirándola, R.M.S.; Araujo, W.P.; Birgel, E.H. (1999). Valores de referencia da
actividade enzimática da aspartato-aminotrasnferase e da gama-glutamiltrasnferase em bovinos de raça
Jersey. Influencia dos fatores etários, sexuais e da infecçao pelo virus da leucose dos bovinos. Arquivo
Brasileiro de Medicina Veterinaria e Zootecnia 51(6).
Haas, G.; Deittert, C.; Köpke, U. (2007). Impact of feeding pattern and feed purchase on area- and cow-related
dairy performance of organic farms. Livest. Sci. 106: 132-144.
IFOAM, 2002. IFOAM Norms. II. IFOAM Basic Standards for organic production and processing. International
Federation of Organic Movements, Tholey-Theley, Germany. (http://www.ifoam.org/standard/norms/ibs.
pdf).
Kaneko, J.J.; Harvey, J.W.; Bruss, M.L. (1997). Clinical biochemistry of domestic animals. 5th ed. Ed. Academic
Press, Orlando.
Kennedy, E.; O´Donovan, M.; Murphy, J.P.; Delaby, L.; O´Mara, F. (2006). Effects of grass pasture and
concentrate-based feeding systems for spring-calving dairy cows in early spring on performance during
lactation. Grass Forage Sci. 60(3): 310-318.
Loy, D. (2007). By-product feed utilization by grazing cattle. Vet. Clin. North Am. Food Anim. Pract. Mar
23(1):41-52.
Lund, V. (2006). Natural living- a precondition for animal welfare in organic farming. Livest. Sci. 100, 71-83.
Mannimen, M.; Sankari, S.; Jauhiainen, L.; Kivinen, T.; Soveri, T. (2007). Insulated, uninsulated and outdoor
housing for replacement beef heifers on restricted grass silage-based diet in a cold environment. Livest.
Sci. 107, 113-125.
Mathis, C.P.; Sawyer, J.E. (2007). Nutritional management of grazing beef cows. Vet. Clin. North Am. Food
Anim. Pract. Mar 23 (1):1-19.
Mori, A.; Urabe, S.; Asada, M.; Tanaka, Y.; Tazaki, H.; Yamamoto, I.; Kimura, N.; Ozawa, T.; Morris, S. T.;
Hickson, R.; Kenyon, P. R.; Blair, H.; Choi C. B.; Arai, T. (2007): Comparison of plasma metabolite
concentrations and enzyme activities in beef cattle raised by different feeding systems in Korea, Japan and
New Zealand. J. Vet. Med. Ser. A 54, 342-345.
Owens, F.N., Secrist, D.S., Hill, W.J., Gill, D.R. (1998). Acidosis in cattle: A review. J. Anim. Sci. 76, 275-
286.
Radostits, O.M.; Gay, C.C.; Blood, D.C.; Hinchcliff, K.W. (2002). Veterinary Medicine: a Textbook of the
Diseases of Cattle, Sheep, Pig, Goats and Horses. Ed. WB Saunders Company, London.
Smith, B.P. (2007). Large Animal Internal Medicine. 3 ed. Ed. Mosby.
Sundrum, A. (1997). Assessing animal welfare standards of housing conditions-possibilities and limitations. In:
Sörensen, J., Livestock Farming Systems. More than Food Production. EAAP, Publ. 89:238-246.
A field outbreak of Aflatoxicosis with high fatality
rate in feedlot calves in Tehran Province - Iran
IZBIJANJE AFLATOKSIKOZE S VISOKOM STOPOM SMRTNOSTI U

TELADI UZGAJANIH U ZABRANU PROVINCIJE TEHERAN U IRANU
Tooloei, M.1 Nadalian, M.1, Khosravi, A.2, Helan, J. A.3, Najafie, R.4
1
Department of Clinical Science, Faculty of Veterinary Medicine, University of Tabriz, Iran
2
Department of Mycology, Faculty of Veterinary Medicine, University of Tehran, Iran
3
Department of Pathbiology, Faculty of Veterinary Medicine, University of Tabriz, Iran
4
Doctor of Veterinary Medicine
Corresponding author ’s E-mail: Mtooloei@tabrizu.ac.ir
Abstract
Aim of the study: To identify a deathly problem of feedlot calves in a farm and to treat it. Background:
Aflatoxicosis is caused by the aflatoxins and is the most important disease due to the ingestion of the feed
contaminated with Aspergillus spp. especially A.flavus, A.parasiticus and some specious of Penicillium.
AflatoxinB1, a hepatotoxic metabolite, is the most important in the pathogenesis of the disease. All animal
species are susceptible, but outbreaks occur mostly in cattle, sheep and pigs. Hepatosis and hepatic insufficiency
are the principle effect, but mutagenic and teratogenic effects are recorded. Material and Methods (case
report): In January 2007, several stall-fed calves from a farm at the suburb of the Goum city in Iran were
examined. The farm had approximately 200 crossbreed and Holstein calves. The calves were suffering from
chronic diarrhea, and about 35 calves had died during 4 months. Different antibiotics such as OTC, penicillin,
lincospectin and … had been administered by farmers but there were any responses. In the clinical examination
of the about 20 affected calves, the following signs were found: anorexia, weight loss, mild to severe chronic
diarrhea, dysentery, severe tenesmus, rough hair cout, fever (until 40 °c), braxism, bradycardia (40-50 bit per
min.), hyperpnoea, blindness, keratoconjunctivitis, ataxia and falling. Terminally recumbence and death were
followed by convulsions. All breeds had affected but 5-8 months old Holstein calves were most susceptible. At
the inspection of the environment and the feed, the sunflower cake, with abnormal smell and appearance (dark
color and slightly mouldy smell) were found as a part of the calves feed. The animals were feed with the cake
from 6 months ego. Blood samples were obtained from 3 affected calves for hematological and serological
examinations. The mycological tests were applied on the cake sample and the calf’s serums. Results.At
the necropsy of the two died calves, swelling of the liver and kidneys, mild enteritis, as well as
thickening and parakeratosis – like lesions of the ruminal walls, were observed. Neutrophilia and
monocytosis were found at the hematological examination. The levels of the SDH, ALP and SGOT
in the calf’s serums had been increased. Serological examinations for detection of the leptospira and
BVD antibodies were negative. Toxicogenic specious of the aspergillus (mainly A. flavus) grew in
the culture of the cake specimen. Aflatoxins B1 were demonstrated in the cake and serum samples.
Histopathologic examination revealed congestion, zonal (periacinar) hepatocellular necrosis, fatty
change and severe megalocytosis in the liver. Severe congestion and acute focal tubulointerstitial
nephritis were present in the kidney. Conclusions: The diagnosis of Aflatoxicosis was confirmed
by the evaluation of the clinical, hematological, serological and mycological findings as well as
histopathologic changes. Providing of aflatoxin- free feed to all animal and therapy for liver failure
in affected calves prevented further clinical cases.
Key words: Aflatoxicosis, feedlot calves, Tehran
Sažetak
Cilj istraživanja bio je utvrditi uzrok smrtnosti teladi na farmi te izliječiti bolesne. Aflatoksikoza se razvija
prilikom uzimanja hrane kontaminirane toksinima vrste Aspergillus (pogotovo A. Flavus, A. Parasiticus) i
nekim vrstama Penicilliuma. Aflatoksin B1, hepatotoksični metabolit najbitniji je u patogenezi bolesti. Primljive
su sve vrste domaćih životinja, ali se epizootije najčešće javljaju u goveda, ovaca i svinja. Iako su hepatoze i
zakazivanje jetre najčešća poslijedica, opisane su pojave mutagenih i teratogenih učinaka. Materijal i metode
(opisani slučaj): U siječnju 2007. g. Pregledali smo nekoliko teladi iz štalskog uzgoja okolice grada Gouma. Na
farmi je držano cca 200 križanih i Hollstein teladi. Telad je patila od kroničnog proljeva, a tijekom četiri mjeseca
uginulo je 35-oro teladi. Različiti antibiotici kao OTC, Penicilin i Linkospektin prepisivani su stočarima, ali
nije uočena pozitivna reakcija na terapiju. Kliničkim pregledom 20 oboljele teladi uočeni su slijedeći simptomi:
anoreksija, gubitak težine, blaga do ozbiljna kronična dijareja, dizenterija, tenezam, ogrubljela dlaka, febra (do
40oC), braksizam, bradikardija (40-50 udaraca bila u minuti), hiperpneja, sljepilo, keratokonjunktivitis, ataksija
i padanje. Terminalni stadij bolesti bio je obilježen konvulzijama i uginućem. Bolest zahvaća sve pasmine, no
telad Hollsteina u dobi od 5 do 8 mjeseci bila je klinički najsumnjivija. Pregledom držanja i hranidbe, u krmi
su uočene suncokretove pogače sumnjiva izgleda i mirisa (tamna boja i memljiv miris). Životinje su hranjene
tom hranom kroz proteklih šest mjeseci. Uzeti su krvni uzorci tri oboljela teleta za hematološku i serološku
analizu. Na krvnim uzorcima i uzorcima suncokretove pogače učinjene su mikološke pretrage. Rezultati:
Sekcijom dva uginula teleta uočena su otečenja jetre i bubrega, blagi enteritis, kao i parakeratoza i zadebljanje
buražne stijenke. U serumu je uočena neutofilija i monocitoza. Razine SHH, ALP i SGOT u serumu su porasle.
Serološkom pretragom nisu dokazana antitijela za leptospirozu i BVD. Toksogeni sojevi aspergilusa (uglavnom
A. Flavus) izolirani su iz svih uzoraka suncokretove pogače. Aflatoksin B1 je uočen u svim uzorcima pogače
i seruma. Histološkom pretragom utvrđene su kongestija jetre, zonalna hepatocelularna nekroza, omašćenje i
znatna megalocitoza. Također su uočeni značajno otečenje bubrega, fokalna tubulointersticijalna upala bubrega.
Zaključci: Dijagnoza aflatoksikoze potvrđena je vrednovanjem kliničkih, hematoloških, seroloških i mikoloških
nalaza, kao i histopatoloških promjena. Opskrba oboljele teladi hranom slobodnom od aflatoksina i terapijom
insuficijentne jetre spriječili smo pojavu novih slučajeva bolesti.
Ključne riječi: aflatoksikoza, telad u zabrani, Teheran
Introduction
Aflatoxicosis is caused by the aflatoxins and is the most important disease due to the ingestion of
the feed contaminated with Aspergilus spp. especially A.flavus, A.parasiticus and some specious of
Penicillium. Aflatoxins (AF) include AFB1, B2, G1, G2, M1 and M2 which related chemically to and
probably derived from dicoumarin compounds.(1,12,3) Other important toxins produced by the fungi
include Ochratoxin, Patulin and Sterigmatocystin.(2,1,12) A great deal of aflatoxin ingested in the
feed by cattle is physically bound to ruminal content and as little as 2 to 5% reaches the intestine(3).
AFB1, a hepatotoxic metabolite, is the most important in the patogenesis of the disease. Level of
AFB1 in excess of 100 µg/kg of feed are considered to be poisonous for cattle(12). Aflatoxicosis
has been reported in most country and on many feeds such as: peanuts, cottonseed meal, sorghum
grain, corn, sweet corn and moldy bread(4,6,12) The mycotoxin (AF) is not destroyed by milling of
the grain. All animal species are susceptible, but outbreaks occur mostly in cattle, sheep and pigs.
3-6 months old calves are the most susceptible animals. Pregnant and growing cattle are also more
susceptible than adults. The disease has public health importance due to excretion of the toxin into the
cows’ milk in the form of AM1 and present in meat of animals eating contaminated feed which can
cause the human hepatocellular carcinoma. The toxin residues in the milk are approximately equal to
1-2% of the dietary level.(13) A maximum level of 0.5 ppb of the aflatoxin is permitted in bulk tank
milk. Hepatosis - hepatic insufficiency and renal damages are principle effects of the mycotoxin, but
mutagenic, carcinogenic and teratogenic effects through binding to DNA and protein to form adducts,
development of monoclonal antibodies and mutational specificity of the genotoxic compounds have
also been recorded. Role of AFB1 in the etiology of nasal tumors in cattle through Bioactivation of
the toxin in the bovine olfactory mucosa and consequently DNA binding, mutagenicity and induction
of sister chromatid exchanges have been demonstrated.(5,14) The nasal olfactory mucosa has a
much higher capacity than the liver to form lipid-soluble, water-soluble and tissue-bound AFB1-
metabolites because of the differences in the cytochrome P-450 isoenzymes. Hemorrhagic disease
with increased prothrombin time, depression of the immune system functions and impaired protein
formation and coagulation are the other recorded effects of the toxicosis. Effects of aflatoxin ingestion
on the development of Moraxella bovis infectious bovine keratoconjunctivitis(11) and on absorption
of zinc (7,17) through the intestine have been also discussed.
In cattle clinical signs include: anorexia and weight gains, blindness, walking in circles, ear
twisting, braxim, frothing at the mouth, diarrhea and dysentery, sever tenesmus and anal prolapse,
abortion, phothsensetive dermatitis, staring hair coat, keratoconjunctivitis, hemorrhagic disease,
convulsion, recumbency and death. (15) The disease is confirmed by detection of AFs in feed
materials, blood, urine and liver and measurement of serum hepatic enzymes. AFs in Feed materials
may be detected by Black light and Chromatography techniques including thin-layer chromatography
(TLC), gas-liquid chromatography (GLC) and high-pressure liquid chromatography (HPLC) as
well as serological methods such as ELISA and immunoaffinity chromatography. Grain infected
with Aspergillus flavus produces a compound called Kojic acid, which characteristically produces a
greenish-yellow fluorescence when examined in a dark room under long-wave ultraviolet light (black
light). Symptomatic treatment of hepatic insufficiency, administration of a broad-spectrum antibiotic
to prevent of secondary infections, detoxification of aflatoxin by phyllosilicate clay (10) and hydrated
sodium calcium aluminosilicate(9), avoiding of the other types of stress as well as providing of a
clean uncontaminated (toxin-free) medium-to high-energy protein feed help to improve the disease.
The aim of the study was to identify the causative agent of death of feedlot calves in a farm and to
resolve the problem.
Material and Methods (Case history)

In January 2007, several stall-fed calves from a farm at the suburb of the Goum city in Iran were
examined. The farm had approximately 200 crossbreed and Holstein calves. The calves were suffering
from chronic diarrhea, and about 35 calves had died during 4 months ego. Different antibiotics
such as OTC, trimetoprim, penicillin and lincospectin had been administered by farmers but there
were any responses. In the clinical examinations of about 20 affected calves, the following signs
were found: anorexia, weight loss, mild to severe diarrhea, dysentery, fever (up to 40°c), braxism,
bradycardia (40-50 bit per min), hyperpnoea, blindness, keratoconjunctivitis, ataxia and falling.
Terminally recumbency and death were followed by convulsions. All of the breeds were affected but
5-8 months old Holstein calves were most susceptible. At the inspection of the environment and the
feed, the sunflower cake, with abnormal smell and appearance (dark color and slightly moldy smell)
were found as a part of the calves feed. The animals were feed with the cake from 6 months ego.
Ten and three ml of blood samples were obtained from jugular veins of three affected calves for
haematological and serological examinations, respectively. Haematological tests such as total cell
blood count and differentiated count were achieved by standard procedures. Level of the serum SDH,
ALP and SGOT were evaluated through biochemical enzymatic colorimetric kit.
Mycological evaluations were applied on the sunflower meal samples and the calves' serums
so that meal samples cultured on SGA medium and both of serum and the meal samples were
analyzed for Aflatoxins B1 by standard sandwich Elisa- Gibco co. The sera were also analyzed for
anti leptospiral and anti bovine viral diarrhea virus antibodies by Microscopic Agglutination Test and
Pestivirus Kit Elisa Morden UK, respectively.
Results
At the necropsy of the two died calves, slightly swelling of the liver and kidneys, mild enteritis,
as well as thickining and parakeratosis–like lesions on the ruminal walls were observed.
Neutrophilia( 42, 51 and 73%) and monocytosis (5, 7 and 3%) were found at the hematological
examination. the level of serum ALP and SGOT had been increased and were ~540 u/l and ~420u/l,
respectively. Anti leptospiral and Bovine Viral Diarrhea disease antibodies were not detected by the
serological studies. Fig 1 and 2 show the toxicogenic specious of the aspergillus (mainly A. flavus)
which grew in the culture of the cake specimen on SGA medium and microscopic view of Aspergillus
flavus, respectively.
Fig 1: Powdered or granular appearance colonies of Aspergillus flavus which have grew in the culture of the
infected meal samples on SGA medium. The colonies were Wight color in first time and intense yellow to yel-
low – green color at the time of spore production.
Fig 2: Microscopical views of Aspergillus flavus. Thick-walled, coarsely roughened long conidiophores. Glo-
bose and fertile vesicle. Biserata or uniserata phialiders
Fig 3: Fatty changes in liver. Small and large fatty vacuoles within the hepatocytes. (H& E Staining, Magnifi-
cation ×40)
Fig 4. Fatty changes in liver. small and large fatty vacuoles within the hepatocytes (H& E Staining, Magnifica-
tion ×1000)
Fig 5: Severe megalocytosis in the liver. enlargement of cytoplasm and nuclei of the hepatocytes due to the
inhibitory effects of aflatoxins on cell division especially division of nucleus. (H& E Staining, Magnification
×1000)
flatoxin B1 were demonstrated in the meal and serum samples. The sunflower meal was infested
with A.flavus and contained AFB1 with total levels as high as160 ppm.
Histopathologic examination revealed congestion, zonal (periacinar) hepatocellular necrosis,
severe fatty change and megalocytosis in the liver (fig3to5). Severe congestion and acute focal
tubulointerstitial nephritis were present in the kidney.
Discussion and Conclusion

The diagnosis of Aflatoxicosis was confirmed by the evaluation of the clinical, hematological,
serological and mycological examination as well as histopathologic findings. In this outbreak,
similar to the other reports (8,3), 5-8 months old Holstein calves were most affected animals with
aflatoxicosis. Clinical signs in the affected calves such as: anorexia, weight loss, mild to severe
diarrhea, dysentery, fever (up to 40°c), braxism, blindness, keratoconjunctivitis, ataxia, falling
and terminally convulsive recumbency and death were also similar to signs reported in the other
world surveys(16,13,15). With attention to the young calves suffering from chronic diarrhea and
eye problems as well as renal lesions the animals tested to anti BVD-MD virus and anti leptospiral
antibodies, respectively but they were not detected by the serological studies. Mycological findings
such as growing of toxicogenic specious of the aspergillus (mainly A. flavus) in the culture of the
meal specimen on SGA medium, and detection of Aflatoxin B1 in the meal samples as high as160
ppm and sera as well as histopathological finding such as hepatic lesions especially severe fatty
change and megalocytosis in the liver confirmed occurrence of aflatoxicosis in the calves. Only by
providing of aflatoxin- free feed to all animal and therapy for liver failure in affected calves such as
infusion of 5%dextrose solutions prevented further clinical cases during approximately 30 days
Acknowledgements
The authors would like to thank Miss Hashemian M., the employee of University of Tehran in Veterinary
Mycological department for her kindly help in the mycological evaluations.
References
1. Andrews, A.H., Blowy, W., Boyd, H. and Eddy, R.G. (2003) Bovine medicine. 2th ed. Blackwell science,
Oxford . PP:933-4.
2. Blood, D.C., Studdert, V.P. (2000) Bailliers comparative veterinary dictionary. Baillier Tindall, WB Saunders.
3th edd. Pp: 75.
3. Colvin, B M; Harrison, L R; Gosser, H S; Hall, R F (1984) Aflatoxicosis in feeder cattle, JAVMA, 184 (8):
956-958.
4. Hall, R F; Harrison, L R; Colvin, B M (1989) Aflatoxicosis in cattle pastured in a field of sweet corn, JAVMA,
194 (7): 938.
5. Larsson, P; Pettersson, H; Tjälve, H (1989) Metabolism of aflatoxin B1 in the bovine olfactory mucosa,
Carcinogenesis, 10 (6): 1113-1118.
6. McKenzie, R A; Blaney, B J; Connole, M D; Fitzpatrick, L A (1981) Acute aflatoxicosis in calves fed peanut
hay, Aust. Vet. J., 57 (6): 284-286.
7. Neathery, M W; Moos, W H; Wyatt, R D; Miller, W J; Gentry, R P; George, L W (1980) Effects of dietary
aflatoxin on performance and zinc metabolism in dairy calves, J. Dairy Sci. 63 (5): 789-789.
8. Osweiler, G D; Trampel, D W (1985) Aflatoxicosis in feedlot cattle, JAVMA.187 (6): 636-637.
9. Phillips, T D; Clement, B A; Kubena, L F; Harvey, R B (1990) Detection and detoxification of aflatoxins:
prevention of aflatoxicosis and aflatoxin residues with hydrated sodium calcium aluminosilicate, Vet. And
Hum. Toxicol. 32, Supp.: 15-19.
10. Phillips, T D; Sarr, A B; Grant, P G (1995) Selective chemisorption and detoxification of aflatoxins by
phyllosilicate clay, Natural Toxins, 3(4): 204-213
11. Pugh, G W, Jr; Richard, J L; Kopecky, K E; McDonald, T J (1984) Effects of aflatoxin ingestion on the
development of Moraxella bovis infectious bovine keratoconjunctivitis, The Cornell Veterinarian, 74 (2):
96-110.
12. Radostitis, O.M., Gay, C.C., Hinchcliff, K.H. and Constable, P.D. (2007) Veterinary medicine. 10th ed.,
Saunders Elsevier, London. PP: 1624,1687-1689, 1698.
13. Robens, J F; Richard, J L (1992) Aflatoxins in animal and human health, Reviews of Environmental
Contamination and Toxicolo. 127: 69-94.
14. Tjälve, H; Larsson, P; Andersson, C; Busk, L (1992) Bioactivation of aflatoxin B1 in the bovine olfactory
mucosa: DNA binding, mutagenicity and induction of sister chromatid exchanges, Carcinogenesis, 13 (8):
1345-1350
15. Vaid, J; Dawra, R K; Sharma, O P; Negi, S S (1981) Chronic aflatoxicosis in cattle, Vet. And Hum. Toxicol.
23 (6): 436-438.
16. Van Halderen, A; Green, J R; Marasas, W F; Thiel, P G; Stockenström, S A (1989) field outbreak of chronic
aflatoxicosis in dairy calves in the western Cape Province, J. South African Vet. Asso. 60(4): 210-211.
17. Wyatt, R D; Neathery, M W; Moos, W H; Miller, W J; Gentry, R P; Ware, G O (1985) Effects of dietary
aflatoxin and zinc on enzymes and other blood constituents in dairy calves, J. Dairy Scie., 68 (2): 437-
442.
Subacute rumen acidosis in dairy herds: diagnostics
tools
Subakutna acidoza buraga u mliječnih krava:

dijagnostički postupci
Morgante M., Stelletta C., Cannizzo C., Casalone M., Coppola L., Gianesella M.
Dipartimento di Scienze Cliniche Veterinarie, University of Padua, Viale dell’Università 16, 35020, Legnaro
(PD), Italy
ABSTRACT
Subacute rumen acidosis (SARA) represent one of the most important metabolic disorders in intensive
dairy farms that affects rumen fermentations, animal welfare, productivity and profitability. The aim of the
present study was to study SARA in intensive Italian dairy herds and to determine the correct clinical approach
to diagnose this disease. During the last four years forty commercial dairy herds were investigated. Twelve
cows in good body condition, between 5 and 60 day in milk and without clinical signs of disease were selected
randomly from each herd, to perform rumenocentesis and obtain rumen fluid. Ruminal pH was determined
immediately after sampling and concentration of SCFA in ruminal fluid was determined on samples after
storage. Blood samples for hematochemical and hematological profiles were obtained from the same cows that
had rumenocentesis performed by jugular venipuncture. Milk yield quality was determined in the cows were
we performed the rumenocentesis. The herds were divided into three groups depending on the mean rumen pH:
group A counted farms with average ruminal pH > 5.8 (normal), group B included farms with average ruminal pH
between 5.6 and 5.8 (risk), and in group C, dairy farms presented an average ruminal pH < 5.6 (acidosis). Results
were subject to ANOVA and correlation analysis using SIGMA STAT 3.05. We had no sampling problems with
the 480 cows of our study series, and no animal developed any health problem during or after the procedure. In
particular dairy herds show an average SCFA concentration of 121, 147 and 162 mmol/L for normal, risk and
acidosis herds, respectively. The differences among particle size showed a light discordance between the three
class of herd, a result which suggests more attention in TMR preparation and management, especially in large
herds where the attitude of the personnel responsible for feeding the cows is of paramount importance. Milk
yield quality were not statistical different in three groups. Statistically significant differences (p < 0.05) were
observed for various blood parameters observed: these data suggest that modifications of some haematological
parameters can be observed and in particular the total and differential WBC count were significantly higher in
the dairy cows belonging to the farms affected by SARA.
Sažetak
U radu je proučavana subakutna acidoza buraga miječnih krava. Riječ je o kompleksnoj bolesti utječe
istovremeno na fermentaciju u buragu, dobrobit životinja, proizvodnju i profitabilnost. Promatrano je 40
komercijalnih stada u intenzivnom uzgoju tijekom 4 godine kako bi se ustanovilo ispravan klinički pristup
dijagnostici navedenog stanja. u svakom je stadu odabrano 12 krava koje nisu pokazivale znakove bolesti a
bile su u dobroj tjelesnoj kondiciji i 5. do 60. dana laktacije. Na tim je kravama provedena ruminocenteza i
uzet je buragov sadržaj. U buragovom sadržaju je određen ph i SCFA a paralelno je uzeta i krv iz v. jugularis i
određeni hematološki i biokemijski pokazatelji. Ukupno je pregledano 480 krava, a nijedna nije imala nikakvih
zdravstvenih poteškoća nakon pokusa. Na osnovi rezultata za Ph buraga, SCFA i rezultate krvnih pretraga
podijelili smo krave u zdrave (ph buraga preko 5,8) rizične (ph buraga 5,6-5,8) i bolesne (ph buraga ispod
5,6). razine SCFA su za navedene skupine iznosile 121, 147 i 162 mmol/l. na osnovi promjena krvne slike u
navedenih bolesnih životinja, zaključili smo da je diferencijalna krvna slika odnosno njene alteracije siguran
pokazatelj subakutne acidoze buraga.
INTRODUCTION
Subclinical rumen acidosis, also known as subacute rumen acidosis (SARA), represents one of
the most important metabolic disorders in intensive dairy farms that affects rumen fermentations,
animal welfare, productivity and eventually farm profitability. The onset of SARA is linked to the
intake of low fiber high energy diets, often combined with a ruminal environment not yet adapted
to highly fermentable feeds. Under these conditions, rumen papillae are not fully developed with
consequent slower absorption of SCFA. The concentration of these latter thus increases, leading to
a decrease in ruminal pH below physiological limits (Kleen et al., 2003). According to Nordlund
and Garrett (1994), SARA can be defined as a condition characterized by rumen pH below 5.8,
increased total concentration of SCFA, ratio between acetic, propionic and butyric acid shifted
towards propionic and butyric acid, and elevated concentration of lactic acid in the rumen fluid
not exceeding 5-10 mmol/l (Hibbard et al., 1995). Clinical signs of SARA include decreased DMI,
laminitis, rumenitis, liver abscesses, pulmonary bacterial emboli (Nordlund, 1995) and, furthermore,
displacement of the abomasum (Sarashina et al., 1990), mastitis and metritis (Enemark et al., 2002),
low fertility (Britt, 1995). These problems are linked to rumen pathology because of the exceptional
osmotic capacity shown by the rumen and the increase in the adsorption rate of ruminal products,
which may have toxic and vasomotor effects. However, the factors associated with SARA vary,
and provide ambiguous clinical signs, thus defying definitive diagnosis based only on clinical signs
(Garrett et al., 1999), but the only way to obtain a correct diagnosis is to observe and correlate many
aspects (Oetzel, 2000; Morgante et al., 2007): correct collection of the history and clinical analysis
of the herd, diet evaluation (NDF, NDF from forages, NFC) and examination of ruminal fluid; this is
the most important test because it is the only one that allows us to assess the condition of the rumen in
that particular moment (Nordlund and Garrett, 1994). The determination of ruminal pH is a key factor
for the diagnosis of SARA (Enemark et al., 2002). Common field techniques for collecting rumen
fluid for SARA diagnosis include rumenocentesis, by percutaneous needle aspiration (Nordlund
and Garrett, 1994) and oral stomach tube (Nocek, 1997). According various researcher (Garret et al.
1999, Duffield et al. 2004, Morgante et al., 2007), rumenocentesis may be useful for the collection of
rumen fluid for pH determination.

During the last four years forty commercial Italian dairy herds were investigated. The visit to each
herd was organized in cooperation with the local veterinarian and the farmer to obtain the rumen fluid
samples just 4-6 hours after feed distribution. In each farm a general investigation was performed,
with particular attention to herd management and presence of typical clinical signs of SARA. Farms
were selected with these characteristics: high average milk production (about 10000 Kg for year),
over 100 lactating cows, housed in free stalls and in the early part of their lactations (first 60 DIM), use
of TMR and adoption of steaming-up in the final part of the dry period. Twelve cows without clinical
signs of disease, with good body condition and between 5 and 60 DIM, were randomly selected from
each herd to perform rumenocentesis. Ruminal fluid was sampled from each cow 4 to 8 hours after
TMR distribution, a timeframe chosen because ruminal pH likely reaches its minimum. According
the procedure of Edmonson et al. (1989) body condition score (BCS) was recorded for all the cows
studied. Ruminal fluid was obtained by rumenocentesis as described by Nordlund and Garret (1994)
without sedation, using a 13G 105 mm needle (figure 1-4). Rumenocentesis was chosen because it
is most the used technique, providing the most accurate results (Garrett et al., 1999; Enemark et al.,
2002; Duffield et al., 2004). Ruminal pH was determined immediately after sampling using a portable
pHmeter (Piccolo, Hanna Instruments). An aliquot of 8 ml of rumen fluid was immediately acidified
with metaphosphoric acid (25%wt/vol) and stored at 4°C until the samples arrived to the laboratory
where they were stored at –80°C until subsequent determination of concentration of SCFA by high
performance liquid cromatography (HPLC). A TMR samples were taken after TMR distribution:
feed samples were stored –20°C until subsequent analysis by near infrared spettroscopy (NIRS)
and a TMR sample taken was sieved with a modified Penn State method (Lammers et al., 1995) to
determine particle size. Blood samples were collected from the same cows by jugular venipuncture;
hematology profile, hematochemical parameters and serum total proteins were determined. Milk
yield quality was determined in the cows were we performed the rumenocentesis. The herds were
divided into three groups depending on the mean rumen pH: group A counted farms with average
ruminal pH > 5.8 (normal), group B included farms with average ruminal pH between 5.6 and 5.8
(risk), and in group C, dairy farms presented an average ruminal pH < 5.6 (acidosis). Data obtained
were analyzed by ANOVA to verify the effect of farm using the statistical package SIGMA STAT 3.5
according the following model: “Yij = µ + FARMi + eij” Where: Yijk = dependent variable, µ = overall
mean; FARMi = effect of different class of herds, and eij = error term. Pearson linear correlations were
also calculated between the parameters.
RESULTS
We had no sampling problems with the 480 cows of our study series, and no animal developed
any health problem during or after the procedure. The three groups (Normal, Risck and Acidosis)
were homogeneous for average DIM (32 ± 29, 38 ± 25, and 34 ± 32, respectively), BCS (3.05 ± 0.30,
3.08 ± 0.27, and 3.06 ± 0.29, respectively), and all the animals were on absence of external clinical
signs of disease.
Table 1. History and milk (production and quality) on three class of herd
Normal Risck Acidosis

N° lactacting cow 275 294 330
Dry-off 56 55 57
Laminitis Low 10-15% 25-30%
Diarrhoea Low 20% 25-30%
Ketosis Low Low Low
Mastitis No signific No signific No signific
Riproduct.
No signific No signific No signific
problems
Management
Note / /
problems
Milk production
1153 1116 1101
(Kg)
Fat (%) 3,8 3,6 3,5
Protein (%) 3,3 3,3 3,3
Table 2. Chemical composition (%) of diets used during steaming-up (S-UP) and during early lactation
(LACT) on three class of herd

S-UP LACT S- UP LACT S-UP LACT
CRUDE PROTEIN 13,75 15,96 13,355 15,762 13,22 16,405
ETHREAL EXTRACT 4,88 5,21 4,725 4,92 4,235 5,41
ASH 7,79 7,28 8,54 7,702 9,63 7,61
NDF 40,12 31,28 39,86 34,51 42 32,12
NFC 34,475 40,27 33,525 36,992 30,91 38,45
DRY METTER (% s.s.) 59,63 69,375 60,78 52,956 59,51 68,83
ADF 24,56 18,52 24,12 21,358 27,74 20,195
STARCH 15,6 25,25 17,845 23,298 15,655 24,665
CALCIUM 0,955 1,095 0,9 1,01 1,03 1,105
PHOSFORUS 0,38 0,44 0,43 0,468 0,44 0,47
MAGNESIUM 0,315 0,325 0,34 0,314 0,36 0,365
SODIUM 0,255 0,58 0,545 0,628 0,42 0,68
POTASSIUM 1,595 1,375 1,45 1,326 1,765 1,495
CLORUM 0,32 0,36 0,42 0,374 0,305 0,36
DCAD (meq) 30,725 38,245 37,065 37,996 38,705 35,525
Table 3. Results (%) of particle size of sampling on three class of herd

HOLES OPTIMUM
SIEVE
DIAMET. QUANTITY gr % Gr % Gr %
SIEVE I 22 mm 15 gr 3% 8,5 1,9 12,5 1,36 21 4,22
SIEVE II 19 mm 5 gr 1% 8 2,05 8 1,85 6,8 1,44
SIEVE III 8 mm 107,5 24,95 122 31,45 87,6 17,36
>200 gr > 40%
SIEVE IV 5 mm 155 40,75 138,5 32,35 153,2 31,06
PAN / < 200 gr < 40% 132,5 30,3 140,5 31,3 230,8 46,2
Table 4. Mean values of principal short chain fatty acids (mmol/L) of rumen fluid on three class of herd

total SCFA 121.4 142.3 167.2
Acetic Acid 76.4 87.3 90.5
Propionic Acid 28.8 32.4 38.1
N-Butyric Acid 13.5 15.5 15.2
N-Valerate Acid 1.9 2.1 2.3
Table 5. Average values of haematological and haematochemical profiles, expressed in their conventional
units together with the related standard deviations on three class of herd, and statistical significance observed.

WBC (10 /µl) 3
5.58 ± 1.67 5.55 ± 2.61 8.09 ± 1.56*†
RBC (106/µl) 5.91 ± 0.60 6.00 ± 0.78 6.29 ± 0.64
MCV (fl) 49.81 ± 3.36 50.09 ± 3.85 46.50 ± 2.80*†
Albumin (g/l) 33.32 ± 2.56 30.11 ± 2.82* 30.45 ± 3.05
Alpha-1 (g/l) 4.76 ± 0.75 5.83 ± 0.88* 4.76 ± 0.89†
Alpha-2 (g/l) 8.89 ± 0.91 7.96 ± 0.89* 8.67 ± 0.96†
Beta-1 (g/l) 6.05 ± 0.82 6.37 ± 1.10 6.79 ± 0.55*
Gamma (g/l) 18.88 ± 4.16 22.79 ± 5.12* 21.39 ± 4.74
Albumin/Globulin 0.88 ± 0.14 0.85 ± 0.16* 0.86 ± 0.16
Significance: * vs Group A p < 0.05; † vs Group B p < 0.05
DISCUSSION
The aim of this study was to survey the incidents of SARA syndrome in dairy herds in Northern
Italy. Therefore the farms were chosen based on their correspondence to the established parameters
and not in relation to previous suspect of SARA. Herds were homogeneous for several characteristics
(table 1): Holstein cows (except herd 5, where we had also Jersey cows), high production, presence
of more than 100 lactating cows, free stalling, a feeding group in early lactation (first 60 days),
utilization of TMR and utilization of steaming-up at the end of the dry period. However we also stress
that information given by farmers does not always correspond to the real situation. Several herds
showed an unfit flooring and a poor system of effluents ejection; this situation can induce limping
or influence the welfare of animals, a key factor for the onset of numerous diseases, including those
studied here. The data of the initial chemical analysis of diets (table 2), showed that cows were fed
correctly; the value of NDF, ADF, NFC, starch and crude protein, resulted on three class of herd
similar to the values reported in the literature (Nordlund, 2001). However, the particle size of diet
at sampling (table 3) showed a large portion of residual feed on the last sieve (more than 40% is the
optimal value) in acidosis herds. This indicates the presence of large quantities of small particles
(especially concentrates) in feed, or excessive grinding of TMR. A large quantity of concentrates
promotes the development of amylolitic bacteria and decreases chewing, with consequent curtailed
salivary secretion, a situation that can facilitate the occurrence of SARA. We observed smaller than
optimum quantities of NDF from forage (essential portion, because able to chewing stimulation)
in several herds. In fact, previous studies (Mertens, 1997; Stone, 2004) showed that the best value
of peNDF (physically effective NDF) should be about 22% of ration DM to maintain an average
ruminal pH of 6.0. We had no sampling problems with the 480 cows of our experimental series,
and no animal developed any health problem during or after the procedure, including peritonitises,
local abscesses or even decrease in milk production. An analysis of SCFA determination reported in
table 4 show that the concentration of acetate in rumen fluid resulted higher than reference values
reported by Murphy et al. (2000). Propionate values varied between 28 and 38 mmol/l, thus resulting
higher than the concentration of 25 mmol/l reported by Murphy et al. (2000). In all farms, butyrate
concentration seemed to be slightly lower than range values (13-16 mmol/l) reported by Murphy et
al., 2000. Valerate and isovalerate showed values higher than those reported in the literature where
traces of these SCFA are taken into account (Kristensen et al., 2000; Allen et al., 2004). From our data
total valerate concentration ranged between a minimum mean value of 3.73 mmol/l and a maximun
value of 5.25. N-valerate is a toxic acid, derived from proteins (rather than from carbohydrates) that
is absorbed by the rumen wall (Kristensen et al., 2000; Allen et al., 2004). Little is known about its
metabolism. N-valerate reaches the liver (where it may induce damage) or the mammary gland when
it is released into the blood stream. A previous study (Morgante et al., 2004) showed a significant
correlation between N-valerate levels in the rumen and the presence of somatic cells in the milk.
Although our study didn’t show a statistic correlation between herds with low ruminal pH and high
levels of valerate concentration, we think it is important to extend the investigation and define the role
of valerate in respect to SARA. Subacute ruminal acidosis is certainly related to management errors,
especially in large herds where the attitude of the personnel responsible for feeding the cows is of
paramount importance. Substitution or replacement of feeding personnel may lead to differences in
feeding schedules, proportion of roughage and concentrate, with consequent considerable impact on
unstable ruminal environments. These problems, although mainly reported in feedlots (Elam, 1976),
may apply also to high-producing dairy herds and should therefore be regarded as a potential hazard
for the health management of the herd.
Milk yield quality were not statistical different in three groups: in particular we showed an
average of 3.8, 3.6 and 3.5 of milk-fat % for normal, risk and acidosis herds, respectively, and the same
values (3.3) of milk protein %. Although ruminal pH is reported to drop in experimental situations of
inducing low milk-fat, this alone does not justify those situations to be characterized as being SARA.
The three groups were homogeneous for average values of DIM (32 ± 29, 38 ± 25, and 34 ± 32,
respectively), BCS (3.05 ± 0.30, 3.08 ± 0.27, and 3.06 ± 0.29, respectively), therefore the variations
about haematological and haematochemical profiles between groups are more likely to be related
to different ruminal pH values. The calculated erythrocytic indices showed that the values obtained
for MCV, MCH and MCHC were within expected normal ranges. Although no substantial changes
in the level of RBC, MCH, MCHC, and MCV were observed, dairy cows with SARA in the present
study exhibited a significant decrease in MCV and MCH, and an increase in MCHC, in contrast to
observations made by other authors (Akinbamijo et al., 1998; Omer et al., 2002). It is possible that the
slight increase in MCHC observed in the herd with low ruminal pH is a compensatory erythropoietic
action in response to the slowly decline in the HCT. The values of these factors were essential for
the classification of anemia. Although anemia is an important symptom reported by other authors
(Bonfanti et al., 2004; Mbassa et al., 1994), its precise link with subacute ruminal acidosis is still
unknown. White blood cells were significantly higher in the dairy cows belonging to the farms of
group C (acidosis). As suggested in previous studies (Jacob et al., 2001), this involves an increase of
cortisol levels that are significantly involved in various events during periparturient period including
initiation of parturition. In effect, according this previous work (Jacob et al., 2001), were the study
was conducted to estimate the serum cortisol concentration in cows and the neonatal calves in order
to correlate the effect of cortisol on certain haematological and biochemical parameters such as blood
glucose level, total plasma protein, lymphocyte:neutrophil ratio and mitogen induced lymphocyte
proliferative response, our study confirmed that the dam at the time of parturition and neonatal calf
before taking colostrum are under a high risk of infection and diseases (for example subacute ruminal
acidosis) because of the low profile of immune status.
REFERENCES
Akinbamijo OO, Bennison JJ, Jaitner J, Dempfle L, 1998. Haematological changes in N’Dama and Gobra
Zebu bulls during Trypanosoma congolense infection maintained under a controlled feeding regimen. Acta Trop
69: 181-192. Allen MS, Voelker JA, Oba M, 2004. Physically effective fiber and regulation of ruminal pH: more
than just chewing. Proceedings of the 12th international conference. East Lansing, Michigan USA, July 2004.
Britt JH, 1995. Relationship between postpartum nutrition, weight loss and fertility. Cattle practice (BVCA),
Jan. 79-83. Duffield T, Plaizier JC, Fairfield A, Bagg R, Vessie G, Dick P, Wilson J, Aramini J, McBride B,
2004. Comparison of techniques for measurement of rumen pH in lactating dairy cows. Journal of Dairy Science
87: 59-66. Edmonson AJ, Lean IJ, Weaver LD, Farver T, Webster G, 1989. A Body Condition Scoring
Chart for Holstein Dairy Cows. J. Dairy Sci. 72: 68-78. Elam CJ, 1976. Acidosis in feedlot cattle: practical
observations. J. Anim. Sci. 43: 898–901. Enemark JMD, Jørgenssen RS, Enemark PS, 2002. Rumen acidosis,
with special emphasis on diagnostic aspects in subclinical rumen acidosis. A review. Veterinary Zootecnie 20:
16-29. Garrett EF, Perreira MN, Nordlund KV, Armentano LE, Goodger WJ, Oetzel GR, 1999. Diagnostic
methods for the detection of subacute ruminal acidosis in dairy cows. J. Dairy Sci. 82: 1170–1178. Hibbard
B, Peters JP, Chester ST, Robinson JA, Kotarski SF, Croom WJ Jr, Hagler WM Jr, 1995. The effect of
slaframine on salivary output and subacute and acute acidosis in growing beef steers. Journal of Animal Science
73: 516–525. Jacob SK, Ramnath V, Philomina PT, Raghunandhanan KV, Kannan A, 2001. Assessment
of physiological stress in periparturient cows and neonatal calves. Indian. J. Physiol. Pharmacol. 45: 233 – 238.
Kleen JL, Hooijer GA, Rehage J, Noordhuizen JP, 2003. Subacute ruminal acidosis (SARA): a review. J.
Vet Med A Physiol Pathol Clin Med 50: 406-414. Kristensen NB, Pierzynowski SG, Danfær A, 2000. Net
portal appearance of volatile fatty acids in sheep intraruminally infused with mixtures of acetate, propionate,
isobutyrate, butyrate, and valerate. J. Anim. Sci. 78: 1372–1379. Lammers BP, Buckmaster DR, Heinrichs
AJ, 1995. A simple method for the analysis of particle size of forage and total mixed rations. J. Dairy Sci. 79:
922-928. Mbassa GK, Balemba O, Maselle RM, Mwaga NV, 1994. Severe anemie due to haematopoietic
precursor cell dedestruction in field cases of East Coast Fever in Tanzania. Vet Parasitol 52: 243 – 256. Mertens
DR, 1997. Creating a system for meeting the fiber requirements of dairy cows. Journal Dairy Science 80: 1463-
1481. Morgante M, Stelletta C, Tacchio G, Lettig I, Berzaghi P, 2004. Subclinical rumen acidosis in Italian
rd
dairy herds. 23 World Buiatrics Congress, July 11-16, 2004-Quèbec (Canada); S. 566. Morgante M, Stelletta
C, Berzaghi P, Gianesella M, Andrighetto I, 2007. Subacute rumen acidosis in lactating cows: an investigation
in intensive Italian Dairy herds. Journal of Animal Physiology and Animal Nutrition 91: 226-234. Murphy M,
Akerlind M, Holtenius K, 2000. Rumen fermentation in lactating cows selected for milk fat content fed two
forage to concentrate ratios with hay or silage. J. Dairy Sci. 83: 756–764. Nocek JE, 1997. Bovine Acidosis:
Implications on Laminitis. J. Dairy Sci. 80: 1005–1028. Nordlund KV, Garrett EF, 1994. Rumenocentesis – a
technique for collecting rumen fluid for the diagnosis of subacute rumen acidosis in dairy herds. The Bovine
Prac. 28: 109–112. Nordlund K, 1995. Questions and answers regarding rumenocentesis and the diagnosis of
herd-based subacute rumen acidosis. Proc. 4-State Applied Nutrition and Management Conference. La Crosse,
WI, USA. Nordlund K, 2001. Herd based diagnosis of subacute ruminal acidosis. Preconvention seminar
8: Dairy herd problem investigations American Association of Bovine Practitioners 34th Annual Convention,
September 11-12, 2001-Vancouver, BC. Oetzel GR, 2000. Clinical aspects of ruminal acidosis in dairy cattle.
Proceedings of the 33rd Annual Convention of the Americn Association of Bovine Practitioner, Rapid City, pp.
46–53. Omer OH, El-Malik KH, Mahmoud OM, Haroun EM, Hawas A, Sweeney D, Magzoub M, 2002.
Haematological profiles in pure bred cattle naturally infected with Theileria annullata in Saudi Arabia. Vet.
Parasitol. 107: 161 – 168. Sarashina T, Ichijo S, Takahashi J, Osame S, 1990. Origin of abomasum gas in cow
with displaced abomasum. Jpn. J. Vet. Sci. 52: 371-378. Stone WC, 2004. Nutritional approaches to minimize
subacute ruminal acidosis and laminitis in dairy cattle. Journal Dairy Science 87 (E.supp.): E13-E26
INFLUENCE OF PROPYLEN GLYCOL IN FEED FOR PROPHYLAXIS
OF KETOSIS IN PERIPARTAL PERIODS OF DAIRY COWS
utjecaj PROPiLEN GLikOLa u hrani na spriječavanje

ketoze u muznih krava prije poroda
Biljana Radojičić1, B. Dimitrijević1, A. Krasnić2
Ketosis is a relatively frequent metabolic disorder of dairy cows with high milk yield, which
mostly occurs as a consequence of the nutritive-metabolic inadequancy of an organism. It manifests
itself in amassing of free fatty acids in the blood, in decrease of the glucose concentration in the blood,
and a considerable presence of aceto-bodies in the blood and the urine. It can take a sub-clinical (more
frequently), or clinical form (accompanied with the loss of appetite, decrease in milk yield and aceto-
bodies in the urine). It occurs as a primary or secondary disease, mostly during the puerperium of
high yield dairy cows (Blood, 1994). In prevention and treatment of ketosis various substances have
beeen used (molasses, nicotinaamid, Na-propionat, glycosol, propylene glycol) as additions to dairy
cows’meals, in different quantities and at different times, before and after delivery (Markovic, 1991,
Studer et al., 1993 Formigoni et al., 1996). Propylen glycol is a dominant substance in the Glucolac
plus energetic compound, which contains some vitamines from the B vitamine group and some
oligo-elements, which basically is a gluco-genoplastic substance aimed at prevention of ketosis, and
which is used in variously recomended dosages of 100-300 g per, at different times, but generally 30
to 15 times per days before delivery (Sauer et al., 1989; Formigoni et al., 1996; Krasnic, 2005).
The way in which propylen glycol works is through enzime inclusion and intermediary metabolism
which takes place within the liver cells.
Simultaneous evaluation of metabolisnm and the liver functional activities can be followed
using certain biochemical parameters in the blood and the blood serum (metabolic profile), and by
way of them a sub-clinical ketosis can be revealed, so it can be timely prevented (Blood 1994;
Samanc et al., 2004, Radojicic Biljana et al., 2007). Since numerous parameters are used in these
researches, the objective of some of them was to determine parameters exactly and reduce thewi
number to achieve a better diagnostic significance in evaluating metaphylaxis of the liver. So many
researchers have determined that the suimulataneous finding of hypoglycemia, hypoalbuminemia,
hyperbilibirubinemia and higher activity of AST in a blood serum, is a valid indicator of the disturbed
metabolism and liver disorder (Brugere-Picoux Jeane and H. Brugere 1987: Lotthammer, 1991;
Kasagic, 2005; Krasnic, 2005; Radojicic Biljana et al., 2002; Radojicic Biljana, 2007; Radojicic
Biljana et al., 2007).
Sažetak
Ketoza (acetonemija) je dobro poznata bolest uzrokovana neadekvatnom prehranom krava
muzara, posebice pri visokoj proizvodnji mlijeka, u krava bilo koje dobi, uglavnom tijekom prvih 30
dana laktacije, rijetko u prvoj laktaciji. Profilaksa i terapija ketoze koristi različite peroralne preparate:
nikotin amid, propionat, glicerol i propilenglikol. Aplikacija propilenglikola, zajedno sa nekim
vitaminima B skupine pozitivno utječe na glikemiju u krava u peripartalnom razdoblju. Istraživanje
je provedeno na kravama holstein pasmine, u kasnoj gravidnosti, starih 4-6 godina, koje su imale
ketozu u nekoliko ranijih navrata. Životinje su podijeljene u 3 skupine. Prva skupina (10 krava) je
dobivala propilenglikol i neke vitamine B grupe u jednokratnoj dnevnoj dozi od 200g u obroku, 14
dana prije poroda. Druga skupina (10 krava) dobivala je propilenglikol počevši 7 dana prije poroda
pa do 7 dana nakon poroda, također kao jednokratna dnevna doza od 200g u krmivu. Treća skupina
krava (10 krava) je bila kontrolna grupa kojoj nije dodavan propilenglikol prije poroda. Uzorci krvi
uzimani su za određivanje metaboličkih parametara prije i nakon pokusa venepunkcijom v. subcutanea
abdominis. U krvnom serumu određivana je razina glukoze, albumina, ukupnog bilirubina te aktivnost
enzima AST testom „Reneal Finechemical Co“. Takođeer tijekom pokusa redovito je praćena razina
ketonskih tijela u mokraći Rhotera-Ross testom. Analizom dobivenih rezultata zaključili smo da u
kontrolnoj skupini krava nakon pororda razina bilirubina ima statistički znakovit rast (p<0.05), kao
i razina aktivnosti AST, a razina albumina pada, što se potvrdilo u pojavi kliničke ketoze u dviju
krava (pozitivan nalaz ketonskih tijela u mokraći). U prvoj grupi životinja aktivnost AST enzima
je stabilna, kako prije, tako i nakon pokusa te unutar fizioloških vrijednosti (x=62,37 ± 15,32 : 72 ±
24,36 U/l). U prvoj skupini krava nije došlo do pojave ketoze nakon poroda. Ipak, razina glikemije
je bila niža (x=1,97 ± 0,65 mmol/l) u odnosu na kontrolnu i drugu grupu. Vrijednosti razine AST u
prvoj skupini u odnosu na drugu i kontrolnu skupinu su pokazale kako je AST znakovit parametar
kontrole statusa jetara krava u peripartalnom razdoblju. Dobivanje propilenglikola u hrani najmanje
2 tjedna prije poroda ima hepatoprotektivnu ulogu u profilaksi ketoze. Hiperbilirubinemija i visoka
aktivnost AST u serumu indikatori su subkliničkog oblika acetonemije u krava.
Ključne riječi: propilenglikol, profilaksa, ketoza, metabolički parametri

Investigation were conducted in the high yield cows, Holstein breed (n=30), ages 4-6 years,
divided into tree groups, in the farm »Kopovo«, Starčevo. Prior the experiment cows have been one
or two time in ketosis in the earlier lactation period.
The first experimetal group (n=10) two weeks prior delivery intake with the feed Glucolac plus,
200 g, in single dosis per day. The second group (n=10) 7 day prior and 7 days after delivery intake
with feed Glucolac plus, 200 g in single dosis per day, and control group od cattle (n=10) stand
without Glucolac plus in feed.
Blood sampling for analyses was provided prior and after experiment with venepunction from
vena abdominis subcutanea always in the morning. In the blood sera we determined concentrations
of glucose, total bilirubine, albumine and activity of enzime AST with spectrophotometar Basic
Secoman, using comercials tests »Reneal Finechemical Co«. Every morning we controled urine
by Rother-a test to establish presence of aceto-bodies. In the ketotic cows we provided standard
therapeutical treatment. Results of biochemical analyses in the blood sera were statisticaly processed
with description methods, and statistical significance were determined using Studen t test.
Results
After conducted examination and blood sera analysis, results were statisticaly processed,
interpreted, and showed in table 1, 2, 3 and 4.
In table 1. it can be seen that mean values of glucose concentration in cows blood serum of I
experimental group was the lowest (x=1.28±0.35 mmol/l), while the second day after delivery it was
x=1.97±0.65 mmol/l , which was significantly higher compared with the beginning of experiment (p<
0.05). In II experimental group dropping of glycemia occured at seventh day postpartum, compared
with the glycaemia at the beginning of experiment, namely before propylen glycol application
(x=1.84±0.87 : 1.55±0.63 mmol/l). In control group, mean values of glycaemia were in physiological
range (x=3.08± 1.4 mmol/l), but in that group two cows were with glycaemia 1.17 and 1.22 mmol/l,
i.e., it was clinically manifested ketosis (findings of aceto-bodies in urine samples).
Table 1. The mean values of glucose concentrations (mmol/l) in blood sera of cows in experimental and
control group
I group I group II group II group Control

Stat. param. prior after prior after group
x 1.28 1.97* 1.84 1.55 3.08
SD 0.35 0.65 0.87 0.63 1.04
SY 0.1105 0.2068 0.2760 0.2000 0.3033
Minimum 0.75 1.23 1.10 0.86 1.17
Maximum 1.75 3.31 3.73 2.96 4.69
CV (%) 27.26 33.17 47.76 40.82 33.57
* (p< 0.05)
Table 2. The mean values of total bilirubin concentrations in the blood sera (μmol/l) of cows in experimental
and control group
I group I group II group II group

Control group
Stat. param. prior after prior after
x 9.32 13.61 9.44 13.84 9.00
SD 4.21 3.58 2.97 7.37 5.18
SY 1.3314 1.1322 0.9397 2.3291 1.6372
Minimum 4.91 7.50 5.11 4.89 4.92
Maximum 18.13 20.10 15.00 26.70 21.51
CV (%) 45.18 26.30 31.47 53.24 57.50
In table 2. it can be seen that mean values of total bilirubine concentrations were higher than
physiological values (>8.0 μmol/l), in all of animals during all the time (experimental and control
group), although the cows of second experimental group, at seventh day after delivery has the highest
values, x=13.84±7.37 μmol/l .
Table 3. The mean values activity of AST (U/l) in blood sera of cows in experimental and control group
I group I group II group II group Control

Stat.
prior after prior after group
param.
x 62.37 72.00 82.46 100.55 116.23**
SD 15.31 24.36 43.79 48.53 54.90
SY 4.8420 7.7026 13.8487 15.3462 17.3602
Minimum 42.10 4.850 49.10 46.70 67.10
Maximum 88.50 123.50 182.00 200.10 225.10
CV (%) 24.55 33.83 53.11 48.26 47.23
** (p< 0.01)
In table 3., it can be seen that activity of AST in blood sera was significantly higher (p<0.01)
in control group, and was x=116.23±54.23 U/l. The highest values of AST activity were noticed in
two cows with clinically manifested ketosis ( 225.10 and 210.2 U/l). Decidedly stability of AST
activity was in I experimental group before and after experiment x=62.37±15.31 : 72.0±24.36 U/l ,
respectively it was in physiological range (up to 80 U/l) during the both period of examination.
Table 4. The mean values concentration of albumin (g/l) in the blood sera of cows in experimental and control
group.
I group I group II group II group

Stat. param. Control group
prior after prior after
x 37.28 43.34** 33.34 35.43 36.58
SD 7.51 11.55 3.26 3.44 4.09
SY 2.3760 3.6509 1.0294 1.0872 1.2930
Minimum 31.50 24.60 28.00 29.40 31.80
Maximum 57.90 58.10 37.70 40.70 46.50
CV (%) 20.16 26.64 9.76 9.70 11.18
** (p< 0.01)
In table 4. it can be seen that mean values of albumin concentration, in all of examined groups,
were in physiological range, although it was significantly higher (p< 0.01) in cows of I experimental
group (x=43.34±11.5 g/l ) at the end of experiment, compared with the II experimental group before
experiment (x=33.34±3.26 g/l). In cows of control and I experimental group, albumin concentrations
were somewhat lower compared with the cows of I experimental group, but it is out of statistical
significance.
Discussion
Ketosis, as one of most frequent metabolic disorder in high-yield dairy cows, occurs in 20-38
%, as a consequence of the nutritive-metabolic inadequacy of an organism (Krasnić, 2005). It occurs
mainly in older cows, after delivery, in a period when they should be in a most productive time ( at
3.-5. lactation). Ketosis carry out to dropped milk production, bearing calves in neonatal acidosis, as
well as reproductive disabilities, what is reflected in important economical loses. It manifests itself in
decrease of the glucose concentration in the blood, and a considerable presence of aceto-bodies in the
blood and the urine. It occurs as a primary or secondary disease, mostly during the puerperium of high
yield dairy cows For clinical form of ketosis is hypoglycaemia and aceto-bodies in urine. It can take
sub-clinical (more frequently), or clinical form. Detectione of ketosis is posible with determination
biochemical parametres indicate in the same time status of metabolism and functional activity od
liver cells (Šamanc et al., 2004; Radojičić Biljana et al. 2007). Among of many parameters it is
established that four of them can be used for validation of metaphylaxis of liver status in order to
prevent ketosis (Brugere-Picoux Jeane and H. Brugere 1987; Krasnić, 2005; Radojičić Biljana
et al., 2002; Radojičić Biljana, 2007). Glucolac plus is energetic compound, which contains some
vitamines from the B vitamine group, and some oligo-elements, as couper, which basically is a gluco-
genoplastic substance aimed at prevention of ketosis, and which is used in variously doses and diffrent
time. recomanded of may authors (Sauer et al., 1989; Studer et al., 1993; Formigoni et al., 1996,
Krasnić, 2005). Lotthammer (1991) sugested that for ketosis in clinical form the level of glycaemia
is lower then phisiological value (2.2 mmol/l) , i.e. it was 1.8 mmol/l, but, Blood (1994) sugested that
level of glicaemia is 1.6 mmol/. However, in our investigation in the condition of hypoglicaemia we
did not find clinical form of ketosis into first group, where mean values of glucose concentration prior
application of Glucolac plus was x=1.28±0.35 mmol/l. Application of Glucolac plus two weeks before
delivery lead to statisticaly important increase (p<0.05) of glycaemia level, x=1.97±0.65 mmol/l, in
the first group. In the control group we found statisticaly important increase activity of enzime AST
x=116.23 ±54.23 U/l, and hyperbiliruminemia and hypoalbuminemia in the two cows in clinical
form of ketosis. In the cows before delivery hypoalbuminemia, hyperbilirubinemia and high activity
of AST is valid parameters for detection of subclinical form of ketosis (Brugere-Picoux Jeane and
H. Brugere 1987; Lotthammer, 1991; Kasagić, 2005; Krasnić, 2005; Radojičić Biljana et al.,
2007).
Stabile activity of enzime AST in the first group in peripratal period indicate that Glucolac plus
have hepatoprotective role, and AST can be used as valid parameter for metaphylaxis of status liver
in cattle (Krasnić, 2005 ; Radojičić Biljana, 2007).
Conclusion
Application of Glucolac plus in feed for high yield cows, in single dosis at 200 g per day (100
g propylen glycol) two weeks before delivery, resulted with imoprtant increase of glycaemia level,
stabile activity of AST in the blood sera, prior and after delivery, which was not case in the second
and control group. Determination of AST activity is good parameter for functional evaluation of
status liver in high yield cows in peripartal period.
References:
Blood D.C. (1994): Pocket Companion to Veterinary Medicine. Chapter 7. Disease of the liver and pancreas.
Baillere Tindal
Brugere-Picoux Jeane and H. Brugere (1987): Particularites de la biochemie clinique des ruminants. Rec. Vet.
Med., 163 (11), 1043-1053
Formigoni A.M.C., Cornil A., Proudi A., Mordenti A., Rossi D., Portetelle and R Removille (1996): Effect
of propylen glycol supplementation around parturition on milk yield reproduction perfomans and some
hormonal and metabolic ccharacteristics in dairy coes. J. Dairy Res., 63: 11-24
Krasnić A. (2005): Primena propilen glikola i nekih vitamina B grupe u preveniranju ketoze visoko mlečnih
krava. Specijalistički rad, Fakultet veterinarske medicine, Beograd
Kasagić D. (2005): Koncentracija trijodtironina, tiroksina, insulinu sličnog faktora rasta I i biohemijskih
pokazatelja metabolizma u krvnom serumu junica pre i posle partusa. Magistarska teza. Fakultet veterinarske
medicine, Beograd
Lotthammer, K.H. (1991) : Uticaj i posledice neizbalansirane ishrane na zdravlje i plodnost mlečnih krava.
Zbornik predavanja XX seminara za inovaciju znanja veterinar, 71-102, Fakultet veterinarske medicine,
Beograd
Marković S. (1991) : Uticaj amida nikotinske kiseline i L-metionina na metabolizam lipida krava u visokom
graviditetu i ranom puerperijumu. Magistarska teza, Fakultet veterinarske medicine, Beograd
Radojičić Biljana, J. Bojkovski, D. Janković (2003): Neki biohemijski parametri kontroli metabolizma visoko
mlečnih krava, Veterinarski žurnal Republike Srpske, Vol. 2., br./No 1-2, 31-35, 2002
Radojičić Biljana (2007): Opšta klinička dijagnostika kod domaćih papkara. Naučna »KMD«, ISBN 978-86-
84153-76-2
Radojičić Biljana, Bosiljka Đuričić, D. Matarugić, D. Kasagić (2007): Značaj hematološko biohemijskih analiza
u diferencijalnoj dijagnostici oboljenja kod visokomlečnih krava. II Kongres veterinara Republike Srpske
24-27. okotobar 2007, Veterinarski žurnal Republike Srpske, Vol 7, Broj 2, str. 128-134
Sauer F. D., J.K.G. Kramer, and W. J. Cautwell (1989): Antiketogenic effect of monensin and propylen glycol
in aerly lactation. J. Dairy Sci. 72:436-442
Studer V.A., R.R. Grummer and S.J. Bertics (1993): Effect of prepartum propylen glycol adminstration on
periparturient fatty liver in dairy cows. J. Dairy Sci. 76: 2931.2939
Šamanc H., Radojičić Biljana, Mira Kovačević i R. Đoković, (2004): Some endocrino-metabolic parameters in
the blood serum of healthy and ketotic cows. The 12th Congress of Mediterrranean Federation for Health
and Production of Ruminants, Abstract book, 26 Istanbul, Turky, 16-19 september, 5.
Electrophoretic study of plasma proteins in dairy
cows with clinical and subclinical mastitis by
Agarose gel procedure
Istraživanje proteina plazme elektroforezom u

mliječnih krava s kliničkim i subkliničkim mastitisom
postupkom gel Agara
Tabrizi1, Afshin Davasaz; Roozali Batavani2, Siamak Asri-Rezaei2, Malahat Ahmadi2

1
Department of Clinical Sciences, Faculty of Veterinary Medicine, Islamic Azad University of Tabriz, Iran
2
Faculty of Veterinary Medicine, University of Urmia, Urmia, Iran
Abstract
The mastitis is one the most important diseases from point view of economy in milk cow breeding industry,
which it causes reduction in milk producing, treatment expenses, reduction in cattle genetic progress and fall in
milk combination quality. The aim of this study was to survey Holstein dairy cow plasma with different protein
bounds ratio changes in the case of clinical and subclinical mastitis. Samples from dairy farms around TABRIZ
were taken. For recognizing subclinical cases Californian Mastitis Test (CMT) was used, and instances of two
positives and three positives were considered. In the case of clinical mastitis one group in the name of mild (sub
acute) diagnosed, Which had milk containing abnormality and clots, and other group in the name of moderate
(acute) determined which in addition to milk, they had inflammation changes in udder tissue. The numbers
of samples in every 4 groups were 25 . Besides of these affected 4 groups, we chose 25 healthy cows which
both their (CMT) tests were negative and it was not separated in their milk culture pathogenic bacteria. In all
groups blood samples from jugular vein were obtained, using vacuum tube and containing of EDTA and plasma
separated. The next phase, the samples by using protein hydragel by electrophoresis were measured. The results
on albumin bound although the mean amounts of these protein in affected groups were lower than control group,
it does not show significant difference (P>0.05). In alpha-1 bound , there was significant difference between
CMT2+ group and control group (P<0.05), also it showed significant difference with clinical mastitic groups.
In alpha-2 bound clinical mastitic groups had difference with healthy group (P<0.05). However, there was not
difference between clinical and subclinical groups (P>0.05). In beta-1 bound it showed difference only in the
affected to clinical moderate mastitis group (acute) with other groups (P<0.05). In Beta-2 bound there were not
any difference among groups (P>0.05). In gamma-1 bound , there was significant difference between control
group and CMT3+ group (P<0.05), And in gamma-2 bound there were not any differences among groups. In
conclusion, regarding to the results obtained this is what understood, with increasing the inflammation and
infection intensity, the increase in proteins amount, especially in alpha-2 and beta-1 bounds are significant .
Sažetak
Mastitis je jedna od najizraženijih bolesti koja utječe na mljekarsku industriju uzrokujući pad mliječnosti,
rast troškova držanja, genetsko nazadovanje i pad kvalitete mlijeka.Cilj ovog istraživanja je procijeniti omjere
proteina u plazmi Holštajn mliječnih krava sa subkliničkim i kliničkim mastitisom. Uzimani su uzorci krava
s mliječnih farmi u okolici Tabriza. Za dokaz subkliničkog mastitisa korišten je Kalifornijski tesz za mastitis
(CMT) te su u obzir uzeti slučajevi dvije i tri pozitivne reakcije. U slučajevima s kliničkim mastitisom jedna
skupina je bila blaga kod koje je mlijeko sadržavalo krpice i grudice, dok su u drugoj umjerenoj skupini uz
promjene u mlijeku uočene upalne promjene u tkivu vimena.
INTRODUCTION
Mastitis is the most frequent and expensive disease associated with current intensive dairying
It has adverse effects on the economics of milk production by reducing the quantity and quality of
milk (De Graves et al., 1993), and increasingly through the imposition of financial penalties by milk
purchasers for high numbers of somatic cells in milk which increase as a result of intramammary
infection (Booth, 1997). Per acute clinical mastitis has also been recognized as the major cause of
mortality in adult dairy cows (Menzies et al., 1995). Mastitis can be caused by a large number of
bacterial species. Subclinical infections are those for which no visible changes occur in the appearance
of milk or the udder, but milk production decreases, somatic cell count increases, pathogens are
present in the secretion, and composition is altered. Clinical mastitis is recognized by abnormal
milk, varing degrees of mammary gland inflammation (redness, heat, swelling, pain) and with or
without illness of the cow. Milk production declines, bacteria are present in the milk and the milk can
vary from having a few milk clots to serum with clumps of fibrin in the secretion (Tyler and cullor,
1990). Early identification of udder health problems is essential for dairy farmers and veterinarians to
ensure not only animal well-being but also milk quality and dairying productivity. Economic aspects
interfere with the routine application of bacteriologic examination of quarter milk samples. For this
reason, alternative parameters are used to identify trends in the development of the udder health in a
dairy herd, although these parameters indicate inflammation.

Animals were selected from two Holstein dairy herds located Tabriz in east Azerbaijan province
of Iran. Cows were milked three times daily by machine milking. All cows were subjected to post-
milking teat disinfection, those were dried off approximately 2 months before expected calving and
all quarters of cows were infused with an antibiotic preparation approved for use in non lactating
cows following the last milking of lactation. Milk samples were collected from cows just before
morning milking. Teats were washed thoroughly and dried with a single-use paper towel. The first
three streams of milk from each teat were discarded. The teat end and orifice was sanitized with
cotton swabs soaked in 10% ethyl alcohol and approximately 10 ml foremilk sample were collected
from each quarter of cow in a sterile tube held horizontally. Clinical mastitis was recognized by
the dairymen on each farm in the usual way, by observation and palpation of the udder. In 25 case
mastitis was diagnosed by the presence of clots in the milk (defined as mild mastitis), and in 25
case by the presence of clots and observable inflammation in the infected quarter such as heat, pain,
redness or swelling (defined as moderate mastitis). Subclinical mastitis was determined by California
mastitis test (CMT). The CMT results were interpreted as negative (O), 1+ (traces), 2+(gel) and
3+(clumps), (Busato et al., 2000). CMT 1+ cases were eliminated from this study. CMT 2+ and CMT
3+ cases (25 case from each score) were submitted in the research. CMT(0) and culture negative
cases were considered healthy (Control). Milk samples were also taken from an unaffected, non-
mastitic, diagonally opposed quarter of the udder of the healthy and mastitic cows, as intra-animal
controls. The number of samples in each group were 25 case. Jugular blood samples were taken
from each dairy cow. Venoject tubes with EDTA and For bacteriological examinations, standard
procedures was performed according to the guidelines described by sears et al.(2003) and Quinn et
al.(1994).
To investigate protein fractions in the serum and uterine fluid, the samples were diluted (1:10)
with normal saline and run on agarose gel media (commercial kits, sebia Performance, France) with
a buffer consisting of barbital (1.8g/l), tris [tris(hydroxymethyl)amino methane] (7.2g/l), sodium azid
(0.1g/l) and sidium barbital (10.3g/l) included in the kits, at 100 V and starting flow of 25mA for
25 min.The gel was rinsed with double distilled water, fixed 15 min in fixing solution and dried in
a hot air current ,then, stained in the staining solution (acid violet, 2g/l asetic acid 10%,water 90%)
for 15 min and cleared by repeated washing in the de-staining solution (acetic acid, 10ml; ethanol
95%,350ml; water up to 11).After drying in the hot air the amount of each protein fraction was
calculated.
RESULTS
Bacteria isolated from the mastitic cows included the usual range of pathogens. The isolates
from subclinical mastitis cases were coagulase negative staphylococci (40%), staphylococcus aureus
and corynebacterim bovis (each 12%), streptococcus spp. (6%), Serratia marcescens, Enterobacter
aerogenes and Proteus spp. (each 4%). 18% from subclinical mastitis cases showed no growth on
bacteriological examination.
Clinical mastitis cases had the following bacteria isolated from them: taphylococcus aureus
(26%), coagulase negative staphylococcus (18%), streptococcus spp.(10%), corynebacterium bovis
and E.coli (each 8%), Pasteurella multocida (6%), Bacillus cereus and Arcanbacterium pyogenes
(each 4%). 16% from clinical mastitic cases showed no growth on bacteriological examination. The
somatic cell count in milk from quarters with subclinical and clinical mastitis were significantly
(P<0.01) greater than in the milk of the control cows, also was significant difference between each
four mastitic groups (P<0.01). (Table 1).
The level of albumin in affected group did not differ from control group (P> 0.05). there was
considerable difference between CMT 2+ group and control group in Alpha-1 fragment (P<0.05).
Alpha-2 fragment showed meaningful difference in both mild and moderate clinical groups (P<0.05),
but there was no difference in subclinical mastitis groups. Considerable difference was only observed
in moderate group relative to control group in Beta 1 fragment (P<0.05). Other affected groups did
not show any significant difference.
There was meaningful difference between CMT3+ and control group in gamma-1 fragment
(P>0.05) but other affected groups did not show any meaningful difference relative to control group.
Any meaningful difference have not been considered between affected group and control group in
gamma 2 fragment (P>0.05).
Table 1: Mean concentration of protein fractions in plasma in different groups (Mean ± SE, gr/dl)
Groups Albumin
α1 α2 β1 β2 γ1 γ2
Control 2.98±0.35 0.44±0.2 0.6±0.2 0.19±0.12 0.57±0.1 1.27±0.19 1.48±0.32
CMT 2+ 2.66±0.47 0.66±0.22* 0.73±0.14 0.33±0.27 0.63±0.19 1.62±0.4 1.99±0.57
CMT 3+ 2.55±0.46 0.55±0.1 0.81±0.2 0.29±0.08 0.71±0.15 1.96±0.42* 2.12±0.43
Mild 2.84±0.17 0.41±0.09 0.96±0.2* 0.43±0.29 0.73±0.27 1.66±0.44 1.77±0.62
Moderate 2.43±0.8 0.45±0.16 0.95±0/32* 0.52±0.31* 0.78±0.35 1.59±0.35 1.64±0.53
*: Significant difference with control group (P<0.05)
DISCUSSION
The bacteriological results from the subclinical cases was showed coagulase negative staphylococci
(CNS) were most frequent isolate bacteria. CNS organisms, group of staphylococcal species, have
become the predominant pathogens causing bovine mastitis in many countries (Pitkala et al., 2004).
Although the CNS usually cause only subclinical or mild clinical mastitis, they are harmful since
they increase somatic cell count (SCC) in milk (chaffer et al., 1999) and may slightly decrease
milk production (Timms and Schultz, 1987). Mastitis caused by CNS responds well to antimicrobial
treatment (McDougall, 1998). Staphylococcus aureus was the next more causative organisms of
subclinical mastitic cows. Staphylococcus aureus still as one of the most infectious agents which
produces mastitis in cattle. Other bacteria that was often isolated corynebacterium bovis. C.bovis
are generally considered as opportunistic pathogens and inhabitants of teat canals (Rainard, 1987).
The infection causes minor hispathological alterations in the udder parenchyma without affecting
the secretory function of the tissue. Environmental streptococci from 6% of subclinical and 10% of
clinical mastitis were isolated. In countries where the prevalence of intramammary infections due to
the contagious pathogens has been reduced or eradicated, the proportion of intramammary infections
associated with environmental streptococci has increased markedly (Radostits et al., 2007). The
bacteriological results from the clinical cases of mastitis shows the staphylococcus aureus is the most
frequent organism. S.aureus is ubiquitous in the environment of dairy cattle. The infected mammary
gland of lactating cows is the major reservoir and source of the organism. Transmission between
cows occurs at the time of milking by contaminated milker’s hands and teat cup liners (Radostits et
al., 2007).
Inflammation of the mammary gland leads to a variety of compositional changes in milk either
because of local effects or because of serum components entering the milk and the movement of
some normal milk components out of the alveolar lumen into the perivascular space (Harmon 1994).
Theoretically, all changes in mammary secretion during inflammation might be used to measure
the effects of mastitis, but problems of instrumentation and standardization have prevented farm
application of most tests. In dairy herds, mastitis is a production disease of major importance. Cows
with clinical signs of mastitis are easily spotted by farmers and proper treatment can be applied.
However, subclinical infections may not be observed and remain untreated. Cow-side tests, such as
the California Mastitis Test, are available but laboursome and time consuming if applied to a large
number of animals (Petersen et al., 2004). For the screening of herds, the somatic cell counts (SCC) are
used despite the fact that high levels do not necessarily reflect mastitis. In order to detect subclinical
infections, APP might be applied. For a test be useful in routine investigations for mastitis, it is
important that it can be applied to milk samples which are readily available than serum or plasma.
Plasma albumin concentration is higher than other proteins, so that 55-66 percent of plasma
total protein consists of albumin. Synthetic albumin level in liver corresponds to nutrition and its
concentration in plasma. Because of small size, albumin is easily observable in urine relative to
other proteins in glomerular damages. Albumin decreases in liver disease, inflammatory states,
malnutrition and urinary secretion. It is not valuable to diagnosis alpha 1 globulin increase in animals
while Alpha 2 globulin increase indicate important sign of acute inflammatory disease. It mostly
belongs to acute phase protein. Beta globulin increase is not solely high in animals. It is usually seen
in active liver disease, infectious skin damages and sometimes it is observed in nephritic syndrome.
Gamma globulin increase in chronic inflammatory diseases like chronic liver inflammation, liver
abscess, septic diseases, and immunologic diseases. The results of plasma proteins fragment study
showed that there is no meaningful statistical difference between treatment and control groups in
albumin level (P>0.05). Albumin is a negative acute phase protein, and it is reduced in infections and
inflammatory states.
In current study, albumin average level is lower in mastitis suffering cows, than healthy cows. But
this reduction did not lead to meaningful statistical difference among groups. There was meaningful
difference between clinical mastitis suffering group and treatment group in Alpha 2 fragment.
According to this fact that the main acute phase proteins in cows are in this fragment from increase
in haptoglobulin, serum amyloid a point of view, this considerable difference is explained easily. So
haptoglobulin level increase related directly to inflammation severity. Meaningful difference between
moderate mastitis suffering group and control group was considered in Beta 1 fragment (P>0.05).In
spite of higher average protein level in affected group, there was no meaningful difference in Beta 2
fragment (P>0.05).
There was meaningful difference between CMT3+ and control group in gamma 1 fragment.
This difference was not related to severity and inflammation level of course, in other group’s, in
spite of meaningful difference, gamma 1 fragment average was higher treatment group. In study
of gamma 2 fragment, according to this fact that protein average level was high in affected group
relative to control group meaningful difference was not considered. In conclusion, regarding to the
results obtained this is what understood, with increasing the inflammation and infection intensity, the
increase in proteins amount, especially in alpha-2 and beta-1 bounds are significant .
REFERENCES
Booth, J.M., 1997. Is mastitis being reduced in the 1990s? cattle pract. 5, 61-65.
Chaffer, M., G.Leitner, M. Winkler and A. Glickman, 1999. Coagulase- negative staphylococci and mammary
gland infections in cows. J. Vet. Med. B 46, 707-712.
Chassagne, M., J. Barnouin and J.P. Chacornac, 1998. Biological predictors for early clinical mastitis occurrence
in Holstein cows under filed conditions in france. Prev. Vet. Med., 35: 29-38.
Conner, J.G., P.D. Eckersall, M. Doherty and T.A. Douglas, 1986. Acute phase response and mastitis in the cow.
Res. Vet. Sci., 41: 126-128.
De Graves, F.J. and J. Fetrow, 1993. Economics of mastitis and mastitis control.Vet. Clin. North. Am. Food
Anim. Pract., 9: 421-434.
Eckersall P., F.J. Young, C. Mc comb,C.J. Hogarth, S. Safi, A. Weber, T. McDonald, A.M. Noland and J.L.
Fitzpatrick, 2001. Acute phase proteins in serum and milk from dairy cows with clinical mastitis. Vet. Rec.,
148: 35-41.
Giesecke W.H. and M.H. Vilijoen, 1974. The diagnosis of subclinical mastitis in lactating cows: a comparison of
cytological methods and a monovalent radial immuodiffusion test. J. Vet. Res., 41: 51-74.
Hirvonen, J., S. Pyorala and H. Jousimies- Somer, 1996. Acute phase response in heifers with experimentally
induced mastitis. J. Dairy Res., 63: 351-360.
Mc Dougall, S., 1998. Efficasy of two antibiotic treatments in curing clinical and subclinical treatments in
curing clinical and subclinical mastitis in lactating dairy cows. N.Z. Vet., 46: 226-232.
Menzies, F.D., D.G. Brison, T. Mccallion, and D.I. Mathews, 1995. A study of mortality among suckler and
dairy cows in Northern Ireland. Vet. Rec., 137: 531-536.
Murata, H., N. Shimada and M. Yoshika, 2004. Current research on acute phase proteins in veterinary diagnosis:
an overview. Vet. J., 168: 28-40.
Petersen, H.H., J.P. Nielsen, P.M.H. Heegard, 2004. Application of acute phase protein measurements in
veterinary clinical chemistry. Vet. Res., 35: 163-187.
Pitkala, A., M. Haveris, S. Pyorala, V.Myllys and T. Honkanen Buzalski, 2004. Bovin mastitis in finland 2001-
prevalence, distribution of bacteria, and antimicrobial resistance.J. Dairy. Sci., 87: 2433-2442.
Pyorala, S., 2003. Indicators of inflammation in the diagnosis of mastitis. Vet. Res., 34: 565-578.
Quinn, P.J., M.E. carter, B.M. Maarkey and G.R. Carter, 1994. Clinical Veterinary Microbiology. Wolfe
Publication company, UK, PP: 327-344.
Radostits, O.M., C.G. Gay, K.W. Hinchcliff and P.D. Constable, 2007. Veterinary medicine. 10th ed. Saunders
publication company, UK, PP: 697-721Rainard, P., 1987. Shoud mammary infections caused by
corynebacterium bovis and coagulas – negative staphylococci be eliminated?Ann. Rech. Vet, 18: 355-364
Sears, P.M. and K.K. Mccarthy, 2003. Diagnosis of mastitis for therapy decisions. Vet. Clin. North Am. Food
Anim., 19: 93-108.
Thomas, J.S., 2000. Over view of plasma proteins. In: Feldman, B.F., J.G. Zinkl and N.C. Jain (Eds.), Schalm’s
veterinary Hematology, fifth edition. Lippincott Williams, Wilkins, Philadelphia: 891-898.
Timms, L.L., L.H. Schultz, 1987. Dynamics and significance of coagulase – negative staphylococcal intra
mammary infections. J. Dairy Sci., 70: 2648-2657.
Tyler, J.W. and J.S. Cullor, 1990. Mammary gland health and disorders. In large animal internal medicine. 3rd
Edn. (Eds. By smith BP), Mosby, London: 1019-1022.
SECONDARY COPPER DEFICIENCY IN CATTLE FROM
MOLYBDENUM INTOXICATION: CLINIC AND PATHOLOGICAL
STUDY.
[HIPOCUPROSIS BOVINA SECUNDARIA A MOLIBDENOSIS: ESTUDIO

CLÍNICO, HISTOPATOLÓGICO Y HEMATOLÓGICO
Sekundarna deficijencija bakra u goveda otrovanih

molibdenom: Klinički i patološki nalaz
Bustamante Cano J1, Hernández Arroyave W.2, Gutiérrez Chávez A. J.3, Alonso Alonso
P.3, González Montaña J.3
1
Facultad de Ciencias Agrarias. Universidad de Pamplona. Pamplona (Colombia)
2
Escuela de Medicina Veterinaria y Zootecnia. Universidad de la Paz. Barrancabermeja (Colombia)
3
Departamento de Medicina, Cirugía y Anatomía Veterinaria. Universidad de León. León (España)
SUMMARY
Copper deficiency in cattle it’s the second important disease only after of phosphorus around the world,
especially in grazing conditions. There are two types of copper disorder, one for molybdenum-induced followed
for their interaction with iron (Fe), sulphur (S) and zinc (Zn) and direct copper deficiency. In Colombia region,
soils and grass have high concentrations of molybdenum and frequently to observe toxicosis cases caused for
this element. However, there are few clinical reports about this condition in this country. Therefore, the objective
for this work is described the clinic and pathological findings and changes observed in secondary copper
deficiency. All animals are reared in extensive conditions with local pastures, water and common salt. Soils
have not been applied some fertilization treatment. It was observed in some animals poor growth rates, infertility
and reproductive failure. In a lot of sixty Zebu crossbred female and males animals between 2 and 3 years old
were observed clinical signs suggested for copper deficiency. It was chosen three females and three males for
pathology study. Soil and forage samples were taken for determined molybdenum and copper levels by mean
Atomic Absorption Spectrophotometer (AAS). Some clinical signs as poor growth rates, achromotrichia, fragile
skeletal systems, anemia, infertility and reproductive failure were recorded for these animals. In four of six
animals it was observed a decrease of blood cell pack and hemoglobin concentrations. Histopathology changes
as slimming of epidermis atrophy in hair follicles and sebaceous glands, hepatic sinusoids were engorged with
blood. Most hepatocytes were degenerate or necrotic with eosinophilic cytoplasm, glomerular congestion and
lymphocyte infiltrate in parenchyma and cortex kidney. Molybdenum and copper concentrations in soil and
forage in dry season were 3.9 mg/kg and 9.0 mg/kg, respectively. Copper and molybdenum high concentrations
in soil and forage with additional information about clinic and pathological findings observed and recorded in this
study suggested the presence of secondary copper deficiency was induced for previous molybdenum toxicosis.
The bovines with symptoms were quickly recovered with copper borogluconat treatment by subcutaneous
route.
Sažetak
Nedostatak bakra u goveda je po važnosti druga bolest nakon nedostatka fosfora . Rasprostranjena je diljem
svijeta posebno u pašno držanih goveda.Postoje dva tipa poremećaja u metabolizmu bakra, prvi je uzrokovan
molibdenom, a drugi je uzrokovan zbog djelovanja iona željeza, sumpora i cinka.U regiji Columbia, zemlja i
trave sadrže visoke koncentracije molibdena i često uzrokuju otrovanja tim elementom. Zbog toga, ovaj rad
opisuje kliničke i patološke nalaze koji su utvrđeni kod sekundarne deficijencije bakra. Sve životinje su držane
u ekstenzivnim uvjetima pri čemu su se hranile sa autohtonom vegetacijom uz dodatak mineralnih soli. U
pojedinih životinja primjećeno je zaostajanje u rastu, neplodnost i problemi u reprodukciji. U populaciji od 60
križanih Zebu goveda različiog spola, u dobi između 2 i 3 godine starosti zamijećeni su klinički simptomi koji su
upućivali na nedostatak bakra.Za istraživanje odabrne su po tri jedinke muškog i ženskog spola. Uzeti su uzorci tla
i krme za utvrđivanje koncentracije molibdena i bakra pomoću atomske apsorpcijske spektrofotometrije(AAS).
Kod ispitivanih životinja zamijećena je kržljavost, akronotrihia, anemija, fragilan koštani sustav, neplodnost te
reproduktivne poremetnje. Kod 4 od 6 životinja primjećen je smanjen volumen krvnih stanica i koncentracija
hemopglobina. Patohistološke promjene ukjlučivale su atrofiju epidermisa, dlačnih folikula i žlijezda lojnica,
a jetrene sinusoide bile su prepunjene krvlju. Većina hepatocita bilo je degenerirano ili nekrotično , primjećena
je i kongestija glomerula i limfocitna infiltracija parenhima i srži bubrega. Utvrđena koncentracija molibdena
i bakra u tlu i krmi za vrijeme sušne sezone iznoslia je 3.9 mg/kg za molibden i 9.0 mg/kg za bakar. Visoke
koncentracije bakra i molibdena u tlu i krmi zajedno sa kliničkim i patohistološkim nalazima ukazuju na
sekundarnu deficijenciju bakra. Životinje sa simptomima otrovanja brzo su se oporavile nakon potkožne
aplikacija bakar-boroglukonata.
RESUMEN
En los rumiantes las deficiencias de cobre, después de las de fósforo, son las más frecuentes a nivel
mundial. La absorción del cobre se ve antagonizada por algunos microminerales, siendo quizá el moblideno
(Mo) el más importante, seguido del hierro (Fe), azufre (S) y zinc (Zn). Por ello en muchas ocasiones las
concentraciones elevadas de molibdeno, frecuentemente, desembocan de forma secundaria en hipocuprosis. En
algunas zonas de Colombia la intoxicación en bovinos en pastoreo por concentraciones excesivas de molibdeno
en el suelo es muy alta, aunque apenas existen estudios sobre la patología en este país. Por ello el objetivo
del presente trabajo es describir el cuadro clínico, los cambios hematológicos y las lesiones histopatológicas
halladas en algunos órganos. Todos los bovinos del hato, de raza cebú comercial, eran explotados de forma
extensiva, en praderas naturales y sin ningún programa de fertilización, disponiendo de forma permanente tanto
de agua como de sal común. La mayoría del ganado presentaba mal estado de carnes y diarrea, deficiencias
reproductivas y las hembras alcanzaban su madurez sexual tardíamente. Se seleccionaron 60 cebuinos, de ambos
sexos, con edades de dos y medio a tres años, que presentaban sintomatología compatible con molibdenosis y
de ellos se escogieron seis animales (tres machos y tres hembras) en los que se cuantificó el hematocrito y la
hemoglobina. Posteriormente se sacrificaron y se recogieron algunos órganos para el correspondiente estudio
histopatológico. Asimismo, mediante espectrofotometría de absorción atómica, se midieron las concentraciones
de molibdeno y cobre en suelo y en pastos. Los signos clínicos hallados en los animales enfermos fueron
diarrea profusa, enflaquecimiento progresivo, retardo en el crecimiento, disminución en el porcentaje de
fecundidad, dolores articulares y acromotriquia. Cuatro de los seis bovinos que fueron sacrificados presentaron
disminución en el hematocrito y en la hemoglobina, y se evidenciaron cambios histopatológicos tales como
adelgazamiento de epidermis, atrofia de anexos, folículos pilosos y glándulas sebáceas, tumefacción turbia
de hepatocitos, hiperplasia de células de Pkuffer, presencia de polimorfonucleares en sinusoides, congestión
glomerular, descamación del epitelio tubular renal y focos linfocitarios en el parénquima cortical renal. n la
época seca, en la cual se realizó el estudio, la cantidad de moblideno en el suelo fue de 3,9 ppm, mientras que el
pasto su concentración fue de 9 ppm. La valoración de las concentraciones de Cu y Mo en suelo, acompañada
de los signos clínicos y de los hallazgos hematológicos e histopatológicos permiten concluir se trata de una
hipocuprosis secundaria a una molibdenosis. Es importante destacar que el resto de animales afectados que
presentaron sintomatología respondieron positivamente al tratamiento con borogluconato de cobre por vía
subcutánea, recuperándose rápidamente.
Sažetak
Copper deficiency in cattle it’s the second important disease only after of phosphorus around the world,
especially in grazing conditions. There are two types of copper disorder, one for molybdenum-induced followed
for their interaction with iron (Fe), sulphur (S) and zinc (Zn) and direct copper deficiency. In Colombia region,
soils and grass have high concentrations of molybdenum and frequently to observe toxicosis cases caused for
this element. However, there are few clinical reports about this condition in this country. Therefore, the objective
for this work is described the clinic and pathological findings and changes observed in secondary copper
deficiency. All animals are reared in extensive conditions with local pastures, water and common salt. Soils
have not been applied some fertilization treatment. It was observed in some animals poor growth rates, infertility
and reproductive failure. In a lot of sixty Zebu crossbred female and males animals between 2 and 3 years old
were observed clinical signs suggested for copper deficiency. It was chosen three females and three males for
pathology study. Soil and forage samples were taken for determined molybdenum and copper levels by mean
Atomic Absorption Spectrophotometer (AAS). Some clinical signs as poor growth rates, achromotrichia, fragile
skeletal systems, anemia, infertility and reproductive failure were recorded for these animals. In four of six
animals it was observed a decrease of blood cell pack and hemoglobin concentrations. Histopathology changes
as slimming of epidermis atrophy in hair follicles and sebaceous glands, hepatic sinusoids were engorged with
blood. Most hepatocytes were degenerate or necrotic with eosinophilic cytoplasm, glomerular congestion and
lymphocyte infiltrate in parenchyma and cortex kidney. Molybdenum and copper concentrations in soil and
forage in dry season were 3.9 mg/kg and 9.0 mg/kg, respectively. Copper and molybdenum high concentrations
in soil and forage with additional information about clinic and pathological findings observed and recorded in this
study suggested the presence of secondary copper deficiency was induced for previous molybdenum toxicosis.
The bovines with symptoms were quickly recovered with copper borogluconat treatment by subcutaneous
route.
INTRODUCCIÓN
En todas las especies domésticas se ha descrito la presentación de efectos adversos por deficiencias
de Cu (Radostis y cols, 1994). Los rumiantes presentan con frecuencia concentraciones inadecuadas
de este elemento bajo una amplia diversidad de suelos, condiciones nutricionales y climáticas. Se
considera que las deficiencias de Cu son las segundas mas frecuentes en los rumiantes en todo el
mundo después del fósforo (Wikse y cols, 1992).
La carencia de este microelemento posee incidencia geográfica y ocasiona serias pérdidas
productivas en sistemas extensivos de cría bovina basados en el consumo de pasturas naturales
(Rearte, 2004; Underwood, 1997).
En los suelos de Colombia se presenta una deficiencia generalizada de cobre. De más de 500
suelos analizados por el INPEC, el 68% presentaba un contenido deficiente de este microelemento.
Estudios realizados por el Instituto Colombiano Agropecuario en la región del litoral Atlántico y en el
Valle del Magdalena Medio, demostraron la existencia de bajos niveles de cobre debido a deficiencia
primaria o secundaria (Bernal 2000, De la Cruz 1983).
Como otras deficiencias minerales, la hipocuprosis puede ser causada por un bajo aporte del
elemento en la dieta, deficiencia primaria, o bien puede ocurrir que ese aporte sea adecuado pero
que otros factores de la dieta interfieran con el aprovechamiento del Cu ingerido, en cuyo caso se
puede referir a una deficiencia secundaria o condicionada (De Rosa 2002; Quiroz 2000). En los
rumiantes, el Cu es el microelemento que mayor número de antagonistas presenta. Uno de ellos,
quizás el principal, es el molibdeno (Mo), seguido del hierro (Fe), azufre (S) y zinc (Zn) (Gooneratne
1997; Humphires y cols 1983, Keen y Graham 1989). Cuando existen concentraciones elevadas
de molibdeno, frecuentemente se presentan casos de hipocuprosis (Humphires y cols 1983). El
mecanismo por el cual se presenta esta interferencia es principalmente a nivel de rumen por la
formación de compuestos (thiomolibdatos) que se unen al Cu impidiendo su absorción (Gooneratne
1997; Humphires y cols 1983).
Son descritos varios signos clínicos en la hipocuprosis tales como anemia, infertilidad variable,
diarrea, acromotriquia, mala estructura de lana, predisposición a enfermedades infecciosas, crisis
hemolíticas, úlceras abomasales, polioencefalomalacia, claudicación, mala condición corporal,
disminución en la ganancia de peso y muerte súbita (E.E. A INTA 2004; NRC 1999).
Las plantas utilizadas como forrajes contienen en promedio de 8 a 11 ppm de Cu y de 3 a 5
ppm de Mo (en M.S.). Se ha comprobado que aparece molibdenosis cuando, encontrándose normal
el valor de cobre en los vegetales, el contenido de molibdeno en la planta se eleva de 6 a 10 ppm
(Radostits y cols, 1994).
MATERIAL Y MÉTODOS
En una explotación dedicada a la cría de ganado, localizado en el municipio de Yondó, Antioquia,
Colombia (75 m altitud) con una temperatura promedio entre 26ºC y 35ºC, con una humedad relativa
superior al 85% y una pluviosidad de mas de 2500 mm/año, correspondiente a bosque húmedo
tropical, se seleccionaron seis animales (tres machos y tres hembras), entre dos y medio y tres años
de edad, de un total de sesenta bovinos de la raza cebú comercial.
Estos bovinos eran manejados en sistema de producción extensiva, en praderas naturales sin
ningún programa de fertilización. La sal común (ClNa) y el agua estaban a disposición permanente
para todos los animales.
Casi todos los bovinos presentaban mal estado de carnes y diarrea. El estado reproductivo del
hato era muy bajo y las hembras alcanzaban su madurez sexual tardíamente. A estos animales se
les realizaron exámenes clínicos y a las hembras adultas se les practicó un chequeo ginecológico, a
través de palpación rectal. Adicionalmente fue realizado un examen de hemoparásitos y muestreo de
materia fecal para determinar la carga parasitaria.
Tras el examen clínico, medición del hematocrito y hemoglobina y de realizado el examen
parasitológico, se sacrificaron los seis bovinos y les fue practicado un estudio histopatológico.
Igualmente se tomaron muestras de suelo y fueron enviadas al laboratorio del Instituto Colombiano
Agropecuario (ICA), ubicado en Tibaitatá (Cundinamarca) para la cuantificación de molibdeno y
cobre a través de la técnica de espectrofotometría de absorción atómica (EAA).
En una fincas cercanas, donde las condiciones de manejo eran similares, se seleccionados al
azar 16 cebú, de un grupo de 50 bovinos machos de raza cebú comercial, y con edades entre 30 y 34
meses.
Cuantificación de cobre en el suero de los bovinos
Para la obtención del cobre sérico, a cada uno de los 16 bovinos le fueron extraídos 10 ml de
sangre sin anticoagulante mediante venopunción en yugular. Las muestras de sangre fueron remitidas
inmediatamente laboratorio de la Universidad Industrial de Santander, en Bucaramanga, donde luego
fueron centrifugadas a 3000 rpm para la separación del suero. La determinación del cobre sérico
se realizó, utilizando la técnica de espectrofotometría de absorción atómica, obteniendo valores
expresados en µmol/l.
Cuantificación del cobre en hígado
Para la cuantificación de los niveles de Cu en hígado los 16 bovinos fueron marcados y rastreados
hasta el matadero municipal. Allí se obtuvieron fragmentos de hígado, aproximadamente de 2 cm
de espesor, de cada animal. Estos fragmentos fueron conservados para su posterior procesamiento,
utilizando la técnica de espectrofotometría de absorción atómica, expresando los valores resultantes
en pates por millón (ppm).
Cuantificación de cobre y molibdeno en el suelo en el municipio de Yondó
Se tomaron muestras del suelo de varias fincas, en el municipio de Yondó, para cuantificar
los niveles de cobre y de molibdeno. Las muestras fueron enviadas al laboratorio del Instituto
Colombiano Agropecuario (ICA) localizado en Tibaitatá (Cundinamarca). Se utilizó la técnica de
espectrofotometría de absorción atómica con horno de grafito y se expresaron los valores en ppm.
Determinación de Cobre y Molibdeno en forrajes
Para la cuantificación de niveles de Cu y Mo en los forrajes de las fincas en estudio, se
tomaron muestras representativas tanto de gramíneas como de leguminosas que sirven como base
de la alimentación para los bovinos objeto de estudio y fueron procesadas aplicando la técnica de
espectrofotometría de absorción atómica en el laboratorio del Instituto Colombiano Agropecuario en
un equipo Perkin – Elmer con lámpara de cátodo hueco, reportando sus valores en mg/kg (ppm). Para
la recolección del material vegetal se emplearon bolsas plásticas con sellado hermético y se enviaron
refrigeradas con el fín de evitar la fuga de algún material volátil. El material vegetal fue recolectado
en las horas de la mañana y se guardó en refrigeración hasta el momento de su análisis.
CASO CLINICO
Casi la totalidad de los animales del hato, correspondiente al municipio de Yondó, presentaron
mal estado de carnes, con pelaje amarillento y mucosas pálidas. Además mostraron diarrea profusa,
de color oscuro y con espuma abundante. La diarrea se agudizó en los periodos con abundantes
lluvias. Algunos animales presentaban adelgazamiento extremo, sin embargo ninguno de los bovinos
estudiados presentó anorexia.
Tabla 1. Hallazgos histopatológicos en los bovinos del estudio en el municipio de Yondó.
Tejido Alteración microscópica nº de casos

Piel Adelgazamiento de epidermis 6
Atrofia de anexos folículos pilosos y glándulas sebáceas 6
Hiperplasia de células de Pkuffer 3
Hígado Tumefacción turbia de hepatocitos 4
Presencia de polimorfonucleares en sinusoides
6
Congestión glomerular
6
Riñón Descamación epitelio tubular hacia la luz
6
Focos linfocitarios en parénquima cortical
6
Inflamación aguda
6
Bazo Alta concentración de hemosiderina
2
El examen ginecológico, realizado por palpación rectal, reveló deficiente actividad ovárica.
La mayoría de las hembras adultas presentaron un útero de tamaño muy pequeño y no mostraban
manifestaciones propias del celo. El porcentaje de preñez era inferior al 50%.
Los frotis sanguíneos para evaluar hemoparásitos dieron resultados negativos, así como el resto
exámenes parasitológicos que no evidenciaron de carga parasitaria alguna.
El examen sanguíneo (de los 6 cebú) reveló una disminución del hematocrito en cuatro de ellos
(20%, 23%, 23% y 20%) y una reducción en la hemoglobina (6,6 mg/dl, 7,0 mg/dl, 6,7 mg/dl y 6,0
mg/dl) respectivamente.
Ante la sospecha de una posible hipocuprosis y como ensayo terapéutico, algunos bovinos del
rebaño fueron tratados con cobre vía parenteral, obteniéndose la desaparición de la diarrea dos días
después de la aplicación.
Durante la necropsia no fueron encontradas lesiones macroscópicas relevantes. En la tabla 1 se
puede apreciar como los cambios mas frecuentemente se localizaron en piel, hígado, bazo y riñón.
La medición de cobre y de molibdeno en el suelo de las fincas estudiadas arrojó una concentración
de 4,57 ppm y de 3,90 ppm, respectivamente. La concentración media del cobre en pasto fue de 10
ppm (resultado de los niveles obtenidos en los diferentes pastos muestreados).
DISCUSIÓN
Los resultados del examen clínico practicado a los bovinos, asociados a los hallazgos de las
necropsias, invitan a pensar que estos animales estaban padeciendo una deficiencia de cobre. La
alta concentración de molibdeno, presente en los suelos de la zona donde se realizó este estudio,
implica un alto consumo de este mineral por parte de los animales, dada la interrelación suelo - planta
– animal para cada elemento en particular.
En general el cuadro clínico presentado por los bovinos, es coincidente con el comunicado por
otros autores acerca de la hipocuprosis secundaria a molibdenosis (Balbuena y Mastandrea 1992;
Brem y cols 2002; Quiroz y Bouda 2000).
Es importante destacar el mal estado de carnes presentado por la mayoría de los animales, e incluso
con adelgazamiento extremo en algunos casos, a pesar de la exuberancia de las pasturas. Similares
condiciones corporales fueron observadas en recientes estudios al provocar experimentalmente
una hipocuprosis al suministrar molibdeno, en forma oral, en bovinos de raza Brangus (Brem et al,
2002).
La presentación del cuadro diarreico, con heces de coloración verde oscura y presencia de
espuma, es frecuentemente observada en la hipocuprosis secundaria ocasionada por un exceso de
molibdeno. Se mencionan dos mecanismos fisopatologicos, una atrofia acinar pancreática debida
a la excesiva peroxidación de los lípidos de membrana y la infiltración de proteasas séricas o bien
una alteración en la conformación de la mucosa intestinal. La lisil oxidasa participa en la síntesis de
colágeno y elastasa, por lo que su deficiencia causa una mala conformación del tejido; además, la
disminución de citocromo oxidasa promueve la atrofia de vellosidades (Suttle 1986).
La acromotriquia posiblemente se debe a la deficiencia de cobre en el organismo. Es conocido
que el cobre es necesario en la síntesis de la polifenil oxidasa tirosinasa. Esta enzima es utilizada en
la transformación de la tirosina en melanina y dopamina. La melanina es responsable del color de la
piel y del pelo. En la hipocuprosis el pelo de color negro se torna rojizo, mientras que los pelajes rojos
adquieren un aspecto amarillento (Grace 1994).
La anemia observada, en estos bovinos, es coincidente con la hallada por otros autores (Brem y
cols 2002; Humphires y cols 1983; Quiroz y Bouda 2000) y puede ser ocasionada por la deficiencia
de cobre; pues este elemento participa de manera crucial en el metabolismo del hierro, fundamental
para la formación de hemoglobina principal componente del eritrocito (Balbuena y Mastandrea 1992;
Quiroz y Bouda 2000). Cuando la hemoglobina disminuye, se limita la absorción del cobre, así como
su contenido total en el cuerpo y por tanto se ven la movilización a los tejidos se ven disminuidas. El
hierro se absorbe como Fe++ y se transporta como Fe+++, pero esta conversión requiere de una enzima
dependiente del cobre, la ferroxidasa II (Tanner y cols 1988; Tocarnia 1968). El resultado final, es
una anemia microcítica hipocrómica grave.
Aunque todavía es incierto el papel de la hipocuprosis en la infertilidad, se ha sugerido que el
problema es debido más al aumento de molibdeno que a la deficiencia primaria de cobre. Sin embargo,
existen informes que señalan a la hipocuprosis secundaria a la molibdenosis como causa directa de
problemas en la fertilidad (Phillipo 1987). Entre los efectos adversos que causa la hipocuprosis está
la alteración de la duración del ciclo estral llegando a veces al anestro, retrasos en la pubertad,
alteraciones en la ovulación, presencia de ovarios quísticos y reducción de los índices de concepción
(Brem y cols 2002; Graham 1991; Under 1997). La reducción o supresión del estro y la muerte
embrionaria han sido identificadas como síntomas comunes en la deficiencia de cobre en ganado
de carne (Underwood 1997; Suttle 1986). En un estudio reportado por Phillipo et al (1987) novillas
consumiendo una dieta con niveles marginales de Cu y altas en molibdeno exhibieron retraso en la
pubertad, baja índices de ovulación y baja tasa de concepción comparadas con novillas que recibieron
una dieta conteniendo altos niveles de cobre. Igualmente, en estudios realizados en la región del
nordeste argentino en suelos ricos en molibdeno, el suministro de cobre vía oral a novillas provocó
resultados muy positivos sobre la fertilidad (De Rosa 2002). En la misma línea, en Cuba, se demostró
que la aplicación de cobre en ganado lechero afectado de hipocuprosis mejoró ostensiblemente la
fertilidad de las hembras (Garcia y cols 2006).
Los hallazgos anatomopatológicos indican alteraciones provocadas por una deficiencia de cobre
(Blakley 1987; Graham 1991; Gooneratne 1989). En este sentido Tokarnia et al (1987) describen
hemosiderosis en hígado, bazo y ganglios linfáticos de bovinos con deficiencia de cobre.
Por tanto, bajo las condiciones de este estudio, es posible señalar que el cuadro clínico, los hallazgos
histopatológicos y los cambios hematológicos encontrados en los bovinos en el municipio de Yondó
corresponden a una hipocuprosis secundaria a molibdenosis. Además, las altas concentraciones de
molibdeno encontradas en el suelo de este municipio, pueden estar reafirmando este diagnóstico.
Como hemos indicado la concentración media del cobre en pasto fue de 10 ppm, alterándose
la normal relación que según algunos autores (Radostits y cols, 1994; de Rosa, 2002) debe tener
normalmente el suelo y las plantas (Cu:Mo 2:1).
BIBLIOGRAFIA
Balbuena O, Mastandrea R. Clinical symptoms of cattle grazing on melilutus alba with high molybdenum
concentration in the central Chaco area. Vet Arg. 1992; 9: 612-615.
Bernal J. El cobre en los suelos, pastos y animales. Asociación Colombiana de Criadores de Ganado Cebú. 2000;
315: 28 – 33.
Blakley BR, Hamilton, DL. The effect of copper deficiency on the immune response in mice. Drug Nutr Interact
1987; 5: 103-111
Brem JJ, Mestre J, Pochon D.O, Trulls HE. Alteraciones del ciclo estral provocadas por un alto ingreso de
molibdeno en vaquillonas Brangus y su respuesta a la suplementación con cobre. Rev Vet Arg. 2002; 13:
2001-2002
De la Cruz ML, GIL A. Contenido de molibdeno y cobre en pastos y su relación con algunos tejidos y enzimas
del bovino en el litoral Atlántico Colombiano. Rev ICA 1983; 18: 279-281.
DE Rosa, Mattioli GA. Metabolismo y deficiencia de cobre en los bovinos. Analecta Veterinaria. 2002; 22: 7-
16.
E.E.A INTA. Animales sin cobre. Rev Brangus. 2004; 26:64-66.
Garcia J, Cuesta Mario, Pedroso R, Gutierrez M, Mollineda A, et al. Efecto del cobre sobre la reproduccion en
novillas lecheras de Cuba. Rev MVZ Cordoba. 2006; 11: 790 - 798.
Gooneratne SR, Buckley WT, Christensen DA. Review of copper deficiency and metabolism in ruminants. Can
J Anim Sci. 1989; 69: 819-845.
Gooneratne SR, Howell JMc, Gamthorne JM. Intracellular hepatic distribution of copper in normal and copper
loaded sheep. Res Vet Sci. 1997; 27: 30-37.
Grace N. Managing trace elements deficiencies New Zealand: Ag Research, New Zealand Pastoral Agriculture
Research Institute Ltd. 1994.
Graham TW. Trace element deficiencies in cattle. Vet Clin North Am: Food Anim Pract. 1991; 7: 153-215.
Hill R, Thambyah R, Wan SP, Shanta CS. The copper status of cattle and buffalo in Malaya. J Agric Sci. 1962;
59: 409-414.
Humphires WR, Phillippo M, Young BW, Bremner I. The influence of dietary iron and molybdenum on copper
metabolism in calves. Br Nutr. 1983; 49: 77-86.
Keen CL, Graham TW. Trace elements. In: Kaneko JJ, editor. Clinical biochemistry of domestic animals. 4th ed.
San Diego (Ca): Academic Press. 1989: 271-83.
NRC. Nutrient Requirements of Beef Cattle. 7th ed. National Research Council, National Academy Press,
Washington, DC; 1996.
Phillippo M, Humphries WR, Garthwaite PH. The effect of dietary molibdenum and iron on copper status,
puberty, fertility and estrous cycles in the cattle. J Agric Sci. 1987; 109: 321-336.
Quiroz-Rocha GF, Bouda J. Fisiopatología de las deficiencias de cobre en rumiantes y su diagnóstico. Vet Méx.
2000; 32: 289-296.
Radostis O.M, Blood D.C, Gay C.C. Veterinary Medicine 8th ed London (UK): Bailliêri Tindall. 1994.
Rearte D. Situación de la Ganadería Argentina. Instituto Nacional de Tecnología Agropecuaria, INTA. URL:
www.inta.gov.ar/expo/intaexpone/charlas.htm. 2004
Suttle NF. Problems in the diagnosis and anticipation of trace element deficiencies in grazing livestock. Vet Rec.
1986; 119: 148-152
Tanner DQ, Stedinick J.D, Leininger W.C Minimal herd sample size for determination of blood copper status of
cattle. J Vet Med Assoc. 1988;192: 1074-76.
Tokarnia CH, Canella CFC, Guimarães JÁ, Döbereiner J. Deficiência de cobre e cobalto em bovinos e ovinos
no Nordeste e Norte do Brasil. Pesq Agropec Bras. 1968; 3: 351-360.
Underwood EJ. Trace Elements in Human and Animals Nutrition. 4th ed. New York. Academic Press. 1997.
Under AP. Some nutritional factors affecting the fertility of dairy cattle. New Zealand Vet J. 1997; 25: 305-
308.
Wikse SE, Herd D, Field R, Holland P. Diagnosis of copper deficiency in cattle. J Am Vet Med Assoc. 1992;
200: 1625-29.
NEONATAL PERIOD AND HAIR CORTISOL IN CATTLE AS A MARKER
OF STRESs
NEONATALNO RAZDOBLJE I DLAČNI KORTIZOL U GOVEDA KAO

MARKER STRESA
Comin A.1, Tidu L.2, Cornacchia G.3, Cappa A.4, Renaville B.1, Prandi A.1
1
Dipartimento Scienze degli Alimenti, Sezione Fisiologia Veterinaria e Nutrizione, Università Degli Studi di
Udine, Italy
2
Centro Veterinario Militare Veterinary, Grosseto, Italy
3
Veterinary Mantova, Italy
4
Agronomist, Vicenza, Italy
ABSTRACT
Cortisol is a key component of the physiological response to stress. It is involved in several events during
peripartum period and it is very important for the beginning of parturition. The aim of this work was to test
cortisol in the hair of neonatal calves and cows to determine its significance as biomarker of neonatal stress. The
cortisol was assessed on new hair growth samples from 21 calves on the day of parturition and to six months
old; from 49 cows after the parturition and 257 non pregnant dry cows not exposed to stress and healthy
(controls). Hair cortisol was extract by methanol and analysis was carried out using the RIA method. The
hair cortisol concentration in calves on the day of parturition was significantly higher (P<0.0001) than at six
months (24.30 ± 2.18 vs 5.90 ± 0.56 pg/mg) and than controls (3.96 ± 0.16 pg/mg). The cortisol level in calves
at 6 months was similar than in cows after the parturition (5.74 ± 0.37 pg/mg) and significantly higher than in
controls. These results suggest that neonatal but also postnatal period in calves are very stressing conditions and
hair cortisol is a potential stress biomarker which could be very useful in valuate the cow welfare. Grant MIUR
2005
KEY WORDS: hair cortisol, stress, cattle
Sažetak
Kortizol je ključna komponenta fiziološkog odgovora na stres. On je uključen u nekoliko procesa tijekom
peripartalnog razdoblja, a veoma je bitan i za sam početak poroda. Cilj ovog rada bio je odrediti kortizol u dlaci
novorođene teladi te u krava kako bi se odredila njegova uloga biomarkera stresa u novorođenih životinja.
Kortizol je određivan na uzorcima novoizrasle dlake 21-og teleta, na dan poroda te nakon 6 mjeseci; na 49 krava
nakon poroda te u 257 negravidnih, zasušenih, zdravih krava neizloženih stresu (kontrola). Dlačni kortizol je
ekstrahiran metanolom, a analiza je učinjena RIA postupkom. Razina kortizola u dlaci teladi bila je znakovito
viša na dan poroda (P<0,0001), nego nakon 6 mjeseci (24,30 ± 2,18 vs 5,90 ± 0,56 pg/mg) i u kontrolnoj skupini
(3,96 ± 0,16 pg/mg). Razina kortizola u teladi nakon 6 mjeseci bila je slična kao u krava nakon poroda (5,74 ±
0,37 pg/mg) i znakovito viša nego u kontrolnoj grupi. Ovi rezultati ukazuju da je neonatalno kao i postnatalno
razdoblje u teladi veoma stresno stanje te je dlačni kortizol mogući biomarker stresa koji može biti veoma
koristan u procjeni stanja dobrobiti krava.
Ključne riječi: dlačni kortizol, stress, govedo
INTRODUCTION
Transition from pregnancy to lactation in dairy cow involves considerable metabolic adaptation
that induce stress in the animals. Many different hormones are involved in the stress response
(Matteri et al, 2000). Among these ones, cortisol is recognized as a stress hormone and is involved
in initiation of parturition and in various events during peripartum period. Indeed the timing of
parturition is dependent on a cascade of endocrine signals from fetal hypothalamo-pituitary-adrenal
axis (McMillen et al 1995) and it is a physiological event that involves stress in mother and calf.
As well neonatal period is a critical phase of the animal’s life cycle. In this period, the metabolic
adaptation which requires immediate changes in the endocrine regulatory molecules, would be
compromised by postparturient mastitis or other infections as well as by environmental changes as
social regrouping or relocation or by weaning. All these events are responsible of noticeable stress.
The concentration of cortisol is widely used an indicator of stress and the hormone is currently tested
in blood, saliva, urine and faeces (Negrao et al, 2004; Mostl et al., 2002; Hay et al., 1998). Blood,
saliva and urine collection needs manipulation of the animal which cause stress and might alter the
cortisol levels.in the samples.
An alternative source for hormones may be found in hair, which can be collected noninvasively.
Hair is easy to obtain, to store and to transport. The analysis is unaffected by the stress of capture
(Yang 1998) or by acute stress. Incorporation of hormones in hair is thought to occur mainly via
blood circulation during the formation of the hair shaft (Conn, 1996).
The measurement of cortisol in hair has already been validated in humans, rhesus macaques,
dogs and cats (Davenport et al., 2006; Accorsi et al, 2008; Villain et al., 2004). Since hair grows
approximately 0.4 cm/week, a hair sample of 2-4 cm reflect average hormone levels over months and
it is used to evaluate cortisol variations in the long-term and a condition of chronic stress.
The aim of this work was to measure cortisol in hair of neonatal calves and cows to determine
its significance as biomarker of neonatal stress.

The cortisol was assessed on new hair growth samples from 21 calves on the day of parturition
and to six months old; from 49 cows after the parturition and 257 non pregnant dry cows not exposed
to stress and healthy (controls).
The hair samples were carefully taken with clippers from the animal’s forehead. The calves were
shaved at birth and then six months later, always in the same area. The hair samples were stored
in dry tubes at room temperature until analysis. Hair strands were washed in 5 ml isopropanol, as
suggested by Davenport et al. 2006 and hair cortisol extraction was determined as described by
Koren et al. (2002), modified by Accorsi et al. (2007). Hair cortisol analysis was carried out using the
RIA method described by Tamanini et al. (1983). Intra-assay and inter-assay were 5.45% and 9.6%,
respectively. The sensitivity of the method was 0.21 pg/mg.
RESULTS
The concentrations of hair cortisol in newly born calves were very high (24.30 ± 2.18 pg /mg)
and significantly different (P <0.0001) than those detected in the same animals to six months old
(5.90 ± 0.56 pg /mg) (Figure 1). Hair cortisol in cows after the parturition (5.74 ± 0.37 pg/mg)
was similar to concentration in calves to six month old. The value in calves and in cow after the
parturition was significantly higher (P<0.001) with respect to levels detected in non pregnant dry cow
(3.96 ± 0.16 pg/mg) (Figure 2).
30
25
20
hair cortisol pg/mg
15
10 P<0.0001
0
c alv es at parturition s ix -month old c alv es
Figure 1. Hair cortisolo level in calves.
30
25
20
hair cortisol pg/mg
15
10 P<0.001
5
0
c ow at parturition non pregnant dry c ow s
Figure 2. Hair cortisolo level in cow.
DISCUSSION
In this study we used a new matrix for measurement of cortisol levels in cow. This assay has
limitations but also notable advantages associated with method of sample collection, storage and
sending. The hair hormone concentrations reflect average levels over month and non acute levels.
Hair cortisol level has potential as biological marker for chronic stress.
Critical phases of cows life cycle, which may induce stress, include neonatal period, postpubertal
reproduction and lactation. In this study we analyzed the hair cortisol levels in calves and cows on
the day of parturition and we compared them with those in non-pregnant dry cows. The non-pregnant
dry cows are animals not exposed to stress and healthy and can be considered a representative
control.
We haven’t chosen calves as control because, in high yielding dairy farms, during the first years
of life calves are subject to changes in biological state (weaning and puberty) and management.
Pregnancy and parturition can be considered a highly stressful period for the calves which contributes
to increase hypercortisolemia. The mechanism of labour coincides with a highly stressful time for
the calf. High cortisol concentrations found in calves at labour are essential for the beginning of
parturition and are the expression of stress period. The process that led to this high incorporation in
the hair, had a significant duration comparable to a chronic stress. In six months old calves, cortisol
levels decreased about four times. Hence, it may be inferred that the stress associated at birth is
overcame. However, the cortisol concentrations found at six months of age are statistically lower than
those found at birth but similar to those of cows at parturition. Stressful conditions in livestock like
weaning, social regrouping and relocation, factors typical of neonatal period, can explaine these high
levels. Indeed changes in social groups, new animals introduction into a group, resulting in increased
social stress and reduction feed intake (Boe and Faerevik, 2003). Frequent regrouping may to lead to
signs of chronic stress, such reduced growth rate, immune responses and health, although less than
other species (Veissier et al., 2001). An increased susceptibility to disease in neonatal calves may be
attributable to high corticoid levels that influence immune reaction (Anderson et al., 1999). Disease
incidence is a major cause of reduced performances and survival of neonatal dairy animals (McGuire
et al,1976).
In conclusion hair cortisol level has potential as biological marker for chronic stress during
pregnancy and neonatal period and can be used to evaluate animal welfare.
REFERENCES
Accorsi PA, Carloni E, Valsecchi P, Viggiani R, Gamberoni M, Tamanini C, Seren E. 2008. Cortisol determination
in hair and faeces from domestic cats and dogs. Gen Comp Endocrinol. 155(2):398-402.
Anderson B.H., Watson D.L. and Colditz I.G. 1999. The effect of dexamethasone on some immunological
parameters in cattle. Vet. Res. Commun. 23: 399-413.
Boe K.E. and Faerevik G. 2003 Grouping and social preferences in calves, heifers and cows. Appl. Anim. Behav.
Sci. 80: 175-190.
Conn P.M. 1996. Mechanisms of drug incorporation into hair. Ther. Drug Monit. 18: 434-443.
Davenport MD, Tiefenbacher S, Lutz CK, Novak MA, Meyer JS. 2006. Analysis of endogenous cortisol
concentrations in the hair of rhesus macaques. Gen Comp Endocrinol. 147: 255-61.
Hay M., Mormede P. 1998. Urinary excretion of catecholamines, cortisol and their metabolites in Meishan
and large white sows: validation as a non-invasive and integrative assessment of adrenocorrtical and
sympathoadrenal axis activity. Vet res. 29: 119-128.
Koren L., Mokady o., Karaskov T., Klein J., Koren G., Gleffen E. 2002. A novel method using hair for determining
hormonal levels in wildlife. Anim. Behav. 63: 403-406.
Matteri R.L., Carroll J.A., Dyer C.J. 2000. Neuroendocrine responses to stress. In: Morberg GP, Mench JA,
editors. The biology of animal stress. CABI Publishing, p. 123-146.
McGuire T.C., Pfeiffr J.M., Weikel J.M., and Bartsch R.C. 1976. Failure of colostral immunoglobulin transfer in
calves dying of infectious disease. J. Am. Vet. Med. Assoc. 169: 713.
McMillen I.C., Phillips I.D., Ross J.T., Robinson J.S., Owens J.A. 1995. Chronic stress—the key to parturition.
Reprod. Fertil. Dev. 7: 499-507.
Mostl E., Maggs J.L., Schrotter G., Besenfelder U., Palme R. 2002. Measurement of cortisol metabolites in
faeces of ruminants. Vet. Res. Comm. 26: 127-139.
Negrao J.A., Porcionato M.A., de Passille A.M., Rushen j. 2004. Cortisol in saliva and plasma of cattle after
ACTH administration and milking. J. Dairy Sci. 87:1713-1718.
Tamanini C, Giordano N, Chiesa F, Seren E. 1983. Plasma cortisol variations induced in the stallion by mating.
Acta Endocrinol 102:447-450
Veissier I., Boissy A., dePassilé A.M., Rushen J., van Reenen C.G., Roussel S., Andanson S., and Pradel P. 2001.
Calves’responses to repeated social regrouping and relocation. J. Anim. Sci. 79:2580-2593.
Villain M., Cirimele V., Kintz P. 2004. Hair analysis in toxicology. Clin.Chem. Lab. Med. 42: 1265-1272.
Yang H.Z., Lan J., Meng Y.J., Han D.W.1998. A preliminary study of steroid reproductive hormones in human
hair. J. Steroid Biochem. 67: 447-450.
Diseases of sheep on Croatian islands
Bolesti ovaca na hrvatskim otocima
Kostelić1, A., Branka Artuković2, R. Beck2, M. Benić3, M. Cergolj2, I. Štoković2,

Z. Barać3
1
Faculty of Agriculture, University of Zagreb, 10 000 Zagreb, Svetošimunska 25, Croatia
2
Faculty of Veterinary medicine, University of Zagreb, 10 000 Zagreb, Heinzlova 55, Croatia
3
Croatian Veterinary Institut, Zagreb, Savska cesta 143, Croatia
4
Croatian livestock center, Zagreb, Ilica 101, Croatia
Contact: Mr.sc. Antun Kostelić, DVM,University of Zagreb Faculty of Agriculture. Phone +385 12393915;
E-mail: akostelic@agr.hr
Abstract
According to the Croatian Livestock Centre’s data (2006) over 100.000 sheep are bred on the islands for
the purpose of producing meat (lambs) and milk (cheese). The majority are raised on the islands of Krk, Cres,
Rab, Pag and Brač. Autochthonous (island) breeds predominate on these islands while Istrian and crossbreed
sheep are represented in smaller numbers. The sheep are kept extensively and feed on the numerous types of
Mediterranean plants there. During the winter period, they are fed on hay, concentrats and pelleted alfalfa.
The aim of our research was to establish which diseases affect the health of sheep on Croatian islands. The
study was carried out on 40 flocks on the islands of Cres, Krk, Rab, Pag and Brač from 2004 to 2007. The
following diagnostic methods were used: clinical examination, necropsy, serological blood tests and coprology
tests. It was established that they most frequently suffered from parasitical, infectious and digestive system
diseases. The following internal parasites were found: gastrointestinal nematodes, Eimeria sp., Protostongylus
sp., Dicrocoelium dendriticum, Fasciola hepatica, Paramphistomum sp., Nematodirus sp., Moniezia
sp, Haemmonchus contortus. and Trichuris sp.. As far as external parasites are concerned, the presence of
Rhipicephalus and Ixodes ticks were established. Invasion of Melophagus ovinus was identified on the island of
Rab. The parasites most frequently affect the health of lambs and young sheep. The presence of abscesses caused
by puncture wounds was also established in the sheep. Clinical mastitis was diagnosed on all islands indicating
the bacteria Staphylococcus aureus as the major causative agent. The following infectious diseases were found:
enterotoxemia, actinobacillosis, contagious ecthyma, footrot and the Brucella ovis infection. As far as diseases
of the digestive system are concerned, bloat was found, as well as various forms of indigestion, which are a
consequence of overfeeding on green grass, figs or acorns. Diarrhoea widely occurs in sheep since they lick
sea salt the so-called posolica drifted by a north-eastern wind to the areas where sheep are bred. Most diseases
identified in the study can be prevented and controlled by implementing elaborate safety precautions. When
choosing precautions, both breeders and veterinarians have to take account of the size of a flock, objective and
stage of production, breeding area, epizootiological situation, diseases identified in the flock so far and season.
Key words: diseases, sheep, Croatian islands
SAŽETAK
Prema podacima Hrvatskog stočarskog centra (2006) na hrvatskim otocima se uzgaja preko 100 000 ovaca
s ciljem proizvodnje mesa (janjetine) i mlijeka (sira). Većina populacije se uzgaja na Krku, Cresu, Rabu, Pagu
i Braču. U uzgojima prevladavaju autohtone (otočke) pasmine: paška, creska, krčka, rapska (škraparica), dok
su istarska i križane ovce zastupljene u manjem broju. Ovce su držane ekstenzivno pri čemu se hrane brojnim
vrstama mediteranskog bilja. U zimskom razdoblju dohranjuju se sijenom, smjesom i peletiranom djetelinom.
Cilj našeg istraživanja bio je utvrditi bolesti koje ugrožavaju zdravlje ovaca na hrvatskim otocima. Istraživanje je
provedeno u 40 stada ovaca na Krku, Cresu, Rabu, Pagu i Braču u razdoblju od 2004. do 2007 godine. Korištene
su slijedeće dijagnostičke metode: klinički pregled, razudba, serološka pretraga krvi i koprološka pretraga.
Koprološkom pretragom utvrđeni su slijedeći paraziti: gastrointestinalni nematodi, Eimeria sp., Protostongylus
sp., Dicrocoelium dendriticum, Fasciola hepatica, Paramphistomum sp. Nematodirus sp., Moniezia sp.,
Haemmonchus contortus i Trichuris sp. Od vanjskih parazita na otocima je utvrđena invazija krpeljima rodova
Rhipicephalus i Ixodes. Na otoku Rabu je utvrđena invazija i Melophagus ovinus. Utvrđeno je da paraziti najviše
ugrožavaju zdravlje janjadi i mladih ovaca. Zatim je utvrđena prisutnost apscesa koji najčešće nastaju kao
posljedica ubodnih rana. Klinički oblik mastitisa je utvrđen na svim otocima, a kao najčešći uzročnik je izoliran
Staphylococcus aureus. Od zaraznih bolesti dijagnosticirane su: enterotoksemija, aktinobaciloza, zarazni
ektim, zarazna šepavost i infekcija ovnova Brucellom ovis. Od bolesti probavnog sustava dijagnosticirani su
pjenušavi nadam i različiti oblici indigestija koji nastaju kao posljedica prežderavanja zelenom travom, žirom
ili smokvama. U ovaca se često javlja proljev zbog lizanja morske soli tzv. posolice koju je bura nanijela na
površine gdje se drže. Većina bolesti utvrđenih našim istraživanjem može se spriječiti i suzbiti provedbom
temeljitih preventivnih mjera. Kod odabira mjera uzgajivači i veterinari moraju uzeti u obzir veličinu stada, cilj
i stadij proizvodnje, područje držanja, epizootiološku situaciju, dosadašnje bolesti utvrđene u stadu i godišnje
doba.
Ključne riječi: ovce, bolesti, hrvatski otoci
Introduction
According to the Croatian Livestock Centre’s data (2006) over 100.000 sheep are bred on the
islands for the purpose of producing meat (lambs) and milk (cheese). The majority are raised on the
islands of Krk, Cres, Rab, Pag and Brač. Autochthonous (island) breeds predominate on these islands
while Istrian and crossbreed sheep are represented in smaller numbers.The sheep are kept extensively
(Pict. 1) and feed on the numerous types of Mediterranean plants there.
Picture 1
During the winter period, they are fed on hay, concentrats and pelleted alfalfa.Such sheep
breeding favours development of numerous diseases bringing a fall in production and sheep deaths
quite often. Supported by the Centre for Sustainable Development of Northern Adriatic Islands and
Ministry of Agriculture, Fisheries and Rural Development a study was carried out objective of which
was to determine which diseases exist among sheep flocks on the islands. Apart from diseases, safety
precautions have been identified that might fight and prevent them.
Materials and working methods

The study was carried out on 40 flocks of native and crossbreed island sheep breeds on the islands
of Cres, Krk, Rab, Pag and Brač from 2004 to 2007. The flock size ranged between 20 and 400 sheep.
The following diagnostic methods were employed: clinical examination, autopsy, serological blood
test and parasitological and bacteriological tests. Some diseases were determined on the strength of
data on development and course acquired from breeders.

The study found diseases among flocks of native and crossbreed sheep breeds in most cases to be
a consequence of an extensive way of breeding and insufficient feeding. Diseases occur individually
and only rarely a larger number of sheep or a whole flock develop a disease. Sheep health on the
islands is primarily harmed by parasitic invasions, insufficient feeding and watering while infectious
diseases occur rarely.
Coprological tests proved sheep on the islands of Cres, Krk, Rab, Pag and Brač to be most
often exposed to invasions of mostly identical parasites. A sheep breeding location on single islands
provokes invasions of single parasites. Coprological tests and necropsy identified the following
parasites: gastrointestinal nematodes, Eimeria sp., Protostongylus sp., Dicrocoelium dendriticum,
Fasciola hepatica, Paramphistomum sp. Nematodirus sp., Haemmonchus contortus,Moniezia sp. i
Trichuris sp. Kostelić et. al.(2005) mention the majority of sheep flocks on the island of Rab and Pag
is invaded by gastrointestinal parasites andEimeria sp. On the island of Rab as against the island of
Pag a larger number of sheep is invaded by a small fluke (D. dendriticum) whereas a larger number
of Nematodirus sp was determined on the island of Pag. Our study revealed the presence of D.
dentriticum, Protostongylus sp., Moniezie sp., Eimerie sp. and gastrointestinal parasites on all the
islands included in the study. Not only coprological tests, but also dissection proved sheep were
invaded by a small fluke in which process a large number of D. dendriticum was found in bilial ducts
of sheep and lambs from the island of Cres. Čanković and Džakula (1988) quote D. dendriticum
invasions are determined in craggy areas and on the islands of Cres and Brač as well as the fact the
disease is rarely visible in clinical terms. Our study found the presence of D. dendriticum in sheep
flocks on all the islands included in the study. Čanković and Džakula (1988) and Jensen and Swift
(1982) claim most determined parasites pose a threat to lamb and younger sheep health while causing
clinical signs to elderly sheep only in certain circumstances such as insufficient feeding.
So far as external parasites on the islands are concerned tick invasion of Rhipicephalus and Ixodes
genus were identified causing allergic reactions on the spot stung and anaemia and the so called
“tick paralysis” in lambs, if invasions were stronger. Invasion of Melophagus ovinus was identified
on the island of Rab. The dissection of several sheep found verminous pneumonia following an
infestation by small lungworms. Parasitological invasions are mainly caused by both slow growth
and productivity of native island sheep breeds.In rare cases these may lead to death, as this is the case
of verminous pneumonia.
With respect to infectious diseases, enterotoxemia, contagious ecthyma, footrot, actinobacillosis
and ram infection Brucellom ovis were identified. Enterotoxemia was diagnosed on all islands
occurring individually as a result of lamb’s overeating milk or cereals used for supplemental feeding.
Cvetnić (2002) and Pugh (2002) say mortality of a two-to-three-week-old lamb is 100%, which
was also proved by our study. Our study revealed the presence of contagious ecthyma on all the
islands included in the study. On the island of Krk infectious sheep footrot was diagnosed that has
not been eradicated yet. According to the data acquired from breeders, the disease occurred some
ten years ago after infected sheep were transported to the island from the mainland causing spread
of the disease in several flocks around Malinska. Cvetnić (2002) says the disease is to fight most
successfully in summer by removing a wall horn and treating a hoof with 5% copper sulphate or
formalin. Additionally, he mentions vaccination as one of the measures; however, immunity lasts
from 4 to 12 weeks so that the author raises the question over economic cost-effectiveness of such
a prophylaxis. Actinobacillosis (PicT. 2) was diagnosed in one case of a two-year-old sheep on the
island of Rab.
Picture 2
The Croatian Veterinary Institute data report on a ram infection by Brucella ovis identified on
the island of Krk. It was established that the infected rams had been purchased in the area of Istria
and then transported to the island of Krk without veterinary surveillance. Cvetnić (2002) alludes to B.
ovis as the commonest cause of infection in rams releasing the bacteria by sperm, which significantly
reduces their fertility. B. ovis and infectious footrot occur strictly due to the vicinity of and connection
to the mainland of the island of Krk as well as ignorance and veterinary regulation infringement by
single breeders. Clinical mastitis was diagnosed on all islands indicating the bacteria Staphylococcus
aureus as the major causative agent. When dealing with dairy animals, owners seek veterinarian’s
help while they do not do so when sheep aimed at producing lamb are involved. Ruminal bloat
was found to occur in sheep occasionally as a consequence of their overeating of acorns and figs.
Forenbacher (1975) says ruminal bloat is a rare and more dangerous sheep disease when compared
to bovine cattle. He adds the disease develops fast and may cause death of a larger number of sheep.
Breeders treat acute ruminal bloat quite successfully by applying olive oil to rumen. Necropsy of a
ram from the island of Pag found pieces of a plastic bag in the rumen contents (Pict. 3).
Picture 3
Forenbacher (1975) says the existence of foreign objects in the rumen indicates monotonous
nutrition or meals lacking in some minerals and proteins. Since the aforementioned ram was bred in
the area of sparse vegetation it may be concluded that the cause of its peculiar appetite was monotonous
nutrition that is lacking in both quality and quantity. Diarrhoea widely occurs in sheep since they lick
sea salt the so-called posolica drifted by a north-eastern wind to the areas where sheep are bred.
Breeders have to provide sheep with larger amounts of drinkable water to prevent dehydration caused
by diarrhoea. Abscesses were found on all islands mostly on sheep’s heads. These were identified
to be a result of a puncture wound received when sheep pass through the bushes. In most cases a
bacteria Archanobacterium pyogenes was isolated from the abscesses contents (pus). A rare case of
basosquamosa skin carcinoma (Pict. 4) was reported in a four-year-old sheep on the island of Cres.
The same sheep also developed verminous pneumonia.
Picture 4
On the island of Cres a similar death of 9 sheep was detected that were caused by urea poisoning
used in spreading manure on the olive-groves. Deaths of three sheep and two lambs caused by
lightning in bed weather were reported on the island of Rab. Non-native game inflicts untold damage
to sheep breeding on the island of Cres (wild boars) and Rab (jackal). Damage done by wild boars is
multiple: they knock down dry stone walls (a part of cultural heritage), frighten sheep causing them
severe injuries (bone fractures), make sheep produce up to 40% less milk due to stress and eat lamb
and attack sheep in the lambing period. Although it is an unknown how jackals have appeared on the
island of Rab, they have slaughtered more than 200 sheep and lambs over the last two years. Sheep
breeders seek veterinary help rarely, except when a larger number of head is involved since service
charge is (too) high and often exceeding the value of the animal. Most diseases identified in the
study can be prevented and controlled by implementing elaborate safety precautions. When choosing
precautions, both breeders and veterinarians have to take account of the size of a flock, objective and
stage of production, breeding area, epizootiological situation, diseases identified in the flock so far
and season. The fighting of parasitic invasions must be systematic and continuous while choosing a
drug and treatment season should be based on the results of coprological tests and production stage.
Making sheep used to green pasture and cereals within ten days can fight various forms of indigestion.
A sufficient amount of drinkable water must be provided without regard to pasture quality and the
sheep breeding area. As far as the fight against the occurrence of contagious diseases is concerned,
such as footrot and B. ovis, breeders are obliged to adhere to veterinary regulations when purchasing
and introducing new sheep to a flock i.e. to the island. Taking into account the population size, way
of breeding and diseases identified in flocks of native island sheep breeds the study has proved a well-
known fact that we are dealing with modest yet quite resistant animals.
References
Cvetnić, S. (2002): Bakterijske i gljivične bolesti životinja, Medicinska naklada, Zagreb.
Čanković, M., N. Džakula(1988).Invazione bolesti ovaca i koza. U «Bolesti ovaca i koza», Spectrum, Zagreb,
133-188.
Forenbacher, S. (1975): Klinička patologija probave i mijene tvari domaćih životinja, svezak I/1 klinička
patologija probave i resorpcije. JAZU i Sveučilišna naklada Liber, Zagreb.
Hrvatski stočarski centar (2007): Godišnje izvješće 2006. Ovčarstvo i kozarstvo. Zagreb.
Jensen, R., B.L. Swift(1982). Diseases of sheep, LEA&FEBINGER, Philadelphia.
Kostelić, A., Dagny Stojčević, V. Rupić, D. Karolyi, K. Salajpal, Z. Barać, G. Kiš, R. Beck (2005): Sheep
internal parasites on Pag and Rab, Italian Journal of Animal Science, Proceedings of the 13th Internatonal
Symposium “ Animal Scinece Days”, Vol.4-2005, Supplement 3.
Pugh, D.G. (2002): Sheep and goat medicine. W.B. Saunders Company, str. 341-358.
The influence of calcium-propionate in diet on energy
status in dairy cows
Utjecaj dodavanja propionata u hrani na energetski

status mliječnih krava
Stojević, Z.1, Natalija Filipović1, Z. Tuček2, Blanka Beer Ljubić1, K. Dolanski3,

Lina Bačar-Huskić4
1
Department of Physiology and Radiobiology, Faculty of Veterinary Medicine University of Zagreb, Heinzelo-
va 55, Zagreb 10 000, Croatia
2
Center for Animal Reproduction of Croatia, Planinska 2b, Zagreb 10 000, Croatia
3
Osatina proizvodnja promet i usluge u poljoprivredi, K. Tomislava bb, Semeljci 31 402, Croatia
4
VETERINA, Animal Health, Inc., Svetonedjeljska 2, Rakov Potok 10 436, Croatia
Abstrac
The energy metabolism in dairy cows in the beginning of lactation is a metabolically most demanding
period, because of rapid increase of milk production. The ruminant is completely denied of glucose, since all
carbohydrates are converted to volatile fatty acids, by digestion in the forestomach. The vital glucose needs,
necessary for metabolic demands and lactose synthesis, are satisfied by the gluconeogenesis in liver, primarily
from propionate. The quantity of propionate, which originates from the fermentative digestion in rumen, is
often insufficient to satisfy the need for glucose. In relation to above mentioned, we wanted to investigate the
influence of the calcium-propionate supplement to diet of dairy cows on the energy metabolism in the beginning
of lactation, by measuring of blood serum indicators of energy status. The research was conducted on Holstein-
Friesian cows during the first 30 days of lactation. Control group was fed with a standard diet, which was adapted
to the phase of lactation. Experimental group was fed equally, with addition of 80 g of calcium propionate twice
a day, beginning from the first to the 30th day of lactation. Samples for blood analyses were taken on day 1,
day 10 and day 30 after calving in plain vacutainer tubes. In separated blood serum, the concentrations of non-
esterified fatty acids (NEFA), beta hydroxybutyrate (BHB), total cholesterol, triglycerides, glucose and urea
were determined. The concentration of NEFA and BHB was significantly lower in experimental in comparison
with control group, on day 10 of lactation (p<0.002 and p<0.03, respectively). On day 30, significant differences
of concentration of NEFA and BHB between control and experimental group were not observed. In the same
period, experimental group has had significantly lower concentration of total cholesterol and urea (p<0.01 and
p<0.001, respectively) and higher concentration of glucose in serum (p<0.001). The milk yield was not different
in control and experimental group. The presented data indicate that addition of 160 g of calcium propionate
diminish mobilisation of body fat stores and production of ketones, and keeps the stabile concentration of blood
glucose around the day 10 of lactation. Observed decrease in concentration of urea on day 30 of lactation is
probably a result of the diminished protein degradation. We conclude that the addition of calcium-propionate as
a supplement to diet of dairy cows has positive influence on energy status. In the same time, we conclude that
the higher doses of calcium-propionate are needed after day 10 of lactation. Additional investigations should
include the dry period and the later stages of lactation and the precise determination of optimal dose of calcium
propionate for different periods of lactation.
Key words: calcium-propionate supplements, dairy cows, energy status, blood serum
Sažetak
Energetski metabolizam krava u početnom razdoblju laktacije metabolički je najzahtjevnije razdoblje,
zbog naglog povećanja proizvodnje mlijeka. Specifičnost probave u preživača onemogućuje opskrbu organizma
glukozom prijeko potrebnom za vlastiti metabolizam kao i sintezu mliječnoga šećera, laktoze. Svu potrebnu
glukozu krava namiruje glukoneogenezom, prvenstveno iz propionske kiseline, koja nastaje procesom vrenja
u buragu. Nastale količine propionske kiseline često nisu dovoljne za podmirenje potreba za glukozom. S tim
u vezi željeli smo istražiti utjecaj dodavanja kalcijeva propionata u hrani na energetski metabolizam krava
početkom laktacije, praćenjem biokemijskih pokazatelja u krvi. Pokusi su obavljeni na kravama holštajnske
pasmine tijekom prvih 30 dana laktacije. Kontrolna skupina dobivala je hranu prilagođenu proizvodnom
ciklusu. Pokusna skupina hranjena je istom hranom uz dodatak 80g Ca-propionata svaki dan dvokratno, počevši
od prvog do tridesetog dana laktacije. Krv za analizu uzimana je prvi, deseti i trideseti dan po porodu punkcijom
vratne vene u vacutainer epruvete. U izdvojenom serumu određena je koncentracija neesterificiranih masnih
kiselina (NEFA), beta-hidroksi maslačne kiseline (BHB), ukupnog kolesterola, triglicerida i glukoze. Rezultati
pokusa pokazali su značajno nižu koncentraciju NEFA (p<0.002) i BHB (p<0.03) kod pokusnih krava desetog
dana laktacije. U tridesetom danu laktacije ne postoji značajna razlika u koncentraciji ova dva pokazatelja. U
toj fazi laktacije pokusna skupina krava imala je značajno nižu koncentraciju ukupnog kolesterola u plazmi
(p<0,01) i ureje (p<0,001). Istovremeno zabilježena je značajno viša koncentracija glukoze u plazmi pokusne
skupine (p<0,001). Količina mlijeka nije pokazala značajne razlike u kontrolnih i pokusnih skupina krava.
Na osnovi dobivenih rezultata može se prepostaviti kako dvokratni dodatak 160g Ca- propionata umanjuje
razgradnju tjelesnih masti te stvaranje ketonskih tijela oko desetog dana laktacije (NEFA-BHB), održava
konstantnu koncentraciju glukoze u krvi. Pad koncentracije ureje tridesetog dana laktacije može se pripisati
smanjenoj razgradnji tjelesnih bjelančevina. U zaključku, primjenjena doza Ca-propionata pokazuje pozitivan
učinak na energetski status mliječnih krava. Istovremeno preporuča se povećanje doze Ca-propionata poslije
desetog dana laktacije te proširenje istraživanja na period kasnog suhostaja te do tridesetog dana laktacije.
Ključne riječi: propionat u hrani, energetski status, krvna plazma, mliječne krave
Uvod
Početak laktacije prijelazno je razdoblje u kojem dolazi do naglog povećanja potreba za tvarima
nužnim za sintezu mlijeka, osobito energetskih; glukoza, masne tvari, bjelančevine. Specifičnosti
probave u preživača onemogućuju dotok jednostavnih metabolita iz probavila, posebice glukoze.
Naime, probava ugljikohidrata odvija se u predželucima fermentativnim procesima. Tako konačni
produkt razgradnje ugljikohidrata nije glukoza već niže masne kiseline, ponajprije octena, propionska
i maslačna. Glukoza prijeko potrebna za osnovne životne procese kao i za sintezu mliječnog šećera,
laktoze nastaje glukoneogenezom najvećim dijelom iz propionske kiseline. Kronični nedostatak
glukoze, osobito u početku laktacije, povećava učestalost metaboličkih poremećaja (Goff i Horst,
1997; Hardeng i Edge, 2001). Pad razine inzulina s posljedičnim porastom koncentracije glukagona
rezultira povećanim opsegom lipolize i ß-oksidacije nastalih masnih kiselina. Nastali acetil-CoA
ulazi u ciklus limunske kiseline, ali samo u količini koja je ovisna o raspoloživosti oksal-acetata,
a koji ovisi o količini glukoze. Preostali acetil CoA skreće u ketogenezu (Bruss, 1997). Osobitost
metabolizma preživača je niska koncentracija oksal-acetata u mitohondrijima (Vernon, 2005) što
dalje pridonosi nastanku ketonskih tijela. Dakle, osnovna prevencija u sprečavanju metaboličkih
poremetnji je dovoljna količina glukoplastičnih tvari. To može biti laktat (mliječna kiselina) koja vrlo
lako prelazi u glukozu. Međutim, mliječna kiselina može polučiti jak toksični učinak. Vrlo široku
primjenu ima i propilen glikol, no novija istraživanja ukazuju kako i taj pripravak ima toksični učinak
(Filipović i sur., 2008). Preostaje jedino propionat (propionska kiselina) koja fiziološki nastaje
vrenjem u predželucima. S tim u vezi željeli smo istražiti utjecaj dodavanja propionata u hranu na
energetski metabolizam krava u početku laktacije.
Materijal i metode
Pokusi su obavljeni na kravama holštajnske pasmine tijekom prvih 30 dana laktacije. Kontrolna
skupina dobivala je hranu prilagođenu proizvodnom ciklusu. Pokusna skupina hranjena je istom
hranom uz dodatak 80 g Ca-propionata po kravi u obliku komercijalnog pripravka Biomax®tranzit
(200 g po kravi dva puta dnevno). Krv za analize uzimana je prvi, deseti i trideseti dan laktacije
punkcijom vratne vene. U izdvojenom serumu određena je koncentracija neesterificiranih masnih
kiselina (NEFA), beta-hidroksimaslačne kiseline (BHB), ukupnog kolesterola, triglicerida, glukoze i
ureje komercijalnim kompletima.
Rezultati
Rezultati pokusa prikazani su na slikama 1-6. Rezultati pokusa pokazali su značajno nižu
koncentraciju NEFA (p<0.002) i BHB (p<0.03) kod pokusnih krava desetog dana laktacije. U
tridesetom danu laktacije ne postoji značajna razlika u koncentraciji ova dva pokazatelja. U toj fazi
laktacije pokusna skupina krava imala je značajno nižu koncentraciju ukupnog kolesterola u plazmi
T R IG L YC E R ID E S C H OLESTER OL
0,16 7,09
0,15
6,09
0,14
0,13 Control 5,09 Control
mmol/L
mmol/L
0,12 P ropionate 4,09 P ropionate

0,11
0,10 3,09
0,09 2,09
1 2 3 1 2 3
p e rio d p e rio d
UREA
GLU C OSE
8,50
6,09 8,00
5,09 7,50
4,09 7,00 Control
mmol/L
Control
mmol/L
3,09 6,50 P ropionate

P ropionate 6,00
2,09
5,50
1,09
5,00
0,09 1 2 3
1 2 3
p e rio d
p e rio d
NEFA BHB
1,49 1,09
1,29 0,89
1,09 Control 0,69 Control

mmol/L
mmol/L
0,89 P ropionate 0,49 P ropionate
0,69 0,29
0,49 0,09
1 2 3 1 2 3
p e rio d p e rio d
(p<0,01) i ureje (p<0,001). Istovremeno zabilježena je značajno viša koncentracija glukoze u plazmi
pokusne skupine (p<0,001). Količina mlijeka nije pokazala značajne razlike u kontrolnih i pokusnih
skupina krava.
Rasprava
Rezultati pokusa ukazuju na pozitivno djelovanje dodavanja Ca-propionata u hranu mliječnih
krava. Na osnovi kretanja biokemijskih pokazatelja u krvi može se pretpostaviti kako primjenjena
doza propionata umanjuje razgradnju tjelesnih masti na što upućuje niža koncentracija NEFA
desetog dana laktacije uz izdašniju sintezu triglicerida. Koncentracija glukoze u krvi tretiranih krava
bila je konstantna kroz pokusno razdoblje iako nešto niža prvog dana, ali značajno viša tridesetog
dana laktacije. Ovi rezultati upućuju na učinak propionata u održavanju normoglikemije. Kretanja
koncentracija BHB nedvojbeno ukazuju na protektivni učinak propionata u sprečavanju ketoze. Niže
koncentracije ureje u krvi pokusnih krava upućuju na zaključak da upotreba propionata smanjuje
obim razgradnje tjelesnih bjelančevina u svrhu glukoneogeneze. Ovakvo mišljenje temelji se na
činjenici da su obje skupine krava hranjene istom hranom dok u proizvodnji mlijeka nije bilo
razlike. U zaključku, primjenjena doza Ca-propionata pokazuje pozitivan učinak na energetski status
mliječnih krava. U isto vrijeme, rezultati upućuju kako bi se istraživanja trebala proširiti na veće
količine propionata u hrani poslije desetog dana laktacije kao i na period suhostaja.
Literatura
Bruss, M. L. (1997): Lipids and ketones. In: Clinical biochemistry of domestic animals. 5th ed. Kaneko, J. J., J.
W. Harvey, M. L. Bruss. Academic Press. pp. 83-115.
Filipović Natalija, Z. Stojević, Blanka Beer Ljubić und Nina Poljičak-Milas (2008): Der Fettstoffwechsel bei
Holstein-Kühen in der Trockenstehzeit und zu Laktationsbeginn. Tierärtzl. Umschau 63, 59-64
Goff, J. P., R. L. Horst (1997): Phisiological changes at parturition and their relationship to metabolic disorders.
J. Dairy Sci. 80. 1260-1268.
Hardeng, F. V., L. Edge (2001): Mastitis, ketosis and milk fever in 31 organic and 93 conventional Norvegian
dairy herds. J. Dairy Sci. 2673-2679.
Vernon, R. G. (2005): Lipid metabolism during lactation: a review of adipose tissue-liver interactions and the
development of fatty liver. J. Dairy Res. 72. 460-469.
The Clinical Efficiency of Minerasol® Which is a New
Trace Element Combination on Sheep
Učinak kombinacije minerala u pripravku Minerasol na

nivo nekih elemenata u ovaca
KAYAR1, A., Mehmet Erman OR1, Remzi GONUL1, Banu DOKUZEYLUL1, Ali Rıza
KIZILER2, Birsen AYDEMIR2, Abdullah AKSU3, Cağla PARKAN1, TAMERCAN
MORKOC4 , and BORA BARUTCU2
1
Istanbul University, Faculty of Veterinary Medicine, Department of Internal Medicine, 34320
Avcilar-Istanbul/TURKEY
2
Istanbul University, Cerrahpaşa Medicine Faculty, Department of Biophysics, Cerrahpaşa-Istan-
bul/TURKEY
3
Chemical Oceanography, University of İstanbul, Enstitute of Marine Science and Management
Vefa-Istanbul/TURKEY
4
Interhas Limited Company, Ankara/TURKEY.
Introduction
The importance of many inorganic elements classified as macro and micro elements in nourishing and
growing of animals is accepted (2,19). Trace elements have an important role on growth, reproduction and
productivity of domestic animals. Mineral deficiency or imbalance observed in nearly everywhere in the world
causes significant losses in terms of both production and economy (3, 5, 7, 8, 9, 19). It is reported that the losses
caused by trace elements are as important as the losses caused by infectious and parasitic diseases (19). Although
trace elements are very important for increasing resistance to diseases in living organisms (4,19). Minerasol®
used in this study, is a hypertonic infusion solution that includes calcium, phosphate, potassium, magnesium
and sodium salts and iodine, iron, cobalt and zinc trace elements. Mineral substances and trace elements are
critical co-enzymes necessary for the activation of the effects of biologically important substances like hormone,
enzyme, vitamine and other functional proteins (21). Any deficiency causes specific or non-specific disorders in
cells’ metabolism. In this study planned under the light of all these information, the effects of Minerasol®
application which is a new mineral combination, on blood serum parameters were examined, its efficiency on
sheep breeding and its safety on the treatments of diseases caused by macro and micro element deficiencies.
Sažetak
Uzgoj ovaca zauzima važno mjesto u gospodarstvu države. Ovce nam daju mlijeko, meso i vunu te na taj
način čine industrijski značaj u stočarstvu naše zemlje. Bolesti uzrokovane nedostatkom makro i mikroelemenata
su vrlo važne. Debilizam, anoreksija, pad produktivnosti, anemija, proljev i poremetnje plodnosti su najvažniji
klinički znakovi uočeni na životinjama. U ovoj studiji cilj je odrediti učinkovitost Minerasola, koji je
kombinacija minerala na nivou nekih elemenata ( Fe, Cu, Zn, Mg, Ca ( .S tom namjerom otprilike 10 ml krvi
bez antikoagulanata izvađeno je ukupno 40 ovaca na Fakultetskom dobru te su određene razine elemenata u
serumu. Nakon toga smo intravenozno aplicirali 6ml Minerasola razrijeđenog fiziološkom otopinom. Tjedan
dana kasnije ponovo smo izvadili krv i ustanovili promjene. Nakon toga ponovo smo aplicirali 6ml pripravaka
intravenozno. Nakon tjedan dana ponovo smo odredili razinu elemenata u serumu bez aplikacije Minerasola.
Svi elementi određivani su pomoću AA-680 Schimatzu Atomic Apsorption spektrofotometrom na Zavodu za
biofiziku medicinskog fakulteta Sveučilišta Cerrahpas u Istambulu i dobiveni podavi su statistički obrađeni.
Usporedbom razine elemenata u serumu prije i poslije tretiranja pripravkom uočen je porast razine Fe, Cu, Zn,
Mg i Ca. Za Zn i Mg uočen je signifikantni porast (p<0.001 razine u serumu. Konačno, zaključili smo da je
tretman minerasolom kroz program dnevne njege moguće isključiti probleme vezane za nedostatak minerala u
tragovima čime je moguće prevenirati predispozicije za bakterijske, virusne i parazitarne bolesti.
Ključne riječi: Ovce, Minerasol, serum, Fe, Cu, Zn, Mg, Ca

This study was carried out in Istanbul University Veterinary Faculty Farm. 40 sheep that were
determined to be healthy after the clinical examination were included to the study. About 10 ml
of blood without anticoagulant was drawn from the animals before drug administration and serum
element levels were determined. Then, each animal were administered IV 6 cc Minerasol® that
includes calcium phosphonate 65.00 mg, potassium chloride 4 282 mg, calcium gluconat 300.00 mg,
potassium lodide 50.00 mg, sodium iodide 50.00 mg, magnesium chloride 6 H2O 19.64 mg, iron (II)
chloride 4 H2O 12.96 mg, cobalt (II) chloride 6 H2O 0.164 mg, zinc chloride 0,1355 mg in one ml,
blood was drawn one week later and the variations were determined. Then 6 ml of Minerasol® was
again applied intravenously. After one week, without applying IV injection of Minerasol®, blood was
drawn and serum element levels were determined. All the element levels were measured in AA-680
Shimadzu atomic absorption spectrophotometry in Biophysics Department of Istanbul University
Cerrahpaşa Faculty of Medicine, hemogram parameters were measured in Istanbul University
Veterinary Faculty Central Analysis Laboratory and the data were statistically assessed.
Results
When the Minerasol® levels before and after the application were examined, it was determined
that there was no statistically significant change in hemogram levels but there were increases in Fe,
Cu, Zn, Mg and Ca element levels and that the increases of Zn, Mg and Ca were significant in p <
0.001 level (Table 1).
Table 1: The changes in blood serum levels in sheep before the application and one and two weeks later after
Minerasol® (n=40).
Before injection 1 week after injection 2 weeks after injection

X ± Sx X ± Sx X ± Sx
Fe (µg/dL) 120,815 ± 9,30 122,19 ± 5,60 110,944 ± 5,45 N.S.
Cu (µg/dL) 61,91 ± 3,77 61,34 ± 2,01 70,13 ± 2,70 N.S.
Zn (µg/dL) 92,44 ± 4,77 76,44 ± 1,81 79,06 ± 2,29 ***
Mg 3,64± 0,057 3,52±0,064 3,30 ± 0,07 ***
Ca 8,02± 0,13 7,76±0,16 7,12 ± 0,20 ***
N.S.= p > 0.05, ***p<0.001
Discussion
Compared to other countries, while our country is one of the leading countries in terms of
economically valuable animal count, its place is much worse than expected in terms of products like
meat, milk and skin obtained from these animals (1, 4). Deficiency of trace elements plays as much
role as infectious and parasitic diseases in the formation of this table (19, 20). A similar appearance
was observed in Northwest Turkey and after discussions with breeders and veterinary physicians
it was reported that there were many diseases caused by parasites and trace element deficiencies.
Particularly, complaints like walking disorders in calves, fertility related problems, loss of weight,
diarrhea, predisposition to infections, decrease in fleece quality were compatible with symptoms
reported in literature (2,15).
Calcium is present in the structure of tissue and bones and is necessary for healthy bone,
muscle and nerve function. It is essentially responsible for blood clotting. It enables the interaction
of reticuloendolthelial system and suprarenal gland (21). It has a regulatory effect on acute and
chronic metabolic abnormalities and reproduction activities due to its effect on phosphate interim
metabolism. It is necessary for healthy bone and dental growth and its maintenance (21). It is also
known that, calcium and phosphate deficiencies cause many metabolic diseases (5, 9, 17). In our
study, when the changes in calcium level of blood serum was observed, it was a significant increase
seen in calcium quantity, statistically. It was decided that injections of calcium with phosphate could
decrease the risk of metabolic diseases.
Copper has an important role in hemoglobin shaping and body growth, symptoms like failure in
metabolic funstions like immune function, increase in mortality rate, debility, depigmentation, walking
disorders, demyelinization in nerve tissues, low osteoblastic activity and loss of weight caused by
the failure of oxidation in tissued and diarrhea are reported (16,19). Copper and zinc are the most
important essential minerals necessary for the normal functioning of animals’ reproduction functions
(11, 22). Zinc is an essential mineral for healthy skin, hair and nail situation, reproduction, bone and
cartilage growth, carbonhydrate, lipid and protein metabolism, enzyme and immune system. It has a
vital role in DNA synthesis. Decrease in consumption, decrease in growth rate, growth retardation,
anormal estrus behaviour, decrease in testicle magnitude, spermatogenesis malfunction, decrease in
the development of secondary sex organs and fertility, decreases in resistance to infections, significant
compression on immune response, pathological changes in skin and hair, parakeratosis are observed
in the animals with zinc deficiency (19,21).
Magnesium is necessary for bone and tooth formation and the maintenance of normal muscle
functions. It was reported that the inclusion of Zn, Cu and Mg to the ration in sufficient rates plays an
important role for fertilization and increasing the life chance of embryo (22). In this study we observed
that serum Cu, Zn and Mg levels increased after injection and it might be efficient on preventing the
diseases related to these minerals. Although half of the researchers reported that the risk of enzootic
ataxia increased with the blood copper levels under 50 µg/dL, it was observed that no such risk was
present in the animals in our farm and Minerasol® administration completely eliminated this risk by
increasing the serum copper level more.
Fe deficiency along with the Cu deficiency is known to cause violent anemiae and predisposition
to parasitic diseases. Iron enters the structure of hemoglobin necessary for moving oxygen from
lungs to body cells. In case of insufficiency, decrease in immune response, cell mediated immune
abnormalities may be seen and the killing ability of neutrophilia can be significantly reduced (21).
Authors (1,14) reported that high amount of cobalt, zinc, cadmium, mangane and copper found in
ration decreased the absorption of iron. In our study, it was observed that the blood erythrocyte count,
haematocrit level and hemoglobin level before and after the injection did not change and all the
parameters were reported as normal (18) in sheep and all that this was compatible with the presence
of blood serum Fe and Cu levels within normal limits before injection.
Potassium administered to the animals with Minerasol® administration are necessary for the
maintenance of cellular integrity and for healthy nerve and muscle function (21). Sodium and
Chlorine are necessary for the maintenance of healthy nerve and muscle function (21). İodine is
the structural component of thyroid hormones called Thyroxine (T4) and triiodothyronine (T3) and
has a regulatory and activating effect on metabolism. The normal growth and proper functioning
of reproduction organs depend on the thyroid situation. Since blind and hairless calves, abortus in
cows can be seen in its deficiency, iodine supplementation in various concentrations has a positive
effect on reproduction performance (21) . Cobalt is necessary for Vitamin B12 synthesis in the large
intestine of pigs and horses and the rumen of cattle. The field experiences indicate that the population
performance in sheep and cattle is deteriorated and ovarium function is deteriorated in cattle, the rate
of getting pregnant, deliveries and milk and wool production decreased (21). However, although we
did not have the chance to examine the changes in K, Na, Cl, I and Co levels in blood serum after the
injection, it was decided that these were increased similarly to the others and this may be effective on
preventing diseases due to mineral deficiencies.
Minerasol is used for treating, preventing specific or non-specific diseases and disorders caused
by deficiency, lack or imbalance of the components ( Zinc, Cobalt, Iodine, Iron, Sodium, Potassium,
Phosphor, Calcium and Magnesium ) in its constitution and supporting the animal (21).
It’s specific areas of use are grass tetany, milk fever, bone disorders, disorders in hair and skin
related to zinc, anemia related to iron and cobalt deficiency (Vitamin B12), hairless calves due to
iodine deficiency and it is used for removing the negative situations caused by the deficiency of
substances in its constitution mentioned in pharmacological properties section (21).
It can be used for prophylaxis during pregnancy and lactation for the prevention of diseases
which are likely to develop since the need of animals for substances within Minerasol® is increased
during these periods (21).
Consequently, it was decided that with the inclusion of Minerasol® which is a new trace element
combination into the routine care and nourishment program, the problems related to the deficiency of
trace elements would be eliminated in a short time and predisposition in terms of bacterial, viral and
parasitic diseases would be prevented.
References
1. AGAOGLU, ZT 1991: Ülkemiz hayvancılığında bazı iz elementler ve önemleri, Veteriner Hekimler Vakfı
Dergisi, 57-62.
2. ALTINTAS, A, UYSAL, H, YILDIZ, S, GONCAGUL, T 1990: Situation comparee des Mineraux urles
echantillons du serum et des poils chez les brebis hybride et d’Akkaraman- ANKARA. J Lalahan Livestock
Res Ins 30, 40-57.
3. BLOOD, DC, RADOSTITS OM, 1989: Diseases caused by nutritional deficiencies, In:Bailliere Tindall
editor, Veterinary Medicine, 7th ed., W.B. Saunders, London, Part Two, 1150-229.
4. CAMAS, H, BILDIK A, GULSER, F 1994: Toprak, bitki ve koyunların kanında bazı iz elementlerle (Cu, Mo,
Zn, Co, Mn) Sülfat (SO4) miktarlarının araştırılması, Pro.no: VHAG- 966. Van.
5. DAKKA, AA, ABDEL-ALL, THS 1992: Studies on minerals picture in the blood sera of egyptien Sheep.
Assiut Vet Med J 28, 242-249.
6. GHOSAL, AK, MATHUR, GN 1992: Zinc, copper and iron contents of blood serum of cattle, sheep in
semiarid Tract of Rjasthan. Ind J Anim Sci 62, 441-442.
7. GRAHAM, TW 1991: Trace element deficiencies in cattle. Vet Clin North Am Food Anim Pract 7, 153-215.
8. IMREN, HY, SAHAL, M 1990: Metabolizma hastalıkları, In: Veteriner İç Hastalıkları, Aydoğdu ofset matb.
Ankara, 841-1000.
9. JONES, HC, FONTENOT, JP, VEIT, HP 1990: Physiological and pathological effects of feeding high levels
of magnesium to steers, J Anim Sci 68, 4400-4413.
10. KENDALL, N.R., MACKENZIE, A.M., TELFER, S.B. (2001): Effects of a copper, cobalt and selenium
soluble glass bolus given to grazing sheep. Livestock Prod. Sci. 68;31-39.
11. KENDALL, N.R., MCMULLEN, S., GREEN, A., RODWAY, R.G. (2000): The effect of a zinc, cobalt and
selenium soluble grass bolus on trace element status and semen quality of ram lambs. Animal Reproduction
Sci. 62;277-283.
12. MARTIN, DW, MAYES, PA, RODWELL, VW 1983: Harper’s Review of Biochemistry. 19th ed., Lance
Medical Publications, Los Altos, California.
13. NELSON, DR, WOLFF, WA, BLODGETT, DJ, LEUCKE, B, ELY, RW, ZACHARY, JF 1987: Zinc
deficiency in sheep and goats: Three Field Cases J Am Vet Med Assoc 184, 1480-1485.
14. PIRKLE, JL, SCHWARTZ J.LANDIS, R, HARLAN, RW 1985: The relationshipbetween blood lead and
blood pressure and it’s cardiovasculer risk implications. Am J Epidemiol 121, 246-258.
15. RULS, R 1990, Mineral levels in animal health diagnostic data. 3rd ed., The Iowa State University Press
Ame.
16. SHARMA, MC, CHINMAY, J, PATHAK, NN, KAUR, H 2005: Copper status and enzyme, hormone,
vitamin and immune function in heifers. Res Vet Sci 79, 113-123.
17. SHUPE, JL, BUTCHER, JE, CALL, JW, OLSON, AE, BLAKE, JT 1988: Clinical signs and bone changes
associated with phosphorus deficiency in beef cattle. Am J Vet Res 49, 1629-1636.
18. SMITH, BP 2002: Large animal internal medicine. Mosby, Inc. 3rd ed., USA.
19. SAHIN, T 1999: Investigation of some trace element levels and biochemical parameters in sheep with
endoparasite. PhD thesis. Univ Yüzüncü Yıl, Van-Turkey.
20. UNDERWOOD, EJ 1997: Trace elements in human and animal nutrition. Academic Press, London.
21. www.interhas.com/interhas/ilaclar/minerasol.jpg
22. YILDIZ, A, BALIKCI, E 2004: Association between some mineral and embryonic mortality in the sera of
cows. J Fac Vet Med Univ Yüzüncü Yıl, 15, 11-15.
Possibilities for teaching reproductive clinical
anatomy using laparoscopy
Primjena laparoskopije u nastavi reproduktivne

kliničke anatomije
P. Trojacanec1, T. Dovenski2, V. Ilieski3, S. Trojacanec4, K. Ilievska1, L. Pendovski3

1
Faculty of Veterinary Medicine, Department of Surgery, Orthopedics & Ophthalmology
2
Faculty of Veterinary Medicine, Department of Reproduction
3
Faculty of Veterinary Medicine, Department of Anatomy
4
Faculty of Agricultural Sciences and Food, Department of Anatomy
Abstract
Teaching anatomy at the veterinary schools is based on anatomical specimens and preserved
cadavers, in the first two years, as well as on live animals for teaching clinical anatomy. However,
clinical anatomy is restricted only to exterior body markers, allowing the students only mental
depicting of the deeper body structures. Aim of this study was to establish the value of laparoscopy
for visualization of the reproductive organs within the scope of teaching abdominal gross anatomy
of cows, allowing the students live real time image of the abdominal organs and their position in the
abdominal cavity.
For that purpose, we used one non lactating dairy cow, planned for culling. The animal was
lightly sedated with Xylazine (Xyla, Inter Chemie, Holland) 5 mg/100kg BW and left in a standing
position. The left and the right Fossa paralumbalis were selected as the most appropriate site for
trocar insertion. Both regions were surgically prepared and local infiltration anaesthetic was infused
under the skin and in the deeper structures of the abdominal wall. Two stab incisions were made at
distance of 10 cm for trocar insertion. . The sharp trocars were removed and replaced by a 10 mm ×
33 cm, 90° laparoscope (Karl Storz Veterinary Endoscopy) connected to a 300-W xenon light source
(Karl Storz Veterinary Endoscopy) and laparoscopic camera (Karl Storz Veterinary Camera Pal) and
laparoscopic atraumatic Babcock grasping forceps was inserted through the other cannula.
Pneumo peritoneum was achieved with continuous insuflation of filtered air. Following this, the
demonstration was projected on a monitor so that all students could participate, visualize and discuss
the abdominal structures.
In this way, all structures of the cow’s inner reproductive system could be observed, as well as the
caudal sections of the rumen, intestines as well as the urinary bladder with its adnexa. Furthermore,
simultaneously, an assistant attempted to make an endorectal palpation of the uterus and ovaries, in
order to enable the students visualize the procedure.
The dissector had the opportunity to manipulate laparoscopic tools in a live animal closely paralleling
operative experience, and the students had an opportunity to learn abdominal anatomy as well as
some features of the reproductive examination from a clinical perspective.
Laparoscopic examination and dissection of fresh and embalmed cadavers has been used for training
surgeons on new procedures such as colon resection, antireflux procedures, and cholecystectomy.
There is no report of this same technology used in farm animals to teach clinical anatomy or
reproduction. This approach allows first and third-year veterinary medical students to learn the
anatomy while exposing them to the technology currently used in surgical practice, and it affords
students to visualize some examination procedures that are routinely performed by manual endorectal
palpation.
Sažetak
Savladavanje anatomije na veterinarskim fakultetima temelji se na anatomskim preparatima i lešinama
na prve dvije godine studija, a na živim životinjama savaladava se klinička anatomija. Međutim, klinička je
anatomija ograničena samo na vanjske tjelesne oznake, ostavljajući studentu samo zamišljanje i projiciranje
unutarnjih tjelesnih struktura. Svrha ove studije je utvrditi vrijednost laparoskopije u vizualizaciji reproduktivnih
organa, u okviru savladavanja abdominalne makroanatomije krava, omogučujući studentima realni i živi prikaz
trbušnih organa i njihovog položaja u trbušnoj šupljini.
Za tu svrhu koristili smo zasušenu kravu muzaru, namijenjenu isključenju iz uzgoja. Životinja je lagano
sedirana Xylazine-om (Xyla, Inter Chemie, Nizozemska) 5 mg/100kg TT, a prilikom postupka je stajala. Lijeva
i desna paralumbalna jama odabrane su kao najprikladnije mjesto za aplikaciju troakara. Obje regije su kirurški
pripremljene, primjenjena je lokalna infiltrativna anestezija pod kožu te u dublje strukture trbušnog zida. Dvije
ubodne incizije su učinjene s razmakom od 10cm za postavljanje troakara. Oštri troakari zatim su zamjenjeni
10 mm × 33 cm, 90° laparoskopom (Karl Storz Veterinary Endoscopy) spojenim na 300W izvor ksenonskog
svjetla (Karl Storz Veterinary Endoscopy) i laparoskopsku kameru (Karl Storz Veterinary Camera Pal) te
laparoskopskim atraumatskim Babcock forcepsom koji je apliciran kroz drugu kanilu.
Pneumoperitoneum je ostvaren stalnom insuflacijom filtriranog zraka. Nakon toga započela je demonstracija,
projiciranjem slike na monitoru pri čemu su svi studenti mogli sudjelovati, vizualizirati i raspravljati o trbušnim
strukturama.
Na taj način moguće je prikazati sve strukture unutarnjeg reproduktivnog sustava krave, jednako kao
kaudalne partije buraga, crijeva i mokraćnog mjehura sa pripadajućim strukturama. Nadalje, istovremeno je
jedan asistent izvodio endorektalnu palpaciju maternice i jajnika, kako bi omogućio studentima da vide kako se
izvodi taj postupak.
Operater na ovaj način ima mogućnost baratati laparoskopskim instrumentarijem u živoj životinji, živo
simulirajući operativne uvjete, a studenti su imali priliku savladati abdominalnu anatomiju kao i neke osobitosti
reproduktivnog pregleda s kliničkog gledišta.
Laparaskopska pretraga te sekcija svježih i konzerviranih leševa korištena je u edukaciji kirurga novim
postupcima kao što je resekcija kolona, postupci antirefluksa i kolecistektomije. Nema izvješća o istim
postupcima korištenim na farmskim životinjama u edukaciji kliničke anatomije ili reprodukcije. Ovaj pristup
omogućuje studentima prve i treće godine veterine savladavanje anatomije izlažući ih tehnologijama koje se
upravo koriste u kirurškoj praksi, a ujedno im omogućuje vizualizaciju nekih pregleda koji se rutinski izvode
manualnom endorektalnom palpacijom.
Reproduction, Obstretic and Udder Health
Reprodukcija, porodništvo i zdravlje vimena
PREGNANCY TOXEMIA IN EWES: ALTERNATIVE THERAPEUTIC IN
EXTENSIVE SYSTEM CONDITIONS
GESTOSIS OVINA SUBCLÍNICA: ALTERNATIVAS TERAPÉUTICAS EN

CONDICIONES DE EXPLOTACIÓN EXTENSIVA
GRAVIDITETNA TOKSEMIJA U OVACA: ALTERNATIVNA TERAPIJA U

EKSTENZIVNOM OVČARENJU
González Montaña JR1, Cal L2, Benech A2, Lataste V2, Grille L2, Rodas E.2
1. Dpto. Medicina, C. y A. Veterinaria. Facultad de Veterinaria. Universidad de León. León, Spain

2. Facultad de Veterinaria. Universidad de la República. Montevideo, Uruguay
SUMMARY
The objective of this study was compared the efficacy of alternative therapeutics for pregnancy toxemia
ewe cases which can be used in extensive farming conditions. It was used 30 double purpose ewes (meat-
wool) maintained in extensive conditions with local pastures; it was recorded the specific breed date and all
animals had single lamb. At the 130-d of pregnancy, animals were divided in three groups, which were exposed
starved period until glycemia level were reached risk values (28.62±4.33 mg/dl) and animals showed subclinical
toxaemia signs. The feeding was restarted and designed one treatment for each group during four days. The
animals of the first group received once at day 50 ml glucose hypertonic solution (I.V.) and 20 IU of insulin
(S.C.). The second group was applied twice at day 100 ml of glycerol-propilenglycol suspension (P.O.), and
animals of the third group were feeding with 150 g/head/d of grain corn. From 130-d of pregnancy to end of
experiment were determined twice at day glycemia and urine pH values, and once at day seric β-hydroxibutirate
(BOHB) concentration in each animal of all groups. Glycemia values increase in the three groups just after
received treatment, but animals of the second group (glycerol-propilenglycol) showed quickly reestablish of
glucose levels. Before the treatments, BOHB levels were <3.0 mmol/L, which could be subclinical pregnancy
toxemia symptom, however, the BOHB concentration decreased when animals received respective treatment,
especially the glycerol-propilenglycol group’s animals. Similar results were showed for urinary pH values. The
three alternative treatments recorded a good efficacy to recovered glucose and BOHB blood concentrations. The
glycerol-propilenglycol treatment was more efficiency than others.
RESUMEN
Se comparan algunas alternativas terapéuticas aplicadas a la toxemia de la gestación ovina, teniendo en
cuenta que puedan ser aplicadas a ganaderías ovinas extensivas. Se utilizaron 30 ovejas de aptitud carne-lana,
con fecha de cubrición conocida y con un solo feto. Las ovejas se alimentaron exclusivamente con pasto natural.
En el día 130 de gestación se dividieron en tres grupos a los que se sometió a ayuno total de alimento hasta que
la glicemia alcanzó un “valor de riesgo (28,62 ± 4,33 mg/dl)” indicativo de toxemia de gestación subclínica.
Además de reiniciar la alimentación, a cada grupo se le administró uno de los tratamientos ensayados durante 4
días. Al primer grupo se le aplicó 50 ml de glucosa hipertónica i/v junto con 20 UI de insulina s/c/animal/día; al
segundo grupo se trató con glicerol-propilenglicol p/o, 100 ml cada 12 horas y al tercer grupo fue suplementada
su dieta con 150 g/animal/cada 12 horas de maíz triturado. A partir del día 130 de gestación y durante todo el
protocolo experimental se valoraron cada 12 horas la glucemia y el pH urinario y diariamente el ß-hidroxibutirato
(BOHB) sérico. La glucemia se incrementó en los tres grupos al instaurarse los tratamientos, si bien las ovejas
a las que se administró glicerol-propilenglicol normalizaron la glucemia más precozmente. Antes de comenzar
los terapias los valores de BOHB sérico fueron inferiores a 3 mmol/l, que puede ser indicativo de Toxemia de
la gestación subclínica. Tras instaurarse los tratamientos el BOHB disminuyó en todos los grupos. El grupo
tratado con propilenglicol fue el que mostró una disminución más pronunciada y más precoz de este cuerpo
cetónico. El pH urinario evolucionó de forma similar a la mostrada por el BOHB sérico. Los tres tratamientos
ensayados lograron restablecer la concentración normal de glucosa y de ß-hidroxibutirato en sangre, siendo la
administración de glicerol-propilenglicol el que logró normalizar estos parámetros en menor tiempo.
SAŽETAK
Uspoređivana je alternativna terapija primjenjena u gestacijskoj toksemiji ovaca, imajući na umu
da budu primjenjive u ekstenzivnom tipu ovčarenja. Korišteno je 30 ovaca kombiniranih proizvodnih
svojstava (meso-vuna), sa poznatim datumom parenja i sa samo jednim plodom. Ovce su hranjene
isključivo dostupnim prirodnim krmivima. U 130. danu gravidnosti ovce su podijeljene u 3 skupine
koje su podvrgnute alimentarnom postu sve dok razina glikemije nije dosegnula rizični nivo (28,62
± 4,33 mg/dL), indikativan za subkliničku gestacijsku toksemiju. Osim ponovnog započinjanja
hranidbe, svaka je grupa podvrgnuta jednoj od zacrtanih terapija tijekom 4 dana. Prvoj se skupini i/v
apliciralo 50mL hipertonske glukoze zajedno sa 20 i.j. inzulina s/c po ovci na dan. Druga skupina
tretirana je glicerol – propilenglikolom p/o, 100mL svako 12h, a trećoj je skupini obroku bilo
nadodano 150g mljevenog kukuruza po ovci svako 12 sati. Počevši sa 130. danom gravidnosti i
tijekom cijelog eksperimentalnog protokola određivane su razine glikemije i pH urina svako 12h te
serumskog ß-hidroksibutirata (BOHB) jednom dnevno. Razina glikemije je rasla u sve 3 skupine
sa započetim tretmanom, iako se u skupini ovaca u kojih je primijenjen glicerol – propilenglikol ta
razina normalizirala najranije. Prije početka terapije, vrijednosti serumskog BOHB bile su niže od
3mmol/L, što se može smatrati subkliničkom gestacijskom toksemijom. Sa započetom terapijom
došlo je do pada BOHB u svim skupinama. Skupina tretirana propilenglikolom imala je najizraženije
i najranije sniženje tog ketonskog tijela. Urinski pH mijenjao se slično serumskom BOHB. Sva 3
tretmana uspjela su uspostaviti normalnu razinu glukoze i ß-hidroksibutirata u krvi, pri čemu je
aplikacija glicerol – propilenglikola navedene parametre normalizirala u najkraćem vremenu.
SUMMARY
The objective of this study was compared the efficacy of alternative therapeutics for pregnancy toxemia
ewe cases which can be used in extensive farming conditions. It was used 30 double purpose ewes (meat-
wool) maintained in extensive conditions with local pastures; it was recorded the specific breed date and all
animals had single lamb. At the 130-d of pregnancy, animals were divided in three groups, which were exposed
starved period until glycemia level were reached risk values (28.62±4.33 mg/dl) and animals showed subclinical
toxaemia signs. The feeding was restarted and designed one treatment for each group during four days. The
animals of the first group received once at day 50 ml glucose hypertonic solution (I.V.) and 20 IU of insulin
(S.C.). The second group was applied twice at day 100 ml of glycerol-propilenglycol suspension (P.O.), and
animals of the third group were feeding with 150 g/head/d of grain corn. From 130-d of pregnancy to end of
experiment were determined twice at day glycemia and urine pH values, and once at day seric β-hydroxibutirate
(BOHB) concentration in each animal of all groups. Glycemia values increase in the three groups just after
received treatment, but animals of the second group (glycerol-propilenglycol) showed quickly reestablish of
glucose levels. Before the treatments, BOHB levels were <3.0 mmol/L, which could be subclinical pregnancy
toxemia symptom, however, the BOHB concentration decreased when animals received respective treatment,
especially the glycerol-propilenglycol group’s animals. Similar results were showed for urinary pH values. The
three alternative treatments recorded a good efficacy to recovered glucose and BOHB blood concentrations. The
glycerol-propilenglycol treatment was more efficiency than others.
INTRODUCCIÓN
La Toxemia de la Gestación es un trastorno metabólico que afecta a las ovejas preñadas durante
el último tercio de la gestación, especialmente en las últimas seis semanas, como consecuencia de la
incapacidad del organismo para mantener la homeostasis energética al enfrentarse, en esta etapa, a un
balance energético negativo (Harmeyer y Schlumbohm, 2006; West, 1996; González Montaña y Rejas
López, 1995). La causa determinante de esta patología es una alteración del metabolismo energético
y aunque la etiopatogenia no es completamente conocida, esta enfermedad es esencialmente una
forma severa de cetosis, caracterizada por una baja circulación de glucosa en sangre y altos niveles
de cuerpos cetónicos (Rook, 2000; Andrews, 1997).
Se han descrito varios tratamientos para la Toxemia de la gestación, obteniéndose resultados
variables, que además son muy costosos cuando la enfermedad afecta a un número elevados de
animales. La respuesta a los tratamientos son generalmente decepcionantes al ser los resultados,
como hemos indicado, muy variables con alta proporción de mortalidad materna (West, 1996).
Los resultados obtenidos por diferentes autores han sido además contradictorios y a menudo
desconcertantes (Andrews, 1997; Marteniuk y Herdt, 1988).
Únicamente es posible obtener una respuesta efectiva cuando el tratamiento se instaura en
los primeros estadios de la enfermedad, cuando aún no se han establecido lesiones neurológicas
irreversibles y cuando el animal aún no está en decúbito (González Montaña y Rejas López, 1995;
Marteniuk y Herat, 1988; Bonino y col, 1987). Por ello es muy importante el diagnóstico precoz de la
enfermedad, ya que permitirá una terapéutica racional y efectiva. González Montaña y Rejas López
(1995) sugieren que el objetivo prioritario en el tratamiento de esta enfermedad es el aumento de la
formación de glucosa y su utilización a nivel tisular, debiendo incrementar también la utilización de
los cuerpos cetónicos, a lo que Ford (1988), Marteniuk y Herdt (1988) y Bonino y col (1987) agregan
combatir la acidosis y los trastornos hidroelectolíticos. Herdt y Emery (1992) sugieren que la mayor
meta en la terapia de la cetosis es restablecer el apetito normal, lo cual depende de que se restablezca
la concentración normal de glucosa y cuerpos cetónicos en sangre.
MATERIAL Y MÉTODOS
Fueron utilizadas 50 ovejas Corriedale adultas, de entre 4 y 6 años, identificadas por medio de
crotales numerados y dos carneros de la misma raza de 5 años. Se seleccionaron animales con una
condición corporal por encima de 2,5, valorados en un rango de 1 a 5.
Los celos de las ovejas fueron sincronizados con esponjas intravaginales conteniendo 60 mg de
medroxiprogesterona (Sincrovin®, Santa Elena) durante 12 días. Una vez retiradas las esponjas se
realizó el servicio por monta natural usando 2 carneros de la misma raza con arneses marcadores.
Se registró el día de la monta como el día cero (0) de gestación. Entre los días 50 y 70 se realizó el
diagnostico de gestación por ultrasonografia, descartándose las ovejas vacías y las portadoras de dos
o mas fetos, seleccionando de esta forma 30 ovejas gestando un solo feto.
Posteriormente a la cubrición todas las ovejas pasaron a alimentarse durante todo el día a cielo
abierto en una pradera con pasto natural. A los 130 días de gestación fueron divididas al azar en
tres grupos de 10 animales cada uno. A partir de este momento las ovejas de los tres grupos fueron
encerradas en corrales techados con piso de hormigón. Durante el encierro fueron sometidas a un
ayuno total de forraje hasta que la glicemia alcanzó valores considerados de riesgo (28,62 ± 4,33
mg/dl) (Cal Pereyra, 2007). Todos los animales tuvieron agua ad libitum. Al retirarlas del ayuno se
les aplicó uno de los tratamientos siguientes durante 4 días.
Grupo A (n=10): se administraron 50 ml de glucosa hipertónica intravenosa (Dextrolena®, Santa
Elena) junto con 20 UI de insulina en forma subcutánea (Caninsulin®) por oveja y por día. Este
tratamiento se realizó tras obtener las muestras de sangre, a la hora 06:00.
Grupo B (n=10): se administraron 100 ml de glicerol-propilenglicol (Acetolena®, Santa Elena),
vía oral, a cada oveja y cada 12 horas. Estos tratamientos se realizaron después de obtener las muestras
de sangre, a las 06:00 y 18:00 horas.
Grupo C (n=10): se suplementó el pasto con 300 g de maíz triturado a cada oveja repartido en
dos tomas diarias. Estas se suministraron a los animales tras obtener las muestras de sangre (a las
06:00 y 18:00 horas).
A partir del encierro (día 130 de gestación) y hasta terminar los tratamientos se sangraron
diariamente, en yugular, todas las ovejas a la hora 06:00 para valorar ß-hidroxibutirato (BOHB) y
cada 12 horas para determinar glicemia. Estas últimas muestras fueron obtenidas a las 06:00 y 18:00
horas.
La sangre para determinación de glicemia se colectó en tubos con fluoruro de sodio, mientras que
para las demás determinaciones se recolectó en tubos secos, almacenándose hasta su procesamiento.
A partir del encierro y hasta terminar los tratamientos se obtuvieron cada 12 horas, muestras de
orina de todas las ovejas (06:00 y 18:00 horas por el método de apnea momentánea) y se procesaron
inmediatamente mediante el empleo de tiras reactivas de orina (Human-Test Combina®, Human),
para determinar el pH.
Se analizó la significación de las diferencias entre grupos en los niveles séricos de glicemia,
de BHOB y del pH urinario mediante el test de t para grupos independientes con estimaciones
independientes de la varianza. Los análisis estadísticos se realizaron con el programa STATISTICA
6.0. Se consideraron diferencias significativas cuando p<0,05. Todos los valores se presentan como
media ± desviación estándar ( x ± ds).
RESULTADOS
Los valores de glicemia tomados en el momento de retirar a las ovejas del ayuno y comenzar los
tratamientos, así como los tiempos transcurridos desde el comienzo del ayuno hasta alcanzar estos
valores de glicemia en los tres grupos no mostraron diferencias estadísticamente significativas entre
ellos (A = 23,8 ± 5,8, B = 27,2 ± 7,1 y C = 26,7 ± 6,5 mg/dl.
Una vez iniciados los tratamientos los valores de glicemia comenzaron a aumentar en los tres
grupos. En las ovejas pertenecientes al grupo B, la glicemia aumento más precozmente y sus valores
fueron superiores a los de los demás grupos durante todo el tratamiento. La glicemia de este grupo
presentó diferencia estadísticamente significativa (p<0,001) con la del grupo C a las 12 hasta de
comenzado el tratamiento, diferencia que se mantuvo durante 24 horas más. Al comparar la glicemia
de los animales del grupo B con los del grupo A se observa que ésta aumenta anteriormente en el
grupo B, aunque esa diferencia es significativa a partir de las 24 horas de instaurados los tratamientos
(p<0,0001). A partir de este momento y hasta finalizar las terapias, ambos grupos mostraron diferencia
significativa en los valores de glicemia, cuando habían transcurrido 24 horas de aplicar tratamiento en
el grupo A y no mostraron diferencia estadística en aquellos muestreos en los que habían trascurrido
12 horas de aplicar tratamiento en el grupo A. Cuando comparamos la glicemia de los grupos A y C,
vemos que solamente tuvieron diferencia significativa a las 12 horas de instaurada la terapia (p<0,01)
no mostrando diferencias hasta el último muestreo (p<0,001).
Al retirar los animales del ayuno los valores de este cuerpo cetónico no presentaron diferencias
significativas entre los grupos, siendo de 2,32 ± 0,53; de 2,54 ± 0,53 y de 2,62 ± 0,80 mmol/l para
A, B y C respectivamente. En los tres grupos el BHB comenzó a descender una vez aplicados los
tratamientos, aunque este descenso fue más precoz y pronunciado en el grupo B. Ya desde el segundo
día, se encontraron diferencias significativas con el grupo A (p<0,01) y con el grupo C (p<0,05)
diferencias que se mantuvieron hasta el final. Entre los grupos A y C los valores séricos de BHB no
mostraron, sin embargo, diferencia significativa durante todo el ensayo.
Al comienzo del ayuno el pH descendió en los tres grupos. Al iniciar los tratamientos la media de
los valores de pH para los distintos grupos no presentaron diferencias estadísticamente significativas
entre ellos y fueron de 5,8 ± 0,6 de 5,8 ± 0,4 y de 5,6 ± 0,5. El pH comenzó a ascender a las 24 horas
de iniciados los tratamientos en los grupos A y B, mientras que en el grupo C este ascenso comenzó
12 horas más tarde, sin que esta diferencia fuera significativa.
DISCUSIÓN
Si tenemos en cuenta los valores medios observados en la glicemia y el BOHB en el momento de
retirar las ovejas del ayuno (glicemia: A = 23,8 ± 5,8; B = 27,2 ± 7,1 y C= 26,7 ± 6,5 mg/dl; BOHB:
A = 2,32 ± 0,53; B = 2,54 ± 0,53 y C = 2,62 ± 0,80 mmol/l) y que no se observaron síntomas clínicos,
podemos asumir que estos animales previo al comienzo de los tratamientos, se encontraban en una
Toxemia de la gestación subclínica (Duffield, 2000).
Considerando que uno de los objetivos prioritarios del tratamiento de la Toxemia de la gestación
es el aumento de la glicemia (González Montaña y Rejas López, 1995; Herdt y Emery, 1992;
Marteniuk y Herdt, 1988), se observa que una vez iniciado los tratamientos la glicemia comenzó a
aumentar en los tres grupos experimentales. Sin embargo en las ovejas tratadas conjuntamente con
glucosa intravenosa e insulina y en las tratadas con glicerol-propilenglicol, este ascenso fue más
precoz que en las ovejas tratadas mediante la suplementación con maíz. Esta diferencia se puede
explicar si tenemos en cuenta las distintas velocidades de absorción y/o transformación en glucosa de
los precursores utilizados para el tratamiento. En respuesta al tratamiento con glicerol-propilenglicol
la glicemia se elevó de 32,2 ± 13,5 a 58,6 ± 8,6 mg/dl a las 12 horas de iniciado el tratamiento. El
propilenglicol, es absorbido en su mayoría intacto directamente desde el rumen a una tasa de 40
% por hora (Herdt y Emery, 1992) y alcanza su nivel máximo en sangre dentro de los 30 minutos
de su administración, logra su máxima conversión en glucosa sanguínea alrededor de las 4 horas
después de su administración. Cuando a las ovejas se les administró maíz, la glicemia se elevó
de 33,0 ± 11,5 a 36,0 ± 16,1 mg/dl a las 12 horas de iniciado el tratamiento, alcanzando los 54,0
± 13,0 mg/dl a las 48 horas de iniciado el mismo. El maíz al administrarse como suplemento del
forraje debe primero ser atacado por los microorganismos ruminales y transformado en ácidos grasos
volátiles, especialmente ácido propiónico. El propionato una vez formado, debe ser absorbido a nivel
de las papilas ruminales, siendo en parte transformado en lactato en la pared del rumen y ambos son
transformados en glucosa en el hígado vía neoglucogénesis. Los valores de glucosa en sangre de
las ovejas del grupo tratado con glicerol-propilenglicol fueron superiores a los de los demás grupos
durante todo el tratamiento. Este comportamiento de la glucosa es debido a que mientras que el
propilenglicol produce un incremento rápido de la glucosa, el glicerol es degradado lentamente en el
rumen produciendo una elevada proporción de propionato, principal precursor de la glucosa vía NG,
dando como resultado una elevación de la glicemia por un período relativamente prolongado (Bonino
y col, 1987; Hunt, 1976). Las ovejas tratadas con glucosa intravenosa no lograron mantener una
concentración de glicemia estable, produciéndose elevaciones rápidas post-administración seguidas
de importantes descensos de la misma Este mismo comportamiento de la glicemia fue descrito por
González Montaña y col (2001) quienes lo atribuyeron a la eliminación renal de glucosa cuando ésta
se administró vía intravenosa.
Teniendo en cuenta que otro de los principales objetivos del tratamiento de la Toxemia de la
gestación es restablecer la concentración normal de cuerpos cetónicos en sangre (González Montaña
y Rejas López, 1995; Herdt y Emery, 1992) los resultados de este experimento muestran que si bien
el BOHB sanguíneo descendió en los tres grupos experimentales una vez aplicados los tratamientos,
este descenso fue más precoz y pronunciado en las ovejas tratadas con glicerol-propilenglicol,
observándose además que en estos animales el BOHB se mantuvo significativamente más bajo
durante todo el ensayo.
Si observamos el comportamiento del pH urinario después de iniciados los tratamientos vemos
que presentó una tendencia paralela a la del BOHB en sangre. Como era de esperar a medida que
disminuía el BOHB sanguíneo aumentaron valores del pH urinario.
REFERENCIAS
Andrews A (1997). Pregnancy toxaemia in the ewe. In Practice, 19, 6, 306-312.
Bonino J, Sienra R, Sorondo L (1987). Enfermedades causadas por trastornos metabólicos: toxemia de la preñez.
En: Enfermedades de los lanares II. Ed. Bonino J, Durán del Campo A, Mari J, Hemisferio Sur, 239-265.
Cal Pereyra L (2007). Inducción Experimental de Toxemia de la Gestación Ovina. Aplicación a la explotación
ovina en Uruguay. Tesis Doctoral. Universidad de León, León, España.
Duffield T (2000). Subclinical ketosis in lactating dairy cattle. Vet Clin of North Am: Food Animal Practice, 16,
2, 231-251
Ford E J (1988). Toxemia de la gestación En: Martin W B, Enfermedades de la oveja. Ed. Acribia, Zaragoza,
159-164.
González-Montaña J R, Rejas López J (1995).Toxemia de la Gestación. Med Vet, 12, 9, 513–522.
González Montaña J R, Alonso Diez A J, López Mendez S, Cal Pereyra L, Prieto Montaña F (2001). Utilización
de la glucosa vía oral para el tratamiento de la gestosis ovina. Fase preliminar. En: IX Congreso Internacional
de la Federación Mediterranea de Sanidad y Producción de Rumiantes, León, España.
Harmeyer J, Schlumbohm C (2006). Pregnancy impairs ketone body disposal in late gestating ewes: Implications
for onset of pregnancy toxaemia. Research in Veterinary Science, 81, 2, 254-264.
Herdt T H, Emery R S (1992). Therapy of diseases of ruminant intermediary metabolism. Vet Clin of North Am:
Food Anim Pract, 8 ,1, 91-106.
Hunt E R (1976). Treatment of pregnancy toxaemia in ewes by induction of parturition. Australian Veterinary
Journal, 52, 338-339.
Marteniuk J V, Herdt T H (1988). Pregnancy toxemia and ketosis of ewes and does. Vet Clin of North Am: Food
Animal Pract, 4, 2, 307-315.
West H J (1996). Maternal undernutrition during late pregnancy in sheep. Its relationship to maternal condition,
pregnancy length, hepatic physiology and glucose metabolism. Br J Nutr, 75, 593-605.
A Survey of Teat End Hyper Keratosis Prevalence in the
Tabriz Dairy Herds
Hiperkeratoza sisa u stadima mliječnih krava u

provinciji Tabriz
Hamali H.1, S. Mosafery2

1
Department of Clinical Sciences, Faculty of Veterinary Medicine, University of Tabriz, Iran, Fax:
+984113357834, E-mail: hamali@tabrizu.ac.ir
2
Department of Clinical sciences, Faculty of Veterinary Medicine, University of Tabriz Azad Islamic, Iran
Abstract
Teat end hyperkeratosis is a very important problem which affects cows in the farms of Iran and many other
countries. This disease mainly caused by the over milking and defects in the milking machine function. In a
survey focusing on the 4 large dairy Holstein herds in suburb of Tabriz (north-west of Iran), prevalence of teat
end hyperkeratosis, was evaluated. In the herds of A (n=300) and B (n=160), cows were milked 3 times/day. In
the herds of C (n=162) and D (n=190) cows were milked 2 times/day. Prevalence of the teat end hyperkeratosis
in the herds of A and B were recorded as 63.38%. In the herds of B and C this prevalence was 24.86%. Also,
according to the wilson’s grading schedule (1986) the grades of 2 and 3 of hyperkeratosis more prevalent
between the cows which were milked 3 times/day, than cows milked 2 times/day. Statistical analyses indicated
significant differences between the herds of A and B (3 times milking/day) and herds of C and D (2 times
milking/day). In conclusion, according to our results, significant relationship exists between the cow’s teat end
hyperkeratosis and milking frequency/day.
Key words: Hyperkeratosis, Holstein, milking, cow, teat
Sažetak:
Hiperkeratoza vrha bradavice je ozbiljan problem koji zahvaća mliječne krave u Iranu i mnogim drugim
zemljama. Bolest je najčešće uzrokovana zbog prekomjernog dojenja te greškama u strojevima za mužnju.
Ispitivanja su provedena na 4 velike farme mliječnih Holstein goveda u okolici Tabriza ( sjevero-zapadni dio
Irana). U stadima A (n=300) i B (n=160) krave su mužene 3 puta dnevno. U stadima C (n=162) i D (n=190)
krave su mužene 2 puta dnevno. Učestalost hiperkeratoze u stadima A i B iznosila je 63.38%. U stadima Bi
D učestalost je bila 24.86%. Prema Wilsonovoj klasifikaciji (1986) 2. i 3. stupanj hiperkeratoze učestaliji su
između krava koje su mužene 3 puta dnevno nego kod krava koje su mužene 2 puta dnevno. Statističke analize
ukazuju na značajne razlike između stada A i B ( mužene 3 puta dnevno) i stada C i D ( mužene 2 puta dnevno).
Zaključno, u skladu sa našim rezultatima postoji signifikantna povezanosz između hiperkeratoze vrha bradavice
i broja mužnji po danu.
Ključne riječi: Hiperkeratoza, Holstein, mužnja, krava
Introduction
Milk production in the dairy farms is the basic economic source, which guaranties the life span
of these farms. Therefore udder of the cow is the most important organ, which may be attacked by
environmental or infectious pathogens. In this case, the main entrance for pathogens is the teat end
orifice. Naturally, teat end have many defensive mechanisms, including sphincter and keratinized
epidermis, which later one, is extended into the teat canal (4). After every milking, keratinized
epidermis, excretes some keratin which in turn closes the sphincter orifice by forming a keratinized
plaque(10). Hyper stimulation of the teat end by over milking, defects in milking machine function,
and unsuitable teat dippers utilization, lead to teat end hyperkeratosis (11). On the other hand, keratin
projection from the teat sphincter, will be result in colonization of pathogens such as Fusobacterium
necroforum, and finally lead to diseases such as black spot and acute mastitis.
The objective of this research was evaluation of teat end hyperkeratosis prevalence in the Tabriz
dairy herds and indication of its probable relationship with milking frequency/day.
Material and method

This research was carried out on May 2007 in the four large dairy herds (A, B, C and D) of Tabriz
suburb (north-west of Iran) with the Mediterranean climate and nearly 2000 meter altitude above sea
level.
Herd A, included of 300 dairy Holstein cows, with mean milk production of 32Kg/day/cow and
3 times milking/day (8 am and 14, 22 pm). Herd B, included of 160 dairy Holstein cows, with mean
milk production of 30 kg/day/cow and 3 times milking/day (5 am and 13, 21 pm).
Herd C, included of 162 dairy Holstein cows with, mean milk production of 28 kg/day/cow and
2 times milking/day (8 am and 16 pm).
Herd D, included of 190 dairy Holstein cows with mean milk production of 31 kg/day/cow and
2 times milking/day (7 am and 17 pm).
Nutrition of herds was the same and consisted of hay, corn, cottonseed, concentrates and mineral
supplements.
In all of the herds, milking procedure was performed by West Valia Company milking
machines,
Before the milking, teats of the cows were washed and dried by special papers and then, were
inspected very carefully and categorized according to the Wilson’s grading schedule.
According to this schedule, grade 1, is the normal teat end, and grade 4 is the maximum teat end
hyperkeratosis.
Finally, collected data were analyzed by soft ware of SPSS version 13 and statistical method of
chi-square and Mann-Whitney tests.
Results
Summarize of results are shown in figures (Fig.1, Fig.2, Fig.3 and Fig.4). Overall rate of teat end
hyperkeratosis in the 4 groups (a total number of 807 cows) was 43.84% (fig 5-1).
54 53.16
52
50 Ne g itive
46.84 Ne g itive
48 Po s itive 53.16
46.84 Po s itive
46
44
42
Fig.1. Prevalence of teat end hyperkeratosis in all of the herds (A, B, C and D)
But in detail, the rate of teat end hyperkeratosis in the groups of 2 time’s milking/day/cows was
24.86% and in the groups of 3 time’s milking/day/cows was 63.68% (Fig.2 and Fig.3).
80 75.14
60 24.86
Ne g itive
Ne g itive
40 Po s itive
Po s itive
24.86 75.14
20
Fig.2. Prevalence of teat end hyperkeratosis in the herds with 2 times milking/day (C and D)
70
63.68
60
50
36.32
Ne g itive Ne g itive
40 63.68
Po s itive Po s itive
30 26.32
20
10
0
Fig.3. Prevalence of teat end hyperkeratosis in the herds with 3 times milking/day (A and B)
The rates of teat end hyperkeratosis in the two groups analyzed by Crosstab and Chi-square
tests. The difference between two groups of cows (3 times milking/day vs 2 times milking/day) was
significant (P<0.01) (Table 1 and Table 2).
Table 1. Comparing the rates of teat end hyperkeratosis in the 2 and 3 times milking/day herds by crosstab
tests (Crosstab)
MILKING
Total
3 2
Negative Count 248 181 429
Disease
Expected conunt 296.1 132.9 429.0
% within Disease 57.8% 42.2% 100.0%
% within MILKING 44.5% 72.4% 53.2%
% of Total 30.7% 22.4% 53.2%
Positive Count 309 69 378
% within Disease 81.7% 18.3% 100.0%
% within MILKING 55.5% 27.6% 46.8%
% of Total 38.3% 50.6% 46.8%
Total Count 557 250 807
% within Disease 69.0% 31.0% 100.0%
% within MILKING 100.0% 100.0% 100.0%
% of Total 69.0% 31.0% 100.0%
Table 2. Comparing the rates of teat end hyperkeratosis in the 2 and 3 times milking/day herds
by Chi-Square Tests (P<0.01) Chi-Square Tests
Asymp. Sig. Exact Sig. Exact Sig.

Value df
(2-sided) (2-sided) (1-sided)
Pearson Chi-Square 53.848b
1 .000
Continuity Correctiona 52.735
1 .000
Likelihood Ratio 55.474
1 .000
Fisher’s Exact Test Linear-by-
.000
LinearAssociation 53.782 .000
1 .000
N of Valid Cases 807
a.Computed only for a 2×2 table
b.0 cells (.0%) have expected count less than 5. The minimum expected conunt is 117.
10.
On the other hand, according to the Wilson’s grading schedule, the rate of grades 2 teat end
hyperkeratosis was more prevalent than grades 3 and 4, in the herds (fig.4).
35 33.4
30
25
20
15 12.8
10
5
1.5
0
G2 G3 G4
Fig.4. Prevalence of grades 2, 3 and 4 in the herds (A,B, C and D)
By using the Mann-Whitney U test for all of the quarters, it was revealed that, the intensity of
teat end hyperkeratosis in the 3 times milking/day cows is more than of 2 times milking/day cows
(P<0.01) (table 3).
Table 3. Comparing intensity of the hyperkeratosis in the herds with 2 and 3 times/day by Mann-Whitney U
tests (P<0.01) Ranks
Milking N Mean Rank Sum of Ranks
Rcr 3 456 444.02 202471.50

2 350 350.71 122749.50
Total 506
Rca 3 457 454.99 207930.50
2 349 336.08 117290.50
Total 806
Lcr 3 456 444.13 202525.00
2 349 349.26 121890.00
Total 805
Lca 3 456 440.46 200852.00
2 350 355.34 124369.00
Total 806
Test Statisticsa
Rcr Rca Lcr Lca
Mann-Whitney U 61324.500 56215.500 60815.000 62944.000
Wilcoxon W 122749.5 117290.5 121890.0 124369.0
Z -7.533 -9.233 -7.763 -6.975
Asymp. Sig. (2-tailed) .000 .000 .000 .000
a. Grouping Variable: milking
Discussion
Teat end hyperkeratosis is a very important complication in the dairy herds of Iran and many
other countries. Wilson (1986), categorized the forms of teat end hyperkeratosis into 4 grades, which
grade 1 was the normal teat end and grade 4 was the teat end with the maximum hyperkeratosis (9).
In the 2004, Gleeson and William in a study, reported that, the rate of teat end hyperkeratosis in the
Irish Holstein dairy herds is 31.4%, and the rates of grades 2,3 and 4 hyperkeratosis are 20%, 5.5%
and 0.5% respectively (6).
Kirk (2004) reported that, the rate of teat end hyperkeratosis in the dairy farms of California is
23.8% and the rates of grades 2, 3 and 4 are 24%, 4.4% and 0.25% respectively (7).
In contrast with the above mentioned data, our results showed high rate teat end hyperkeratosis
prevalence in the Tabriz dairy herds, especially in the herds with 3 times milking/day.
Also, the rates of grades 2, 3 and 4 teat end hyperkeratosis more prevalent than of other countries
(3).These differences partly are related to the utilization of non-standard milking machines and
non-standard teat dippers. But the most important factor in this case, is the milking frequency/day
(Fig4).
The following factors could be affec the rate of teat end hyperkeratosis in a herd (1, 2):
1- Teat shape: convex teat ends are more susceptible to the hyperkeratosis than flat teat ends.
2- Incidence of teat end hyperkeratosis is more prevalent in the cold seasons (winter and
spring), than warm seasons.
3- Defect in the milking machine function, directly lead to hyperkeratosis.
4- Hyper sensitivity to the teat dippers could be cause hyperkeratosis.
5- Increases in the cow age.
6- High milk production.
7- Finally according to our results, milking frequency/day has a direct effect on the rate of teat
end hyperkeratosis in the herds (Tables 1 and 2). In other word, Increase in the milking frequency/day
lead to increase in the teat end hyperkeratosis and consequent diseases such as black spot and mastitis
in the herd.
References
1. Andrews, A.H., Blowey, R.W., Boyd, H., Eddy, R.G., 1992, Bovine medicine disease and husbandary of
cattle, Sanders London, pp: 7-28.
2. Blowey, R., Edmondson, P.,1995, Mastitis control in dairy herds an illustrated and practical guide, pp: 32-
68.
3. Bakken, G., 1981, Relationship between udder and teat morphology, mastitis and milk, production in
Norwegian Red cattle. Acta Agric, pp: 25-32.
4. Craven, N, & Williams, M.R., 2004, Defences of the bovine mammary gland against infection and prospects
for their enhancement. Veterianry Immunology and Immunopathology, pp: 10-71.
5. Dyce, Sack, Wensing, 1995, Text book of veterinary anatomy. By W. B. Sanders Company. pp: 9-45.
6. Gleeson, David, E., Meaney, J., William, 0., 2004, Callaghan Edmond J, Rath. Mylesv, Effect of teat
hyperkeratosis on somatic cell counts of dairy cows - teagasc, moorepark production center, fermoy, co,
cork, Ireland -vol: 2, No 2, pp: 41-52.
7. Kirk, John H., 2003, Risk factors for Excessive Hyperkeratosis of teat end- Extension veterinarian school
of medicine university of California Davis Tulare. C A, pp: 16-26.
8. Mein, G.A, Neijenhuis, F., Morgan, W.F., Reinemann, D.J., Hillerton, J.E., Baines, J.R., Ohxstad, I.,
Rasmussen, M.D., Timms, L., Britt, J.S., Farnsworth, R., Cook, N., Hemling, T., 2001, Evaluation of bovine
teat condition in commercial dairy herds (Non infectious Factors) - Teat ceub international of Netherlands,
pp: 28-35.
9. Neijenhuis, F., Mein, G.A., Britt, J.S., Reine, unn. DJ., Hillerton, J.E., Faransworth, R., Baines, J.R.,
Hemling, T., ohnstad, I., Cooks, N.B., and Morgan, W.F., 2001, Relationship between teat-end callosity or
hyperkeratosis and mastitis, Paper presented at the proceeding, AABP-NMC International symposium on
Mastits and milk quality, Vancouver, bcm Canada, September, pp: 41-50.
10. Radostits, M., Otto, Y., 2000, Veterinary Medicine, Sanders London, pp: 46-59.
11. Shearn, M.F., Hillerton, J .E., 2002, Hyperkeratosis of the teat duct orifice in the dairy cow, Institute for
animal health, Compton laboratory, Newbury, U.K pp: 18-25.
12. Swenson, K., Melvin, J. and Reece., William, O., 1996, Duke’s Phisiology of domestic animals eleventh
edition. By Cornell university, pp: 34-49.
PERACUTE STAPHYLOCOCCUS AUREUS MASTITIS IN EWES
PERAkutni STAPHYLOCOCCUS AUREUS MASTITIS u ovaca
Pengov A*, Podpečan O.**
*Institute for microbiology, Veterinary faculty of Ljubljana, Gerbičeva 60, 1000 Ljubljana, E-mail: andrej.
pengov@vf.uni-lj.si
** Savinjska veterinarska postaja, Celjska c. 3/a 3310 Žalec, Slovenia
Abstract
Staphylococci are the main etiological agents of intramammary infections in ewes. Staphylococcus aureus
is the predominant organism isolated in ovine clinical mastitis, while coagulase-negative staphylococci,
traditionally considered as non-pathogenic or of low pathogenicity for the mammary gland of domestic
ruminants, are the most prevalent isolates in subclinical intramammary infections. The annual incidence of
clinical mastitis in ewes is usually lower than 5%, however severe mastitis outbreaks caused by Staphylococcus
aureus are not uncommon. Antibiotic therapy regimes generally formulated for the bovine mammary gland
are often unsuccessful in eliminating existing Staphylococcus aureus udder infections. At the time of weaning
and start of milking (6-8 weeks after parturition) in a flock of 180 dairy ewes, 29 cases of peracute gangrenous
clinical mastitis appeared, during a 10 days period. In 26 cases (90%), Staphylococcus aureus was determinate
as the causative agent. In the described case, diseased animals were treated intramammary and parenteral with
a cephalosporin preparation designed for cows, immediately after detection of inflammatory changes in the
mammary gland. Despite of immediate treatment, which was based on results of laboratory findings, 9 of the
animals (31%) died, 14 (48%) lost the affected udder half and only in 6 cases (21%) functional recovery was
achieved.
Key words: clinical mastitis, ewes, Staphylococcus aureus, treatment
Sažetak:
Stafilokoki su glavni etiološki uzročnici intramamarnih infekcija u ovaca. Staphylococcus aureus je
najčešće izolirani mikroorganizam u ovaca sa kliničkim mastitisom, dok se koagulaza negativni stafilokoki
nalaze ka one patogeni ili slabo patogeni mikroorganimi najčešće u ovaca sa subkliničkim mastitisom. Godišnja
učestalost klinički evidentnog mastitisa u ovaca je obično manja od 5%, isto tako učestalog teških oblika
mastitisa uzrokovanog sa Staphylococcus aureus nije učestala. Antibiotici koji se koriste u liječenju mastitisa
kod krava često ne uspijevaju eliminirati infekciju vimena ovaca uzrokovanih sa Staphylococcus aureus. U
vrijeme odbića te početkom sisanja u stadu od 180 mliječnih ovaca zabilježili smo 29 slučajeva gangrenoznog
mastitisa u razmaku od 10 dana. U 26 slučajeva izoliran je Staphylococcus aureus . Oboljele životinje liječene
su intramamarnom I parenteralnom aplikacijom cefalosporina namijenjenim za liječenje mastitisa kod krava.
Unatoč brzo započetom liječenju 9 životinja je uginulo, 14 životinja je uzgubilo vime a kod samo 6 životinja
zamijećen je potpuni oporavak.
Ključne riječi: Klinički mastitis, ovce, liječenje, Staphylococcus aureus
INTRODUCTION
The increasing demand for ewe’s milk and milk products has been reflected in recent years in
fresh interest in raising small ruminants. With increasing production and the introduction of more
intensive breeding methods, questions connected with inflammation of the udder and the quality of
milk from small ruminants have become more actual in the last decade (Pengov, 2001).
The incidence of clinical mastitis cases is mostly less than 5%, both in dairy and in meat flocks
of ewes. As a general rule, the overall level of infection within a flock is consistently less than that
found in a herd of dairy cows. Where ewes are used primarily for meat production outbreaks, mostly
associated with some predisposing factors (teat lesions), have been reported occasionally. When
ewes are milked commercially the prevalence of clinical and subclinical mastitis is usually higher.
As it is the case in dairy cows, the increase in milk production by dairy ewes has resulted in a similar
increase in the prevalence and severity of mastitis and other diseases of the udder (Watson and
Buswell, 1984).
In spite of the variety of organisms, which may be isolated from the ovine udder, there is a basic
pattern of distribution, which pertains, in broad terms, irrespective of geographical location, but is
affected to some degree by the stage of lactation at which udders are sampled. Thus, regarding clinical
mastitis Staphylococcus aureus is the predominant organism, with Pasteurellaceae, Corynebacteria,
Streptococci and Mycoplasmas of secondary importance (Kirk et al., 1996). Coagulase-negative
staphylococci, which have been previously considered to be non-pathogenic, are definitely capable
of producing clinical mastitis in ewes and are the most prevalent causative agent isolated from
subclinical mastitis cases (Albenzio et al., 2002).
Clinically, mastitis in small ruminants is normally connected with serious disorders in the general
health state of the animal resulting in the animal’s death or in complete or partial sloughing of the
udder (Calavas et al., 1998).
The objective of the present study was to describe an outbreak of peracute gangrenous mastitis in
a separate sheep flock, to elucidate the causes and to establish reasonable treatment regimes.

Animals. At the time of the mastitis outbreak 180 ewes (domestic dairy breed) were included in
the described flock. During a 10 days period 29 cases (16% of the animals in the flock) of peracute
clinical mastitis appeared. In 26 (90%) cases, Staphylococcus aureus was isolated as the causative
agent.
Bacteriology. Immediately before treatment, milk samples from the infected udder halves, were
collected into autoclaved glass tubes following teat swabbing with 70% alcohol and after discarding
the first streams of milk. The samples were kept cool and streaked, using a sterile swab, within
24 hours on quarter plates of washed ovine blood agar and were incubated at 37oC. Plates were
examined at 24 and 48 hours for aerobic bacterial growth. Gram-positive cocci were considered as
Staphylococcus or Micrococcus species if they were catalase-positive. Differences in haemolysin
production were classified visually by an experienced observer as either β-haemolysin-positive
(incomplete haemolysis with a sharply defined margin) or β-haemolysin-negative (no haemolysis or
another type of haemolysis) (Jasper and Jain, 1966).
The slide coagulase test was performed as described by the manufacturer of the rabbit coagulase
plasma (Difco). The slide coagulase test, which detects bound coagulase, was considered positive if
clumping was observed within 10 s. If the reaction was weak, or if it occurred after 10 s, the sample
was judged as doubtful (Lam et al., 1995).
To determine Staphylococcal isolates at the species level the API-Staph test (Bio Merieux) was
used (Jasper et al., 1985).
Antimicrobial susceptibility testing. The agar diffusion test was used to determine the antimicrobial
susceptibility of the isolated S. aureus strains. With a sterile loop the tops of 4-5 colonies of S. aureus
from pure culture were picked up. The colonies were suspended in 5 ml of sterile physiologic saline.
The inoculum turbidity was standardized to equivalent of a 0,5 McFarland standard. The entire
surface of a Mueller-Hinton agar plate was inoculated using a sterile swab. Disks containing various
antibiotics (penicillin, ampicillin, cefquinome, amoxicillin/clavulanic acid and kanamycin) were
placed using a sterile forceps onto the agar surface and gently pressed down to ensure contact. Plates
were incubated at 35oC for 20 hours. Subsequently the diameter of the zone of inhibition around each
disk was measured. This procedure is conforming to the National Committee for Clinical Laboratory
Standards (NCCLS) documents M31-A2 and M2-A7.
Treatment protocol. In the described mastitis outbreak, all animals were treated intramammary
and parenteral with a cephalosporin preparation designed for cows. For intramammary applications
a complete syringe for each udder half was used. For parenteral treatment doses prescribed by the
manufacturer were used. In all cases treatment was introduced immediately after the finding of
inflammatory changes in the udder. The infected udder halves were treated at least for five days (at
ten consecutive milking) and within this period animals received also two intramuscular injections.
In the most severe cases the therapy was supported with intravenous applications of trimethoprim.

The factors predisposing to peracute gangrenous mastitis outbreaks in sheep flocks are not
always clearly evident. Ruminants are unique in that they have a “dual” digestive system: microbial
fermentation and digestion in the rumen and intestinal digestion similar to other mammals.
Especially the rumen digestion is very sensitive to rapid changes in nutrition. In high producing
animals, disturbances in the general metabolic processes can have a severe influence on the function
of the mammary gland (Bocklisch and Wetzstein, 1994). Heavy feeding for increased production
can produce clinical mastitis in animals where subclinical mastitis or latent infections had existed
previously.
In our case, several days before the outbreak of mastitis, the owner of the flock practically
overnight changed the feed ration. The sheep were in that period on fresh pasture, and the ration was
supplement with hay and protein concentrates. Unbalanced rations in the most vulnerable period after
parturition in connection with a number of physical and psychological stressors can be undoubtedly a
serious risk factor for the development and course of udder infections (Maisi et al., 1987).
The described mastitis outbreak was characterized by a sudden onset at the time of weaning;
good milking ewes were particularly affected. Animals were depressed; anorexia and an increased
body temperature (41oC and more) were also present. At the early stage of the disease hyperaemia,
swelling, pain and severe oedema of the infected udder half was observed. Sick animals remained
behind the flock. In the following days two different clinical courses of the disease became evident.
Table 1: Prevalence of clinical and subclinical mastitis in the flock over a five year period
ANIMALS CLIN. M. S.aureus SUBCL. M. S.aureus

YEAR
N N % N % N % N %
2001 157 9 (5,7%) 7 (4,5%) 29 (18,5%) 7 (4,5%)
2002 168 11 (6,5%) 8 (4,8%) 24 (14,3%) 3 (1,8%)
2003 180 29 (16,1%) 26 (14,4%) 16 (8,9%) 6 (3,3%)
2004 195 7 (3,6%) 4 (2,1%) 22 (11,3%) 6 (3,1%)
2005 209 5 (2,4%) 5 (2,4%) 19 (9,1%) 5 (2,4%)
Clin. m. = Clinical mastitis; Subcl. m. = Subclinical mastitis
Table 2: Mastitis outbreak (2003)
N %
TOTAL NUMBER OF CLINICAL
29 100
CASES
ISOLATION OF
26 89,7
S. AUREUS
GANGRENOUS FORM 16 55,2
In the majority of cases the gangrenous form developed and despite the immediate treatment,
which was based on results of laboratory examinations, 9 of the animals (31%) died during the first
five days. In 16 (55%) cases a separation of the gangrenous tissue occurred, which gradually falls off.
This process lasted a number of weeks and, during this time, the animals constantly lost weight. In
the remaining cases an indurative process was observed, edema of the udder and the blue coloration
of the skin gradually fade, but because of induration, the diseased udder half was lost. For economic
reasons, these animals were no longer suitable for further breeding after recovery.
Table 3: Antimicrobial drug susceptibility (Agar disk diffusion test) N = 26
ANTIBIOTIC S I R
% % %
Penicillin 73,1 26,9
Ampicillin 76,9 23,1
Kanamycin 88,5 11,5
Amoxicillin/clav.acid 92,3 7,7
Cefquinome 96,2 3,8
S = Sensitive; I = Intermediate; R = Resistant
Table 4: Treatment results
N %
NUMBER OF TREATMENTS 29 100
COMPLETE CURE 6 20,7
CULLING AFTER RECOVERY 14 48,3
DEATH 9 31,0
Staphylococcus aureus mastitis in ewes is in most cases clinically identical with the peracute
form in cattle (Bergonier et al., 2003). The course of the disease is rapid and its effects severe.
Treatment is therefore invariably directed at saving the life of the ewe in the full knowledge that
lesions within the affected udder tissue are often irreversible (Buswell and Barber, 1989). However,
early detection of clinical signs and immediate treatment, sometimes enable functional recovery of
infected udder halves.
CONCLUSIONS
Considering the achieved recovery rate in the present study, the average mastitis treatment costs
exceeded the culling value of the animals. Because of the unpredictable course of the disease and
consecutive low cure rates concerning ewes mastitis, permanent and effective prophylaxis is even
more important than in other animal species.
REFERENCES
1. Albenzio, M., Taibi, L., Muscio, A., Sevi, A., 2002. Prevalence and etiology of subclinical mastitis in
intensively managed flocks and related changes in the yield and quality of ewe milk. Small Rumin. Res.
(43) 219-226.
2. Bergonier, D., De Cremoux, R., Rupp, R., Lagriffoul, G., Berthelot, X., 2003. Mastitis of dairy small
ruminants. Vet. Res. (34) 689 - 716.
3. Bocklisch, H., Wetzstein, D., 1994. Klinische, labordiagnostische und therapeutische Untersuchungen zur
Mastitis in einem großen Schafzuchtbestand. Tierärztl. Prax. (22) 524-528.
4. Buswell, J.F., Barber, D.M.L., 1989. Antibiotic persistence and tolerance in the lactating sheep following a
course of intramammary therapy. Br. Vet. J. (145) 552-557.
5. Calavas, D., Bugnard, F., Ducrot, C., Sulpice, P., 1998. Classification of the clinical types of udder disease
affecting nursing ewes. Small Rumin. Res. (29) 21-31.
6. Jasper, D.E., Jain, N.C., 1966. Hemolytic behaviour of staphylococci isolated from cows milk. Can. J.
Comp. Vet. Med. Sci. (30) 63-70.
7. Jasper, D.E., Infante, F., Dellinger, J.D., 1985. Efficacy of the API Staph-Ident system for identification of
staphylococcus species from milk. Am. J. Vet. Res. (46) 1263-1267.
8. Kirk, J.H., Glenn, J.S., Maas, J.P., 1996. Mastitis in a flock of milking sheep. Small Rumin. Res. (22) 187-
191.
9. Lam, T.J., Pengov, A., Schukken, Y.H., Smit, J.A.H., Brand, A., 1995. The differentiation of Staphylococcus
aureus from other Micrococcaceae isolated from bovine mammary glands. Appl. Microbiol. (79) 69-72.
10. Maisi, P., Junttila, J., Seppänen, J., 1987. Detection of subclinical mastitis in ewes. Br. Vet. J. (143) 402-
409.
11. Pengov, A., 2001. The role of coagulase-negative Staphylococcus spp. and associated somatic cell counts
in the ovine mammary gland. J. Dairy Sci. (84) 572-574.
12. Watson, D.J., Buswell, J.F., 1984. Modern aspects of sheep mastitis. Br. Vet. J. (140) 529-534.
Onset of ovulation analysis in dairy cows
Analiza vremena nastupa ovulacije u mliječnih

plotkinja
Zobel Robert (1), Darko Gereš (2), Romana Turk (2), Damjan Gračner (2), Damir
Žubčić (2)
(1)Vetmed d.o.o. Stružec,

(2) Veterinarski fakultet Sveučilišta u Zagrebu
ABSTRACT
The research was conducted from December, 1st 2004 to December, 1st 2006, in Moslavina, a part of
Sisak-Moslavina county situated in Central Croatia. Veterinary service in this concession area are covered by
the veteinary ambulance VETMED Ltd. In their covering area there are over 2000 dairy cows and heifers.
The research has included 1088 cows , 218 heifers and 870 cows. 598 (54,96%) of them were symenthal
breed, 27,39% were holstein-friesian breed , 9% were red holstein, 2,57% were montafon breed and 6,1% were
crossbred, dominantly in the type of holstein friesian breed. After detecting the beginning of oestrus, the cows
were examined gynecologicaly and by using of ultrasound, in the morning and in the evening. According to
the findings, they have been inseminated artificially, till gynecological and ultrasound detection of ovulation.
Cows with reproductive disorders weren’t observed, but only those with regular cyclus, e.i. the cows which
have concepted after the insemination . Even 64,28% montafon breed cows ovulated within 24 hours from
the beginning of estrus, and 49,17% of the symenthal breed, 36,24% of holstein-friesian breed, 33,33% of
crossbred and 32,65% of red holstein. Incidence of ovulation manifestation between the 24th and 48th hour was
high in symenthal breed (36,46%), and somewhat lower and equal in red holstein, montafon breed and holstein-
friesian breed (22,45%; 21,43% and 20,13%). Average incidence of the delayed ovulation (48 to 72 hours) in
red holstein, cross breeds and holstein-friesian breed was 36,74%; 34,85%; 33,89%. Average incidence of the
delayed ovulation from 72 to 96 hours was detected in 3,68% symenthal breed, 9,06% holstein-friesian breed,
7,14% of red holstein and 27,27% cross breeds, with the remark that none of the cases of the delayed ovulation
has been found in montafon breed. Cows with the delayed ovulation over 96 hours have also been detected
(holstein-friesian breed 0,67%, red holstein 1,02% and cross breeds 1,51%). The results of this research suggest
that the average oestrus length is extended, and that the ovulation is late in holstein breed. Almost the same
values in cows and heifers which were fenotypicali and genotypicali dominantly of holstein crossbred, are the
proof of unresonable cross breeding. High average percentage (85,71%) of the early ovulations to 48 hours,
tells of a good reproductive health of the montafon breed, even more because of the fact that only cows were
represented. It is explicable, since the montafon breed are of the low productivity cows in this area.
SAŽETAK
Istraživanje je provedeno u razdoblju od 1. prosinca 2004. godine do 1. prosinca 2006. godine u dijelu
Moslavine, sastavnice Županije sisačko-moslavačke, smještene u središnjoj Hrvatskoj. To je koncesijski teritorij
koji veterinarskim djelovanjem pokriva Veterinarska ambulante VETMED doo.. Na terenu ambulante obitava
preko 2000 mliječnih krava i junica. Istraživanjem je obuhvaćeno 1088 plotkinja, (218 junica i 870 krava), od
čega 598 (54,96%) u tipu domaćeg simentalca, 27,39% crno-šarog holštajna , 9% crvenog holštajna, 2,57%
montafonskog goveda i 6,1% križanih, dominantno u tipu crno-šarog holštajna. Po detektiranom početku
estrusa plotkinje su ginekološki i ultrazvučno pregledavane ujutro i navečer. Sukladno nalazu, umjetno su
osjemenjavane sve do ginekološke i ultrazvučne detekcije ovulacije Krave sa reprodukcijskim poremećajima
nisu opservirane već samo one sa regularnim ciklusom koje su nakon osjemenjavanja koncipirale . Čak 64,28%
plotkinja montafonske pasmine ovuliralo je unutar 24 sata od početka estrusa, u simentalca49,17%, crno-šarih
36,24%, križanih33,33% i crvenog holštajna 32,65%. Incidencija pojavnosti ovulacija između 24. i 48. sata
bila je visoka u simentalaca (36,46%), a nešto niža i ujednačena u crvenog holštajna, montafonca i crno-šarog
holštajna (22,45%; 21,43% i 20,13%). Prosječna incidencija kasnijih ovulacija (48 do 72 sata) u crvenog
holštajna, križanaca i crno-šarog holštajna bila je (36,74%; 34,85%; 33,89%). Prosječni nastup kasnih ovulacije
u razdoblju 72 do 96 sati bio je u 3,68% plotkinja tipa simentalaca, 9,06% crno-šarog goveda, 7,14% crvenog
holštajna i 27,27% križanih, uz napomenu da u montafonca nije bilo plotkinja sa zakašnjelom ovulacijom.
Registrirane su i plotkinje sa kasnom ovulacijom iznad 96 sati (crno-šaro govedo 0,67%, crveni holštajn
1,02% i križane 1,51%). Rezultati istraživanja sugeriraju kako je prosječno trajanje estrusa produljeno odnosno
nastup ovulacije kasniji, u plotkinja koje su holštajnske pasmine. Podjednake vrijednosti u krava i junica koje
su fenotipski i genotipski dominantno holštajnski križanci, dokaz su nerezonskog križanja. Prosječni visoki
postotak (85,71%) ranih ovulacija do 48 sati, govori o dobrom reprodukcijskom zdravlju montafonaca, tim
više što su bile zastupljene samo krave. To je objašnjivo budući su montafonci u ovom podneblju krave niske
proizvodnje. UVOD
Jedan od uvjeta za postizanje zadovoljavajuće plodnosti je rasplođivanje u optimalno vrijeme. Loš
postotak koncepcije djelomično je i posljedica osjemenjavanja u krivo vrijeme. Autori pretpostavljaju
da bi vrijeme inseminacije bilo bolje određivati obzirom na ovulaciju, a ne temeljem estrusa, ali na
žalost, u praksi još ne postoje metode kojima bi se vrijeme ovulacije moglo predvidjeti. Stoga su
istraživali korelaciju između karakteristika estrusa i vremena ovulacije (Roelofs i sur. 2006).
Ovulaciju inicira porast LH hormona koji rezultira rupturom folikula i otpuštanjem jajne stanice
(Espey, 1994). Nakon ovulacije je kratak period u kojem jajna stanica može biti fertilizirana (Brackett
i sur.,1980). Trimberger (1948) smatra da je optimalno vrijeme za fertilizaciju između 6 do 12 sati
nakon ovulacije, dok je vrijeme preživljavanja spermija u reprodukcijskom traktu 24 do 30 sati.
Kako je godišnji gubitak mliječne industrije USA, samo zbog grešaka u detekciji estrusa, veći
od 300 milliona dolara, učinkovita detekcija i točno vrijeme inseminacije od najvećeg je značenja za
poboljšanje reprodukcijske efikasnosti stada (Senger, 1994).
Prema Trimberger-u (1948) trajanje estrusa u mliječnih krava kreće se u rasponu od 2.5 do
28 sati, prosječno 18 sati, u krava vizualno opserviranih triput dnevno. Ovulacija se obično javlja
otprilike 28 to 32 sati od početka estrusa (Trimberger 1948; Walker i sur., 1996). Roelofs i sur. (2006)
ustanovili su da je prosječno trajanje estrusa 18 sati (4 do 24 sata), a ovulacija nastupa oko 30 sati
od početka estrusa (10-15 sati po završetku estrusa). Prema tome, pretpostavljeno vrijeme ovulacije
je 29.3±3.9 sati, budući je prosječni nastup estrusa bio 26.4±5.2 sati prije ovulacije. Zaključili su
da inseminacija 24 do 12 sati prije ovulacije rezultira najvećim brojem kvalitetnih embrija 7. dana,
odnosno da je najbolje vrijeme inseminacije 5 do 17 sati od početka estrusa.
Trimberger (1948) smatra da je optimalno vrijeme za inseminaciju u mliječnih krava između 6.
and 24. sata prije ovulacije, a postotak koncepcije drastično pada kod UO nakon ovulacije. Postotak
koncepcije bio je viši u krava inseminiranih unutar 24 sata od početka estrusa nego u prvih 12 sati
nakon početka estrusa (Saacke i sur., 2000). S druge strane, krave inseminirane 12 - 24 sata od
početka estrusa imale su viši postotak degeneriranih embrija u odnosu na osjemenjene do 12. sata od
početka estrusa.
Prema istraživanju Nalbandov i Casida-e, (1942) i Trimberger-a, (1948) mliječne krave ovuliraju
10-15 sati po završetku estrusa ili 27.6 ± 0.6 sati od početka estrusa (Walker et al., 1996). Najbolji
postotak koncepcije bio je kada su inseminirane između 4. i 12.sata nakon početka estrusa (Dransfield
et al., 1998).
Trimberger (1948) je ustanovio da ovulacija u mliječnih junica nastupa 10,5 sati po završetku
estrusa. Mliječne krave mogu ovulirati ranije od početku estrusa nego mesne krave. Tako mliječne
krave ovuliraju 27.6 ± 0.6 sati nakon početka estrusa (Walker i sur.,1996). Yelich i sur., (1999)
ustanovili su da Angus, Brahman, and Senepol krave ovuliraju 30.8 sati od početka estrusa. Skraćen
interval od početka estrusa do ovulacije u mliječnih krava u odnosu na mesne krave uvjetovan je
managementom, hranidbom, laktacijskim stresom i pasminskim specifičnostima.
U posljednjih 50 godina istraživano je optimalno vrijeme za UO u odnosu na stadij estrusa.
Ustanovljeno je da je koncepcija bila viša u krava inseminiranih između 6 i 24 sata prije ovulacije,
pa je preporučan sustav osjemenjavanja “a.m.–p.m” (Trimberger, 1948). To znači da bi krave u
kojih je estrus počeo prijepodne trebale biti osjemenjene u poslijepodnevnim satima, a krave koje
su se počele tjerati poslijepodne, trebalo bi inseminirati sljedećeg prijepodneva. Ipak, istraživanja su
pokazala da se maksimalna koncepcija nije postizala ”a.m.-p.m.” sustavom već osjemenjavanjem
u srednje prijepodne u krava koje su se počele tjerati prethodne noći ili istog jutra (Foote 1979).
Također, krave inseminirane jednokratno (između 8 i 11 sati prijepodne) imale su podjednak postotak
koncepcije kao krave osjemenjene sustavom “a.m.-p.m.” (Nebel i sur. 1994). Prema Dransfield-u i
sur. (1998) krave treba osjemeniti ranije nego po sustavu “a.m.-p.m.” jer je postotak koncepcije u
krava osjemenjenih između 4. i 12. sata od početka estrusa, bio viši nego u krava inseminiranih 16
sati od početka estrusa.
Dransfield i sur. (1998) koristeći metodu kontinuirane opservacije estrusa radiotelemetričkim
sustavom (HeatWatch), ustanovili su da je prosječno trajanje estrusa 7 sati. Walker i sur. (1996) su u
holštajnskih krava, 42.-49.dana postpartalno, determinirali su početak spontanih i induciranih estrusa
HeatWatch sustavom, a vrijeme ovulacije detektirali ultrasonografski 12, 20 i 24 sata od inicijalne
pojave, potom svaka 2 sata sve do 40. sata od početkatjeranja. U prosječnom nastupu ovulacije
(27,6+-5,4 sata od početka estrusa) nije bilo razlike između spontanih i induciranih estrusa.
Cilj istraživanja bio je odrediti vrijeme nastupa ovulacije u 1088 mliječnih krava u ekstenzivnim
i poluekstenzivnim uvjetima držanja, na području koje veterinarskim djelovanjem pokriva privatna
ambulanta.
MATERIJALI I METODE
Istraživanje je provedeno u razdoblju od 1. prosinca 2004. godine do 1. prosinca 2006. godine.
Na terenu ambulante obitava preko 2000 mliječnih krava i junica. U istraživanju je opservirano
1088 plotkinja, od čega 218 junica i 870 krava, sljedećeg pasminskog sastava: 598 (54,96%) u tipu
domaćeg simentalca, 27,39% crno-šarog holštajna, 9% crvenog holštajna, 2,57% montafonskog
goveda i 6,1% križanih krava i junica, dominantno u tipu crno-šarog frizijca. U svih plotkinja
temeljem anamneze registriran je početak estrusa. Krave su ginekološki i ultrazvučno pregledavane
ujutro i navečer, a prema nalazu umjetno osjemenjavane sve do ginekološke i ultrazvučne detekcije
ovulacije. U istraživanju nisu opservirane krave sa reprodukcijskim poremećajima, samo krave sa
regularnim ciklusom koje su nakon osjemenjavanja koncipirale.
U svih je plotkinja temeljem anamneze registriran početak estrusa. Držaoci prijavljuju plotkinje
koje se tjeraju do 8 sati ujutro, uz opasku da li su znakove tjeranja primijetili navečer ili tek ujutro.
Krave i junice su ginekološki i ultrazvučno pregledavane prvi puta ujutro, a potom ujutro i navečer.
Prema nalazu umjetno su osjemenjavane sve do ginekološke i ultrazvučne detekcije ovulacije. U
istraživanju nisu opservirane krave sa reprodukcijskim poremećajima, samo krave sa regularnim
ciklusom i isključivo one koje su su nakon završenog osjemenjavanja koncipirale.
Podaci o vremenu ovulacije bilježeni su za svaku kravu.
REZULTATI
U plotkinja montafonske pasmine najviše ovulacija nastupilo je unutar 24 sata (64,28%), nešto
manje u simentalca (49,17%), a u ostalih crno-šarih (36,24%), križanih 33,33% i crvenog holštajna
(32,65%). Incidencija pojavnosti ovulacija između 24. i 48. sata bila je šarolika, visoka u simentalaca
i (36,46%), nešto niža i ujednačena u crvenog holštajna, montafonca i crno-šarog holštajna (22,45%;
21,43% i 20,13%). Viska incidencija kasnijih ovulacija (48 do 72 sata) bila je crvenog holštajna,
križanaca i crno-šarog holštajna (36,74%; 34,85%; 33,89%).
Unutar 48 sati od početka estrusa ovulralo je 61,32% simentalki, 42,95% frizijaca, 40,13%
holštajna, 71,42% montafonaca i 34,34% križanih.
U razdoblju od 48-72 sata od početka estrusa ovuliralo je 10,70% simentalki, 33,89% frizijaca,
36,73% holštajna, 14,29% montafonca i 34,85% križanih.(komentar-kasna ovulacija u frizijaca i
križanih frizijaca,; utjecaj mliječnosti!!!)
Unutar 24 sata od početka estrusa ovulirale su 122 (55,97%) junice i 352 (40,46%) krava.
Indeks osjemenjavanja po non-return metodi bio je za 598 goveda u tipu domaćeg simentalca
1,202, crno-šarog holštajna (298) 1,517, crvenog holštajna (98) 1,704, montafonca (28) 1,429 i
križance (66) 1,545. Istim načinom indeks za 218 junica bio je 1,353, za 870 krava 1,362, a ukupno
(1088) 1,360.
Tablica 1. Pasminska distribucija nastupa ovulacije od početa estrusa
VRIJEME OD POČETKA ESTRUSA DO OVULACIJE (sati)
PASMINA
do 12 12 - 24 24 - 48 48 - 72 72 - 96 96 - 120
(n;%)
Simentalac
8 (1,34%) 286 (47,83%) 218 (36,45%) 64 (10,70%) 22 (3,68%) 0 (0%)
(598)
Frizijac (298) 13 (4,36%) 95 (31,88%) 60 (20,13%) 101 (33,89%) 27 (9,06%) 2 (0,67%)
Holštajn (98) 7 (7,14%) 25 (25,51%) 22 (22,45%) 36 (36,73%) 7 (7,14%) 1 (1,02%)
Montafonac
2 (7,14%) 16 (57,14%) 6 (21,43%) 4 (14,29%) 0 (0%) 0 (0%)
(28)
Križanac (66) 2 (3,03%) 20 (30,30%) 2 (3,03%) 23 (34,85%) 18 (27,27%) 1 (1,51%)
UKUPNO
32 (2,94%) 442 (40,62%) 308 (28,31%) 228 (20,95%) 74 (6,80%) 4 (0,37%)
(1088)
Tablica 2. Nastup ovulacije od početka estrusa u junica i krava
VRIJEME OD POČETKA ESTRUSA DO OVULACIJE (sati)
do 12 12 - 24 24 - 48 48 - 72 iznad 72
Junice (218) 18 (8,26%) 104 (47,71%) 16 (7,34%) 72 (33,02%) 8 (3,67%)
Krave (870) 14 (1,61%) 338 (38,85%) 292 (33,56%) 156 (17,93%) 70 (8,04%)
UKUPNO
32 (2,94%) 442 (40,62%) 308 (28,31%) 228 (20,95%) 78 (7,17%)
(1088)

DISKUSIJA
Jedan od uvjeta za postizanje zadovoljavajuće plodnosti je rasplođivanje u optimalno vrijeme. Loš
postotak koncepcije djelomično je i posljedica osjemenjavanja u krivo vrijeme. Autori pretpostavljaju
da bi vrijeme inseminacije bilo bolje određivati obzirom na ovulaciju, a ne temeljem estrusa, ali na
žalost, u praksi još ne postoje metode kojima bi se vrijeme ovulacije moglo predvidjeti. Stoga su
istraživali korelaciju između karakteristika estrusa i vremena ovulacije (Roelofs i sur. 2006).
Ovulaciju inicira porast LH hormona koji rezultira rupturom folikula i otpuštanjem jajne stanice
(Espey, 1994). Nakon ovulacije je kratak period u kojem jajna stanica može biti fertilizirana (Brackett
i sur.,1980). Trimberger (1948) smatra da je optimalno vrijeme za fertilizaciju između 6 do 12 sati
nakon ovulacije, dok je vrijeme preživljavanja spermija u reprodukcijskom traktu 24 do 30 sati.
Kako je godišnji gubitak mliječne industrije USA, samo zbog grešaka u detekciji estrusa, veći
od 300 milliona dolara, učinkovita detekcija i točno vrijeme inseminacije od najvećeg je značenja za
poboljšanje reprodukcijske efikasnosti stada (Senger, 1994).
Prema Trimberger-u (1948) trajanje estrusa u mliječnih krava kreće se u rasponu od 2.5 do
28 sati, prosječno 18 sati, u krava vizualno opserviranih triput dnevno. Ovulacija se obično javlja
otprilike 28 to 32 sati od početka estrusa (Trimberger 1948; Walker i sur., 1996). Roelofs i sur. (2006)
ustanovili su da je prosječno trajanje estrusa 18 sati (4 do 24 sata), a ovulacija nastupa oko 30 sati
od početka estrusa (10-15 sati po završetku estrusa). Prema tome, pretpostavljeno vrijeme ovulacije
je 29.3±3.9 sati, budući je prosječni nastup estrusa bio 26.4±5.2 sati prije ovulacije. Zaključili su
da inseminacija 24 do 12 sati prije ovulacije rezultira najvećim brojem kvalitetnih embrija 7. dana,
odnosno da je najbolje vrijeme inseminacije 5 do 17 sati od početka estrusa.
Trimberger (1948) smatra da je optimalno vrijeme za inseminaciju u mliječnih krava između 6.
and 24. sata prije ovulacije, a postotak koncepcije drastično pada kod UO nakon ovulacije. Postotak
koncepcije bio je viši u krava inseminiranih unutar 24 sata od početka estrusa nego u prvih 12 sati
nakon početka estrusa (Saacke i sur., 2000). S druge strane, krave inseminirane 12 - 24 sata od
početka estrusa imale su viši postotak degeneriranih embrija u odnosu na osjemenjene do 12. sata od
početka estrusa.
Prema istraživanju Nalbandov i Casida-e, (1942) i Trimberger-a, (1948) mliječne krave ovuliraju
10-15 sati po završetku estrusa ili 27.6 ± 0.6 sati od početka estrusa (Walker et al., 1996). Najbolji
postotak koncepcije bio je kada su inseminirane između 4. i 12.sata nakon početka estrusa (Dransfield
et al., 1998).
Trimberger (1948) je ustanovio da ovulacija u mliječnih junica nastupa 10,5 sati po završetku
estrusa. Mliječne krave mogu ovulirati ranije od početku estrusa nego mesne krave. Tako mliječne
krave ovuliraju 27.6 ± 0.6 sati nakon početka estrusa (Walker i sur.,1996). Yelich i sur., (1999)
ustanovili su da Angus, Brahman, and Senepol krave ovuliraju 30.8 sati od početka estrusa. Skraćen
interval od početka estrusa do ovulacije u mliječnih krava u odnosu na mesne krave uvjetovan je
managementom, hranidbom, laktacijskim stresom i pasminskim specifičnostima.
U posljednjih 50 godina istraživano je optimalno vrijeme za UO u odnosu na stadij estrusa.
Ustanovljeno je da je koncepcija bila viša u krava inseminiranih između 6 i 24 sata prije ovulacije,
pa je preporučan sustav osjemenjavanja “a.m.–p.m” (Trimberger, 1948). To znači da bi krave u
kojih je estrus počeo prijepodne trebale biti osjemenjene u poslijepodnevnim satima, a krave koje
su se počele tjerati poslijepodne, trebalo bi inseminirati sljedećeg prijepodneva. Ipak, istraživanja su
pokazala da se maksimalna koncepcija nije postizala ”a.m.-p.m.” sustavom već osjemenjavanjem
u srednje prijepodne u krava koje su se počele tjerati prethodne noći ili istog jutra (Foote 1979).
Također, krave inseminirane jednokratno (između 8 i 11 sati prijepodne) imale su podjednak postotak
koncepcije kao krave osjemenjene sustavom “a.m.-p.m.” (Nebel i sur. 1994). Prema Dransfield-u i
sur. (1998) krave treba osjemeniti ranije nego po sustavu “a.m.-p.m.” jer je postotak koncepcije u
krava osjemenjenih između 4. i 12. sata od početka estrusa, bio viši nego u krava inseminiranih 16
sati od početka estrusa.
Dransfield i sur. (1998) koristeći metodu kontinuirane opservacije estrusa radiotelemetričkim
sustavom (HeatWatch), ustanovili su da je prosječno trajanje estrusa 7 sati. Walker i sur. (1996) su u
holštajnskih krava, 42.-49.dana postpartalno, determinirali su početak spontanih i induciranih estrusa
HeatWatch sustavom, a vrijeme ovulacije detektirali ultrasonografski 12, 20 i 24 sata od inicijalne
pojave, potom svaka 2 sata sve do 40. sata od početka tjeranja. U prosječnom nastupu ovulacije
(27,6+-5,4 sata od početka estrusa) nije bilo razlike između spontanih i induciranih estrusa.
Hurnik i sur.(1975) smatraju da mnogi čimbenici u managementu mliječnih krava utječu na
osobine estrusa u mliječnih krava. Tako Britt i sur. (1986) te Vailes i Britt (1990) tvrde da krave
na mekoj stelji imaju jače izražen i dulji estrus od onih držanih na betonu. Također su potvrdili
nepovoljni utjecaj visoke temperature na estrusne aktivnosti. Sezonost i toplinski stres imaju štetno
djelovanje na reprodukcijsku efikasnost u mliječnih goveda (Gwazdauskas i sur.,1975; Cavestany
i sur., 1985) negativno utječući na razvoj folikula i endokrine funkcije (Wolfenson i sur., 1995;
Wolfenson i sur., 1997; Wilson i sur., 1998). U mesnih pasmina utjecaj sezone na osobine estrusa
nije ustanovljen. Gwazdauskas i sur. (1983) i Gwazdauskas (1985) ustanovili su da su manifestacie
estrusa jače izražene u mliječnih krava, opservirano dvaput dnevno, pri dnevnim temperaturama
nižim od 25C u usporedbi s temperaturama iznad 30C. U našem radu plotkinje su opservirane
dvaput dnevno
Prema Xu-u i sur. (1998), doba dana ne utječe na estrusnu aktivnost, za razliku od De Silva-e
i sur. (1981) koji su ustanovili da mliječne krave imaju najjaču estrusnu aktivnost tijekom jutarnjih
sati, ali na intenzitet estrusa mogu utjecati varijacije u vremenu mužnje i hranjenja, temperatura
okoliša (Pennington i sur., 1985; Britt i sur., 1986). Borges i sur. (2004) istraživali su utjecaj sezone
na folikularnu dinamiku i ovulaciju u domaćih autohtonih goveda. Nakon detektiranog estrusa UZV
su pregledavali krave svakih šest sati do detekcije ovulacije. Nije uočen utjecaj pasmine niti sezone
na dinamiku folikulogeneze, a vrijeme od početka estrusa do ovulacije bio je kraći u krava sa dva
vala folikula. Većinom je estrus detektiran ujutro (57.3%) a 28.0%) kasno poslijepodne. Prosječni
nastup ovulacije od početka estrusa za gir i nelore goveda bilo je 23,1±5,6 sati.
Sezona nije utjecala na vrijeme početka ovulacije (Trimberger, 1948).
Rae i sur. (1999) su ustanovili učinak pasmine na trajanje estrusa u Angus, Brahman, i križanih
krava. Tako je prvi postpartalni estrus u primipara Angus x Hereford (Ciccioli i sur., 2001) i odraslih
mesnih krava (Lents i sur., 2000) bio je kraći 4 do 6 sati.
Visoka incidencija ranih ovulacija (do 48 sati, 85,71%) govori o dobrom reprodukcijskom zdravlju
montafonaca, tim više što su zastupljene bile samo krave. To je objašnjivo budući su montafonci u
ovom podneblju krave niske proizvodnje. Dok je u simentalaca i montafonaca postotak krava sa
nastupom ovulacije unutar 72 sata identičan, oko 85%, u holštajna crnog i crvenog on je gotovo
podjednak i oko 50% niži nego u simentalca (56,37% i 55,10%), a isto toliko viši nego u križanih
goveda (36,36%). Iz istraživanja se može zaključiti kako duljina estrusa podudara sa činjenicom da
su holštajnske krave više opterećene subfertilnošću. Podatak da je trajanje estrusa do ovulacije dulje
navodi na zaključak da je riječ o kravama koje su fenotipski i genotipski dominantno holštajni, ali i
upozorava na štetnost nerezonskog križanja.
LITERATURA
Borges, A.M. C.A.A. Torres, V.R. Rocha Júnior, J.R.M. Ruas, M.M. Gioso, J.F. Fonseca, G.R. Carvalho, V.V.
Maffili (2004): Dinâmica folicular e momento da ovulação em vacas não lactantes das raças Gir e Nelore
durante duas estações do ano. Arq. Bras. Med. Vet. Zootec. 56 (3).
Brackett, B.G., Y.K. Oh, J.F. Evans, W.J. Donawick (1980): Fertilization and early development of cow ova.
Biol. Reprod. 23:189.
Britt, J. H., R. G. Scott, J. D. Armstrong, M. D. Whitacre (1986): Determinants of estrous behavior in lactating
Holstein cows. J. Dairy Sci. 69:2195–2202.
Cavestany, D., A. B. El-Wishy, R. H. Foote (1985): Effect of season and high environmental temperature on
fertility of Holstein cattle. J. Dairy Sci. 68:1471–1478.
Ciccioli, N. H., R. P. Wettemann, L. J. Spicer, D. H. Keisler, C. A. Lents, F. J. White (2001): Postpartum
nutrition influences concentrations of leptin, IGF-I, and pregnancy rate of primiparous beef cows. J. Anim.
Sci. 79(Suppl. 1):34 (Abstr.).
De Silva, A. W. M. V., G. W. Anderson, F. C. Gwazdauskas, M. L. McGilliard, J. A. Lineweaver (1981):
Interrelationships with estrous behavior and conception in dairy cattle. J. Dairy Sci. 64:2409–2418
Dransfield, M.B.G., R.L. Nebel, R.E. Pearson, L.D. Warnick (1998): Timing of insemination for dairy cows
identified in estrus by a radiotelemetric estrus detection system. J. Dairy Sci. 81:1874.
Espey, L.L. (1994): Current status of the hypothesis that mammalian ovulation is comparable to an inflammatory
reaction. Biol. Reprod. 50:233.
Foote, R.H. (1979): Time of artificial insemination and fertility in dairy cattle. J. Dairy Sci. 62:355.
Gwazdauskas, F. C., C. J. Wilcox, W. W. Thatcher (1975): Environmental and management factors affecting
conception rate in a subtropical climate. J. Dairy Sci. 58:88–92.
Gwazdauskas, F.C., J.A. Lineweaver, M.L. McGilliard (1983): Environmental and management factors affecting
estrous activity in dairy cattle. J. Dairy Sci. 66:1510.
Gwazdauskas, F.C. (1985): Effects of climate on reproduction in cattle. J. Dairy Sci. 68:1568.
Hurnik, J.F., G.J. King, H.A. Robertson (1975): Estrous and related behavior in postpartum Holstein cows. Appl.
Ethol. 2:55.
Lents, C. A., F. J. White, D. L. Lalman, R. P. Wettemann (2000): Effects of body condition of beef cows at
calving and protein supplementation on estrous behavior and follicle size. Available:http://www.ansi.
okstate.edu/research/2000rr/30htm.
Nalbandov, A., L.E. Casida (1942): Ovulation and its relation to estrus in cows. J. Anim.Sci. 1:189–198.
Nebel, R.L., W.L. Walker, M.L. McGilliard, C.H. Allen, G.S. Heckman (1994): Timing of artificial insemination
of dairy cows: fixed time once daily versus morning and afternoon. J. Dairy Sci. 77:3185.
Pennington, J. A., J. L. Albright, M. A. Diekman (1985): Sexual activity of Holstein cows: Seasonal effects. J.
Dairy Sci. 68:3023–3030.
Rae, D.O., P.J.Chenoweth, M.A. Giangreco, P.W. Dixon, F.L. Bennett (1999): Assessment of estrus detection by
visual observation and electronic detection methods and characterization of factors associated with estrus
and pregnancy in beef heifers. Theriogenology 51:1121–1132.
Roelofs, J.B. N.M. Soede, B. Kemp (2006): Insemination strategy based on ovulation prediction in dairy cattle.
Vlaams Diergeneeskundig Tijdschrift 75, 2.
Saacke, R. G., J. C. Dalton, S. Nadir, R. L. Nebel, J. H. Bame (2000): Relationship of seminal traits and
insemination time to fertilization rate and embryo quality. Anim. Reprod. Sci.60–61:663–677.
Senger, P.L. (1994): The estrus detection problem: new concepts, technologies, and possibilities. J. Dairy Sci.
77:2745.
Trimberger, G.W. (1948): Breeding efficiency in dairy cattle from artificial insemination at various intervals
before and after ovulation. Univ. Nebraska Ag. Exp. Sta. Res. Bull. 153:3.
Vailes, L.D., J.H. Britt (1990): Influence of footing surface on mounting and other sexual behaviors of estrual
Holstein cows. J. Anim. Sci. 68:2333.
Walker, W.L., R.L. Nebel, M.L. McGilliard (1996): Time of ovulation relative to mounting activity in dairy
cattle. J. Dairy Sci. 79 (9):1555-1561.
Wilson, S. J., C. J. Kirby, A. T. Koenigsfeld, D. H. Keisler, M. C. Lucy (1998): Effects of controlled heat stress
on ovarian function of dairy cattle. 2. Heifers. J. Dairy Sci. 81:2132–2138.
Wolfenson, D., W. W. Thatcher, L. Badinga, J. D. Savio, R. Meidan, B. J. Lew, R. Braw-Tal, A. Berman
(1995): Effect of heat stress on follicular development during the estrous cycle in lactatingdairycattle.Biol.
Reprod.52:1106–1113.
Wolfenson, D., B. J. Lew, W. W. Thatcher, Y. Graber, R. Meidan (1997): Seasonal and acute heat stress effects
on steroid production by dominant follicles in cows. Anim. Reprod. Sci. 47:9–19.
Xu, Z. Z., D. J. McKnight, R. Vishwanath, C. J. Pitt, L. J. Burton (1998): Estrus detection using radiotelemetry
or visual observation and tail painting for dairy cows on pasture. J. Dairy Sci. 81:2890–2896.
Yelich, J. V., C. L. Barnett, J. K. Fullenwider, J. R. Kempfer, J. W. Lemaster, C. C. Chase, Jr. (1999): Effect of
season on behavioral estrus, ovulation, and estrous cycle length in Angus, Brahman and Senepol cows in a
subtropical environment. J. Anim. Sci. 77(Suppl. 1):230 (Abstr.).
Influence of breed, parity and lactation on PAG and
progesterone profiles in pregnant saanen and boer
goats
Utjecaj pasmine, pariteta i laktacije na koncentraciju

PAG i progesterona tijekom gravidnosti sanskih i
burskih koza
Prvanović, N., D. Đuričić, S. Vince, J. Sulon, J. F: Beckers, N. Filipović, M. Cergolj, J.

Grizelj, M. Samardžija, T. Dobranić, M. Lipar
Klinika za porodništvo i reprodukciju, Veterinarskog fakulteta Sveučilišta u Zagrebu

Klinika za kirurgiju, ortopediju i oftalmologiju, Veterinarskog fakulteta Sveučilišta u Zagrebu
Zavod za fiziologiju i radiobiologiju, Veterinarskog fakulteta Sveučilišta u Zagrebu
Laboratorij za fiziologiju reprodukcije, Veterinarski fakultet, Sveučilište u Liege-u
Veterinarska stanica Đurđevac
Abstract
The aim of the study was to investigate role of breed, parity and lactation on PAG and progesterone profiles
in pregnant saanen and boer goats. All saanen goats were in lactation and milked twice daily till the last trimester
of pregnancy. All boer goats were separated from previous kidds and had no milk production. We had two herds
of goats, boer goats (n=25) and saanen goats (n=22). We subdivided herds in 2 subgroups each: pluriparous
pregnant (boer goats n=17, saanen goats n=14) and primiparous pregnant goats (boer goats n=8, saanen goats
n=8). We monitored natural mating of all goats during november 2006. We monitored pregnancy 35 days after
mating and monthly later to follow fetal development and detect embrionic mortality using ultrasound probe.
The fetuses were identified, counted by ultrasound and later the numbers were compared with the kidding rate.
Only goats who kidded at the end of the study were taken in final consideration and used in study. Blood samples
(10 ml) were collected from the jugular vein in heparinized vacutainer tubes at weeks 0, 1, 2, 3, 4, 6, 8, 10, 12,
14, 16, 18, and 20 after mating and on the day of parturition. Plasma was removed by centrifugation (at 1500
g for 15 min) immediately after collection and stored at -20°C until assayed for PAG and progesterone. Level
of progesterone and PAG in sera samples was determined using standard RIA method. PAG was determined
by method described by Zoli and modified by Beckers. Progesterone was determined using standard procedure
with conjugated steroids (Coat-A-Count TKPG, Diagnostic Product Corporation) without preincubation. The
125
I in the pellet was quantified using gamma counter (LKB Wallac 1261 Multigamma counter, LKB, Turku,
Finland) with a counting efficiency of 75%. All samples were analysed in duplicate with middle value like
result and all suspect results were repeated. Program Statistica and ANOVA to perform variance analysis and
linear correlations were used. PAG and progesterone level were compared between primiparous and pluriparous
groups according to breed, parity and lactation differences. Progesterone and PAG level curve was significantly
higher in pregnant pluriparous goats of both breeds comparing to summarized results for both primiparous
group (p<0,05). Number of kidds didn’t differ between all four groups (2,4 and 2,6 for saanen groups versus 2,6
and 2,8 kidds for boer groups) and couldn’t influence progesterone nor PAG level. Primiparous goats of both
breeds had statistically significant higher individual variations (maximum and minimum) for both parameters
(progesterone and PAG) during pregnancy (p<0,05). We compared levels of progesterone and PAG from
lactating saanen goats with pluriparous nonlactating boer goats in the same stage of pregnancy and didn’t find
any significant difference. We concluded that parity influences both level of progesterone and PAG in pregnant
goats of both breeds but lactation and breed had no significance.
Key words: goat, pregnancy, parity, lactation, progesterone, PAG
Sažetak
Svrha istraživanja je ustanoviti utjecaj pasmine, pariteta i laktacije na razine PAG i progesterona
u gravidnih burskih i sanskih koza. Sve sanske koze su bile u laktaciji i muzene su dvaput dnevno
sve do posljednje trećine gravidnosti. Burske koze su bile odvojene od jarića i nisu bile u laktaciji. U
istraživanju su promatrana dva stada: bursko (n=25) i sansko (n=22) koji su dodatno podijeljeni na
dvije podskupine_pluriparnu (burske n=17, sanske n=14) i primiparnu skupinu (burske n=8, sanske
n=8). Sve koze su pripuštene tijekom studenog 2006.Ptom je 35 dana nakon parenja sprovedena
ultrazvučna dijagnostika gravidnosti. Za pregled je korišten ultrazvučni aparat Sonovet 2000 a
koze su pregledavane transabdominalno i transrektalno (kod svih dubioznih slučajeva) sa sondom
frekvencije 7,5 Mhz. Koze su prije pregleda fiksirane a sonda se nakon obilatog premazivanja gelom postavljala
na bazu vimena. Koze su pregledavane s obe strane vimena. Nakon pozitivne dijagnostike gravidnosti koze su
pregledavane jednom mjesečno u svrhu praćenja razvoja plodova i dijagnostike embrionalne/fetalne smrtnosti.
Plodovi su pobrojani za svaku kozu i kasnije uspoređeni s brojem ojarenih jarića. U konačno razmatranje uzete
su samo koze koje su se doista i ojarile. Paralelno s ultrazvučnim praćenjem sprovedeno je i uzorkovanje krvi.
Krv je uzimana iz v. jugularis u heparinizirane vacutainer epruvete od 10 ml. i to 0, 1, 2, 3, 4, 6, 8, 10, 12, 14, 16,
18, i 20. tjedna po parenju te prilikom poroda. Plazma je odvojena centrifugiranjem na 1500 g kroz 15 minuta
neposredno po uzorkovanju a potom je spremljena na -20°C do pretrage. Razina progesterona i PAG je određena
pomoću standardne RIA pretrage. PAG je određivan po metodi koju je opisao Zoli, modificiranu po Beckersu.
Progesteron je određen pomoću standardne RIA procedure sa konjugiranim steroidima (Coat-A-Count TKPG,
Diagnostic Product Corporation) bez predinkubacije. Pri tome je radioaktivni 125I kvantificiran primjenom
gamma countera (LKB Wallac 1261 Multigamma counter, LKB, Turku, Finland) čija osjetljivost iznosi 75%.
Svi su uzorci analizirani u duplikatu pri čemu je srednja vrijednost predstavljala konačan rezultat a svi sumnjivi
rezultati su ponovljeni. Svi rezultati su statistički obrađeni u programu Statistica pri čemu je sprovedena analiza
varijance i linearne korelacije. Razine PAG i progesterona su uspoređene između primiparih i pluriparih koza s
obzirom na dob, pasminu i laktaciju. Razina progesterona i PAG bila je značajno viša u gravidnih pluriparih koza
obje pasmine u usporedbi s zajedničkim rezultatima za primipare koze (p<0,05). Broj jarića nije se značajno
razlikovao između skupina iako su burske u pravilu imale više jarića ( 2,4 i 2,6 za sanske naprama 2,6 i 2,8 za
burske koze) te stoga nije mogao utjecati na razine PAG i progesterona. Primipare koze obaju skupina imale
su statistički značajne individualne varijacije (maksimum i minimum) za oba parametra(p<0,05) . Usporedili
smo razine za oba parametra s obzirom na laktaciju ( pluripare burske i sanske) ali nije bilo značajnije razlike.
S obzirom na činjenicu da su koze u našem istraživanju imale ne samo veći broj jarića od koza u radovima
nekih ranijih autora nego i konzekutivno više koncentracije progesterona i PAG definitivno smo potvrdili kako
placenta visokogravidnih koza igra značajnu ulogu u hormonalnom očuvanju gravidnosti. Također, zaključili
smo kako paritet utječe na razinu progesterona i PAG u gravidnih koza obje pasmine ali laktacija i pasmina pri
tome ne igraju nikakvu značajniju ulogu..
Ključne riječi: graviditet, koza, paritet,laktacija progesteron, PAG
Uvod
Poznato je da paritet utječe na različite parametre vezane na gravidnost u domaćih životinja.
Naime kako su opisali još Ashdell i sur. (1964.) dob i paritet koze utječu na tijek i duljinu gravidnosti
budući da je graviditet najkraći a broj oplođenih koza najmanji u prvoj rasplodnoj sezoni u životu koze
i postepeno raste do maksimuma u dobi od 6 godina ( Ashdell, 1964). Nadalje Prvanović i sur. (2007.)
su opisali kako paritet izravno djeluje na postotak gravidnosti i razinu cirkulirajućeg progesterona
u gravidnih burskih koza, dok kod negravidnih koza ranija gravidnost nema posljedično nikakav
utjecaj na kasnije lučenje progesterona. U svakom slučaju poznato je da je visoka koncentracija
cirkulirajućeg progesterona neophodna za uspostavu i održavanje graviditeta kod koza. Pri tome je
žuto tijelo na jajniku gravidne koze za razliku od ovce, po svemu sudeći ovisno o hipofizi. Naime,
neka ranija istraživanja su pokazala da uklanjanje hipofize u bilo kojem stadiju graviditeta kod koza
rezultira pobačajem ( Cowie et al, 1963). dok u gravidne ovce, posebice u zadnjem tromjesečju
gravidnosti hipofizektomija ne rezultira pobačajem, već se gravinost normalno nastavlja do poroda.
Pri tome je važno napomenuti da je u ovaca placenta vrlo važan izvor progesterona u kasnoj
gravidnosti pa tako broj plodova ( a time i placenti) pozitivno djeluje na rast progesterona u serumu
gravidne ovce. Iako je placenta koze i ovce jako slična u mnogim morfološkim i strukturalnim
detaljima, nema dokaza za postojanje proizvodnje progesterona u placenti koze (Thorburn and
Schneider, 1972). Čak i ako dođe do stvaranja progesterona, to je premalo za održavanje graviditeta
u odsutnosti žutog tijela. Currie (1977) je smatrala, ali tad nije dokazano, da placentalni laktogen kod
koza sudjeluje u regulaciji sekrecije progesterona iz žutog tijela. Istraživanja Maleckog i sur. ( 1987)
iz Australije pokazuju da kozi nije potreban materinji hipofizni LH kako bi održala graviditet između
50.-og i 130.-og dana gravidnosti. Isti autori su zaključili da funkcija žutog tijela može biti održana
luteotropinima ili antiluteoliticima proizvedenih u maternici. Nadalje, Sousa i sur (1999) opisuju
kako je krivulja PAG (glikoproteini gravidnosti s antiluteolitičkim djelovanjem) značajno viša kod
gravidnih koza nego u gravidnih ovaca. Također su naglasili mogućnost da žuto tijelo koze može biti
sposobno proizvoditi progesteron nezavisno o luteotropinima kao što je ranije utvrdio i Rotschild
(1981). Razina progesterona u plazmi, kojeg gotovo u cijelosti proizvodi žuto tijelo gravidne koze,
ostaje visoka do otprilike 4 dana prije poroda ( Gordon, 1997). Isti autor navodi da je 19 do 22
dana nakon parenja, koncentracija progesterona u plazmi gravidne koze uobičajeno je veća od 1.4
ng/ml. Koze koje nisu gravidne vratit će se u estrus u tom razdoblju i mogu se očekivati minimalne
koncentracije progesterona, sigurno manje od 1 ng/ml. Koncentracija progesterona u mlijeku koza
prate koncentraciju progesterona u plazmi, zbog činjenice da je progesteron hormon topiv u mastima
pa su njegove koncentracije više u mlijeku. Progesteronski testovi se mogu upotrebljavati na različite
načine kod dijagnosticiranja graviditeta koza. Kada je nepoznat datum parenja, može se uzimati
nekoliko uzoraka zaredom. Restall i sur. (1990) izvještavao je o dijagnozi gravidnosti tajlandskih
domaćih koza, što su pokušali mjereći koncentraciju progesterona u plazmi s 4 sedmodnevna intervala
nakon parenja; 96,2% koza sa sve 4 koncentracije progesterona >2 ng/ml su bile gravidne. Na Kubi,
Carmenate i sur. (1992) pratili su koncentraciju progesterona u krvi 8 i 21 dan nakon osjemenjivanja
koza; 21.-og dana gravidnost je točno dijagnosticirana u 77.4% koza i negravidnih 95.7%.
Materijal i metode
Sve sanske koze su bile u laktaciji i muzene su dvaput dnevno sve do posljednje trećine gravidnosti.
Burske koze su bile odvojene od jarića i nisu bile u laktaciji. U istraživanju su promatrana dva stada:
bursko (n=25) i sansko (n=22) koji su dodatno podijeljeni na dvije podskupine_pluriparnu (burske
n=17, sanske n=14) i primiparnu skupinu (burske n=8, sanske n=8). Sve koze su pripuštene tijekom
studenog 2006.Potom je 35 dana nakon parenja sprovedena ultrazvučna dijagnostika gravidnosti.
Za pregled je korišten ultrazvučni aparat Sonovet 2000 a koze su pregledavane transabdominalno i
transrektalno (kod svih dubioznih slučajeva) sa sondom frekvencije 7,5 Mhz. Koze su prije pregleda
fiksirane a sonda se nakon obilatog premazivanja gelom postavljala na bazu vimena. Koze su
pregledavane s obe strane vimena. Nakon pozitivne dijagnostike gravidnosti koze su pregledavane
jednom mjesečno u svrhu praćenja razvoja plodova i dijagnostike embrionalne/fetalne smrtnosti.
Plodovi su pobrojani za svaku kozu i kasnije uspoređeni s brojem ojarenih jarića. U konačno razmatranje
uzete su samo koze koje su se doista i ojarile. Paralelno s ultrazvučnim praćenjem sprovedeno je i
uzorkovanje krvi. Krv je uzimana iz v. jugularis u heparinizirane vacutainer epruveteod 10 ml. i to
0, 1, 2, 3, 4, 6, 8, 10, 12, 14, 16, 18, i 20. tjedna po parenju te prilikom poroda. Plazma je odvojena
centrifugiranjem na 1500 g kroz 15 minuta neposredno po uzorkovanju a potom je spremljena na
-20°C do pretrage. Razina progesterona i PAG je određena pomoću standardne RIA pretrage. PAG je
određivan po metodi koju je opisao Zoli, modificiranu po Beckersu. Progesteron je određen pomoću
standardne RIA procedure sa konjugiranim steroidima (Coat-A-Count TKPG, Diagnostic Product
Corporation) bez predinkubacije. Pri tome je radioaktivni 125I kvantificiran primjenom gamma
countera (LKB Wallac 1261 Multigamma counter, LKB, Turku, Finland) čija osjetljivost iznosi 75%.
Svi su uzorci analizirani u duplikatu pri čemu je srednja vrijednost predstavljala konačan rezultat a
svi sumnjivi rezultati su ponovljeni. Svi rezultati su statistički obrađeni u programu Statistica pri
čemu je sprovedena analiza varijance i linearne korelacije. Razine PAG i progesterona su uspoređene
između primiparih i pluriparih koza s obzirom na dob, pasminu i laktaciju.
Rezultati
Razina PAG (pregnancy associated glycoproteins) bila je značajno viša u gravidnih pluriparih
koza obje pasmine u usporedbi s zajedničkim rezultatima za primipare koze (p<0,05). Pri tome se ne
može reći da su pluripare koze imale više razine PAG, već su samo imale veće individualne varijacije
koje su dovele do navedene razlike. Krivulje PAG za sve 4 podskupine prikazane su u grafikonu
1. Progesteron je bio ukupno nešto viši kod gravidnih pluriparih koza obaju pasmina, neovisno o
laktaciji. Prosječna razina progesterona u primiparih koza iznosila je 15 ng/ml ( minimalna 9,6
a maksimalna 15,2 ng/ml) za obje pasmine Te su se vrijednosti donekle razlikovale za primipare
koze koje su u prosjeku imale 13,4 ng/ml progesterona u krvi, ali su minimalna i maksimalna
vrijednost bile u većem rasponu (6,5 prema 18,2 ng/ml). Iako je jedno od mogućih tumačenja za tu
pojavu mogao biti povećani broj jarića za pluripare koze, nije bilo tako. Broj jarića nije se značajno
razlikovao između skupina iako su burske u pravilu imale više jarića ( 2,4 i 2,6 za sanske naprama
2,6 i 2,8 za burske koze) te stoga nije mogao utjecati na razine PAG i progesterona. Primipare koze
obaju skupina imale su statistički značajne individualne varijacije (maksimum i minimum) za oba
parametra(p<0,05) . Usporedili smo razine za oba parametra s obzirom na laktaciju ( pluripare burske
i sanske) ali nije bilo značajnije razlike.
G ra fiko n 1: K re ta n je ra z in e P A G tije ko m g ra vid n o sti u sve 4 p o d sku p in e

ko z a
600
p lu r ip ar e s an s k e
400 p lu r ip ar e b u r s k e
PAG ng/ml
200 p r im ip ar e b u r s k e
p r im ip ar e s an s k e
0
tje d n i g r avid n o s ti o d k o n ce p cije d o p o r o d a
G ra fiko n 2: K re ta n je ra z in e p ro g e ste ro n a p o p o d sku p in a m a
20
p lu r ip ar e s an s k e
Prog. ng/ml
10 p lu r ip ar e b u r s k e
0 p r im ip ar e b u r s k e
p r im ip ar e s an s k e
tje d n i o d k o n ce p cije d o p o r o d a
Rasprava
Sudeći prema podacima koje je objavio Ashdell (1964), nema sumnje da paritet i dob utječu
na stopu gravidnosti domaćih pasmina koza. Štoviše, isti autor opisuje rast stope gravidnosti do
6. godine života kada dostiže maksimum. U našem istraživanju stopa gravidnosti je bila statistički
značajno veća u pluriparih nego u primiparih koza, no valja napomenuti kako nijedna koza u
našem istraživanju nije bila starija od 6 godina. Unatoč tome, broj jaradi se nije značajno razlikovao
između primipare i pluripare skupine ( 2,4 prema 2,6 jaradi po leglu). Mi smo u našem istraživanju
također proučavali i utjecaj pariteta na razinu progesterona u gravidnih sanskih i burskih koza. Kako
bismo isključili utjecaj individualnih varijacija i lažno pozitivnih rezultata pribjegli smo tjednom
uzimanju krvi tokom čitave gravidnosti nakon čega smo usporedili rezultate između skupina ( u
svim kombinacijama primiparih i pluriparih za obje pasmine). Kako bismo bili sigurni u točnost
rezultata, za sve smo uzorke radili dvostruko testiranje s uzimanjem srednje vrijednosti kao približno
najtočnije a uzorkovali smo krv čak 10 puta tijekom gravidnosti. Upotrijebili smo RIA metodu koja
je vrlo pouzdana i precizna a točnost mjerenja joj za kvantitativne metode prelazi 75%. Sve smo koze
također i ultrazvučno pratili što je dalo 100% pouzdane rezultate što su potvrdili i podaci o jarenjima.
Prosječna razina progesterona u primiparih koza iznosila je 15 ng/ml ( minimalna 9,6 a maksimalna
15,2 ng/ml) za obje pasmine Te su se vrijednosti donekle razlikovale za primipare koze koje su u
prosjeku imale 13,4 ng/ml progesterona u krvi, ali su minimalna i maksimalna vrijednost bile u
većem rasponu (6,5 prema 18,2 ng/ml). Pri tome pasmina i laktacija nisu igrale nikakvu ulogu između
skupina. Naši se rezultati uvelike razlikuju od onih koje je objavio Bon Durant (1981) koji je dobio
bitno niže vrijednosti za gravidne koze. Tu razliku u rezultatima možemo objasniti brojem jaradi.
Naime, u njegovom istraživanju su koze jarile u prosjeku 1,5 jaradi, dok su naše jarile prosječno 2,6
jaradi po leglu (2,4 do 2,8), što se sigurno odrazilo i na koncentraciju progesterona u krvi. Slično
je i sa rezultatima koje je objavila Sousa (1999) na brazilskim kozama. Ona je dobila signifikantno
niže vrijednosti za PAG i progesteron, no njezine su koze u pravilu jarile 1,6 jaradi po kozi. Mi
nismo pronašli pozitivnu korelaciju između broja jaradi i koncentracije progesterona iz jednostavnog
razloga što je većina koza u svim grupama ojarila isti broj jaradi. Iz svega navedenog zaključili smo
kako paritet utječe na razinu progesterona i PAG a posebice uzrokuje veće individualne varijacije u
gravidnih koza obje pasmine ali laktacija i pasmina pri tome ne igraju nikakvu značajniju ulogu..
Literatura:
Asdell, S.A: (1964): Patterns of Mammalian Reproduction. Cornell University Press, Ithaca, pp623-630
Carmenate C, Pedroso, R., Gonzalez, N., Arencibia J. and Alvarez T. (1992): Pregnancy diagnosis in goats on
the basis of blood progesterone concentration, using radioimmunoassay. Revista Cubana dr Reproducion
Animal 17-18 (1-2), 93-100
Cowie A. T., DAniel, P. M., Pritchard, m., M., L. and Tindal J. S. (1963): Hypophysectomy in pregnant goats and
section of the pituitary stalk in pregnant goats and sheep. Journal of Endocrinology 28, 93-98
Currie W.B. and Thorburn, G.D. (1977) The fetal role in timing the initiation of parturition in the goat. In:
Wolstenholme, G.E:W. and Knight, J. (eds) The Fetus and Birth Ciba Foundation Symposium No. 47,
Associated Scientific Publishers, Amsterdam
Gordon I. (1997): Controlled Reproduction in Sheep and Goats, CAB International
Malecki J., Jenkin G:, and Thornburn G.D. (1987):Passive immunization of pregnant goats against ovine LH,
Journal of Endocrinology, 114, , 413-436
Prvanović N., D. Duricic,A. Tomaskovic, J. Grizelj, S. Vince, JF Beckers, J. Sulon, M. Cergolj, T. Dobranic, M.
Samardžija (2007):Influence of parity on pregnancy rate and progesterone level in boer goats, Rev. Rom.
Med.. Vet. 3/2007, 197-203
Restall B.J., Milton J.T:B, Klong Jutti, P., Kochapakdee, S. (1990): Pregnancy diagnosis in Thai native goats,
Theriogenology, 34, 313-317
Rotschild, I (1981):The regulation of the mammalian corpus luteum. Recent Progress in Hormone Research,
37, 183-298
Sousa N.M.; Garbayo J.M.; Figueiredo J.R.; Sulon J.; Goncalves P.B.D.; Beckers J.F. (1999) Pregnancy-
associated glycoprotein and progesterone profiles during pregnancy and postpartum in native goats from the
north-east of Brazil Small Ruminant Research, Volume 32, Number 2, 12 April 1999 , pp. 137-147(11)
Thorburn G.D. and Schneider W 81972) The progesterone concentration in the plasma of the goat during the
oestrus cycle and pregnancy, Journal of Endocrinology 52, 23-28
An outbreak of Mycoplasma bovis mastitis on a diary
cows farm in Croatia
Epizootija mastitisa uzrokovanog bakterijom

Mycoplasma bovis u mliječnih krava u Hrvatskoj
B. Šeol1*, T. Naglić1, H. Ball2, D. Finlay2, K. Matanović1, M. Martinec3

1
Department of Microbiology and Infectious Diseases, Veterinary Faculty University of Zagreb, Heinzelova
55, 10000 Zagreb, Croatia
2
Veterinary Research Laboratories, Stoney Road, Stormont, Belfast, BT4 3SD
3
Veterinarska stanica Remetinec, 10257 Hrvatski Leskovac, Brezovička 105, Croatia
Corresponding author
1*
Summary
This paper presents our observations during the second outbreak of bovine mastitis in Croatia. On a farm
with approximately 700 dairy cows in different stages of lactation a significant increase in severe clinical
mastitis cases resistant to antibiotic therapy was observed. The animals were of Friesian Holstein breed and
some had been purchased from Western Europe. The acute form of mastitis was characterised by a rapid
decrease in milk production, and a rapid spread of infection from affected to adjacent quarters. The animals were
unsuccessfully treated with different antibiotics for several months. Combinations of tetracycline, neomycin
and bacitracin; penicillin G, dihydrostreptomycin, novobiocin and neomycin; clavulanic acid-amoxicillin,
cephalosporines; and lincomycin were used. To investigate a possible role of mycoplasma as a causative agent of
a large number of mastitis cases, 421 udder secretions were microbiologically examined. Mycoplasma colonies
of typical appearance were cultured from 77 milk samples. Mycoplasmas were identified directly from milk
samples by antigen capture ELISA test and polymerase chain reaction for routine identification of M. bovis.
All isolated mycoplasmas were identified as Mycoplasma bovis. Mastitic bovine milk originated from a large
number of farms in Croatia has been routinely cultured for mycoplasma on appropriate media at Department of
Microbiology and Infectious diseases for the last 30 years. On this basis, it is likely that mycoplasma mastitis
in Croatia was brought into the country with the imported animals. As bovine mycoplasma mastitis might be
a major udder health problem in dairy cattle there is an urgent necessity of coordinated action of veterinary
diagnostic laboratories and veterinary authorities in identifying the distribution and control of this infection in
Croatia.
Sažetak
U radu je prikazana epizootija mikoplazmalnog mastitisa u mliječnih krava u Hrvatskoj. Na farmi sa 700
mliječnih krava u različitim stadijima laktacije zablježen je značajan porast broja kliničkih mastitisa koji nisu
reagirali na liječenje antibioticima. Krave su bile holštajnsko frizijske pasmine, a podrijetlom iz zapadne Europe.
U akutnom obliku mastitis se očitovao naglim padom mliječnosti i brzim širenjem infekcije sa oboljelih na zdrave
četvrti vimena. Životinje su liječene antibioticima nekoliko mjeseci bez uspjeha. Korištene su kombinacije
tetraciklina, neomicina i bacitracina; penicilina G, dihidrostreptomicina, novobiocina i neomicina; amoksicilina
s klavulanskom kiselinom, cefalosporina; i linkomicin. 421 uzorak mlijeka je mikrobiološki pretražen kako bi se
ispitala moguća uloga mikoplazmi kao uzročnika mastitisa. Mikoplazme su izdvojene na hranjivoj podlozi iz 77
pretraženih uzoraka mlijeka. Mikoplazme su također identificirane izravno iz uzoraka mlijeka imunoenzimnim
pokusom. Sve izdvojene mikoplazme identificirane su kao Mycoplasma bovis. Mlijeko krava s mastitisom
podrijetlom s velikog broja farmi u Hrvatskoj na odgovarajućem je mediju rutinski pretraživano na prisutnost
mikoplazmi tijekom zadnjih 30 godina na Zavodu za mikrobiologiju i zarazne bolesti s klinikom, no mikoplazme
nisu izdvojene. Na temelju tih rezultata može se zaključiti da je mikoplazmatski mastitis unesen u Hrvatsku
uvezenim kravama. Smatra se da je mikoplazmatski mastitis veliki problem u uzgojima mliječnih krava te je
nužno brzo i koordinirano djelovanje veterinarskih dijagnostičkih laboratorija i veterinarskih tijela kako bi se
utvrdila proširenost i omogućila kontrola ove bolesti u Hrvatskoj.
Introduction
Since the first isolation from mastitic milk in USA (Hale and others 1962, Jasper 1977)
Mycoplasma bovis and M. californicum (Mackie and others, 1982) have been recorded increasingly
frequently as causative agents of bovine mastitis worldwide. M. bovis is considered one of the most
pathogenic bovine udder mycoplasmas (Pfützner and Sachse 1996) in Europe and North America
resulting in significant economic losses in countries with intensive milk and meat production (Ter
Laak and others 1992). This kind of mastitis is highly contagious, affecting more than 20% up to 70%
of cows independently of the stage of lactation (Pfützner and Sachse 1996, Kirk and Mellenberger
2001, Nicholas and Ayling 2003). A rapid decline in milk production with visible changes in milk
consistency and increased incidence of cases resistant to standard therapy are characteristic clinical
symptoms of acute M. bovis udder infection (Kirk and Mellenberger 2001). Subclinical and chronic
infection may go undetected if not evidenced by mycoplasma examination of suitable sensitivity
(Bulletine 1987). Although predominantly associated with mastitis in cows (Pfützner and Sachse
1996), M. bovis can cause systemic infection with polyarthritis, synovitis and pneumonia in feedlot
calves (Langford 1977, Gagea and others 2006, Gevaert 2006), conjunctivitis (Alberti and others
2006), otitis, meningitis and a variety of genital disorders such as abortion and low fertility in cows
and bulls (Howard and others 1987, Bocklisch and others 1986, Kinde and others 1993, Stipkovits
and others 1993, Kirk and Lauermann 1994, Kirby and others 1996, Waltz and others 1997). This
paper presents our observations during the outbreak of bovine M. bovis mastitis in Croatia.
To investigate a possible role of mycoplasma as a causative agent of a large number of mastitis
cases in cows on a several farms in Croatia, 421 udder secretion samples were microbiologically
examined for mycoplasma presence. For that purpose, 3 ml of PPLO broth media with horse serum
and glucose (Hayflick 1965) were inoculated with 0.1 ml of udder secretions, and three further 10-
fold dilutions in PPLO broth prepared from these. The PPLO-broths were incubated at 37 0C and
plated on solid PPLO media after 4 d and again at 7 d if the first plating was negative. The plates were
incubated for 4 to 10 d at 37 0C in a candle jar. At the same time, the same milk samples collected
from mastitis herd were used for antigen capture (sandwich) ELISA. The sandwich ELISA was
carried out in microtitre plates described by Ball and others (1994). Microtitre plates were coated
with polyclonal antibodies against M. bovis. In each well 200 µl of PPLO broth media with horse
serum and glucose (Hayflick 1965) was used. Duplicate samples of milk were diluted 10-1 do 10-3
in mycoplasma medium. In a combined capture and enrichment stage, the plates were incubated for
three days. The stages to demonstrate capture consisted of one hour incubation with biotinylated
purified M. bovis monoclonal antibodies, one hour incubation with streptavidin-peroxidase (Sigma),
and finally 10 to 20 minutes incubation with substrate 3,3’, 5,5’ tetramethylbenzidine (TMB, Sigma).
The substrate reaction was stopped with 50 µl per well of 2.5 M sulphuric acid and the absorbance
measured at 450 nm with an ELISA plate reader. Positive controls consisted of broth cultures of
M. bovis, and phosphate buffered saline replaced the test sample for the negative control. Positive
reactions were easily determined. The negative controls always had an absorbance of less than 0.06
and the positive reactions always had an absorbance more than 0.4.
Polymerase chain reaction for routine identification of M. bovis described by Ghadersohi and
others (1997) and Ayling and others (1997) was used to confirm isolated strains as M. bovis.
Results
With the present ELISA procedure, M. bovis was specifically detected from 77 (18.29%) out of
421 milk samples. A total of 421 milk samples were investigated by ELISA and conventional culture
techniques. In three milk samples M. bovis was not isolated by conventional culture techniques, but
ELISA gave very strong positive reactions. Those milk samples, which were kept in refrigerator at
40 C, were resubmitted to ELISA and conventional culture techniques and at that time, both ELISA
and conventional culture on PPLO agar were positive for M. bovis. Ten out of 77 isolates, previously
identified as M. bovis (sandwich ELISA), were randomly selected and confirmed as M. bovis using
PCR.
Discussion
The supposition from consideration of the clinical characteristics of a herd mastitis problem,
where a large number of animals were resisting antibiotic therapy, could be caused by mycoplasma,
was confirmed by microbiological examination. Mastitic bovine milk originated from a large number
of farms in Croatia has been routinely cultured for mycoplasma on appropriate media at Department
of Microbiology and Infectious diseases for the last 30 years (Naglić and others, unpublished data).
On this basis, it is likely that the first case of mycoplasma mastitis in Croatia (Naglic and others,
2005) was brought into the country with the imported animals. Mycoplasma bovis is a major, often
overlooked, cause of calf pneumonia, mastitis, arthritis, and other conditions (Nicholas and Ayling,
2003). After its first isolation in 1961 in the USA from a case of severe mastitis in cattle (Hale et al.,
1962), M. bovis was isolated in many countries: Israel (1964), Spain (1967), Australia (1970), France
(1974), Britain (1975), Czech Republic (1975), Germany (1977), Denmark (1981), Switzerland
(1983), Morocco (1988), South Korea (1989), Northern Ireland (1993), Republic of Ireland (1994),
Sudan (1996), Chile (2000), Argentina (2002), Croatia (2002), Greece (2007). Our findings are in
complete agreement with published data according to clinical appearance, poor response to antibiotic
treatment and microbiological findings. All cows in this study found infected by M. bovis had been
purchased from other European countries suggesting that mycoplasma mastitis could be a problem
of herds that import replacement animals. According to Rebhun (1995) the disease is spread between
herds by transfer of infected animals, mechanical transmission of mycoplasma via milking equipment
subsequently occurring within a herd. This survey confirmed the association of M. bovis with clinical
mastitis in dairy herds in Croatia.
As bovine mycoplasma mastitis might be a major udder health problem in dairy cattle there is an
urgent necessity of coordinated action of veterinary diagnostic laboratories and veterinary authorities
in identifying the distribution and control of this infection in Croatia.
Acknowledgments
The Croatian part thanks to Dr. Hywel Ball and Mr. David Finlay for supplying monoclonal and polyclonal
Mycoplasma bovis antibodies and their assistance, advices and supervision.
References
Ayling, R. D., Nicholas, R. A. J. & Johansson, K. E (1997) Application of the polymerase chain reaction for the
routine identification of Mycoplasma bovis. Veterinary Record 141, 307-308.
Alberti, A., Addis, M. F., Chessa, B., Cubeddu, T., Profiti, M., Rosati, S., Ruiu, A. & Pittau, M. (2006)
Molecular and antigenic characterization of Mycoplasma bovis strain causing an outbreak of infectious
keratoconjunctivitis. Journal of Veterinary Diagnostic Investigation 18, 41-51.
Ball, H. J., Mackie, D. P., Finlay, D. A., Gunn, J., McFarland, E. A, Reilly, G. A. C. & Pollock, D. (1994) An
antigen-capture ELISA for the detection of Mycoplasma bovis in milk. Irish Veterinary Journal 47, 45-52
Bisping, W. & Amtsberg, G. (1988) Colour atlas for the diagnosis of bacterial pathogen in animals. Verlag Paul
Parey. Berlin, Hamburg. 306-320.
Bocklisch, H., Pfützner, H., Martin, J., Templin, G. & Kreusel, S. (1986) Mycoplasma-bovis -Aborte bei
Küchen nach experimental Infektion. Archives für Experimentalle Veterinarmedizin 40, 48-55.
Bulletine (1987) Bovine mastitis. Definition and guidelines for diagnosis. Int. Dairy Fed. Bull. 211, Brussels.
Gagea, M. I., Bateman, K. G., Shanahan, R. A., van Dreumel, T., McEwen, B. J., Carman, S., Archambault, M.
& Caswell, J. L. (2006) Naturally occurring Mycoplasma bovis-associated pneumonia and polyarthtritis in
feedlot beef calves. Journal of Veterinary Diagnostic Investigation 18, 29-40.
Gevaert, D. (2006) The importance of Mycoplasma bovis in bovine respiratory disease. Tijdschrift voor
Diergeneeskunde 131, 124-126.
Ghadersohi, A., Coelen, R. J., & Hirst, R. G. (1997) Development of a specific DNA probe and PCR for the
detection of Mycoplasma bovis. Veterinary Microbiology 56, 87-98.
Hale, H. H., Helmboldt, C. F. , Plastridge, W. N. &. Stula, V. (1962) Bovine mastitis caused by Mycoplasma
species. Cornell Veterinarian 52, 582-591.
Hayflick, L (1965) Tissue cultures and mycoplasmas. Texas Reports on Biology and Medicine 23, 285-303.
Hale, H. H., C. F. Helmboldt, W. N. Plastridge i E. F. Stula (1962) Bovine mastitis caused by a Mycoplasma
species. Cornell Veterinarian 52, 582-91.
Howard, C. J., Stott, Thomas, V, L. H., Gourlay, R. N. & Taylor, G. (1987) Protection against respiratory
diseases in calves induced by vaccines containing respiratory syncytial virus, parainfluenza type 3 virus,
Mycoplasma bovis and M. dispar. The Veterinary Record 121, 372-376.
Infante-Martinez, F., J. Aguado, D. & Eduard-Jasper (1999) Mastitis outbreak due to Mycoplasma californicum
and Mycoplasma canadense in a commercial dairy herd in the state of Jalisco, Mexico. Revista
Latinoamericana de Microbiologia. 41(3), 117-120.
Jasper, D. E. (1977) Mycoplasma and mycoplasmal mastitis. Journal of American Veterinary Medical Association
170, 1167-1172.
Kinde, H., Daft, B. M., Walker, R. L., Charlton, B. R. & Petty, R. (1993) Mycoplasma bovis associated with
decubital abscesses in Holstein calves. Journal of Veterinary Diagnostic Investingation 5, 194-197.
Kirby, F. D. & Nicolas, R. A. (1996) Isolation of Mycoplasma bovis from bullocks’s eyes. The Veterinary Record
138, 552.
Kirk, J. H., & Lauermann, L. H. (1994) Mycoplasma mastitis in dairy cows. Compendium on Continuing
Education for the Practicing Veterinarian 16, 541-551.
Kirk, J. & Mellenberger, R. (2001) Mastitis control program for mycoplasmal mastitis in dairy cows. Extension
Bulletin. Veterinary Medicine Extension Website. August 2001.
Langsford, E. U. (1977) Mycoplasma agalactiae subsp bovis in pneumonia and arthritis of bovines. Canadian
Journal of Comparative Medicine 41, 89-94.
Mackie, D. P., Ball, H. J. & Logan, E. F. (1982) Isolation of Mycoplasma californicum from an outbreak of
bovine mastitis and the experimental reproduction of the disease. The Veterinary record, 110, 578-580
Miles, R. & Nicholas, R. (1988) Mycoplasma protocols. Humana Press. Totowa, New Ywersey.
Nakamura, R. M., Walt, M. L. & Bennett, R. H. (1977) Studies on bovine genital tracts: Mycoplasma isolation
from dairy cows. Teriogenology 7, 351-355.
Naglic, T., H. Ball, B. Seol, D. Finlay, M. Benic, G. Galic (2005) The incidence of Mycoplasma bovis mastitis in
Croatia. Acta Microbiologica et Immunologica Hungarica, Supplement / Akademiai Kiado (ur.). - Budapest:
Akademiai Kiado, 2005. 103-103.
Naglic, T., B. Seol, H. Ball, D. Finlay, M. Benic, A. Galov, M. Bedekovic: An outbreak of Mycoplasma bovis
and Mycoplasma californicum mastitis and calf-pneumonia on a dairy cows farm in Croatia (unpublished
data)
Nicholas, R. A. J. & Ayling, R. D. (2003) Mycoplasma bovis: disease, diagnosis and control. Research in
Veterinary Science, 74, 2, 105-112.
Pfützner, H. & K. Sachse (1996) Mycoplasma bovis as an agent of mastitis, pneumonia, arthritis, and genital
disorders in cattle. Revue Scientifique et Technicque de l Office International des Epizooties 15, 1477-
1494.
Rebhun, W. C. (1995) Diseases of the teats and udder. In: diseases of Dairy Cattle. Lippincott Williams and
Wilkins, Philadelphia, pp. 253-308.
ter Laak, E. A., Wentink, G. H. & Zimmer, G. M. (1992) Increased prevalence of Mycoplasma bovis in the
Netherlands. Veterinary Quarterly 15, 100-104.
Stipkovits, L., Rady, V & Glavitzs, R. (1993) Mycoplasmal arthritis and meningitis in calves, Acta Veterinaria
Hungarica 41, 73-88.
Walz, P. H., Mullaney, T. P., Render, J. A., Walker, R. D., Mosser, T. & Baker, J. C. (1997) Otitis media
preweaned Holstein dairy calves in Michigan due to Mycoplasma bovis. Journal of Veterinary Diagnostic
Investingation 9, 250-254.
THE ULTRASONIC EXAMINATION OF OVARIES AS A TOOL IN GOAT
SUPEROVULATION PROCEDURES
ULTRAZVUČNA PRETRAGA JAJNIKA U SUPEROVULACIJSKIM

PO¹STUPCIMA U KOZA
Grizelj, J.¹, S. Vince¹, A. González de Bulnes², M. Karadjole¹, T. Dobranić¹, M.

Samardžija¹, I. Getz¹, N.Prvanović¹, M. Belić¹, A.Tomašković¹, M. Lipar¹, D. Cvitković¹
¹Veterinary faculty, University of Zagreb, Croatia; jgrizelj@vef.hr, svince@vef.hr

²INIA, Dpto. de Reproducción Animal y Conservación de Recursos Zoogenéticos, Madrid, Spain
Abstract
The aim of this research was to establish the importance and accuracy of the ultrasonic examination of
donor goats submitted to superovulation procedures. For this reason 9 goats were systematically examined by
ultrasound: 1) to monitor development of the follicles on the ovaries after hormonal treatement started; 2) to
confirm the ovulation(s) and 3) to assess the quality of the corpus/ora luteum/ea (CL) on the respective ovaries.
To perform the ultrasonic examination the animals were placed in dorsal recumbency and 7,5MHz ultrasound
probe was placed into the rectum.The accuracy of the ultrasound exams was measured by comparing the number
of follicles counted on ovaries with number of corpora lutea presented after laparatomy was done to accomplish
the lavage of uterus and collection of the 7 days old embryos.The absence of follicle(s) on ovaries after ovulation
was expected and does mated was considered as a sign of occured ovulation. The rate of follicles found on the
ovaries by ultrasound / number of corpora lutea counted when the uterus was rinsed was 57,86%. If there were
less then 10 follicles per ovary the results were even better. The ultrasonic exams of donor goats is appreciable
tool by which follicular dynamics can be followed and the success of superovulation procedure predicted and
measured.
Key words: ultrasonic examination, ovary, goat, superovulation, ovulation, follicle, corpus luteum
Sažetak
Cilj ovoga rada bio je utvrditi važnost i točnost ultrazvučnog pregleda koza davateljica u postupcima
superovulacije. U tu svrhu 9 je koza sustavno pregledavano ultrazvukom: 1) kako bi se pratio razvoj folikula na
jajnicima nakon započetog hormonalnog tretmana; 2) kako bi se potvrdila/e ovulacija/e i 3) kako bi se procijenila
kvaliteta žutog/ih tijela (CL) na jajnicima. Prilikom izvođenja ultrazvučne pretrage životinje su polegnute
na leđa, a 7,5MHz linearna ultrazvučna sonda aplicirana je rektalno. Točnost ultrazvučnih nalaza mjerena je
usporedbom broja ultrazvukom utvrđenih folikula na jajnicima sa brojem žutih tijela prisutnih na jajnicima
prilikom laparotomijskog ispiranja maternice koza u svrhu dobivanja 7 dana starih zametaka. Ultrazvukom
utvrđeno neprisutstvo folikula na jajnicima nakon očekivane ovulacije i parenja smatrano je potvrdom nastupa
ovulacije. Stopa ultrazuvučno utvrđenih folikula na jajnicima / broj žutih tijela izbrojanih prilikom ispiranja
maternica je iznosila 57,86%. Ukoliko je na jajnicima bilo sveukupno manje od 10 folikula rezultati su bili i
bolji. Ultrazvučne pretrage koza davateljica značajna su metoda za praćenje folikularne dinamike te za procjenu
i mjerenje uspjeha superovulacijskog hormonalnog postupka.
Ključne riječi: ultrazvučna pretraga, jajnik, koza, superovulacija, ovulacija, folikul, corpus luteum
Introduction
The ultrasonic examination of the ovaries allows the visualization and measuring of ovaries
and its cyclic structures (follicles, corpora lutea). The use of transabdominal pregnancy diagnostic
(5MHz) in the countries where intensive goat industry has been practiced is done routinely.
Nevertheless, transrectal exams of the ovaries are restricted to the scientific purposes mostly. The
detailed ultrasonographic patterns of preovulatory and ovulatory follicles in goats has not been
performed until recently (González de Bulnes et al., 2004). The frequency used to obtain a detailed
view of the ovarian structures are higher (7,5MHz) than those used for transabdominal purposes.
Although the ovulatory size of follicles is 6-8mm, the ultrasound exams allows the small antral
follicles (2-3mm) to be detected as anechoic structures of sphery shape and thin wall and their growth
and development (González de Bulnes et al., 1994).
Riesenberg et al. (2001) found that small follicles began to rise immediately after the
superovulatory stimulus and reach its maximum size during late proestrus or oestrus.
It is considered that the ovulation occurs if the absence of follicular antrum was noticed after
exams were performed once a day and the presence of increased heterogeneous echogenicity in its
site was found (González de Bulnes et al., 2004). It is so due to the fact that the ultrasound structure
of corpus haemorragicum does not differ from the rest of the ovarian parenchym (González de Bulnes
et al., 1999). The process of the corpus luteum formation allows it to be clearly detected as normo
and hiperechoic pattern.
It should be mentioned that aproximatively 33% of CL have a central cavity (González de Bulnes
et al., 1999) which must not be confused with small follicles. The most important difference is the
presence of typical thick wall of CL. Also to be considered is the occurence of partial or total early
luteolysis of corpora lutea in 10-35% of does (Chemineau et al., 1999), which as a consequence has
a big percentage of retarded and degenerated, non- transferable embryos.
The aim of this study was to evaluate the possibility of the prompt detection of ovulation and the
efficacy of accurate detection of follicles created after the goats were submitted to superovulatory
treatements.
Methods
Nine females, assigned to produce the embryos by superovulation procedure were systematically
examined by ultrasound to monitor development of follicules on their ovaries and to confirm the
ovulations.
The study was performed during the breeding season (February) using 9 young nanny goats of
Boer breed, in average age of one year. The animals were held outdoors and by the beginning of the
study they were put indoors, at the facilities of Veterinary faculty in Zagreb, Croatia at a lattitude of
45°N.
To perform the ultrasonic exam the goats were placed in dorsal recumbency, restrained in a
cradle as used for laparoscopy and 7,5MHz lubricated linear array ultrasound probe was placed into
the rectum (Sonovet 2000, Medison Co., Ltd., South Korea).
It is known that probes with outer dimensions of 10cm length, 3cm height and 2cm width can be
introduced into the rectum without difficulties (Kaspar, 1988).
It is necessary that probe can be rotated laterally. If the probe to be used is not attached to a
sufficiently stiff cable which can advance the probe into the rectum, a pipe or concave rod should be
used to stiff the probe (Kähn, 2004).
After the probe has been placed into the rectum, with transductor directed ventrally, it is
pushed cranially to find out the urinary bladder which, due to tipically anechoic shade, represent the
orientation point. After reaching it, the probe is turned a little bit cranially and then laterally on both
directions in order to localise the ovaries, which are situated within the curves of the uterine horns.
The Boer does were submitted to ultrasonic exams once a day through a 3 days superovulatory
treatement with porcine follicle-stimulating hormone (pFSH; Folltropin®–V, Vetrepharm, Canada)
and on the day of oestrus detection. The hormonal treatement was divided into 6 parts in decreasing
concentration and applied at 12 hours intervals. The doses used were 2 times 50mg pFSH and 2 times
25mg for the second and the third day as well. The ovaries were examined in order to confirm the
ovulation 2days after the goats were hand mated as well.

Table 1. The accuracy of ultrasound exams of goat ovaries submitted to hormonal superovulation
by 3 days FSH treatement. The comparison of number of follicles ≥6mm counted on ovaries on
the day of oestrus detection with number of corpora lutea present after laparatomy was done to
accomplish the collection of embryos.
n° of nanny goat n° of follicles ≥6mm n° of CL % of accuracy

1 9 17 52,94
2 12 28 42,86
3 7 14 50,00
4 8 19 42,11
5 7 10 70,00
6 8 9 88,89
7 8 8 100,00
8 11 18 61,11
9 11 17 64,71
Σ 81 140 57,86
The ultrasound accuracy was found to be 57,86% which is in accordance with Kähn (2004) who
pointed out that sonographic examination could only enable the researcher to establish the tendency
in follicle numbers and makes counting the exact number of follicles impossible.
González de Bulnes et al. (1999) explained such difference as a consequence of follicular
superposition. The follicles placed one next to another could mask each other (Fig. 1., 2.) and
consequently provoke mistakes. Moreover, they mentioned that transversal, anechoic section of
blood vessels could also be, by mistake, considered as follicles. To avoid it, the probe should always
be rotated a little bit to obtain the elongated longitudinal section of blood vessel and thereby prevent
the mistakes.
The absence of follicle(s) on ovaries, established by ultrasound exam 48h after onset of oestrus,
is considered as sign of occured ovulation (Fig. 4).
Fig. 1., 2. Ultrasonographic image of superovulated ovary with many follicles present
Fig. 3. Image of superovulated ovaries after laparatomy has been performed
Fig. 4. Ultrasonographic image of ovary 48 h after onset of oestrus; the absence of follicles is considered as
occured ovulation
We also found out that some minor number of follicles did not ovulate and therefore were present
on the respected ovaries after ovulation of the great majority of follicles was confirmed. Nevertheless,
their presence do not influence the quality of created CL and collected embryos as measured by
serum progesterone concentration and quality assessment of embryos.
On the other hand, frequent appearance (10-35%) of early luteolysed CL significantly diminish
the quality and development potential of embryos (Chemineau et al., 1999).
Pierson and Ginther (1988) defined the difficulties of determing the corpora haemorragica by
ultrasound due to the very similar ultrasound pattern as a ovarian parenchym.
González de Bulnes et al. (1999) pointed out the problem of superposed corpora lutea what
disable the corpora lutea to be counted.
This study confirmed those difficulties and furthermore affirmed the inability to differenciate the
formed corpora lutea one from each other due to their merged outlines, despite hyperechoic pattern
attained.
Conclusions
Although it is impossible to determine by ultrasound the exact number of follicles arised after
pFSH treatement was done, the ultrasound examination was found to be very useful tool to estimate
the tendency of individual follicular development. It is also a suitable device to determine the
occurance of the ovulation of the respective follicles.
In this way the ultrasound exams of the ovaries could save the time and the money due to
elimination of those animals who did not respond to the treatement or did not ovulated as well before
the laparatomy and collection of embryos start.
References
Chemineau P, Baril G, Leboeuf B, et al. Implications des progres recents en physiologie de la reproduction pour
la conduite de la reproduction dans l’espece caprine. INRA Prod.Anim. 1999; 12(2): 135-146.
González de Bulnes, A., Díaz-Delfa, C., Urrutia, B., Carrizosa, J.A., López Sebastián, A. (2004): Ultrasonographic
screening of the ovulatory proces sin goats. Small Ruminant Research 52: 165-168.
González de Bulnes, A., Santiago Moreno, J., García López, M., Gómez Brunet, A., López Sebastián, A.
(1994): Observación del ovario en la oveja y eficacia en la detección de folículos y cuerpos lúteos mediante
ecografía transrectal: Investigación Agraria, 9: 319-329.
González de Bulnes, A., Santiago Moreno, J., López Sebastián, A. (1999): Exploración del aparato genital
femenino. Monografías Ovis, 61: 21-33.
Kähn, W. (2004): Veterinary Reproductive Ultrasonography, Special ed. Reprint from 1994. Schlütersche
Verlagsgesellschaft. Hannover. pp. 189-193.
Kaspar, B. (1988): Beitrag zur Sonographie in der gynäkologischen Diagnostik, insbesondere zur Feststellung
der Gravidität bei Schaf und Ziege. Tagungsbericht «Krankheiten der kleinen Wiederkäuer» der DVG,
Gieβen.
Pierson, R.A. and Ginther, O.J. (1988): Follicular populations during the oestrus cycle in heifers III. Time of
selection of ovulatory follicle. Animal Reproduction Science, 16: 81-95.
Riesenberg, S., Meinecke-Tillmann, S., Meinecke, B. (2001): Ultrasonic survey of follicular development
following superovulation with a single application of pFSH, eCG or hMG in goats. Small Ruminant
Research, 40(1): 83-93.
SYNCHRONIZATION OF OESTRUS IN KARADI EWES: THE USE OF
DIFFERENT PMSG DOSES
Sinkronizacija estrusa u karadi ovaca: uporaba

različitih PMSG DOza
SAIF A. BALIOS
Department of Surgery and Veterinary Medicine, College of Veterinary Medicine, University

Of Dohuk, Kurdistan Region, Iraq.
Abstract:
The experiment was performed on 80 karadi ewes. The ewes were randomly divided into 4 groups.
Intravaginal sponges containing 40 mg of FGA, were left in the vagina of groups 2,3 and 4 for 14 d. Immediately
after removal of the sponges,PMSG hormones at the doses of 500 IU (T1), 600 IU (T2) and 700 IU (T3)
respectively were administered intramuscularly. The first group served as control. Conception rate was slightly
higher (p<0.05) in control group (90%) compared with the treated groups ( 80%). Ewes in T1, T2 and T3 groups
exhibited the highest ( 12.5, 18.75 and 12.5 respectively) twinning percentage (p<0.01) and litter size (1.12, 1.18
and 1.12 respectively) (p<0.05). In conclusion the implementation of 500, 600 and 700 IU of PMSG in karadi
sheep warrants improvement of the reproductive efficiency of karadi ewes during the mating season.
Key words: Karadi ewe, PMSG,Reproductive performance.
Sažetak
Pokus je proveden na 80 ovaca koje su nasumično podijeljene u 4 grupe. Vaginalne spužvice sa 40 mg FGA
su aplicirane u 2., 3. i 4. skupini ovaca te su držane tijekom 14 dana. Odmah po vađenju spužvica, intramuskularno
je apliciran PMSG hormon u dozi od 500 i.j. (G1), 600 i.j. (G2) i 700 i.j. (G3). Prva je skupina ovaca bila
kontrolna. Stopa koncepcije je bila lagano viša (p<0,05) u kontrolnoj skupini (90%), nego u tretiranim grupama
ovaca (80%). Ovce u G1, G2 i G3 su pak imale viši (p<0,01) postotak dvojaka (12,5; 18,75 i 12,5) i veličinu
legla (1,12; 1,18 i 1,12) (p<0.05). Zaključeno je kako uporaba 500, 600 i 700 i.j. PMSG u Karadi ovaca jamči
poboljšanje rasplodne učinkovitosti Karadi ovaca tijekom sezone spolne aktivnosti.
Ključne riječi: Karadi ovca, PMSG, rasplodna svojstva
Introduction:
Sheep are considered to be one of the first domesticated mammals and are known to have been
closely associated with man from a very early date. Sheep offer the potential of making an important
contribution to providing food and fiber for a growing world population. The fact that most ewes in
the agriculturally productive countries are seasonal breeders and in general produce smaller lamb
crops than farmers may wish has made sheep an obvious target for the reproductive physiologist’s
attention (20).
To increase fertility in sheep and thus to benefit more from facilities, melatonin, PGf2 alpha and
progestogens are used to stimulate and synchronize oestrus. Progestogens can be used alone or with
FSH and PMSG (13).
An intravaginal progestogen sponge, followed by PMSG injection has been applied to ewes to
synchronize oestrus during the breeding season (17,21). Intramuscular administration of 400 IU and
500- 700 IU of PMSG at day when intravaginally applied sponges were removed increased the ratio
of ovulation and twinning (10, 11).
There is no information regarding synchronization efficiency and fertility induced by
administration of hormones in karadi ewes during breeding season. Thus the purpose of this study
was to investigate the influences of intravaginally applied FGA and intramuscularly injected different
doses of PMSG on fertility, twinning rate and litter size in karadi sheep in mating season in Dohuk
Governorate.
Materials and Methods:
The experiment was conducted at the Department of Animal Production Faculty of Agriculture
College, Dohuk University, in Kurdistan Region in the north of Iraq during 2006 mating season.
Eighty karadi breed ewes (2-4 years old) were used. Animals were allowed to graze cereal
stubble and barley grains (400 g for ewe per day) according to their requirements (18).
Animals were randomly divided into four groups. The first group (n=20) was served as control
(C), and ewes of groups 2, 3 and 4 (n=20) for each of them were intramuscularly injected with
500(T1), 600 (T2) and 700 (T3) IU PMSG ( SYNCRO-PART PMSG, Ceva, France) . The injections
were carried out 14 days after the withdrawal of the vaginal sponges impregnated with 40 mg of FGA
(SYNCRO-PART sponge, Ceva, France).
Active fertile rams (1:10) were introduced to ewes, 24 hrs. after the withdrawal of the sponges.
Rams were left with the ewes for 3 estrul cycles together with the control group.
For this experiment, fertility (%), litter size and the rates of conception, lambing and twinning
were together calculated according to Al-Saigh and Al-Kass(1992) (7).
Data were analyzed by using GLM procedures (SAS, 1996) (19). Chi-square test was performed
to test the significance of the differences.
Results:
Effects of FGA vaginal sponge which used to synchronize oestrus and different doses of PMSG
on fertility parameters were presented in table 1.
Fertility rate was not affected significantly by PMSG treatment. Though it tended to be higher
in control group (85 %) (Table 1). Conception rate on the other hand was higher (p< 0.05) in control
group (90%) compared with PMSG treated groups (80 %) (Table 1).
Lambing rate tended to be higher in T2 group than in T1, T2 and C group. T1, T2 and T3 groups
exhibited the highest (p<0.01) twinning rates in relation with C group (Table 1).Treatment with
PMSG caused significant (p<0.05) in litter size of treated ewes (1.12, 1.18, vs. 1.05).
Table 1: Effects of FGA and PMSG treatment on reproductive performance in Karadi ewes
Treatment
Level of signifi-
Traits C T1 T2 T3 cance
No. of ewes 20 20 20 20
No. of Lambs 17 16 16 16
No. of ewes aborted 1.00 0.00 0.00 0.00
(1) Fertility ( % ) 85 80 80 80 N.S
(2) conception rate ( % ) 90 80 80 80 *
No. of lambs born 18 18 19 18
No. of twins born 1 2 3 2
(3) Lambing rate ( % ) 90 90 95 90 N.S
(4)Twinning rate ( % ) 5.88 12.5 18.75 12.5 **
(5)Liters_size 1.05 1.12 1.18 1.12 *
* = p < 0.05
** = p < 0.01
N.S = Non significant.
(1) No. of ewes lambed /No. of ram-exposured of ewes X100.
(2) No. of ewes lambed and aborted / No. of ram-exposured X 100.
(3) No. of lambs born/ No. of ram –exposured ewes X 100.
(4) No. of twin born / No. of ewes lambed X100.
(5) No. of lambs born / No. of ewe lambed.
Discussion:
Results of the present study revealed a high rate of fertility (85%) compared with those previously
reported by Alkass et al.,(72%) (5) and Al-Khzraji et al.,(45-70%) (6) and in line with that of Imm and
Juma (85%) (14).In retrospect,these findings are lower than the previous results obtained by Alkass
et al.,(92.2%)(4 ) and Timurkan and Yildiz (100%) (21).One could argue that the main reasons for
the reduction of fertility in PMSG treated ewes compared with control group (85%) in the present
study could be attributed to both uterine and ovarian causes. This may be due in part,to differences in
responsiveness of the ovaries to PMSG (16) reduced sperm transport (15) as well as to alteration in
the cleavage rate (2) or in circulating hormonal milieu (8).
Considering the present values of conception rates, the low rates (80%) as compared with those
reported by Alkass et al, (98.7%) (4) experimented on adult ewes using 600 IU PMSG. Differences
as such may reflect the differences in the potency between analogues as well as in the management
practices followed .On the other hand the conception rate was similar to the previous finding of
Alkass et al.,(84%) (5).
Lambing rate in the treated ewes was 90-95% this similar to (90-100%) reported by Timurkan
and Yildiz (21) and 90% reported by Crosby and O’callaghan (9). Similar improvement in twinning
rate was also observed by Ageel (1) using 500 IU PMSG for adult Awassi ewes. It was pointed out
that administration of PMSG increased the number of follicles and therefore raised the twinning
rates(12).
Collectively, increasing lambing and twinning rates would certainly increase the number of
lambs born and consequently increase farmers profits under Iraqi farm condition. Treatment with
PMSG caused a significant increase in litter size among treated ewes. These results data are consistent
with the finding of Al-Haboby et al.,(3).
These data indicated that 500,600 and 700 IU of PMSG is a supportive tool in improving some
of the reproductive output of Karadi ewes raised semi extensively during breeding season in north
of Iraq.
References:
1-Ageel, H.M. (1998).Effect of breeding group and hormonal treatment on Reproductive performance of
Awassi sheep. M.Sc.Thesis. College of Agriculture, University of Baghdad (Arabic).
2- Ahmed, N., Schrick, F.N., Butcher, R.L. and Inskeep, k. (1995). Effect of Persistent follicles on early
embryonic losses in beff cows. Biol. Reprod. 52: 1129- 1138.
3- Al-Haboby,A.H.,Al-salman,M.H., Hassan,H.A. and Faraj,H. (1992). Estrus synchronization and superovulation
of Awassi sheep. IPAJ.Agric.Res.2: 126- 174.
4-Alkass,J.E.,Abdulkareem,T.A. and Al-Anbari,N.N.(1999).The combined Effect of PMSG and Vitamin A
administration on some Reproductive performance of Awassi ewes .2nd Scientific Conference for
Agriculture Research (Animal Production ) Baghdad. Pp.128-135.
5-Alkass,J.E.,Abdulkareem,T.A. and Al-Mjamei,S.M.(2004).Reproduction Performance of Iraqi Awassi ewes
in response to treatment with Equine chorionic gonadotropin .J.Agri.Investment.2:74-77.
6- Al-Khazraji,A.A., Abu-Tabeigh,S.M.,Abdulkareem,T.A. and Mahdi, U.A.(2000).Reproductive response s of
Awassi ewes to different Level of PMSG administration .Iraqi J. Agric.Sci.31:681-687.
7-Al-saigh, M.N. and Alkass,J.E.(1992).Sheep and goat production Dar Al-Hikma Press.(Arabic).
8-Chow,L.A.,Thatcher,W.W.,Karla,P.S.,Wilcox,C.J. and Chenault,J.R. (1982).Peripheral progesterone,estradiol
and luteinizing hormone Plasma levels during and after estrus synchronization in dairy Heifers with
melengestrol acetate .Arq.Esc.Vet.34:545-556.
9- Crosby,T.F. and O’Callghan,D.(1991) .Effect of rumen degradable Bolus containing melatonin or progesterone
plus PMSG on oestrus Response and lambing rates in ewes.Theriogenology.35:747-752.
10- Cruz,D.G.,DeLa Castaneda,M.J.and Rocha,C.G.(1991).Effects of Oestrus synchronization by means of
FGA-impregnated sponges On the fertility and prolificacy of partly housed pelibuey ewes. Anim. Breed
Abstr.59:1052.
11-Gonzalez Lopez,J.,Espejo Diaz,M.,Serrano Garride,A. and Alvarez Martinez,Aj.(1987).Increasing lambing
frequency by means of Techniques for controlling the oestrus cycle in Merino and Merino x Romanov
ewes. Anim. Breed Abstr.55:5083.
12-Gulyuz,F. and Kozat,S. (1995). Synchronization of oestrus in sheep and The effect of PMSG dose on lambs
number.YYU J Faculty Vet. Med. 6:64-66.
13-Hafez,E.S.E.(1993). Reproductive cycles. In: Reproduction in Farm Animals. Hafez E.S.E.(Ed),Lea &
Febiger, Philadelphia.pp.94-113.
14-Imm,A.A.and Juma,F.T.(1987). Estrus synchronization with hormones And its influence on Karadi ewes.
Iraqi J.Agric.Sci.(Zanco)5(3): 71-79.
15- Lauderdale, J.W. and Ericsson, R.J.(1970). Physiological conditions Affecting the ability of cattle uteri to
influence the fertilizing Capacity of sperm . Biol.Reprod.2:179-188.
16-Mann,G.E., McNelly,A.S. and Baird,D.T.(1992).Hormone production In vivo and in vitro from follicles at
different stages of the estrus Cycle in sheep .J.Endocrinol.132:225-235.
17- Mutiga,E.R.and Mukasa-Mugerwa,E.(1992).Effect of method of estrus Synchronization and PMSG dosage
on estrus and twinning in Ethiopian Menz sheep .Theriogenology 38:727-734.
18-NRC.(1975).Nutrients Requirement of Domestic Animals .No.5.Nutrient Requirement of sheep .Fifth edn.
National Academy of sciences. National Research Council .Washington,D.C.
19-SAS.(1996).Users Guide statistics.SAS Inst. Cary.NC. 20-Shelon,M.(1995). Harnessing the biological
potential of sheep in Providing protein for growing world population .J.Anim.Sci.73: 243.
21-Timurkan,H.and Yildiz,H.(2005).Synchronization of oesrtus in Hamdan Ewes : The use of different PMSG
doses .Bull.Vet.Inst.Pulawy.49: 311-314.
Surgery - Miscellaneus
Kirurgija - Ostalo
Role of Bovine Digital Dermatitis (BDD) on service period
of dairy cattle
Utjecaj bovinog digitalnog dermatitisa na servis period

krava muzara
Gjino P.¹, Koleci Xh.¹, Turmalaj L.¹, Grizelj J.², Vince S.2, Lika E.¹
¹Agricultural University of Tirana, Faculty of veterinary medicine, Albania

²Veterinary faculty, University of Zagreb, Croatia
Abstract
Several conditions of foot infections of cattle; bovine interdigital dermatitis, bovine interdigital
necrobacillosis, bovine digital dermatitis (BDD), lamellar suppuration are described in the literature (5, 6). The
bovine digital dermatitis is the most frequent one causing a painful and severe lameness; economic loss due to
decreased milk production and reproduction performance (4, 5, 7). The disease was described for the first time
in Italy in 1974 as Mortellaro’s disease. It occurs primarily in dairy cattle and have been reported as a cause of
lameness worldwide, including Albania. BDD is generally considered as infectious disease (4). This study is
focused on the role of bovine digital dermatitis on service period of affected cows. The study was carried out on
dairy cattle herd in Tirana, Albania. The prevalence of this condition was evaluated, the main bacterial causes
were isolated and the time of successful insemination was surveyed. The animals were divided in two groups.
Each group consisted of six cows in same physiological status and management conditions. The first group was
composed of cows not affected, while the second group comprised the animals affected by foot infections. The
prevalence of foot infections on the farm was 18,67%. The main bacterial agents implicated were Fusobacterium
necrophorum, Dicolobacterium nodosus and Arcanobacterium pyogenes. A significant difference between two
groups was established. The cows from the first group were successfully inseminated 91,5 ± 13,3 days after
delivery. The affected group of cows was successfully inseminated 139 ± 143 days after parturition.
Key words: cattle, foot infection, service period, successful insemination
Sažetak
U literaturi je opisano nekoliko zaraznih stanja papaka; bovini interdigitalni dermatitis, bovina interdigitalna
nekrobaciloza, bovini digitalni dermatitis (BDD) i lamelarna supuracija. Bovini digitalni dermatitis je najčešći,
uzrokujući bol i jako šepanje te gospodarske gubitke zbog smanjenja proizvodnje mlijeka i smanjenih
reproduktivnih parametara. Bolest je prvi puta opisana u Italiji 1974. kao Mortellaro-va bolest. Prvenstveno se
javlja u krava muzara, a potvrđena je širom svijeta kao uzrok hromosti, uključujući Albaniju. BDD se općenito
smatra zaraznom bolesti. Ova je studija usmjerena na proučavanje utjecaja BDD-a na servis period u zahvaćenih
krava, a provedena je na stadu krava muzara u Tirani, Albanija. Proučavana je pojavnost ovog stanja, izolirani
su glavni bakterijski uzročnici te je promatrano vrijeme do uspješnog osjemenjivanja. Životinje su podijeljene u
dvije supine. Svaka grupa sastojala se od 6 krava istog fiziološkog statusa i držanih u jednakim uvjetima. Prvu
skupinu su sačinjavale krave nezahvaćene bolešću, dok su drugu skupinu sačinjavale krave sa bolesnim papcima.
Ukupna pojavnost bolesti papaka na farmi iznosila je 18,67%. Dominantni izolirani bakterijski uzročnici bili
su Fusobacterium necrophorum, Dicolobacterium nodosus i Arcanobacterium pyogenes. Utvrđena je znakovita
razlika između dviju supina - krave iz prve skupine uspješno su osjemenjene 91,5 ± 13,3 dana nakon teljenja, a
s druge strane, zahvaćena supina životinja uspješno je osjemenjena 139 ± 143 dana nakon poroda.
Ključne riječi: govedo, infekcija papka, servis period, uspješno osjemenjivanje
Introduction
Bovine digital dermatitis (BDD) is a bacterial infection of the epidermal skin of the claw (4, 7).
Early lesions are circumscribed, with a red, granular appearance. Lameness is severe, and economic
losses are due to decreased milk production and suboptimal reproductive performance (4).
Etiology
A mixed population of Gram-negative bacteria including anaerobic, microaerofilic organisms
and spirochetes has been identified and isolated (1, 2, 3). At least five different spirochetal phylotypes
within genus Treponema have been identified whereas Treponema denticola-like spirochetes were
the most common (5). Spirochetes isolated from cases of severe virulent ovine foot rot (SVOFR)
in Australia, UK and Ireland are closely related to a treponeme isolated from human periodontitis
and bovine digital dermatitis. This suggests the possibility of cross-species transmission (3, 5).
There are reports about combination between spirochetes, Campylobacter faecalis, Fusobacterium
necrophorum and Borrelia burgdopheri. The two spirochetes most likely to be implicated are the
Treponemes designated 2-1498 and 1-9185 MED. Experimental transmission of BDD has been
achieved by applying fresh BDD exudates on scarified, through eight consecutive days soaked
calf skin, using gauze. This shows the extreme importance of wet environmental conditions for the
development of the disease.
Risk factors
Host risk factors. The prevalence increases with age. At the age of one, almost all animals
have some epiderman skin lesions of the claw of at least one foot. The clinical disease is much more
common in first calf heifer and young cows. The first parity cows have the highest odds of BDD. The
odds decrease, in a dose-effect manner, as parity increases. The odds of BDD increase as lactation
progresses. The plantar and palmar regions of foot may be more conductive to the development of
BDD because these anatomical sites are more exposed to moisture (1, 5, 7).
Environmental risk factors. The BDD is about 20 times more likely to be found in dairy herds
with muddier corrals than in farms with drier ground surface in corrals. The disease is more common
in the freestall confined herds due to the fact that feet are constantly exposed to moisture so they
become coated with layer of dried feces. Purchased heifers increased 4,7 times the risk of disease
occurrence in comparison with the herds where heifers were not purchased on such a manner. The
disease is more likely to appear in the herds were the footbaths are not used regularly. It is more
frequent in the herds where the cows are housed in the slatted floor than in animals housed in straw.
Feeding with a large variety of dietary present a protective measure (5).
Pathogen risk factors. The Treponema strains have adhesion properties and produce high levels
of Chymotrypsine-like protease and high level of praline iminopeptidase which present a major
virulence factor.
Economic importance. The BDD positive herds experience an economic loss due to reduced
total milk production per lactation, longer calving to conception interval and higher number of
services per conception (5).
The study was carried out during the years of 2006 and 2007 on dairy cattle of Frisian / Holstein
breed in Tirana district. Firstly, the prevalence of foot root infections on the herd have been evaluated.
Thereafter, the cows were divided in two groups. The first group consisted of cows not affected and
the second group comprised the animals affected by BDD. The samples were collected with purpose
of isolating the bacterial pathogens which were involved on the apparition of digital dermatitis. There
was no opportunity to carry out the examination of the histologic smears on dark field microscopy to
evaluate the presence of Treponema serovar which may be involved. This study comprised the cows
in the last month of pregnancy and raised in the same management conditions. The period of time
from calving to conception was evaluated and compared between groups.

The prevalence of BDD was 18,67% (48 out of 257 cows). The most affected were first parity
heifers. The data are presented in the chart below.
Incide nce of B ov ine D igital D e rmatitis in D airy cows according

to parity
4 8
4
3 9
3 num ber of affec ted c aw s
Parity
13 Num ber of parity

2
2
1 18
0
Num be r of a ffe c te d c ow s
The high incidence of digital dermatitis in young cows is considered as a consequence of

farmer’s manner of supplying the heifers from the market. The animals were exposed to different
stable conditions and management, as well as stress factors like delivery, first lactation and different
feed.
Mixed bacterial flora was isolated from submitted samples, most prevalently Fusobacterium
necrophorum. The main objective of the study was to determine the impact of BDD on reproduction
performance. The emphasis was put on their influence on calving to conception interval as well as on
number of services per conception.
Dairy cattle Digital Dermatitis
The data for the control group (healthy cows) are presented below.
Calving to conception period
Ear tag No Date of calving Date of successful service
(days)
035 692 06. 03. 2006. 08. 06. 2006. 108
035 166 12. 02. 2006. 19. 05. 2006. 106
035 210 03. 01. 2006. 28. 03. 2006. 84
035 070 27. 02. 2006. 15. 05. 2006. 77
035 139 11. 02. 2006. 02. 05. 2006. 80
035 327 23. 05. 2006. 04. 09. 2006. 94
The data for the second group (affected cows) are presented below.
Date of service of
Calving to conception
Ear tag No Date of calving conception
period (days)
035 174 03. 04. 2006. 03. 09. 2006. 153
035 228 11. 01. 2006. 24. 05. 2006. 133
035 479 16. 02. 2006. 30. 06. 2006. 134
035 462 18. 01. 2006. 26. 06. 2006. 159
035 511 24. 02. 2006. 24. 06. 2006. 120
035 613 18. 04. 2006. 28. 09. 2006. 135
The data indicated a significant difference between two groups. The service period was 91,5 ±
13,3 days for the first group and 139 ± 14,38 days for the second. We concluded that the prevalence
of digital dermatitis is high in our farm. The absence of control program allows and predisposes the
high prevalence. The BDD have a big impact on duration of calving to conception period.
A control program for the foot rot infection in the farm should be established as a routine
procedure, as animals with lesions act as reservoirs of infection for other animals. The important
attention should be pointed to environmental factors and disinfection which should be carried out
regularly.
References:
1. Berberi P. et al. (2003): Diseases of Ruminants
2. Çabeli P. (2006): Microbiology Veterinary
3. Dwight C. Hirsh and Yan Chung Zee., P J. (1999): Veterinary Microbiology
4. Irish Veterinary Journal (2007) Vol.60. Nr.2
5. O. M. Rodostits et al. (2007): Veterinary Medicine, Saunders Co. Ltd., London, Great Britain
6. P. J. Quinn, B. K. Markey, M. E. Carter, W. J. Donnelly and F. C. Leonard, Quinn P.J. et al. (1994): Clinical
Microbiology
INFLUENCE ON PREVALENCE OF THE DERMATITIS DIGITALIS
PAPILLOMATOSA IN THE DAIRY HERDS
UTJECAJ NA POJAVNOST PAPILOMATOZNOG DIGITALNOG

DERMATITISA U MLIJEČNIH KRAVA
Borut Zemljič
Dr. Vet. Med. MrSci, PhD, Dipl ECBHM;Veterinary Polyclinic Ormož d.o.o., Ljutomerska 25, SI2270 Ormož,
Slovenia, Phone: +386 41 639 087, E-mail: borut.zemljic@veterina-ormoz.si
Abstract
The trial was performed on six dairy farms with total number of 652 animals. All animals in our trial were
twice a year systematically corrected and during this procedure not only correction of the defects, but also
inventarisation of all changes on all four feet was made. First systemic correction was made at the end of the
winter period, just before on the three farms animals were put on the pasture, on three other farms animals were
not on pasture any time. Second corrections were mostly done at the end of October or in begin of November. In
between every two weeks material from the manager or the owner of the farm was collected with the data about
obvious seen changes during the milking procedure on the claws of the animals. Every individual procedure was
reported and all the data were at the end statistical evaluated. On all six farms system of disinfection of the claw
was changes during the trial, so we were in the position to measure effect on appearance of dermatitis digitalis
papilomatosa. Data were compared and statistical evaluated. There were no statistical significant improvement;
only on one farm we observed significant changes in prevalence of dermatitis digitalis papilomatosa.
Sažetak
Istraživanje je provedeno na šest farmi mliječnih krava s ukupnim brojem od 652 grla.Sve
promatrane životinje godišnje su dva puta bile obuhvaćene pregledom i korekcijom papaka a izvršena
je zabilježba svih nađenih promjena na sva četiri ekstremiteta.Prvi pregled i korekcija izvedeni su
krajem zimskog perioda,pri čemu u tri farme neposredno prije ispusta na pašnjak a u preostale tri
farme krave su držane u stajama.Drugi pregled i korekcija su obavljeni krajem listopada ili početkom
mjeseca studenog.U međuvremenu svaka dva tjedna rukovoditelj farme ili vlasnik farme je tijekom
mužnje bilježio zamjećene promjene na papcima.Svi podaci su statistički obrađeni. U svih šest
promatranih skupina dezinfekcija papaka je obavljana, no različitim načinima, a mi smo obradili
dobivene rezultate glede pojavnosti papilomatoznog digitalnog dermatitisa.Podaci su statistički
obrađeni i međusobno uspoređeni.Nismo naišli na statistički značajne promjene osim na jednoj
farmi.
Introduction
Dermatitis digitalis (DD) or papilomatous dermatitis digitalis (PDD) of cattle has been identified
as a major cause of lameness and economic looses in dairy herd production world wide. Dermatitis
digitalis is a multifactorial, superficial dermatitis of the digital skin above the coronet in cattle.
Dermatitis digitalis was first diagnosed 1974 in Italy by Mortellaro and after that successively in
different parts of the world, where intense dairy production is present, was reported. In Colour Atlas
of Affections of Bovine Digit from 1984 four diseases were described: Dermatitis digitalis, Dermatitis
interdigitalis, Dermatitis verrucosa and Interdigitalis phlegmon, Zemljic reported in 1994 about
presence of Spirochete like organisms as potential cause of the disease and two years latter same
group founded out, that papilomatous changes on the lesions were actually chronic development of
the disease; therefore disease was named dermatitis digitalis papilomatosa or papilomatous digital
dermatitis (PDD).
Dermatitis digitalis papilomatosa (PDD) could be one of the major causes for diminishing
production in modern dairy herds. Especially in loos house systems and in Holstein Frisian breed
PDD could be reason of the financial problems in the production. In such herds it is necessary to
have overview on prevalence of PDD. Anywhere where the prevalence of the disease is over 20 %
we must understand PDD as herd problem, where systemic measures must be taken also not only
treatment of individual animals must be performed.
On the second hand prevalence of 20% is not sharp border between health and disease, between
financial success and flap. In some cases we can observe prevalence of 10% with typical herd problem
and on other hand we can observe herds where even 20% could not perform problem.
In any case it is necessary to treat herd as unit and additionally individual animals.

The trial was performed at the commercial dairy farms all around Slovenia on six different
locations.
On first farm - No1- were 132 dairy cows and 35 heifers in production stall in two groups
with average production of 7125 kg milk per standard lactation in last year. They used 10% cooper
sulphate. At begin of winter period 2006 they changed to KOVEX®, which is used every second day
on the way to the milking parlour. Systemic trimming were performed once a year, normally in the
spring time.
On farm No.2 there were 46 dairy cows and 25 heifers with average production of 9102 kg/
milk per standard lactation. They introduced KOVEX® in November 2006 and they use foam every
second month and nothing in between. Systemic correction is made before dry off period and after
150 days in milk.
Farm No3 keeps 55 dairy cows and 15 heifers with average production of 8207 kg milk per
standard lactation. The mode of KOVEX® use was same as on farm No.2. They do not use any
systemic claw trimming procedure, only according to needs in the herd.
Herd No4. Have 280 dairy cows and 50 heifers with average production of 7356 kg/milk per
standard lactation. They use systemic trimming every year at the end of the winter period and after
end of pasture period. At begin of the last winter period (2006) they introduced KOVEX®. They used
foam every second day till they began with spring systemic trimming in February. Than they abandon
KOVEX® and start to use 10% cooper sulphate. They change solution twice weekly, after the barrier
passed about 1300 animals.
Farm No5. keep 60 dairy cows and 35 heifers with average production of 8870 kg of milk per
standard lactation. They start to use KOVEX® foam at begin of November 2006 in the mode for
three weeks, than they pause for next three weeks with disinfection with 5% formalin every second
day in between.
Farm No6. keeps 198 dairy cows and no heifers on the farm with average production of 8312 kg
of milk per standard lactation (305 days in milk). They start to use KOVEX® in November 2006,
but they changed back to 10% cooper sulphate after 5 months, because incidence of PDD increased
dramatically.
Prior to the trial and also for at least last two years before, cows have been walking through
10% cooper sulphate or 5% formalin solution at least three times per week. All the data about
infectious claw diseases were registered and twice in the year individually examined and registered
by veterinarian during the systemic foot trimming procedures or during expert v visit on the farm.
All six farms housing systems consisted of free stalls and in two cases they have concreted floors
scraped with automatic scrapers twice a day and in all other four stalls they have grated floor, where
twice a day cleaning were performed manually. In two cases there was pre rinse baths installed before
footbath entering in all other cases footbath was changed depending on farm policy, but at least twice
weekly. At the begin of this year winter period in all six farms KOVEX® system were introduced
to avoid legal problems with using cooper sulphate or formalin in the near future. In five cases
KOVEX® systems were introduced at the entrance of the milking parlour on one farm they installed
KOVEX® system after the milking parlour, unfortunately in most cases there were no enough free
space to obtain application area big enough, but in such cases they try to produce KOVEX® foam
of good quality and on such way ensure at least five minutes contact time of the foam on the skin
above the coronet. The positive circumstance in all cases was also that foaming area was organised
on such way, that dairy cows were not able to jump over, because foam areas were just in front of the
entrance to the milking parlour, so animals were obliged to make sharp turn of 90ş from corridor to
the milking parlour. Foam was implicated for at least three weeks continuously every day and after
that three weeks of break with no disinfection were performed. In two cases they continue to use
foam constantly every day for four months. On those two farms, in between and after systemic claw
trimming were performed, foot bath with 10% cooper sulphate was introduced again.
Every fortnight the registered data were physically controlled by veterinarian during the milking
period and data were compared with data produced by milking persons and dairy herdsmen they
reported every day.
Results
After first inventarisation in first cycle of claw correction in spring 2006 we found out on farm
No.1 that 12.57% of animals on farm show signs of PDD. After introduction of KOVEX® incidence
is diminish to 10.78% what was not significant drop of incidence. On farm No2. the incidence in
spring 2006 was 9.865 and after introduction of new disinfectant method it drop to 8.45%, what
was also statistical not significant. The situation on farm No.3 stayed the same before and after
introduction of new disinfectant method. Incidence of PDD on these farms was not major problem
of the production and treatment of individual cows was enough to control problem in reasonable
borders.
More interesting was the development of the disease on farm No.4 and farm No.6. On farm
No. 4 the incidence of PDD before introducing the new method of disinfection was 38.79% and in
winter correction session the incidence increased to 42.12% what was not statistical significant. After
that we introduced 10% cooper sulphate solutions with every day walk trough foot bath and in one
month we observed rise of clinical cases of PDD to 54.55%. Because of recent health, production
and welfare problems we introduced topical therapy with 2% oxytetracycline and after 14 days the
incidence drop to 22.2% and additional after 14 days to 8.8 % what was significant drop to all
parameters of incidence in the herd.
On farm No.6 the incidence in spring 2006 was 28.79% and raised in six months to incredible
52.02 % what was statistical significant rise and what also produce lot of problems in the herd. Those
problems appear not only as health problem but also as production problem with diminish production
of milk and raised problem on the reproduction in picture of diminished NR 60 -90 days. Therefore
we introduced again 10% cooper sulphate foot bath as walking trough bath and incidence dropped
to 27.27% till end of winter period of 2007 and even diminished after introducing pasture in April of
2007 to 12.63 of obvious clinical cases.
Table 1. Distribution of PDD before and after introduction of KOVEX® foams
Time of
Disease No1 No2 No3 No4 No5 No6
evaluation
Before introd.
PDD 12,57 % 9,86 % 10,0 % 38,79 % 15,79 % 28,79%
KOVEX®
After
10,78 % 8,45 % 10,0 % 4 2 , 1 2 % 16,84 % 52,02%
PDD introduction of
(nons.) (nons.) (nons.) (nons.) (nons.) (sign)
KOVEX®
Table 2. : Development of incidence of PDD in herd No4.

% before % after two
After 1 month of After 2 weeks of After add. 2 weeks
intorduction of months of individual topical
Disease 10% CUSO4 of topical th.
KOVEX® KOVEX® th.
3 4 5
1 2
42,12% 54,55%
22,1 % 8,8 %
PDD 38,79% (nons to 2,
(nons to 1) (sign to 1,2,3 (sign to 1,2,3,4)
sign to 1)
Discussion
On four farms in our trial we do not found any significant changes in the all year distribution of
PDD what was actually expected. The most interesting farms in our trial were farm No.4 and No.6.
Those two farms were the biggest in our trial with lot of outside working force. That could be the
reasons of high incidences of PDD also before because level of herd hygiene was not on highest
level also at begin of our trial. The introduction of new disinfectant method with KOVEX® was
not satisfactory. The place of the disinfection barrier was not satisfactory; the time of introducing
of the foam was not long enough and on one farm the quality of the foam was because of technical
problems unsatisfactory.
We observe statistical significant change in the case of use of topical therapy with 2% OTC
solution. We can agree that with footbaths there is essential to keep stall and herd hygiene on
substantial level, what was effectively performed in our trial on farm No4. Additional to topical
therapy with 2% OTC solution during the milking procedure, we undertake serious consultation with
the management to keep more attention on careful cleaning procedure with manual correction after
automatic scrapping were introduced and also special attention was given to manipulation of the
cows before milking (no hurrying, no violence and raised voices). It was also established, that person
who deals with claw trimming must undergo special education and new crush for fixing the cows
was introduced. With this trial was also practically performed, that when we have to deal with herd
incidence higher than 20%, introducing of new even more efficient preventative solution can only
produce exacerbation of the clinical picture and lead to significant increase of clinical cases. It was
proven, that prophylactic measures are not therapeutic ones.
It was obvious, that in the herds where good management and stall hygiene were performed, there
is no difference which and what kind of footbaths was used. In the stalls where a lot of employed
working power is involved in the working process, special problem is motivation of those persons
and equivalent knowledge and understanding of the dairy process is necessary.
The trial also perform very successful, that also novel formulas successfully exchange old footbath
solutions, for which we thought that are the only ones for such purposes, but only as prophylactic
measure, not as wonder therapeutic formula. We proved, that only prophylactic foot bathing could
not guaranty success and that also other conventional hygiene measures are very successful more
important as foot bathing procedure itself.
References
1. Blowey R. (2004). Use of novel foot foam in the control of digital dermatitis. Proc.13th Int. Symp. and 5th
Conference on Lameness in Ruminants, Maribor, Slovenia
2. Fiedler A.(2004). Investigation of the efficacy of a kovex-foam-system in the decrease of the incidence of
Dermatitis digitalis, dermatitis interdigitalis and erosio ungulae. Proc.13th Int. Symp. and 5th Conference on
Lameness in Ruminants, Maribor, Slovenia
3. Holzhauer M. et al.(2006) Herd- and Cow level prevalence of Digital dermatitis in The Netherlands and
associated risk factors. J. Dairy Science 89: 580 – 588
4. Manske T., Hultgren J., Bergsten C.: (2002) Topical treatment of digital dermatitis associated with severe
heel horn erosion in a Swedish dairy herd. Prev.Vet.Med. 53(3) 215 – 231
5. Somers JGCJ, Frankena K, Noordhuizen Stassen EM, Metz JHM (2005) Risk factors for digital dermatitis
in dairy cows kept in cubicle houses in The Netherlands. Prev Vet.Med.71:11-21
6. Seymour J et al. (2002) Foot bathing in the management of digital dermatitis. Proc.12th Int.Symp. and 4th
Conference on Lameness in Ruminants, Orlando, Florida, USA
7. Vermunt J (2004) Herd Lameness: a review, major casual factors and guidelines for prevention and control.
Proc.13th Int. Symp. and 5th Conference on Lameness in Ruminants, Maribor, Slovenia
8. Zemljic B (1994) Current investigations in to the cause of dermatitis digitalis in cattle. Proc. 7th Int.Symp.
on Lameness in Ruminants, Banff, Canada
9. Zemljic B (2000) Aetiology of digital dermatitis in one dairy farm in Slovenia, Proc. 7th Congress of
FeMeSPRum, Giardini Naxos, Italy 86 –89
10. Zemljic B (1997) Causes and risk factors for occurrence of lameness in cattle, Praxis veterinaria. 451
–2:123 – 129
11. Zemljic B (2004) Influence of foot bathing on prevalence of digital dermatitis after introducing of diseased
animal into healthy dairy herd. Proc.13th Int. Symp. and 5th Conference on Lameness in Ruminants, Maribor,
Slovenia
12. Zemljic B (2006) Digital dermatitis – the costs and benefits of the control. Proc.14th Int. Symp. and 6th
Conference on Lameness in Ruminants, Colonia, Uruguay
13. Zemljic B (2007) Impact of different footbath solutions on Claw health in dairy herds. Cattle Practice Vol.
15-3: 320 - 322
Unilateral scrotal hernia in ram
JEDNOSTRANA SKROTALNA HERNIJA U OVNA
Capak, D1., B. Radišić1, D. Vnuk1, I. Harapin2, J. Kos1, T. Babić1, Marija Lipar,1

and D. Matičić1
1
Clinic for Surgery, Orthopedics and Ophtalmology, Faculty of Veterinary Medicine, University of Zagreb,
Zagreb, Croatia
2
Clinic for Internal Diseases, Faculty of Veterinary Medicine, University of Zagreb, Zagreb, Croatia
Sažetak
Radilo se o ovnu, virtemberške pasmine starom 8 godina koji je doveden na kliniku za kirurgiju, ortopediju
i oftalmologiju sa abnormalno povečanim skrotumom. Vlasnik je primijetio oteklinu u području mošnje prije
par mjeseci. Po njegovim riječima oteklina se pomalo povečavala, a posljednjih mjesec dana je prestala rasti. Pri
dolasku na kliniku utvrđeno je da je skrotum abnormalno povećan, asimetričan i umjereno bolan, a lijeva strana
s testisom veća je od desne. Skrotum je veličine ragbi lopte a lijevi ingvinalni otvor je proširen (9 puta 4,5cm).
Kao hernijalni sadržaj pipaju se tanka crijeva u mnogo tekučine, atrofičan testis i tvrde tvorbe poput užeta u
području funikulusa (najvjerovatnije vene ispunjene krvnim ugrušcima). Rutinskim operacijskim zahvatom u
općoj anesteziji hernija je operacijski sanirana dok je desni testis je po želji vlasnika sačuvan.
Ključne riječi: ovan, skrotalna hernija
Abstract
This article is about ram württenberg breed, 8 years old, suffered from unilateral scrotal hernia. Ram
was presented at surgery, orthopaedics and ophthalmology clinic. A few months ago owner observed oedema
in scrotal region. Oedema had been slowly enlarging. In a period of one month, oedema had stopped to grow.
Clinical observation was done. The enlarged scrotum was in a shape of rugby ball observed. Scrotum was
asimetric, the left side was significantly bigger in comparison to the right side. Scrotal region was painful. Left
inguinal chanel was enlarged (9x4,5 cm). Sac contents were: small intestine, liquid, athrophic left testes and
indured funiculus. Funiculus vesles were full of blood trombs. Surgery was performed in general anaesthesia.
Hernial sac was resected and left testes extracted. The owner wanted that right testes stay in scrotum.
Key words: scrotal hernia, ram
Uvod
Skrotalna hernija u muških preživaća je doista rijetka bolest. U nama dostupnoj literaturi pronašli
smo svega nekoliko izvješća. Izvješća se odnose na ovnove pasmine Merino (Carr, 1972; Dennis i
Leipold, 1968; Orr, 1956; Roberts, 1988) i Hampshire (Braun i Cole, 1985). Svi autori sugeriraju da
je bolest vjerovatno nasljedna.
Zbog iznimne rijetkosti bolesti i zbog našeg slučaja u kojem se javlja hernija u ovna pasmine
Wirtenberg odlučili smo ga opisati.
Materijal i metode
Radilo se o ovnu, virtemberške pasmine starom 8 godina koji je doveden na kliniku za kirurgiju,
ortopediju i oftalmologiju sa abnormalno povečanim skrotumom. Vlasnik je primijetio oteklinu u
području mošnje prije par mjeseci. Po njegovim riječima oteklina se pomalo povečavala, a posljednjih
mjesec dana je prestala rasti.
Slika 1. Abnormalno povećani skrotum u ovna

Pri dolasku na kliniku utvrđeno je da ovan ima abnormalno povećan, asimetričan i umjereno
bolan skrotum, a lijeva strana s testisom veća je od desne. Skrorum je veličine ragbi lopte a lijevi
ingvinalni otvor je proširen (9 puta 4,5cm). Kao hernijalni sadržaj pipaju se tanka crijeva u mnogo
tekučine, atrofičan testis i tvrde tvorbe poput užeta u području funikulusa (najvjerovatnije vene
ispunjene krvnim ugrušcima).
Nakon otvaranja venskog puta izvađena je krv s namjerom da se utvrdi status životinje.
Potom je životinja uvedena u anesteziju, intubirana te je aplicirana epiduralna anestezija.
Anestezija
Životinja je ispoštena 18 sati prije operacije, a voda joj je uskraćena 8 sati prije operacije.
Za premedikaciju je korišten ksilazin (Xylapan, Vetoquinol) u dozi 0,1 mg/kg IM. Postavljena je
kanila u v. cephalica antebrachii. Za indukciju je korišten tiopental u dozi 5 mg/kg IV te je životinja
intubirana. Anestezija je održavana smjesom izoflurana u kisiku. Za analgeziju je apliciran lidokain
(Lidokain 2%, Belupo) u dozi 1 ml/5 kg tjelesne težine epiduralno između zadnjeg lumbalnog i prvog
sakralnog kralješka. Za postoperacijsku analgeziju apliciran je ketoprofen (Ketofen 10%, Merial) u
dozi 1 mg/kg SC.
Operacijski zahvat
Ovan je postavljen u dorzalni položaj (na leđa). Operacijsko polje je pripremljeno uobičajeno,
očišćeno, oprano te dezinficirano povidonom i alkoholom. Nakon pripreme operacijskog polja i
oblačenja u operacijske krpe, operacija je započeta rezom na koži iznad lijevog ingvinalnog kanala.
Rez je produžen na povećani skrotum u duljini oko 50 centimetara. Potom je pažljivo i tupo
otpreparirana unutarnja hernijalna vreća (tunica vaginalis communis) s hernijalnim sadržajem. Kroz
tuniku koja je veoma zadebljana prosijavaju tanka crijeva, funikulus i testis koji se nalaze u velikoj
količini tekućine. Na vrhu hernijalne vreće načinjena je punkcija te ispušten dio tekućine. Budući da
je istjecanje serozne tekučine iz hernijalne vreće bilo sporo načinjen je na istom mjestu rez skalpelom
dužine oko 2 centimetara te je iz vreće isteklo mlazom oko 3 litre serozne žučkaste prozirne tekućine.
Nakon otvaranja hernijalne vreće tanko crijevo je vraćeno u trbušnu šupljinu. Na najvišem mogućem
mjestu načinjena je ligatura funikulkusa spermatikusa zajedno s unutarnjom hernijalnom vrećom, te
su zajedno odstranjeni. Ingvinalni kanal je rekonstruiran pojedinačnim čvorastim šavima Dexon-om
veličine 2. Koža lijevog skrotuma je skoro u potpunosti resecirana i rekonstruirana svilom veličine 2,
jer je vlasnik tražio da ovnu ostane desni skrotim i testis očuvan. U ranu je postavljen dren. Pacijent
je držan pod antibiotikom (amoksicilin) sedam dana po operaciji.
Nakon što je životinja probuđena secirali smo odstranjeni testis i funikulus. Na vrhu funikulusa
(dijela koji je bio neposredno pri ingvinalnom kanalu) pronašli smo splet krvnih žila, najvjerovatnije
vena koje su ispunjene lističavim krvnim ugrušcima.
Rasprava
Petog dana po operaciji dren je izvađen, rana zaraštava bez komplikacija. Dvanaesti dan po
operaciji izvađene su kožne niti. Rana je zarasla per primam.
Ingvinalna odnosno skrotalna hernija je rijetka bolest u svakodnevnoj veterinarskoj praksi. Da
li je bolest nasljedna traje diskusija u literaturi već pola stoljeća. Uglavnom autori koje smo naveli
se slažu da je u ovna nasljedna predispozicija za ingvinalnu herniju kao što je to dokazano u svinja
(Vogt i Ellersieck, 1990).
Slika 2. Ugrušci u venama funikulusa spermatikusa.
U našem slučaju interesantan je nalaz ugrušaka u venama koji je najvjerovatnije doveo do
povećane količine tekućine u unutrašnjoj hernijalnoj vreći.
Osim toga, svi opisi u literaturi se do sada odnose na ovnove pasmine Merino. To su uglavnom
razlozi zašto smo se odlučili prikazati našeg ovna pasmine virtemberg.
Literatura:
Braun, W.F., W.J: Cole (1985): Unilateral scrotal hernia in a ram lamb. J. Am. Vet. Med. Ass. 187, 500.
Carr, P. M. (1972): An apparently inhererited inguinal hernia in a Merino ram. Aust. Vet. J. 48, 126-127.
Dennis, S. M., H. W. Leipold (1968): Congenital hernias in sheep. J. Am. Vet. Med. Ass. 152, 999-1003.
Wright, J. G. (1963): The surgery of the inguinal canal in animals. Vet. Rec. 75, 1352-1363.
Orr, A. E. (1956): Inguinal hernia in sheep. Vet. Rec. 68, 2-4.
Roberts, S. J. (1988): Scrotal hernia in rams. A case report. Cornell Vet. 78, 351-352.
Vogt, D. W., M. R. Ellersieck (1990): Heritability of susceptibility to scrotal herniation in swine. Am. J. Vet.
Res. 51, 1501-1503.
Infectious Keratoconjunctivitis (Pink Eyes) in Sardinian
Goats: Clinical, Diagnostics and Epidemiological
Considerations
Zarazni Keratokonjunktivitis (Pink Eyes) u sardinijskih

koza: klinička, dijagnostička i epiemiološka razmatranja
Cabras*, P. A., A. Firinu*, S. Tola*, A. Orrù*, A. M. Deiana*, S. Usai***, S. R. Pod-

dighe*, V. Petruzzi**
* Esperimental Zooprophilactic Institute of Sardinia

**Veterinary Faculty -University of Sassari
*** Local Health Enterprise – Veterinary Service – Lanusei
ABSTRACT
Infectious keratoconjunctivitis (IKC) is a highly contagious ocular disease that effects small
and large domestic ruminants (V. Petruzzi et al. 2004 ) worldwide. IKC has never before reported
in Italy in goats. This report describes microbiological, diagnostic and clinical features of naturally
occurring caprine keratoconjunctivitis observed during three outbreaks involving separated goat
populatio. The findings suggest that Mycoplasma conjunctivae is the primary agent causing infectious
keratoconjunctivitis in the caprine species.
Sažetak
Visoko kontagiozne pojave keratokonjuktivitisa se pojavljuju u sardinijskih koza uglavnom u proljeće te
početkom jeseni i zime. Simptomi mogu različiti i najčešće traju skoro cijeli mjesec. Morbiditet je visok pa
bolest obično zahvaća cijelo stado. U nekoliko slučajeva (2-3% ozljede oka su bile posebno ozbiljne te su mogle
dovesti do prolazne ili trajne sljepoće. U ovom razmatranju opisali smo neke slučajeve infektivnog keratokon
juktivitisa(IKC) uočene na području istočne Sardinije usredotočivši se na kliničke, dijagnostičke i epizootske
podatke. Tipični znaci keratokonjuktivitisa uočeni su na svim proučavanim životinjama, uz rjeđe opažanje čira
rožnice.Keratokonjuktivalni bris,krv, mlijeko i feces su uzorkovani. Izolacijom, laboratorijskim pretragama i
PCR metodologijom izdvojen je uzročnik Mycoplasma conjuctivae.
INTRODUCTION
Infectious keratoconjunctivitis or PINK EYE is a highly contagious ocular disease affecting
small and large ruminants domestic worldwide and wild caprine species in the European Alps and in
New Zealand (Giacometti at al 2002; Mothe at al 2003).
Its occurrence in goats has never been reported in Italy. The aetiological role of Mycoplasma
conjunctivae in IKC has been established in well-documented studies of experimental infectious in
sheeps and goats (Trotter SC – FRANKLIN RM – BAAS EJ – BARILE MF – Epidemic caprine
keratoconjunctivitis; Experimentally induced disease with a pure culture of M. cong. – Infect immune.
1977, 18 – 816 – 822 – G.E. JONES – The pathogenicity of some ovine or caprine mycoplasma in
the lactating mammary gland of sheep and goats –J. COMP. PATH. 1985 – Vol. 95).
However the aetiology of IKC it’s a much debated question by other authors.. Several bacteria
have been described in association with IKC in both domestic and wild ruminants, including
Mycoplasma conjunctivae, Chlamydia, Branhamella ovis (vedi Bibl. In MAYER NICOLET GIAC
ecc).
In the reported case the disease was characterized by a high rate of contagious , rapid onset,
intense lacrimation, conjunctival hyperaemia and corneal opacity with neovascularization; in a few
cases corneal ulcers.
This report describes the microbiological, diagnostic and clinical features of naturally occurring
caprine keratoconjunctivitis observed during three outbreaks involving separated flocks of goat.

Three flocks of about 150 animals were investigated: all 392 adult females were in the last phase
of pregnancy.
Two of the affected herds were territorially closeness; all subjects showed more or less serious
ocular lesions.
Some animals showed also joints lesions. Ocular lesions first appeared at the beginning of
October; kids had ocular lesion in milder form then adults.
Recurring mild forms were observed on 30% of cases after two months of symptom remission;
death occurred in four cases.
Health status of the flocks was characterised by Chlamydia, Herpes virus and Caev seropositivity
with gastrointestinal and pulmonary parasites.
48 double ocular swabs were collected (48 for cultural detection and 48 in order to check
Chlamydia, Q fewer, Rickettsia by PCR.
Some subjects were treated locally conjunctiva lower fornix with two drops a day for 5 days with
ossitetraciclina (PANTERRAMICINA PFIZER)
The conjunctival specimen was obtained by cotton swabs (CULTIPLAST) in a rotating motion
if possible from between the third eyelid and the cornea or from the conjunctiva of the lower eyelid.
In general both eyes were swabbed.
The swabs were inoculated in blood agar and Hayflick for mycoplasma and incubated at 37°C
for 5 days in wet medium.
Other swabs were inoculated in Mac Conkey, mannitol agar salt and incubated at 37°C for 24
-48 h.
Moraxella has been isolated by a blood agar medium, where it needed 24 hours to grow; further
identification tests were carried out by API 20 system.
DNA extraction – the mycoplasma conjunctivae reference strain HCRC/581 was cultured in
standard PPLO broth medium (DIFCO) supplemented with 20% horse serum, 2,5% yeast extract and
1% glucose at 37°C until exponential growth phase. DNA was extracted from culture, purified by
standard protocols (Ausbel et al., 1992) and concentration determined by UV absorption (Sambrook
et al., 1989).
Strains and nested-PCR- All isolates were confirmed to belong to the species Mycoplasma.
conjunctivae using a nested PCR method as described by Giacometti al al. (1999). Two primer sets:
MOLIGEN1-L/16SUNI-R and McoR1/McoF1, were used to amplify a fragment from 16S rRNA
gene. In the first PCR, 5 µl of M. conjunctivae total DNA were added in 25 µl reaction mix containing
2.5 µl buffer 1o (Roche) plus 25 mM MgCl2, 1 µl of MOLIGEN –L and 1 µl of 16SUNI-R at final
concentration of 25 pmoli/µl, 0.5 µl of 1.25 mM dNTPs, 0.5 µl of 5 U/µl Taq polymerase (Roche) and
14.5 µl of H2O. PCR was carried out in a DNA thermal cycler (GenAmp 9700, Applid Biosystems)
using the following parameters: 35 cycles with each 30s annealing at 51°C and 1 min elongation at
72°C. In nested PCR (two step PCR) 1 µl of amplicon from the first reaction was used as template
in the second step. In nested PCR were used the primers McoF1 at final concentration of 25 pmoli/
µl. DNA was amplified using the following parameters: 35 cycles with each 30s denaturation at
94°C, 30s annealing at 54°C and 1 min elongationat 72°C. A final extension at 72°C for 10 min
was used. Amplicons from PRC (1063 bp) and from the second PCR (748 bp) were analyzed by gel
electrophoresis on 1% agarose gels and visualized after straining with ethidium bromide on a UV
transilluminator. (figure 1)
1 2 3 4 5 6 7 8 M
1063 bp
748 bp
Figure 1 – Agarose gel electrophoresis of amplicons from first step PCR (lanes 1 and 5) and lfrom the second step
nested-PCR (lanes 2 and 3).M, marker lambda Hindiii (Roche)
RESULTS
CLINICAL SIGNS
The following clinical signs were often observed: blefarospasm, photophobia and frequent
blinking, epiphora, conjunctivitis with injection of the scleral blood vessels, follicles in the third
eyelid and micopurulent exudates.
Corneal opacity always began at the margin of the cornea. In more advanced stages the process
extended ever the whole cornea, causing a blue-greyish turbidity vascularization began as a “brush
border” of vessels from the conjunctive and spread centrally into the cornea.
The mild form of the disease appeared to be self-limiting with the usual course of disease taking
about 10 days. In severe cases the disease persisted for as long as 12 weeks.
Three of the goats developed severe keratoconjunctivitis with deep ulceration of the cornea.
Most animals developed unilateral ocular disease, but bilateral involvement was seen in 30% or more
goats examinated. Some subjects were treated locally( conjunctival lower fornix) with two drops a
day for five days with ossitetracicline ( Panterramicine Pfizer)
There were six cases of recurrent eye disease.
Mycoplasma Conjuntivae was isolated from 21 out 48 ocular swabs; it has to be considered that
7 out 11 cases other ocular pathogens were found: Moraxella in 4 cases, Staphylococcus Aureus in 2
cases and one case unidentificated microbial flora.
CONCLUSIONS
In goats clinical signs were similar to symptoms observed in other domestic and wild species.
Mycoplasma conjunctivae seems to be the main, sometime only one, causative agent for
keratoconjunctivitis in observed cases.
The role played by Moraxella and S. aureus is not easy to understand at present .The recurrence
of the eye disease in some animals tends to indicate that little protective immunity is obtained after
Keratoconjunctivitis or that immunity is of short duration, because of the recurrent disease appeared
to be less severe , some grade of protection may have occurred. Moraxella ovis is generally regarded
as an organism without an obvious pathogenic significance in ovine IKC, often isolated from flocks
without signs of IKC; for this reason further investigations in order to know its real role in goats IKC
will be needes.
Why kids show a mild form of disease?
As reported by many authors severity and development of IKC ocular lesions are not strictly
dependent by aetiological agent, but environmental and sanitary conditions with immunitary status
of animals play a fundamental role. In fact ocular lesions of animals in which were found more than
a germ were not more serious than those in which has been isolated only Mycoplasma.
The better immunitary status of kids could explain why the ocular lesions were less serious and
more short without recurring symptoms.
About the important role of environmental conditions it has to be considered Petruzzi et al,
referred a Pinkeye case affecting with particular impact fattening calves of 4-6 months of age bred
in insufficient space.
In most cases the infection is resolved naturally; however treatment should be applied in severe
cases; preferably treatment should be specific to microrganism identified. To date, no vaccine exists
to treat pineye in goats.
A PCR reaction based on unique sequences of the 16S rRNA of M.conjunctivae was use for
the identification of the species. This method, described by Giacometti et al. 1999, has permitted to
identify M.conjunctivae isolates also from eye swabs of our flock.
REFERENCES
1) Ausbel F. et al., 1992- Current protocols in molecular biology.-Wiley interscience
2) Bass E.J. et al., 1977-Infection and Immunity-18,906-815
3) Giacometti M. et al., 1999 –J.Vet.Med.B. ,46;173-180
4) Giacometti M. et al., 2002, J. Wild Life disease
5) JonesG.E. et al., 1985 J. Comp. Path. Vol 95
6) Laak E.A. et al., 1988 the vet. Quartrly,1,73-83
7) Mayer D. et al., 1996, J.Vet. Med. , 43,155-161
8) Petruzzi V.et al., 2004 , 12° congress Femesprum –Istanbul
9) Sambrook J. et al., 1989-Cold Spring harbour Lab. NY
10) Surman P.G. 1973 , Ajebak, 51, 589-607
11) Trotter SC. Et al., 1977- Infection and Immunità,18,816-822
THE FIGURATIVE OUTLINE OF HORN DEFORMATION AND
HORN INJURIES OF THE FARM CATTLE TREATED IN THE WIDER
SURROUNDING COUNTRYSIDE OF ZAGREB
SLIKOVIT PRIKAZ DEFORMACIJA I OZLJEDA ROGOVA FARMSKIH

GOVEDA OBRAĐENIH U ŠIROJ OKOLICI ZAGREBA
Babić, T., Kos J., Smolec O.
Klinika za Kirurgiju, ortopediju i oftalmologiju, Veterinarskog fakulteta, sveučilišta u Zagrebu
SAŽETAK
Budući da je odrožnjavanje goveda na farmama i individualnim gospodarstvima uzelo maha u Republici
Hrvatskoj tijekom posljednjih pet godina, omjer zahvata na ženskoj teladi u odnosu na broj starijih kategorija
mliječnih krava podvrgnutih kupiranju rogova (tzv. «horn tipping») znatno se promijenio u korist odrožnjene
teladi. Stoga se sve rjeđe uočavaju deformacije i ozljede rogova odraslih goveda, te je broj intervencija na
odraslim pacijenticama znatno opao. Hrvatski stočari su pod dojmom informacija stočara iz zemalja razvijenijih
ekonomija, prvenstveno iz Europske Unije, bitno podigli svijest o nužnosti odrožnjavanja goveda uključenih u
intenzivnu proizvodnju. Zaključili smo da bi bilo vrijedno prikazati fotozapis zabilježen tijekom zahvata vezanih
za problematiku rogova u goveda, kao trajan dokument rastućoj potrebi za odrožnjavanjem u intenzivnom
uzgoju goveda, kako bi slična klinička stanja postala predmetom povijesti i u hrvatskom stočarstvu.U našem
izlaganju prikazat ćemo i opisati odabir od 24 fotografije različitih kliničkih manifestacija, vezanih uz rogove
goveda, koje su prikupljene tijekom višegodišnjeg praćenja i liječenja takovih stanja u široj okolici Zagreba.
SUMMARY
Considering that dehorning of cattle in dairy farms is more engaged in our country for the last five years,
the ratio of dehorning performed on female cattle compared with the number of dehorning of the other (older)
cathegories of the dairy cows has been changed in the favor of the young animals. Therefore the malformations
and injuries of the horns are less frequently observed. The number of interventions on the horns of fully grown
dairy cows also decreased. Croatian stockholders, under the influence of informations from their collegues from
economically better developed countries (primaryly from the EU) have significantly upraised their understanding
of importance of dehorning. We estimated that fotodocumentation of our previous experiences in solving horn
issued clinical states would be contribution in making those situations history in our stockholding presence as
same as it is in EU. In our presentation we will present and coment the choice of 25 photographies collected
during several years of our field work in the wider surrounding countryside of Zagreb.
UVOD
Odrožnjavanje je općeprihvaćen postupak u većini zemalja s razvijenim stočarstvom, budući
da smanjuje mogućnost samoozljeđivanja i međusobnog ozljeđivanja životinja u intenzivnom
uzgoju, olakšava manipulaciju stokom tijekom transporta i olakšava držanje životinja (1). Potreba za
odrožnjavanjem uočena je već krajem 19. stoljeća, a do sredine prošlog stoljeća razvijene su različite
tehnike izvođenja zahvata. Usporedo s razvojem raznolikih tehnika odrožnjavanja provedena su
istraživanja utjecaja zahvata na zdravlje pacijenata poslije operacije. U našem prošlom izlaganju (2)
utvrdili smo da bez obzira na objavljene radove koji sugeriraju nepotrebnost preoperativne anestezije
prilikom izvođenja zahvata na određenim dobnim skupinama pacjenata, naše iskustvo pokazuje da
je anestezija n. cornualis po Emersonu tijekom odrožnjavanja ne samo preporučljiva, nego i nužna.
Cilj ovog izlaganja nije bilo polemizirati s rezultatima ostalih istraživanja, već samo komentirati
niz patoloških stanja vezanih uz rogove, koja smo zabilježili tijekom višegodišnjeg terenskog rada.
Na taj način željeli smo sačuvati trajan dokument o kliničkim promjenama na rogovima, koja u
zemljama EU pripadaju prošlosti.
MATERIJALI I METODE
Građa koju prikazujemo prikupljena je tijekom izvođenja nastave na Ambulantnoj klinici,
veterinarskog fakulteta, sveučilišta u Zagrebu. Obilazeći individualna gospodarstva s mliječnim
govedima u intezivnom uzgoju zabilježili smo svaki slučaj malformacije ili ozljede rogova, pri tom
liječeći akutna klinička stanja ukoliko je to pojedinačni slučaj zahtijevao.
Pri tome smo skupili više stotina fotografija, od kojih smo sačinili izbor, koji vam prikazujemo.
Izbor uključuje dio pacijentica koje su odmah obrađene, kao i posljedice različitih ozljeda roga. Među
dokumentiranim stanjima nalaze se i reznolike deformacije u izrastanju roga, svježe ozljede, kao i
posljedice spontanog cjeljenja ili nestručno izvedenog odrožnjavanja. Također smo zabilježili način
na koji vlasnici mliječnih krava pokušavaju riješiti moguću problematiku međusobnog ozljeđivanja
rogatih životinja. Budući da smo u ovom segmentu našeg rada obrađivali mahom odrasla goveda,
koristili smo jednu od uobičajenih metoda odrožnjavanja za tu kategoriju životinja. Pacijentice su
sedirane intramuskularnom aplikacijom 2% Xillazina (Xillapan, vetoquinol, Švicarska) u dozi od
0,25 ml/ 100 kg tjelesne težine 15-20 minuta prije aplikacije vodiljne anestzije. Sediranoj
životinji aplicirano je 10 ml 2% lidokaina po rogu (lidokain 2%, Belupo, Koprivnica, Hrvatska)
ispod lateralnog ruba čeone kosti na sredini između lateralnog očnog ruba i baze roga. Otprilike 15
minuta nakon aplikacije vodiljne anestezije izvršili smo kupiranje roga između mjesta traumatizacije
i baze roga. Kupiranje roga («horn tipping») učinjeno je embriotomskom žičanom pilom, a na rog
je postavljen kompresijski suhi zavoj. Postoperacijski apliciran je depot – antibiotik i TAT serum.
Prilikom obrade slučaja avulzije dijela čeone kosti ispod baze roga, učinili smo eliptičan rez oko baze
roga te u cjelosti ekstirpirali odlomljenu kost i dio čeone kosti.
Fotografije su snimljene kamerom Olimpus – mju, te skenirane i digitalno obrađene za
prezentaciju.
REZULTATI I DISKUSIJA
Tijekom našeg rada izabrano je 25 fotografija najupečatljivijih malformacija u rastu rožine roga
i najdramatičnije ozljede na rogovima farmskih goveda. Budući da je trend odrožnjavanja ženske
teladi u Republici Hrvatskoj u porastu (barem u odnosu na naša prošla razmatranja) (2,3) ovakvih
će promjena biti sve manje. S obzirom da odrožnjavanje još uvijek nije postalo standard u našoj
zemlji, a u široj regiji vjerojatno još dugo neće postati, mislili smo da bi bilo korisno prikupiti
fotodokumentaciju koja će govoriti u prilog ovom zahvatu.
Prikazujući odabir najdrastičnijih problema koji prozlaze zbog držanja rogate stoke u
poluzatvorenom držanju mliječnih goveda (tzv. «lauf štale») željeli smo argumentiraqti opravdanost
ovog zahvata, kao bitnog čimbenika u smanjenju mogućih šteta i ozljeda u sustavu intenzivnog
uzgoja goveda.
slika 1. (fig. 5) – kupiranje deformiranog roga slika 2. (fig. 13) – anestezija n. cornualis prije kupiran-
ja deformiranog roga
slika 4. (fig. 24) – eliptičan rez oko baze roga na slika 3. (fig. 20) – “izuvanje rožine” uz frakturu proc-
kojem je nastupila avulzija processus cornualis od essus cornualis čeone kosti
čeone kosti prije godinu dana
LITERATURA
1. Agricultural animal Care guide. 1988. Guide foe the Care and Use of Agricultural Animals In agricultural
Recearch and Teaching, ASAS/ADSA Association Headquarters, Champaign, IL
2. Kos J., T. Babić, A. Brkić and D.Capak: Our Experiences in Dehorning of the Cattle. III Middle - European
Congress for Buiatrics, congress reports, 2001. pp. 168 – 171
3. Babić T., J. Kos, D. Vnuk, M. Kreszinger, A. Brkić, D. Capak, O. Smolec: The importance of continuing
education in the advancing of dehorning cattle in croatia. Monograph of lectures and the papers presented
on VI Middle-European Buiatrics Congres in Cracow 2005. 511- 514
PENALTIES FOR BREACH OF EC FOOD LAW IN ITALY
Kazne za kršenje EC zakona o hrani u Italiji
Morelli C.1, Cubeddu M.G.2, Calabrò G. 3, Russo M.1, Di Pietro C.1, Passantino A.4
1
Research Doctorate in “EC countries’ norms concerning animal welfare and protection” - University of
Messina;
Istituto di Patologia Speciale e Clinica Medica, University of Sassari, Italy;
2
3
Department RIAM, Faculty of Economy, University of Messina - Piazza Pugliatti 1 98124 Messina, (Italy);
Department of Veterinary Public Heath, University of Messina - Polo Universitario Annunziata. 98168
4
Messina, (Italy)
Summary
In order to ensure a high level of protection of human life and health and consequently the safety of
food, the Community legislator has established with the EC regulation 178/2002 the general principles and
requirements of food law. Member States will also lay down the rules on measures and penalties applicable to
infringements of food law. In Italy, a penalty system (Legislative Decree no. 190, 5th April, 2006) for the breach
of some of the provisions of EC regulation 178/02 has been established in order to facilitate accountability and
enforcement. The Italian legislative system imposes monetary penalties for the food business operators who do
not fulfil the obligations of articles 18-20 of EC regulation 178/2002. The new penalties apply only if the act
does not constitute an offence. In case law, this offence exception applies when the act is the same as the one
which is governed by criminal law. On the basis of these considerations, the Authors carried out an analysis
about the obligations and responsibilities of food business operator and on penalties.
Sažetak:
Kako bi osigurao visoku razinu zaštite ljudskog zdravlja i posljedično sigurnosti kakvoće hrane zakonodavac
Europske unije donio je EC-propis 178/2002. kojim se osiguravaju opća načela i zahtjevi zakona o hrani.
Države članice su usvojile, pravila, ciljeve i kazne za prkršitelje zakona o hrani. U Italiji je ustanovljen sustav
kažnjavanja ( Zakonska odredba br. 190,5. Travnja, 2006. za prekršitelje odredbi EU regulative 170/02 kako bi
se olakšalo provođenje zakona. Talijanski zakonski sustav nameće novčane kazne za proizvođeče i distributere
hrane koji ne ispunjavaju članke 18-20 propisa EU 178/2002. Nove kazne se primjenjuju samo ukoliko čin ne
sačinjava prekršaj. U sudskom slučaju se izuzeće prekršaja se primjenjuje ukoliko je čin kažnjivo djelo.
Introduzione:
Con il regolamento (CE) n. 178/2002, il legislatore comunitario, tenuto conto della necessità
di garantire la sicurezza degli alimenti, ha stabilito i principi e i requisiti generali della legislazione
alimentare, rimettendo però agli Stati membri il compito di determinare le sanzioni da applicare in
caso di violazione della normativa.
Il legislatore italiano ha ottemperato a tale dovere con il Decreto Legislativo 5 aprile 2006, n. 190
che definisce la disciplina sanzionatoria da applicare in presenza di violazioni degli obblighi previsti
dalla normativa comunitaria agli artt. 18,19 e 20.
Destinatari degli obblighi e, di conseguenza, delle relative sanzioni, sono gli operatori del settore
alimentare (OSA) e dei mangimi (OSM).
In particolare, il Decreto Legislativo 190/2006 prevede che gli operatori del settore alimentare
che non rispettano gli adempimenti relativi alla rintracciabilità degli alimenti, previsti dagli artt. 18-
21 del Regolamento CE 178/2002, siano puniti con sanzioni pecuniarie amministrative di diversa
entità, a seconda della fattispecie e della gravità dell’infrazione, salvo che il fatto costituisca reato.
Gli autori effettuano una disamina degli obblighi che gravano sugli operatori del settore e le
relative sanzioni.
Normativa
L’art. 2 del D.Lvo n. 190/2006 fa riferimento alla sanzione che viene comminata laddove gli
operatori del settore alimentare e dei mangimi non ottemperino agli obblighi previsti dall’art.18 del
regolamento CE n.178/2002.
L’art.18, prevede al I comma, l’obbligo di garantire la rintracciabilità “in tutte le fasi della
produzione, della trasformazione e della distribuzione, degli alimenti, dei mangimi, degli animali
destinati alla produzione alimentare e di qualsiasi altra sostanza destinata o atta a entrare a far
parte di un alimento o di un mangime”.
La “rintracciabilità” è lo strumento attraverso il quale il legislatore comunitario si propone
di raggiungere l’obiettivo di permettere alle Autorità di controllo la possibilità di avere tutte
le informazioni necessarie in presenza di un eventuale rischio sanitario, al fine di poter attuare
correttamente le procedure di ritiro ed eventualmente il richiamo del prodotto alimentare o del
mangime, laddove non fossero state già poste in essere dagli operatori, per quanto di competenza.
I commi successivi dell’art.18 puntualizzano gli adempimenti che gli operatori del settore
alimentare e dei mangimi devono attuare per facilitare il raggiungimento dell’obiettivo sopra
illustrato.
In primis, si richiede che gli OSA e OSM siano in grado di “individuare chi abbia fornito loro
un alimento, un mangime, un animale destinato alla produzione alimentare o qualsiasi sostanza
destinata o atta a entrare a far parte di un alimento o di un mangime”. Tale disposizione sta ad
indicare che l’OSA o l’OSM, nel momento in cui riceve un prodotto, sia esso alimento, mangime,
animale o sostanza destinata all’alimentazione, deve essere in grado di indicare il soggetto fornitore
(sia esso singolo che impresa). “A tal fine detti operatori devono disporre di sistemi e di procedure
che consentano di mettere a disposizione delle autorità competenti, che le richiedano, le informazioni
al riguardo”. Gli operatori dovrebbero tenere, dunque, adeguati registri dei fornitori di materie prime
e di ingredienti in modo da consentire di identificare la fonte di un problema. Tali informazioni,
nonostante la lacuna normativa, dovranno essere conservate per un congruo periodo di tempo.
Una politica alimentare efficace richiede la rintracciabilità dell’intero percorso dei mangimi e
degli alimenti nonché dei loro ingredienti; pertanto, l’OSA o l’OSM nel momento in cui cede i propri
prodotti, deve essere in grado di indicare esclusivamente le imprese a cui ha fornito i prodotti.
A tal proposito il III comma dell’art.18 stabilisce che: “Gli operatori del settore alimentare e dei
mangimi devono disporre di sistemi e procedure per individuare le imprese alle quali hanno fornito
i propri prodotti. Le informazioni al riguardo sono messe a disposizione delle autorità competenti
che le richiedano”.
Dalla normativa risulta evidente la volontà del legislatore comunitario di obbligare gli OSA e gli
OSM di garantire la rintracciabilità dei prodotti destinati al consumo alimentare sia a monte che a
valle, pur essendo evidente che per l’ultimo anello della filiera vale solo l’obbligo della rintracciabilità
del prodotto a monte ma non a valle.
In caso di inosservanza di tali obblighi il D.L.vo 190/2006 prevede una sanzione amministrativa
pecuniaria da € 750,00 a € 4.500,00.
L’art. 3 del decreto disciplina le sanzioni da applicarsi agli OSA e agli OSM nel caso in cui,
avendo fondato dubbio o, addirittura, la certezza che un prodotto alimentare o un mangime da loro
importato, prodotto o commercializzato, non risponda ai requisiti di sicurezza, secondo i requisiti
previsti dagli artt. 14 e 15 del Regolamento (CE) n. 178/200, non attivino le procedure per il ritiro
degli stessi.
Infatti, laddove dovesse verificarsi tale ipotesi l’OSA o l’OSM, per agire correttamente e non
essere passibile di sanzione dovrebbe identificare il prodotto o mangime, identificare l’ambito di
commercializzazione (nazionale, comunitario e/o verso Paesi Terzi) e provvedere all’immediato
ritiro del prodotto.
La sanzione amministrativa pecuniaria prevista in caso di violazione di tali obblighi va da
3.000,00 euro a 18.000,00 euro.
È previsto, inoltre, l’obbligo per gli OSA e gli OSM di informare immediatamente le autorità
competenti territorialmente (AA.SS.LL.) dell’avvio delle procedure di ritiro e le motivazioni che
hanno determinato tale evenienza, pena l’applicazione di una sanzione amministrativa pecuniaria il
cui ammontare verrà determinato, tenuto conto delle circostanze e della gravitò del caso, tra i 500.00
euro e i 3.000,00 euro.
L’art. 3 del D.L.vo 190/2006 disciplina un ulteriore obbligo posto a carico degli OSA e degli
OSM, la cui inadempienza è punita con una sanzione amministrativa pecuniaria il cui valore è
ricompresso tra i 2.000,00 euro e i 12.000,00 euro, è quello di fornire alle autorità competenti tutte le
notizie utili e una piena collaborazione.
A garanzia della tutela degli interessi dei consumatori è previsto, sempre a carico degli OSA e
degli OSM, un obbligo di informazione nei confronti dei consumatori; l’informazione dovrà essere
efficace, accurata, tempestiva e dovrà indicare i motivi che hanno reso necessario il ritiro del prodotto
dal mercato. In caso di mancata ottemperanza di tale obbligo, l’art. 4 del D.L.vo 190/06 prevede
l’applicabilità di una sanzione amministrativa pecuniaria da 2.000,00 euro a 12.000,00 euro.
L’art. 5 prevede invece l’applicazione di una sanzione pecuniaria amministrativa (da 500,00
euro a 3.000,00 euro) nei confronti degli operatori della vendita al dettaglio o della distribuzione
che non incidono sulla sicurezza o integrità del prodotto (attraverso una manipolazione diretta, quale
ad esempio lo sconfezionamento, riconfezionamento, porzionatura o attraverso l’apposizione di un
etichetta sul prodotto), nel caso in cui, venuti a conoscenza della non conformità dei prodotti ai
requisiti di sicurezza, non avviano le procedure per il ritiro.
L’art. 6, invece, si rivolge solo agli OSM statuendo che: “Fatte salve le eventuali diverse
disposizioni impartite dall’autorità competente, gli operatori del settore dei mangimi i quali, dopo il
ritiro dal mercato di mangime non conforme ai requisiti di sicurezza, non provvedono alla distruzione
della partita, del lotto o della consegna di tale mangime, sono soggetti al pagamento di una sanzione
amministrativa pecuniaria da cinquecento euro a tremila euro”.
Il decreto prevede, inoltre, nell’ipotesi di reiterazione delle violazioni esaminate, in aggiunta alla
sanzione amministrativa pecuniaria, la sospensione del provvedimento di autorizzazione all’esercizio
dell’attività, causa dell’illecito, per un periodo non inferiore ai 10 giorni e non superiore ai 20.
L’accertamento delle violazione e l’irrogazione delle relativa sanzioni è rimesso, nel rispetto
delle proprie competenze, alle regioni e province autonome.
La normativa considera, infine, il rinvio, per quanto non espressamente disciplinato, alle
disposizioni della legge 24 novembre 1981, n. 689 e successive modificazioni, in quanto
compatibili.
Conclusioni
L’impianto sanzionatorio italiano si presenta chiaro, preciso e puntuale.
È, pertanto, auspicabile che gli organi a cui è stato affidato il compito di accertare le violazioni e,
conseguentemente, irrogare le relative sanzioni assicurino una corretta applicazione della normativa
anche attraverso l’espletamento di controlli sui sistemi utilizzati dagli OSA e dagli OSM per garantire
la rintracciabilità dei prodotti zootecnici.
Bibliografia:
Regolamento (CE) N. 178/2002 del Parlamento Europeo e del Consiglio del 28 gennaio 2002 che stabilisce i
principi e i requisiti generali della legislazione alimentare, istituisce l’Autorità Europea per la sicurezza
Alimentare e fissa procedure nel campo della sicurezza alimentare. Pubblicato sulla Gazzetta Ufficiale delle
Comunità Europee L 31 del 1.2.2002, pp. 1-24.
Accordo 28 luglio 2005 - Accordo, ai sensi dell’articolo 4 del decreto legislativo 28 agosto 1997, n. 281, tra il
Ministro della Salute e i Presidenti delle Regioni e delle Province autonome sul documento recante «Linee
guida ai fini della rintracciabilità degli alimenti e dei mangimi per fini di sanità pubblica», volto a favorire
l’attuazione del regolamento (CE) n. 178 del 2002 del Parlamento e del Consiglio del 28 gennaio 2002.
(Rep. atti n. 2334). Pubblicato in G.U. n. 294 del 19.12.2005.
Decreto Legislativo 5 aprile 2006, n. 190. “Disciplina sanzionatoria per le violazioni del regolamento (CE) n.
178/2002 che stabilisce i principi e i requisiti generali della legislazione alimentare, istituisce l’Autorità
europea per la sicurezza alimentare e fissa procedure nel settore della sicurezza alimentare”. Pubblicato in
G.U. n. n.118 del 23 maggio 2006.
Legge 24 novembre 1981, n. 689 Modifiche al sistema penale (Testo coordinato ed aggiornato con le modifiche
introdotte dalla Legge 23 dicembre 2000, n. 388, dal D.lgs. 11 aprile 2002, n. 61, dal D.P.R. 14 novembre
2002, n. 313, dalla Legge 12 giugno 2003, n. 134, dal D.lgs. 30 giugno 2003, n. 196, dal D.L. 30 dicembre
2005, n. 272 e dal D.lgs. 2 febbraio 2006, n. 40).
www.fao.org
www.europa.eu.int/comm/food
www.efsa.eu.int
Penal and Civil Cases in the matter of cattle: forensic
observations - Il contenzioso penale e civile in materia
di bovini: osservazioni medico-legali
KRIVIČNE I GRAĐANSKE PARNICE S PREDMETOM GOVEDA:

SUDSKI OSVRTI
Cubeddu G.M.,*Lai M.G., Coda S., **Fois G.M.
Istituto di Clinica Medica veterinaria-Università di Sassari.

*Veterinario libero professionista.
**Avvocato.
Summary: the authors make a set of forensic observation on the nth legal case regarding animals, in
particular cattle (bull). They take as a starting point the civil and criminal cases regarding a lawsuit for the
grant of the right of property of a bull, ended after nine long years, when both the plaintif and the defendant,
besides the animal, that now it would have had a lawful owner and its own shelter, died. The criminal trial for
the presumed theft of the animal purpose of the case, the withdrawal of the action from the plaintif, let the
two civil judges decided on the right of property of the bull, the latter in November 2007 granted the right of
property of the animal to one of the involved parties, without knowing that the law of nature had already put and
end to the judicial case. In the case in point, the authors weigh up the difficulties of interpretation of the rules
on the guarantee for the buying and selling of animals, on the damages caused by animals, on the aspects of a
sure identification of the cattle, besides the modern rules about the animal wellbeing. They refer to the articles
of the Civil and Criminal Code enforced to the case, theme of the discussion, making a careful examination on
every controversial aspect of the cases. In the end the authors, trying to avoid the slowness of justice in the cases
regarding animals, propose some modifications to the present rules, that in some case, run the risk of saying that
who breaks the principles of legitimacy is right. In the end, they address an invitation to the legislator to resolve
these problems, both revising the competence of the justice of the peace and finally, foreseeing to issue the so
many hoped for the ‘Special Rules’ on the subject of guarantee for the animals.
Sažetak
Autori su predstavili niz sudskih osvrta u parnicama sa predmetom životinja, posebice goveda (bikovi).
Kao polaznu točku uzimaju građansku i krivičnu parnicu u kojima se tražilo pravo vlasništva nad bikom, što je
završilo nakon 9 godina kad su obojica, i tuženik i tužitelj, osim životinje, koja bi danas mogla imati zakonski
određenog vlasnika i štalu, umrli. Kriminalistički sudski proces glede pretpostavljene krađe životinje, ostavilo
je sudcima odluku o pravu vlasnosti nad bikom, te su kasnije, u studeom 2007. dodijelili pravo vlasnosti nad
životinjom jednoj od uključenih strana, bez da su znali da je zakon prirode već donio svoju presudu u tom
sporu. U konkretnom slučaju autori procjenjuju problematiku interpretacije pravila garancija pri kupnji i prodaji
životinja, štetama uzrokovanih od strane životinja, probleme pouzdane identifikacije stoke, te napose suvremena
pravila o dobrobiti životinja. Referiraju se na članke građanskog i krivičnog zakona vezanih za slučaj, temu
diskusije te iznoseći pažljiv pregled svih kontroverzija slučaja. Na koncu autori, pokušavajući izbjeći sporost
pravde u sporovima sa životinjama, predlažu neke izmjene važećih pravila, koja u nekim slučajevima staju na
stranu onoga koji krši legalističke principe. Osim toga, upućuju poziv zakonodavcu da riješi te probleme, kako
revizijom ovlasti prava na mir te predviđaju izdavanje dugo očekivanih posebnih pravila glede garancija za
životinje.
Riassunto
Gli autori compiono una serie di osservazioni medico-legali sull’ennesimo episodio di contenzioso
giuridico riguardante animali, in particolare bovini ( toro ). Prendono lo spunto da una causa civile
e penale riguardante una lite per l’assegnazione del diritto di proprietà di un toro, conclusasi dopo
nove lunghi anni, quando, sia l’attore, sia il convenuto, oltre all’animale, che ora avrebbe avuto un
legittimo proprietario ed un ricovero tutto suo, sono venuti a morte. Il processo penale per presunto
furto dell’animale in oggetto, la remissione della querela da parte dell’attore, lasciavano a decidere
sulla proprietà del toro due giudici civili, il secondo dei quali, nel novembre del 2007, assegnava la
proprietà dell’animale ad uno dei contendenti, senza sapere che la legge della natura aveva già posto
fine alla vicenda giudiziaria. Nella fattispecie, gli autori valutano le difficoltà interpretative delle
norme sulla garanzia per la compravendita degli animali, sui danni cagionati da animali, sugli aspetti
dell’identificazione certa dei bovini, oltre alle moderne normative in tema di benessere animale. Fanno
riferimento agli articoli del Codice Civile e del Codice Penale in applicazione alla causa in oggetto,
facendo una disamina su tutti gli aspetti controversi della vicenda. Infine gli autori, nel tentativo
di evitare lungaggini della giustizia nelle cause riguardanti animali, propongono alcune modifiche
alle leggi attuali, che in qualche caso rischiano di dar ragione a chi viola i principi di legittimità.
Rivolgono da ultimo un invito al legislatore per risolvere queste problematiche, sia rivedendo le
competenze dei giudici di pace, sia prevedendo di emanare, finalmente, le tanto auspicate “Leggi
Speciali”in tema di garanzia per gli animali.
Introduzione
L’amministrazione della giustizia in Italia sempre più spesso assume connotazioni particolarmente
delicate, sia sotto il profilo della ricerca di una giusta sentenza, ma soprattutto sotto l’aspetto dei
tempi lunghissimi di risoluzione dei vari tipi di contenzioso. In particolare quando ci si trova, sempre
più frequentemente, di fronte a processi civili e penali che riguardano gli animali, si assiste ad
un continuo e reiterato andirivieni di giudici, consulenti del tribunale e di parte, a frequenti rinvii
del processo per assenza del giudice ( nel frattempo sostituito ), o per richiesta degli avvocati, i
quali, ad arte, chiedono l’acquisizione di ulteriori elementi di valutazione, sino ad arrivare a casi
limite di processi per la stima di danni da e/o ad animali durati la bellezza di trentaquattro anni. In
Sardegna il comparto zootecnico rappresenta una fetta importante dell’economia regionale, e sempre
più frequentemente veniamo chiamati a dirimere contenziosi riguardanti danni da cani randagi, da
intossicazioni alimentari da mangime, da calamità naturali, da incidenti stradali che coinvolgono
animali, da richieste di risoluzioni contrattuali per vizi redibitori e/o mancanza di qualità etc.
Materiale e metodi
La vicenda giudiziaria ha inizio nel 1998, quando l’attore, il quale rivendica da subito la proprietà
del vitello di cui è causa, denuncia ai carabinieri il furto di due vitelli con segni padronali U.B. che
rappresentavano i propri nome e cognome. Qualche tempo dopo uno dei due vitelli fa ritorno ( da
solo !) in azienda, mentre l’altro viene reperito in un terreno di un comune confinante, non distante
dalla zona delle smarrimento. L’attore, credendo di riconoscere sull’animale i segni padronali,
ne rivendica la proprietà, e il torello inizialmente viene preso in consegna dalle forze dell’ordine.
Seguirono, nell’ordine, due sequestri e altrettanti provvedimenti di dissequestro ed un processo penale
per presunto furto. Da quel momento si alternano attestazioni di proprietà, si attribuisce al vitello un
codice comunale e una data di nascita (gennaio 1997 ), e l’animale viene sottoposto a visita da parte
di tre veterinari. Il primo ( A.S.L. ) non nota sull’animale segni particolari, il secondo rileva alcuni
segni di abrasione sulla groppa, oltre tracce sulla groppa di marchio a fuoco, peraltro imperfetto e
indecifrabile. In sede di processo penale, a seguito della denunzia per furto, il terzo veterinario (
CTU ), rileva nella coscia Sn. dell’animale un marchio a fuoco secondo lui sovrapponibile ad una U,
ed una serie di cicatrici che potevano essere riconducibili ad una B. Nel frattempo, durante tutte le
indagini, il vitello subiva costanti e ripetute tricotomie, nella ricerca di un qualche segno che potesse
fornire utili indicazioni al riconoscimento della proprietà. Un anno e mezzo più tardi, nel corso del
procedimento penale, compariva anche un investigatore privato, il quale esternava ai giudici alcuni
dubbi su una presunta compravendita dell’animale da parte del convenuto; lo Sherlock Holmes della
situazione non portava alcun contributo utile alla causa, lasciando ancora una volta le parti e i giudici
nel più profondo dubbio. Le spese giudiziarie sempre più crescenti, oltre ad estenuanti comparizioni
in tribunale, l’intervento di terzi, facevano sì che si raggiungesse un accordo in sede penale, con
la remissione della querela. A quel punto l’attore, stanco di perseguire il convenuto si rivolgeva al
tribunale civile rivendicando comunque la proprietà del vitello ormai diventato adulto. Dopo circa
quattro anni dall’inizio della vicenda si decideva, con l’accordo delle parti, di macellare l’animale,
frattanto diventato pericoloso, ed il ricavato veniva messo a disposizione dell’autorità giudiziaria. Il
tutto anche perché l’unica prova che avrebbe potuto consentire l’effettivo riconoscimento dell’animale
(DNA), non si era potuta effettuare in quanto i supposti genitori del vitello erano stati a suo tempo
regolarmente macellati. Nel frattempo, sempre in vigenza della causa civile, venivano a morte, nel
2004, l’attore della causa e nel 2005 il convenuto. Ma la giustizia decideva comunque di chiudere
ugualmente il caso con la sentenza depositata in cancelleria nel 2007, a firma di un altro giudice, che
assegnava la proprietà dell’animale all’attore.
Osservazioni personali
I fatti suesposti offrono lo spunto per fare alcune considerazioni critiche, peraltro già espresse in
altri lavori precedenti, sulle evidenti lacune legislative in tema di contenziosi riguardanti gli animali.
Il caso descritto rappresenta la punta dell’iceberg sulla lungaggine della giustizia nelle cause civili
e penali riguardanti animali. Paradossalmente questi impedimenti burocratici favoriscono spesso
chi, nelle cause come questa in oggetto, ignora e/o viola i principi di equità. Per questa ragione
pratica, nelle fattispecie giuridiche come queste ( compravendita, stima di danni da e/o ad animali,
certificazioni di proprietà, garanzia per vizi ), sarebbe necessario rivedere in tempi brevi alcuni dei
punti nodali del Codice Civile, nel IV libro delle obbligazioni, soprattutto per offrire una maggiore
tutela delle parti che siano state danneggiate. La vicenda, tra l’altro, si sarebbe potuta complicare
ulteriormente attraverso risvolti giuridici quali la vendita di animale altrui e/o i danni provocati
dall’animale ( pericoloso ), non potendosi peraltro, in questo caso, attribuire le responsabilità di cui
all’art. 2052 del Codice Civile ( danno cagionato da animali ). Si sperava che l’avvento dei giudici
di pace ( Legge n. 374 del 3/11/91 e successive modifiche ), i quali hanno iniziato la loro attività dal
1/5/1995, avrebbe portato sostanziali cambiamenti per apportare i giusti correttivi alle problematiche
di questo tipo. Ma già un primo ostacolo si è interposto al cammino della giustizia: i giudici di pace
hanno competenza per cifre non superiori ai cinque milioni di vecchie lire, con rare eccezioni per
l’incidentistica stradale e pratiche condominiali. Ma nelle cause riguardanti i nostri animali, nella
maggior parte dei casi, si raggiungono cifre nettamente superiori a quelle di competenza degli stessi
giudici di pace. Basti pensare ai danni da mangime in grossi allevamenti ovini, a compravendite
di equini, arieti e/o tori di pregio e di alta genealogia. A tutt’oggi, la lungaggine delle cause non
favorisce senz’altro la parte danneggiata, la quale si trova in posizione di netto svantaggio, costretta
ad aspettare anni per vedere riconosciuti i propri diritti, con tutti gli oneri e i doveri nei confronti
degli animali di cui è causa, soprattutto oggi, con le normative in materia di benessere animale, che
pongono l’animale stesso, in quanto essere senziente, al centro dell’attenzione e delle cure amorevoli
da parte del proprietario.
Conclusioni
Nel tentativo di dare una risposta alla migliore amministrazione della giustizia nelle cause
riguardanti animali, proponiamo alcune brevi riflessioni utili alla risoluzione del problema. Intanto è
auspicabile che venga attuato quanto prima in Italia il “Progetto Idea” ( identification elettronique
des animaux ), avviato dalla Commissione Europea nel 1998, attraverso il quale, con l’applicazione
di un trasponder endoruminale nei bovini, si garantirebbe, oltre alla tracciabilità dei prodotti , anche
e soprattutto la legittima appartenenza dell’animale; questo cancellerebbe immediatamente qualsiasi
dubbio sull’identificazione del proprietario. In alternativa, il legislatore dovrebbe prevedere un
aumento delle competenze in denaro per i giudici di pace nelle cause sugli animali: in questo modo si
raggiungerebbe una maggiore rapidità nella risoluzione delle cosiddette “questioni civili” riguardanti
animali, offrendo peraltro in tempi brevi il giusto ristoro economico all’effettiva parte danneggiata.
Ma non solo attraverso l’aumento di competenze per i giudici di pace si potrebbe arrivare rapidamente
alla soluzione di questi contenziosi. L’art. 1496 del Codice Civile, trattando della garanzia nella
compravendita di animali, così recita: nella vendita di animali la garanzia per i vizi è regolata
dalle leggi speciali o, in mancanza, dagli usi locali. Se neppure questi dispongono, si osservano
le norme che precedono. in forza a quest’articolo, ove la garanzia è regolata da Leggi speciali, che
a tutt’oggi non esistono, si può senz’altro prevedere un arbitrato rituale, con la costituzione di un
collegio di 3-5 arbitri, che in tempi brevissimi porterebbe facilmente alla risoluzione di problematiche
di questo tipo. Questa soluzione, applicata per estensione a tutti i contenziosi riguardanti animali,
potrebbe finalmente assumere il carattere di legge speciale, così da costituire una rapida soluzione
alle controversie in oggetto, oggi sempre più numerose. Auspichiamo infine che, prendendo lo spunto
da quello che nei processi penali rappresenta l’incidente probatorio, si possa in tempi brevi rendere
obbligatorio, in cause civili riguardanti animali, l’accertamento tecnico preventivo, già previsto
dall’art. 696 C.P.C. Questo è uno strumento alternativo di risoluzione delle controversie, con finalità
strettamente conciliativa, non assimilabile “quoad effectum” alla relazione del CTU, da espletare nel
corso del giudizio di cognizione. Con questi correttivi riteniamo che si potrebbero colmare quelle
gravi lacune legislative che, in ultima analisi, si ripercuotono in maniera determinante anche sul
benessere degli animali.
Bibliografia
1) Canuto e Tovo: Medicina legale 1970; 2) Cinotti S., Peccolo.G.:Protezione animale-Utet-1997; 3) Codice
Civile – Libro IV delle obbligazioni; 4) Codice Penale: articoli 638 e 727, legge 189/2004; 5) Cubeddu G.M.,
Pintori G., Bassu G., Maninchedda G.-Differenti valutazioni sul danno e risarcimento in ovini di razza sarda.
Atti del VIII Congresso SIPAOC., Sezione Patologia, pag. 397, 1988; 6) Gasparini U.: Appunti di Medicina
Legale Veterinaria, Legislazione Veterinaria e Deontologia-Ed. Esculapio 1983; 7) Ghisleni P., Ghisleni G.:
Trattato di Medicina Veterinaria Legale. UTET, Torino 1925; Mainardi, D., Papalia, S., Etologia e protezione
animale, Editoriale grasso (1991); 8) Nisini: Comp. Infort. La tribuna 1978 tratato di diritto privato; 9) Pezza
F.: Diritto e Legislazione Veterinaria-Utet-1997; 11) Ruffo G.: Legislazione Veterinaria-Poletto Editore-luglio
2003; 12) Torrente A.: Manuale di Diritto Privato. Giuffrè, Milano 1981.
EPIDEMIOLOGICAL DATA ON INFECTIOUS KERATOCONJUNTIVITIS
(IKC) OF SHEEP AND GOAT IN SICILY
EPIDEMIOLOški pokazatelji zaraznog

KERATOkonjUNTIVITISa (IKC) ovaca i koza na Siciliji
Pugliese A., Tortorella A., Di Marco V.*, Di Pietro S., Russo M.*, Gruppillo A.,
Scardillo A., Niutta P.P.
Departement of Veterinary Pubblic Health – University of Messina

Zooprophilactic Institute of Barcellona P.d.G. (Messina)- Italy
Abstract
The authors in this study show the results about the epidemiological diffusion of the sheep and goat
infectious keratoconjuntivitis (IK) on Sicilian territory. The animals were subjected at clinical evaluations and
serological tests were performed, applying the cytological and microbiological analysis on conjunctivae tissues.
Out of 7664 sheep and goat examined, belonging to 32 Sicilian breeding, 539 subjects showed ocular lesions
at different stages of evolution, related to the disease. The various animals showed corneal lesions similar in
clinical aspect in despite of the variety of the isolated microrganisms. The Authors report the results of the
performed clinical, microbiological and serological tests. Some microrganisms, such as Mycoplasma agalactiae
and Moraxella sub-genus branhamella ovis, were isolated as aetiological agents of the keratoconjuntivitis, while
other microrganisms (Rickettsiae and Chlamydiae) were absent.
Abstract
U ovoj studiji autori analiziraju rezultate epidemiološke rasprostranjenosti zaraznog keratokonjuktivitisa
u ovaca i koza na Siciliji. Kod navedenih životinja izvršena su klinička i serološka istraživanja, te je učinjena
citološka i mikrobiološka analiza tkiva očne spojnice. Pregledano je 7664 ovaca i koza koje iz 32 uzgoja. U
539 životinja nađeni su različiti stupnjevi oštećenja očiju koji se mogu povezati sa tom bolešću. Oštećenja
rožnice uočena kod različitih životinja ovisila su o vrsti izoloiranog mikroorganizma. Tako su kao uzročnici
keratokonjuktivitisa izolirani mikroorganizmi kao što su Mycoplasma agalactiae i Moraxella sub-genus
branhamella ovis, dok Rickettsiae i Chlamydiae nisu nađene.
INTRODUCTION
Infectious keratoconjunctivitis (IKC) is a highly contagious ocular inflammation frequently
reported in domestic sheep and goats; it is reported also in bovine and in wild Caprinae. This disease
is caused by various microorganisms (11;1;8;), which establish ocular inflammation.
This pathology is widespread into the ovine and caprine farms on the Sicilian territory and it
has a marked impact on the same farms, determining much economic losses. So, we considered
important to perform a retrospective study on the incidence of the IKC in Sicily, in order to identify
the major etiological agents and to evaluate the epidemiological diffusion of this pathology among
the Sicilian farms.
Infectious keratoconjunctivitis in small ruminants is included into the “contagious Agalactia
complex”: a pathology that determine mastitis, arthritis and ocular involvement.
The ocular lesions are characterized by different stages on the basis of severity:
First stage, 1-4 days: acute conjunctivitis, with hyperaemia of the eyelids and the bulbar
conjunctiva, ocular lacrimation, blepharospasm and photophobia;
Second stage, 4-12 days: diffuse corneal oedema, improvement of the conjunctiva symptoms;
Third stage, 12-25 days: formation of corneal ulceration with hypopion and total loss of visual
function;
Fourth stage, after 25th days (improvement phase): spontaneously regression of the ocular lesions
without therapy until to the return of the visual capacity, if an irreversible damage there wasn’t.
Sometimes the ocular lesions can be very serious, such as corneal erosions, deep ulcers and
panophthalmitis.
In recent years there has been increasing recognition of the prevalence and importance of disease
syndromes of multifactor aetiology. It is often difficult to elucidate the role of each of the infecting
microorganisms, especially because the relative importance of each may vary in different cases.
Synergism between Mycoplasma ssp and other bacteria or viruses in ruminants has been frequently
described. However, the organisms may act sequentially rather than in concert and may not be present
in the lesion or the affected organ at the same time. In sheep and goats the role of Chlamydia spp. as
a major etiological agent in IKC is well established and Mycoplasma spp. And Rickettsia spp. is also
considered a primary pathogen in establishing eye inflammation (3;2;15;4;).
From the corneal sac of sick or clinically healthy animals various microorganisms also be
isolated as Pasteurella spp, Achromobacter spp., Acinetobacter spp., Bacillus spp., Staphylococcus
spp., Streptococcus spp., Branhamella spp. (8).
Among other microorganisms, usually Branhamella ovis (9;14) or Moraxella ovis are frequently
isolated on healthy animals (12) and some Authors (8;7) confirm the pathogen role of Branhamella
ovis in small ruminants infectious keratoconjunctivitis.

The study is performed on 32 farms of sheep and goats on the province of Palermo, Caltanissetta,
Trapani, Messina e Catania.
N° 7674 free reared animals were visited, which presented keratoconjunctivitis at different
stages of evolution. Various serological, microbiological and cytological test were performed in
order to obtain a diagnosis and to relate the symptomatology to the presence of a specific aetiological
agent.
On all animals that showed ocular symptoms referred to the disease and on 5% of healthy animals
the tests were performed.
The serological test to identify the anti- Mycoplasma agalactiae antibodies by ELISA test and
the anti- Chlamydia antibodies by Complement Fixation were performed, considering positives the
results superior to a dilution of 1:16.
The affected animals were submitted to ocular swabs and conjunctival scrubs, after the instillation
of hydrochloride ossibuprocaine in the conjunctival sac.
The collected materials were inoculated into Agar blood and McConkeey’s media. The cultures
were propagated at 37°C and examined after 24, 48, 72 hours. The collected materials were inoculated
also into PPLO medium, with addition of penicillin, thallium acetate and equine serum 20%. The
media, were incubated at 37°C with CO2 and examined after 48 hours and daily for 7-10 days. The
conjunctival scrubs were coloured with Gram coloration, with May-Grunwlad Giemsa to finding
Mycoplasma spp. and with Gimenez coloration to finding Rickettsia spp. or Chlamidia spp.
The identification of mycoplasma isolates was made by Polymerase Chain Reaction (PCR) for
Mycoplasma agalactiae and Mycoplasma mycoides sub. mycoides LC (10).
RESULTS
The controls, performed on 7674 animals belonging to 20 ovine and 12 caprine farms, showed
on n° 539 animals the presence of ocular lesions, as keratoconjunctivitis at different stages.
Totally, on 20 examined ovine farms eleven were positive to Mycoplasma agalactiae, eight to
Moraxella sub-genus Brahnamella ovis and one at Mycoplasma mycoides sub. Mycoides.
On 12 caprine farms eight were positive to Moraxella branhamella ovis, two to Mycoplasma
agalactiae and two to Mycoplasma mycoides sub. mycoides. Moraxella branhamella ovis.
Serological tests for Mycoplasma agalactiae by ELISA technique showed always positive results
except into the outbreaks where Mycoplasma mycoides sub. Mycoides was isolated, because the
antibodies used in the test were species-specific.
The tests to research the antibodies anti- Chlamydia showed negative results.
The swabs on blood agar allowed the isolation of Moraxella sub-genus Branhamella ovis.
The bacteriological test performed on samples of conjunctival sac of healthy sheep and goats
resulted negatives to finding Branhamella ovis.
The cytological test showed the presence of neutrophils and conjunctival epithelial cells. A lot
of Mycoplasms were attached on the surface of the epithelial cells (5;6). The presence of this type of
cells can be related with their phagocytic activity against the neutrophils present on the samples.
The ocular lesion, mono or bilateral were more severe in the adult subjects; the clinical signs
vary from a light conjunctivitis to a serious form with lacrimation, photophobia and corneal oedema.
Different degree of corneal opacity with new vascularization, before superficial and then very deep,
was observed.
The IKC appeared during the May and June months and the ocular lesions remained for 20
days.
Generally the outbreaks of IKC in the affected farms disappeared into two months.
CONSIDERATIONS AND CONCLUSIONS

The results of this study show that infectious keratoconjunctivitis of small ruminants is caused
by various etiological agents considered endemic into the Sicilian farms. Furthermore, the obtained
results about the positivity to Moraxella branhamella ovis, Mycoplasma agalactiae, Mycoplasma
mycoides sub. mycoides. Moraxella branhamella ovis are according to the literature , showing a
major percentage of morbility in the goats than the sheep (11).
The ELISA test and the microscopic examination for Chlamidia spp. negative results always
provided, such as all the samples. The absence of anti-Chlamydia antibodies proves the negativity of
the tests to direct identify the etiological agent. In fact, the presence of other secondary microorganisms
can determine the disappearance of the Chlamidia organisms by the conjunctival tissue and it can
causes the negativity of the conjunctival samples by sick animals (13).
The results of bacteriological tests confirm that the major etiological agents in IKC in domestic
sheep and goats into Sicilian farms is Branhamella ovis.
The endemic presence of Contagious Agalactia in Sicily justify the major frequency of
Mycoplasma agalactiae as cause of IKC into the Sicilian farms of sheep and goats. Although it is
important underline the isolation of Mycoplasma mycoides sub. mycoides as etiological agent of IKC
into 4 examined farms without a clinical pattern related to contagious Agalactia .
The clinical examination and the microbiological tests on milk of the affected animals showed
the absence of clinical signs at udders and joints and the absence of the microorganism in the milk.
The findings of severe forms of keratoconjiunctivitis in adult subjects is related to a hypersensibility
reaction due to a precedent exposition of the eye at the etiological agent.
In recent years the studies on the etio-pathogenesis and the epidemiology of the infectious
keratoconjunctivitis of small ruminants are processing, considering the wide diffusion of the
pathology in the Sicilian territory. These researches need to further surveys in order to define in detail
the etiological agents and the clinical evolution of IKC in Sicily, considering the severe economic
losses into the affected farms.
REFERENCES
1. Andrews A.H., Goddard P. C., Wilsmore A.J.,(1987); Vet. Rec. 120,238-239
2. Beveridge W.I.B.,(1942) Investigation on contagious ophtalmia of sheep, with special attention to the
epidemiology of infection by Rickettsia conjunctivae-Australian Veterinary Journal 16, 155-164.
3. Coles J.D.W.A. (1936)A Rickettsial-like organism in the conjunctival epithelium of cattle. Journal of South
African Veterinary Medical Association 7, 221-225;
4. Cooper B. S. (1974) Transmission of a chlamydia-like agent isolated from contagious conjunctivo-keratitis
of sheep. New Zealand Veterinary Journal 22, 181-184.
5. Dagnall G. J. R, Br.Vet.J., (1994), 150, 65-71.
6. Dagnall G.J.R., Vet. Rec., (1994), 135, 127-130.
7. Di marco V., Lo verde V, Cristodaro G., Palazzo P., Imburgia M., Guercio A. (1998) Cheratocongiuntivite
infettiva degli ovini e dei caprini in Sicilia Atti Fe.Me.S.P.Rum
8. Egwu G. O. (1991): Vet. Bulletin, 61, 6 , 547-559.
9. Fairlie, G. (1966) The Isolation of a haemolytic Neisseria from cattle and sheep in the North of Scotland.
Veterinary Record 78, 649-650.
10. Hotzel H.(1996), Veterinary Microbiology, 49, 31-43.
11. Jones G.E., Foggie A.,Sutherland A., Harcher D.B.(1976);.Vet. Rec. 99, 137-141
12. Langford, E.V. (1971). Mycoplasma and associated bacteria isolated from ovine pink eye. Canadian Journal
of Comparative Medicine 35, 18-21.
13. Pedrini A., Cerri D., Andreani E., Farina R. (1991)Atti XLV SiSvet Palermo 24/28 settembre Palermo.
14. Spradbrow, P.B.; Marley, J. (1971) Ovine Keratoconjunctivitis: possible T-strain in the conjunctival sac.
Australian Veterinary Journal 47, 116-118.
15. Surman, P.G. Cytology of pink eye of sheep including a reference to trachoma of man, by employing
acridine orange stains, end isolation of Mycoplasma agents in infected sheep eyes. Australian Journal of
Biological Science 21, 447-467.
THE ECONOMICS OF EXTENSIVE BEEF PRODUCTION IN SPAIN
Isplativost ekstenzivnog uzgoja goveda u Španjolskoj
Robles-Robles, R. (1); Revuelta, J.F. (1) (2), González-Montaña, J.R.(1)

(1)
University of Leon (Spain)
(2)
CSIC. Estación Agrícola Experimental de León (Spain)
Abstract
Cattle, plays an important role in many Spanish mountain or less-developed regions, as it’s the case of
Castile and Leon, contributing to the sustainability of both, local economies and environment, but the continued
existence of this activity is certainly conditioned by its economical results. In this sense, this study aims to
analyze the economical results of dfferent kinds of extensive beef holdings applying the European Account
System, as a metholodogical approach, to the data obtained by a statistical survey representing all the different
holdings in this region. Results manifest the existence of many different economical situations depending on the
livestock’s size and on the complementation of this activity with other agricultural productions(2).
(2)
This study has been financed by Junta de Castilla y León, Consejería de Educación y Cultura (Castile
and Leon Regional Governments, Education and Culture Council), through the annual programm to support
research projects (Order EDU/1143/2004).
Sažetak
Uzgoj goveda zauzima važnu ulogu u ruralnim, planinskim područjima Španjolske kao što su
Castile i Leon. S tim u svezi ovaj rad analizira ekonomske učinke različitih načina ekstenzivnog
držanja goveda koji vrijedi za European Account System. Na osnovu statističkih podataka iz različitih
područja zaključili smo da ekonomska isplativost ovisi o broju grla te o suradnji sa drugim vidovima
poljoprivredne proizvodnje.
1.- Introducción y objetivos

Desde hace varios años, las explotaciones de vacuno de carne en España se hallan inmersas en
un proceso de reestructuración motivado por distintos factores: Elevada competencia internacional,
excedentes de producción en la Unión Europea, crisis alimentarias –EEB-, y por último, aspectos
relacionados con el bienestar animal y el respeto al medioambiente, que cuestionan las producciones
de tipo intensivo.
Varios mecanismos han tratado de poner solución a la problemática anteriormente descrita,
abogando por una extensificación de los métodos de producción, aunque no siempre los resultados
obtenidos han estado en consonancia con los objetivos propuestos. Así, la reforma de la PAC del
92 abordó un primer intento para mejorar la situación a través de la reducción del sostenimiento
de los precios, compensando los menores ingresos de los agricultores mediante ayudas directas a
la renta e introduciendo medidas para estimular la extensificación. Más adelante, la Agenda 2000
profundiza en estos aspectos, de modo que la reforma de la Organización de Mercado de la carne
de vacuno, aprobada por el Reglamento (CE) 1254/1999, que establece la nueva OCM, tiene por
objeto, entre otros: Incentivar en mayor medida a los productores a fin de que se orienten hacia la
extensificación.
Sin embargo, aunque los mecanismos de gestión del mercado aprobados en la Agenda 2000
parecían haber sido lo bastante sólidos y flexibles para facilitar la recuperación del mercado de
vacuno, y la extensificación de la producción fue ganando terreno, gracias a la redefinición de la
prima por extensificación, se aprecia que los instrumentos de la OCM no han conseguido desalentar la
producción intensiva tanto como se esperaba. El hecho de que los pagos sean por cabeza, que la carga
ganadera esté basada en las primas solicitadas y no necesariamente en el número real de animales,
la exención del requisito de carga ganadera en el caso de los “pequeños ganaderos” (máximo 15
UGM), fueron algunos de los factores que favorecieron la persistencia de la intensificación de la
producción. Por ello, la Comisión propuso eliminar los pagos por cabeza y sustituirlos por un único
pago de apoyo a la renta por explotación, basado en los derechos históricos, junto a exigencias de
condicionalidad más estrictas. Ésto rebajaría la presión que conduce a la práctica de una producción
intensiva y contribuiría a equilibrar el mercado (COMISIÓN EUROPEA, 2002).
Asimismo, se considera esencial que los incentivos que reciban los agricultores estén ligados
de alguna manera a los objetivos relacionados con el medio ambiente, el bienestar de los animales,
la seguridad y la calidad alimentaria. Introducir medidas de este tipo en los procesos de producción
habituales supone un aumento del coste y una pérdida de eficiencia de los agricultores comunitarios,
con relación a sus homólogos internacionales, que de alguna manera hay que limitar, lo que determina
que los pagos directos continúen siendo imprescindibles.
Finalmente, en junio de 2003 con la reforma de la PAC se aprobó el régimen de pago único (RPU),
un sistema de ayudas anuales pagadas a los productores sin vínculo con la producción («disociadas»)
y que constituye la principal característica de la PAC reformada. El RPU combina varios pagos
directos percibidos actualmente por los agricultores en un único pago calculado a partir de los pagos
recibidos durante un período de referencia (REGLAMENTO (CE) n° 1782/2003).
No obstante, los Estados miembros podían optar por la introducción del RPU en su totalidad,
combinando todas las ayudas en un único pago, o decidir mantener una parte de las ayudas directas
pagadas a los agricultores bajo su forma actual («disociación parcial»), cuando consideren que
el tránsito al RPU pueda implicar perturbaciones en los mercados agrícolas o un abandono de
producción. Así, en el caso de España, aunque se decidió desacoplar totalmente algunas ayudas como
la prima al bovino macho, sin embargo, otras decidieron mantenerse acopladas total o parcialmente
(prima a la vaca nodriza, sacrificio). Mientras es de esperar que el desacoplamiento total repercuta en
una disminución de las producciones intensivas, el mantenimiento de las primas acopladas, podría
repercutir en una mayor extensificación de la producción (COMISIÓN EUROPEA, 2005).
En cualquier caso, para que este proceso se convierta en una realidad, el ganadero, como cualquier
otro empresario, debe percibir un beneficio en los resultados económicos de su explotación, bien sea
a través de los precios del mercado, bien a través de los soportes y políticas institucionales, que
tratan de compensar la ausencia de remuneración de los servicios sociales aportados por este tipo de
empresa. En este sentido, el objetivo del presente trabajo, es precisamente analizar los resultados
económicos de este tipo de empresa.
2.- Metodología
2.1.- Obtención de la información
La realización de cualquier investigación requiere en un primer paso, de la obtención de la
información que permita conseguir los objetivos establecidos, que en este caso procede tanto de
fuentes primarias (encuestas), como de fuentes secundarias (censos, estadísticas y publicaciones
relacionadas con el objeto de la investigación). Las primeras constituyen la base de los resultados
presentados en este trabajo, mientras que las segundas se han utilizado fundamentalmente para el
diseño del plan de muestreo, así como para el contraste e interpretación de los resultados.
De este modo, tras realizar un estudio previo y pormenorizado de la situación y problemática del
sector, se procedió a elaborar el correspondiente cuestionario, formulado en su mayor parte a base
de preguntas abiertas, y tomando como base para el diseño de las mismas, estudios desarrollados
por otros autores, que han llevado a cabo investigaciones similares en otros sectores (SOLER y
PERDIGUER, 1992; PUENTE, T, 1995; REVUELTA et al, 1998; ROBLES et al 2001a; ROBLES
et al 2001b).
A continuación, a partir del censo de explotaciones de carne de tipo extensivo en Castilla y León,
se procedió a la selección de la muestra objeto de estudio. Para ello se utilizó un muestreo aleatorio
simple. De acuerdo con este método, se procedió a la determinación del tamaño muestral, teniéndose
en cuenta que no siempre una muestra más grande proporciona mejores resultados, sino que a partir
de cierto tamaño, apenas se reduce el error y, sin embargo, aumentan los costes y pueden aumentar
los errores ajenos al muestreo. Por otro lado, la investigación debe buscar un compromiso entre el
coste de una muestra grande y la fiabilidad de los resultados (GRANDE y ABASCAL, 1995). Para
las encuestas a ganaderos la expresión utilizada ha sido:
n − n pq
e=k⋅ ⋅
Donde:
n −1 n
e = Error absoluto.
N = tamaño de la población
n= Tamaño de la muestra.
p = q = 0,50.
K= 2, aproximadamente equivalente al 95,5% del intervalo de confianza de una distribución
normal.
En este sentido, se ensayaron distintos tamaños muestrales, calculando para todos ellos el
correspondiente error muestral, y se decidió adoptar un tamaño de muestra constituido por 250
explotaciones, lo que supone un error de 6,2%. La muestra se obtuvo mediante el método de los
números aleatorios, quedando distribuida como sigue (tabla 1).
Tabla 1. Distribución de la muestra a ganaderos. Fuente: Elaboración propia.
Provincia 0-20 21-50 51-100 101-300 301-500 501 total

av 20 7 12 10 1 1 51
bu 8 9 4 8 29
le 11 2 2 4 19
va 0
pa 1 3 3 4 11
sa 19 20 20 32 7 3 101
se 4 6 6 5 2 1 24
so 3 3 3 1 10
za 5 4 9
Total 71 50 50 68 10 5 254
En cuanto al modo de administración más conveniente para llevar a cabo la encuesta, a la hora
de elegir éste, se consideraron distintos factores, como: el objetivo del estudio, las características
de la población, y el presupuesto disponible. Se optó por la encuesta personal, como modo de
administración más adecuado, ya que aunque puede presentar algunos inconvenientes, como:
(i) Un coste de obtención elevado debido a la lentitud del proceso y al tiempo empleado en la
recogida de datos, y fundamentalmente, en nuestro caso, debido a los gastos correspondientes a los
desplazamientos, dada la dispersión de los distintos municipios y la distancia geográfica;
(ii) Lentitud del proceso, debida en parte, a las pérdidas de tiempo en los desplazamientos, a
la imposibilidad de concentrar las citas, dados los quehaceres de los ganaderos y a la duración de la
propia encuesta, que dada la diversidad de datos, la concreción y la dificultad que suponían algunos
de los aspectos, llegó, en ocasiones, a superar las dos horas de duración.
Sin embargo, presenta asimismo algunos puntos fuertes de considerable importancia, que
animaron a realizarla de este modo, como la posibilidad de obtener un porcentaje de respuesta
más alto que el obtenido a través de otros métodos (GRANDE y ABASCAL, 1995), característica
de notoria importancia en el caso que nos ocupa, dada la tendencia de parte del encuestado a la
desconfianza y al rechazo de las encuestas, sobretodo en el caso de preguntas relacionadas con datos
de naturaleza económica.
2.2.- Obtención de los resultados económicos
Una vez realizadas las encuestas, se procedió a la determinación, para cada una de las
explotaciones, de una serie de indicadores de naturaleza económica, de cara a evaluar la situación
económica de las mismas. El objetivo final es disponer de los principales indicadores de las rentas
generadas por la actividad productiva en las explotaciones ganaderas. Para la obtención de estos
indicadores se utilizó la metodología de la Red Contable Nacional (MAPA, 2003). A continuación,
se resume el cálculo de los principales indicadores:
Producción Bruta Vegetal: Refleja en € el valor de la producción agrícola. Incluye el valor de la
producción generado por la agricultura.
Producción Bruta Animal: Refleja el valor en € de todo lo producido por la ganadería.
Producción Bruta Total: Suma de la animal y la vegetal
Producción Final Agraria, PFA: Es la Producción Bruta Total menos el Reempleo.
VAB a precios de mercado: Se obtiene restando a la PFA los costes de fuera de la explotación y
los impuestos y tasas.
VAB a coste de factores: VAB a precios de mercado + Subvenciones
VAN a coste de factores: VAB a coste de factores menos amortizaciones.
Disponibilidad empresarial: Se obtiene restando al anterior los salarios de la mano de obra
contratada, y los arrendamientos/alquileres. Refleja lo que queda disponible al empresario para
remunerar la mano de obra familiar (no pagada), los intereses del capital (propio o prestado) y su
propio beneficio por la gestión.
2.3.- Resultados
La tabla 2 resume los principales indicadores económicos de las explotaciones encuestadas
agrupados por tamaño de la explotación (según número de vacas nodriza).
Tabla 2. Valor de las variables económicas en los distintos estratos. Elaboración propia.
Estratos
VAB a
(Número Producción Producción Producción VAB a coste VAN a coste Disponibilidad
PFA precios de
Vacas Bruta Vegetal Bruta Animal Bruta Total de factores de factores empresarial
mercado
Nodriza)
0-21
Promedio 4053 3967 8020 6804 1420 5401 4605 3779
varianza 89936677 9885861 106019513 88178364 52373433 89964684 83936949 79671556
20-51
Promedio 6589 11206 17795 14810 1883 16269 13896 11004
varianza 163227251 220346794 284756405 245823957 200412009 286792398 274928096 250534904
50-101
Promedio 7198 27946 35144 31286 9599 37314 34801 29089
varianza 168797346 331388991 527944391 452045746 555432288 502654727 498251404 562080040
100-301
Promedio 22271 68163 90433 78808 34290 97141 90894 76075
varianza 1331853893 1472237569 3848613803 2706452608 1780183578 4053458564 3781147645 2847585744
300-501
Promedio 100320 160330 260650 194996 114743 283263 271770 199272
varianza 2947239467 688278873 5920157720 5529162713 1360492713 573040938 357227847 420871988
>500
Promedio 52800 416904 469704 416904 181399 399111 396111 361111
varianza 0 0 0 0 0 0 0 0
Entre los principales rasgos socio-económicos, merece destacar los siguientes hechos:
 El valor de la producción total aumenta con el tamaño de la explotación, debido

fundamentalmente al aumento de la producción animal. La participación de la agricultura sobre
la producción total es muy variable, alcanzando los valores más altos en cuanto a participación
en las ventas y en la Producción Total en las explotaciones ganaderas más pequeñas (menos de 50
animales), en base a una mayor diversificación de la actividad. En el estrato de 300 a 500 vacas
nodriza, la producción agrícola vuelve a ganar peso, pero en este caso motivada por el reempleo de
las producciones agrícolas en la alimentación animal. La mayor producción agrícola por hectárea
cultivada, corresponde a las explotaciones ganaderas de mayor tamaño (más de 300 animales),
que son las que presentan asimismo un mayor porcentaje de superficie de regadío. Asimismo, la
Producción Animal por UGM aumenta con el tamaño de la explotación.
 El mayor peso de los gastos fuera de la explotación sobre la Producción Bruta Total (PBT),
tiene lugar en las explotaciones con menos de 51 vacas madre (especialmente en las de 20 a 51).
Para las explotaciones con más de 50 vacas nodriza, el peso relativo de los gastos de fuera de la
explotación disminuye a medida que aumenta el tamaño de la explotación ganadera, minimizándose
en el caso de las explotaciones más grandes.
 Las subvenciones tienen un peso notable sobre el conjunto de la actividad, especialmente
en las explotaciones más pequeñas (las explotaciones con menos de 100 animales son las que
presentan una mayor participación de las subvenciones sobre el Valor Añadido bruto a coste de
factores, disminuyendo ésta en los restantes estratos a medida que aumenta el tamaño). En cuanto
a la participación de la agricultura y la ganadería sobre el total percibido a través de la subvención,
evidentemente, destacan las subvenciones vinculadas a la ganadería, que suponen entre un 66 y
un 97% de las subvenciones totales, aumentando su participación lógicamente con el tamaño de la
explotación ganadera.
 La casi totalidad de las explotaciones utiliza mano de obra familiar, sólo en las explotaciones
de más de 300 animales la contratación de asalariados reviste cierta importancia, el resto recurre a
este factor de forma esporádica.
2.4.- Conclusiones
Aunque la actividad refleja resultados positivos en todos los estratos analizados, sin embargo
debe tenerse en cuenta que no han sido deducidos los costes correspondientes a la mano de obra
familiar, ni los intereses del capital. De deducir éstos de cara a obtener una aproximación al beneficio
empresarial, los importes correspondientes se sitúan en niveles claramente inferiores e incluso
reflejan pérdidas en las explotaciones más pequeñas, en las que la actividad es un mero complemento
de otras rentas.
Cabría distinguir tres tipos de explotaciones: Aquellas donde la actividad tiene carácter
empresarial, reflejando resultados económicos positivos, capaces de competir por sí mismas en los
mercados, aumentando este rasgo con el tamaño de la cabaña ganadera (más de 300 animales), y
aquellas otras (menos de 100 animales) en la que los beneficios económicos son escasos, o incluso
en algunas ocasiones llegan a reflejar pérdidas. Entre ambas existe un estrato intermedio (101-300
animales), que reúne características intermedias entre ambas.
Dentro de las primeras (“explotaciones empresariales”), encontramos negocios bien organizados,
donde la presencia de la mano de obra familiar va disminuyendo en importancia frente a la mano de
obra contratada, a medida que aumenta el tamaño de la cabaña ganadera; Son explotaciones capaces
de subsistir por sí mismas generando beneficios independientemente de la percepción de subvenciones
relacionadas con la actividad. En las segundas, la actividad ganadera, no genera siempre beneficios, e
incluso en el caso de las más pequeñas (menos de 50 animales) no permite la adecuada remuneración
del trabajo familiar y los capitales invertidos, aunque supone un complemento de otras rentas, no
siempre procedentes de la agricultura, que contribuyen al mantenimiento de la población en el medio
rural, y a la aportación de servicios sociales y medioambientales.
En cualquier caso, la supervivencia de la mayor parte de las explotaciones (menos de 300 animales)
pasa por el mantenimiento de las subvenciones existentes; sin éstas sólo aquellas explotaciones
mayores de 300 animales podrían generar beneficios.
2.5.- Bibliografía
COMISIÓN EUROPEA (2002). Communication from the Commission to the Council and the European
Parliament. Mid Term review of the Common Agricultural Policy. Bruselas.
COMISIÓN EUROPEA (2005). Prospects for agricultural markets and income 2005-2012. Julio, 2005.
GRANDE, I. y ABASCAL, E. (1995). Fundamentos y técnicas de investigación comercial. 2ª edición. ESIC
Editorial. Madrid.
MAPA (2003). Red contable agraria nacional, Secretaría General Técnica.
PUENTE, T. (1995). Simulación de políticas ganaderas en las comarcas agrarias de León. Tesis doctoral. Escuela
Superior y Técnica de Ingeniería Agraria. León.
REGLAMENTO (CE) 1254/1999, del Consejo de 17 de mayo de 1999 por el que se establece la organización
común de mercados en el sector de la carne de vacuno. DO L 160 de 26.6.1999.
REGLAMENTO (CE) N° 1782/2003 del Consejo de 29 de septiembre de 2003, por el que se establecen
disposiciones comunes aplicables a los regímenes de ayuda directa en el marco de la política agrícola
común y se instauran determinados regímenes de ayuda a los agricultores y por el que se modifican los
Reglamentos (CEE) n° 2019/93, (CE) n° 1452/2001, (CE) n° 1453/2001, (CE) n° 1454/2001, (CE) n°
1868/94, (CE) n° 1251/1999, (CE) n° 1254/1999, (CE) n° 1673/2000, (CEE) n° 2358/71, (CE) n° 2529/2001
y n° 1156/2006. DO L 270 de 21.10.2003.
REVUELTA, J.F.; PUENTE, T.; FERNÁNDEZ-RODRÍGUEZ, F. (1998). Costes de producción en las
explotaciones ganaderas vacunas en la comarca de Laciana (provincia de León). 6º Congreso de Economía
Regional de Castilla y León. Zamora. Comunicaciones 3, pp. 1698-1714.
ROBLES R.; PUENTE T. and REVUELTA J.F. (2001a). Explotaciones de vacuno en el Páramo de León:
Estructura y Orientación Técnico-Económica. Ganadería, Nº 10, pp 26-29.
ROBLES R.; PUENTE T. y REVUELTA J.F. (2001b). Importancia socioeconómica de la ganadería bovina en la
comarca del Páramo leonés. Paper. Fe.Me.S.P.Rum. IX International Congress. León (Spain).
SOLER, P. y PERDIGUER, A. (1992). Prácticas de investigación de mercados. Siete investigaciones completas.
Ed. Deusto. Bilbao.
CERTAIN FEATURES OF RAW SKIN FROM LARGE DOMESTIC
HOOFED ANIMALS
NEKA SVOJSTVA SIROVIH GOVEĐIH KOŽA
P. Džaja1., M.Čuljak2, J. Bagarić 3., V. Vrkić4., K. Rukavec5, F. Martinković6., E.

Šatrović7 ,M. Radačić8, I. Vranješ9., A. Lokin10., I. Semren11
1
Zavod za sudsko i upravno veterinarstvo, Veterinarski fakultet u
Veterinarska stanica Oborovo
2
3
Veterinarski ured,, Sarajevo
4. Student
5
Veterinarska stanica Sesvete
6.
Zavod za parazitologiju i invazijske bolesti s klinikom, Veterinarski fakultet u Zagrebu
7
Zavod za sudsko i upravno veterinarstvo, Veterinarski fakultet u Sarajevu
8
Dalmacija vino, Split
9
Veterinarska stanica Križevci
10
Veterinaska ambulanta Pakoštane
Student-diplomski rad
11
Summary
Criteria for raw skin quality are defined by the standard from 1985. Large domestic hoofed animals include
calf’s skin, baby-beef’s skin, cow-hide and buffalo-skin. Specified skins classified in 4 category. Feedstock (raw
material) characteristic depends on the form, structure, pile coat and integrity of the pile. Age, sex and breed
affect on size, fatness, structure and pile coat. A the skin we should distinguish admittance weight, weight of
salted skin, weight of dry salted and salted skin. Utilization rate of raw skin is percentage of raw skin weight
against body weight. Abatement of skin we define as losing skin weight during preservation in salt and storage,
as well as after preservation in salt.
Key words: raw skin, hoofed animals, features
Sažetak
Standardom iz 1985.g. određeni su uvjeti kvalitete za sirovu kožu domaćih velikih papkara u koju spada:
teleća, juneća, goveđa i bivolska koža. Teleća koža razvrstava se u 4 klase kao juneća, goveđa i bivolska.
Sirovinska svojstva kože ovise o obliku, građi, dlačnom pokrivaču i potpunosti kože. Starost, spol, pasmina
utječu na veličinu, debljinu, građu i dlačni pokrivač kože. Kod kože treba razlikovati ulaznu težinu, težinu soljene
kože, težinu suho slane i suhe kože. Radman sirove kože je postotak težine sirove kože naspram težine tijela.
Pod kalom kože podrazumijevamo gubitak težine kože za vrijeme soljenja i skladištenja te nakon soljenja.
Ključne riječi: sirove kože, papkari, svojstva
UVOD
Krupna koža stavlja se u promet bez kože glave, donjeg dijela nogu i repa te se s nje mora odsjeći
koža vimena, mošnica, čmar i stidnica i uvijek mora imati dvije podjednake polovice (jedna polovica
kravlja može biti nešto veća). Tako je teleća koža definirana kao koža mladih goveda, potpuno ili
pretežno pokrivena mekom dlakom, koja su se isključivo hranila mlijekom, a nema razlika u debljini
na leđima i vratu. Pod junećom kožom isti standardi podrazumijevaju kožu mladih goveda obaju
spolova, koji nisu upotrebljavani za rasplod i imaju jednolično razvijenu dlaku, a koža nema izrazito
deblje niti tanje okrajine u odnosu na kožu leđa, zatim koža vrata nije izrazito deblja ni tanja od kože
leđa. Pod goveđom kožom podrazumijeva se koža odraslih goveda koja je pokrivena oštom dlakom
različite duljine a razlike postoje i u debljini na leđima, vratu i okrajinama. Bivolska je koža bivola
obaju spolova.
Prema standardima koji su vrijedili na ovim prostorima teleće se kože sortiraju u mliječne i
slamožderske kože težine do 3,5-4 kg svježe težine i iznad te težine. Teleće kože po kvaliteti, prema
navedenim standardima, razvrstava se u 4 klase i onu koja ne može udovoljiti uvjetima 4. klase
razvrstava se u škart. Teleća koža prve klase vrjednija je od kože druge klase za 10%, od treće klase
za 20%, od kože četvrte klase za 50%, a od kože pete klase za 80%. Juneće kože razvrstavaju se u
dvije kategorije: kože junadi-obična i kože tovne junadi (baby beef). Juneća koža razvrstava se u 4
klase, a one koje ne ispunjavaju uvjete 4. klase, spadaju u škart. Juneće kože prve klase vrjednije
su od koža druge klase za 10%, treće klase za 20%, četvrte klase za 40%. Goveđa koža dijeli se na
kravlju, volovsku i bikovsku. Bivolske kože u promet se stavljaju odvojene, dok se kravlje i volovske
kože mogu staviti skupa. Kravlja koža ima izrazito velike i tanke okrajine i kožu vrata tanju od kože
leđa. Volovska koža ima izrazito debelu kožu leđa i razmjerno male okrajine, a koža vrata je tanja od
kože leđa. Bikovska koža ima masu veću od 34 kg svježa i slana oko 30 kg, koža leđa joj je tanja u
odnosu na debelu kožu okrajina i vrata. Goveđe kože razvrstavaju se u klase kao juneće kože, s tim
da je goveđa koža prve klase za 7% vrjednija od kože druge klase, 15% od kože treće klase i 40 % od
kože četvrte klase. Bikovske kože razvrstavaju se u dvije kategorije prema masi: -od 34 kg svježe ili
30 kg slane mase do 63 kg svježe ili 55 kg slane mase i iznad 63 kg svježe ili 55 kg slane mase.
VAŽNA SVOJSTVA KOŽE ZA OBRADU

Sirovinska svojstva kože, kao što su oblik, građa, dlačni pokrivač i potpunost kože, odlike su
koje koži daju mogućnost prerade u kožu ili kožno krzno. Oblik kože određen je njenom površinom
(dužina, širina i debljina), građu predstavljaju tkiva a dlačni pokrivač čine sve dlake koje su na njoj
izrasle. Pod pojmom potpunosti kože podrazumijevamo stupanj zastupljenosti prirođenih svojstava
i neoštećenja. Životinjska koža dobiva oblik sirove kože skidanjem sa životinje, a prirodna svojstva
trebaju biti sačuvana do početka njene prerade u kože ili krzno (Bayer 1978.). Koža pobačenih
teladi mala je, tanka, siromašne građe i potpuno gola ili tek slabo pokrivena rijetkim dlačicama. Kod
novorođenoga teleta koža je pokrivena prvom dlakom, nema razlika u debljini pojedinih dijelova, a
repna je dlaka fina i priliježe uz rep. Koža teleta hranjenoga samo mlijekom imat će razlike u građi
ovisno o pasmini, dobu i spolu i ta je razlika jedva zamjetna. Razlike će biti veće što je tele starije i
što se duže hrani drugom hranom. Prema navedenim standardima nema razlika u debljini kože (leđa,
vrat i okrajine), a dlaka je meka kod teladi hranjenih samo mlijekom i razvrstava se u dvije kategorije
po masi do 4 kg svježe ili 3,5 kg slane mase i više od 4 kg svježe ili više od 3,5 kg slane mase. Muške
su teleće kože nešto deblje od ženskih telećih koža iste dobi i pasmine, a leđni je dio deblji od vratnog
i trbušnog dijela te ima tendenciju stvaranja nabora. Trbušni su dijelovi kože su uski i tek nešto tanji
od leđnog dijela. Ženska telad ima široke i tanke trbušne dijelove i tanak vratni dio. Bikovske kože
imaju vrlo tanak leđni dio i široke i debele trbušne dijelove te debeli vratni dio s brojnim naborima.
Kravlje su kože u području vrata tanke s naborima koji rastezanjem nestaju, kao i trbušni dio, dok je
leđni dio uzak, ali deblji od vratnog i trbušnog dijela kože. Volovska koža ima debeo i široki leđni dio,
tanje i uže trbušne dijelove i vratni dio tanji od leđnog, a deblji od trbušnog dijela. Manje pasmine
goveda imaju zbijeniju i deblju kožu nego mliječna goveda, a goveda uzgojena u hladnim predjelima
imaju deblju kožu od goveda uzgojenih u toplim predjelima. Postoji utjecaj dobi, spola i pasmine
na građu telećih i goveđih koža. Teleće kože imaju finija vlakna, gušćeg su spleta od goveđih. Splet
vlakana volovskih koža gušći je nego u bikovskih ili kravljih koža. Kože muških životinja imaju
deblje snopiće vlakana nego kože ženskih životinja iste dobi. Mliječne pasmine imaju labaviju građu
od mesnih i radnih pasmina. Goveda intenzivno hranjena krmom koja sadrži mnogo masnih sastojaka
imaju spužvastu građu u usporedbi s kožom goveda uzgajanih na pašnjacima. Gladovanje smanjuje
debljinu kože i čini njenu građu siromašnom.
Postoje razlike u dlačnom pokrivaču prema dobi, spolu i pasmini goveda. Mlade životinje imaju
finiju jednolično po koži rasprostranjenu dlaku, neznatne razlike u duljini i debljini. Odrasla goveda
imaju grublju dlaku, deblju u bikova nego u volova i krava. Repna je dlaka teleta fina, ravna i priliježe
uz rep, goveđa je repna dlaka kovrčava, gruba i strši od repa. Goveđe kože iz hladnih predjela imaju
deblju i gušću dlaku od onih iz toplijih predjela. Dobro hranjena goveda imaju gustu i sjajnu dlaku
koja priliježe uz tijelo, a gladna goveda imaju tamnu, čupavu i rijetku dlaku.
Epidermalno područje sirove teleće kože zauzima najmanje polovicu od cijele debljine kože,
a kod odraslog goveda to područje zauzima trećinu debljine kože. Korijum teleće kože ima gušće
snopiće vlakana negoli korijum goveđe kože, ali pletež vlakana korija kod goveđe kože jasnije
je izražen (razvijeniji je). Ukupna debljina kože raste od teleće ka goveđoj koži. Izgleda da je
epidermalno područje teleće i goveđe kože relativno isto a glavni dio rasta odvija se u području
korija. Apsolutni broj dlačnih mješića isti je na telećim i goveđim kožama, ali je razmak između njih
na telećim kožama manji.
Klaonička ili ulazna masa kože masa je kože koju svježa koža ima nakon skidanja sa životinje.
Vaganje svježe kože vrši se tek kada je koža izgubila tjelesnu toplinu, tj. pošto je primila temperaturu
okolice u kojoj se nalazi. Svježa masa vaga se pošto je s nje odstranjeno sve što standardi traže. Kada
je na mesnoj strani kože vidljiva krv, voda ili prljavština, od ustanovljene mase odbija se najmanje
5%, a ako je mokra i zaprljana dlačna strana, najmanje 10%.
težina suhoslane, suhe kože x 100
Ulazna težina:-----------------------------------------------------------
100 – dopušteni kalo (60 ili 45)
Soljena je koža bilo koja koža koja je 48 sati potpuno potopljena u zasićenu otopinu NaCl, ili
je stajala najmanje 14 dana potpuno prostrana i nasoljena dovoljnom količinom soli. Masa soljene
kože dobije se nakon toga što je presoljena zasićenom otopinom soli te se ocijedila za 48 sati, ili je
soljena suhom soli te se nakon istresanja preostale soli važe 24 sata nakon toga postupka. Suho-slana
koža –koža je koja je nakon soljenja na zraku osušena tako da su rep i uši otvrdnuli. Suha koža -koža
je koja se na zraku potpuno osuši tako da rep i uši otvrdnu. Masa suhe kože masa je koja se postigne
vaganjem kože nakon toga što rep i uši potpuno otvrdnu.
Radman sirove kože goveda podrazumijeva postotak težine sirove kože (skinuta koža s glave i
nogu) naspram težine tijela i ovisan je o pasmini goveda (primitivne pasmine imaju viši radman),
spolu, dobu (ženska i mlada goveda imaju obično niži radman sirove kože u usporedbi sa starijim i
muškim govedima), težini (što je govedo manje i mršavije to je radman manji) i kondiciji životinje.
Tako se smatra da je kod goveda u intenzivnom uzgoju radman sirove kože 7%, a kod primitivnih
pasmina 10%. Ovo se može raščlaniti i reći da je u krava 6- 6,5%, junadi 6,5-7%, volova 7- 7,5% i
bikova 7,5-8%.
Sirovu kožu vrlo brzo zahvaćaju raspadni procesi, a kad se kuha u vodi, raspada se u tutkalo ili
kelj, dok potpuno uštavljena koža teško trune i vrlo se kasno raspada, a kuhanjem u vodi ne mijenja
se. Životinjska se koža sastoji se od vode, bjelančevine, masti i mineralnih soli. Ako neka koža sadrži
više masti, sadrži manje vode. No najvažniji su sastojak kože bjelančevine, a od osobite su važnosti
kolagen i kreatinin. Od kolagena su građena kožna vlakna, a od keratina orožnjeli dijelovi epiderme,
dlaka i ostale rožnate tvorevine (nokti, kandža, papci, kopita i rogovi). Kolagen je nositelj štavnih
sposobnosti sirove kože i ima svojstvo da privlači vodu i da s njom nabubri. On osim u vodi bubri i
u kiselinama i lužinama, a kuhanjem se polagano pretvara u želatinu koja nema štavne sposobnosti i
zbog čega treba izbjegavati svaki dodir kože s vrućom vodom. Dok su neke kože osjetljive na vruću
vodu, neke podnose, bez ikakvih posljedica, i toplinu od 65 stupnjeva. Bayer (1950) navodi kako
u pravilu pri radu sa sirovim kožama nikada ne treba upotrebljavati vodu topliju od 30 stupnjeva.
Juneća i goveđa koža dovezena sortirana i Juneća koža, nasoljena i složena u štos
kategorizirana i spremna za soljenje i slaganje u tzv.
štos.
Teleća soljena koža složena na paletu za trnsport na Juneća soljena koža složena na paletu za transport na
preradu preradu.
Osnovni sastav kože je: 50% ugljika, 25% kisika, 7% vodika, 17,8 % dušika i oko 0,2% ostalih
mineralnih sastojaka.
Danas nema postupka konzerviranja kojim bi se sirove kože potpuno i neograničeno dugo
sačuvale od raspadanja bez ikakvih šteta za sirovinska svojstva koža. Za dobar rezultat konzerviranja
jedan od bitni uvjeta je da je koža svježa, a da bi se dobila dobra kondicija kože, uz navedeno, treba
voditi računa o načinu prestanka života životinje, vremenu od smrti životinje do skidanja kože i do
trenutka kada se koža počinje konzervirati. Raspadni procesi na koži počinju prije negoli se okom
mogu vidjeti. Glavni su znakovi raspadanja: promjena prirodnog mirisa kože (miris kože, pojava
mrlja na lešini), popuštanje dlake u korijenu, promjena boje mesne strane kože te gubitak elasticiteta
i čvrstoće sirove kože. Ako se koža ostavi na životinji, ona će se pod istim uvjetima brže raspadati
nego ako je odmah neposredno poslije prestanka života odvojena od tijela. Svježa koža ima jednak
miris kao za života, a ako koža poprimi zadah po lešini, znak je da su u njoj počeli razgradni procesi.
U slučaju gubljenja dlake zbog raspadanja, mjestimice ili na cijeloj koži ispadaju sve vrste dlaka
i ostaju gola mjesta, što se razlikuje od mijenjanja dlake (linanja) kada se na koži razlikuju dlake
različite dužine i debljine. Kod manipulacije kožama pri ispadanju dlake zamjećujemo to na svim
mjestima istodobno, a najprije na onim dijelovima na kojima su zadržani ostatci mekanih dijelova
(meso, potkožje, slanina, žlijezde i sl.). Također ponekada dlaka ispala zbog kožne bolesti životinja,
što treba razlučiti i istaknuti da to nije posljedica mijenjanja dlake, odnosno raspadanja kože. Kod
kožnih bolesti ispadanje dlake prate i druge patološke promjene kože na mjestu ispadanja (boja, otok,
krasta, rana, čir i sl.). Svježa koža koja potječe od dobro iskrvavljene životinje ima sjajnu, glatku,
bijelu, svijetloružičastu boju mesne strane, koja s raspadanjem postaje zagasitije boje. Raspadanjem
kože javljaju se mrlje koje su u početku svjetlije boje, a daljnjim raspadanjem ta boja prelazi u tamnu
boju. Tako od svijetložutih, crvenkastih i smeđih mrlja nastaju zelenkaste, tamnozelene, plave i crne
mrlje. One su u početku raspadanja malene i odvojene od okolice, a s razvojem raspadanja, osim
promjene boje, postaju veće te se međusobno spajaju i zauzimaju sve veću površinu na mesnoj strani
kože. Kože uginulih, ubijenih i ustrijeljenih životinja koje nisu iskrvarile imat će glatku i sjajnu
mesnu stranu u kojoj će biti vidljivi tragovi neiskrvarenja i bit će crvenija strana mesnog dijela kože.
Kože životinja uginulih od bedrenice karakterizira mesni dio kože hladatinasto nabubrio ili prožet
crnom katranastom krvlju. Neće biti razlike u boji i karakteristikama kože životinja koje su zaklane
i kože životinja koje su stradale tako da su iskrvarile. Ostala krv u koži, uzrok uginuća i vrijeme
proteklo od uginuća utječe na bržu pojavu raspadanja na takvim kožama. Na takvim kožama brže
će se razviti znakovi neugodna zadaha, popuštanja dlake na koži, promjena boje mesine negoli na
iskrvarenim životinjama.
Toplina, vlaga i mikroorganizmi ubrzavaju raspadanje životinjske kože, pa tako pri temperaturi
od 10 ºC ostat će sirova koža tijekom 48 sati bez mikroskopski vidljivih promjena. Ako koža ostane
na temperaturi 10-12 ºC, već za 24 sata uočavaju se promjene u građi kože, a koje se nakon tri dana
mogu uočiti tako što se potkožje i epidermalne tvorbe pokriju tankim slojem sluzi. Pri temperaturama
od 23 ºC ova se promjena može uočiti već nakon 6 sati stajanja kože, a što je to vrijeme duže, to
je jače pokrivanje sa sluzi. Ako koža stoji na vlazi od 70%, onda se ta pojava može ustanoviti i
pri temperaturi nižoj od 23 ºC. Nakon smrti životinje na koži se mogu naseliti razne bakterije i
gljivice hraneći se sastojcima kože, uz istodobnu razgradnju. Samo one bakterije koje znatno utječu
na razgradnju kože znatno utječu i na kvalitetu kože kao kožarske sirovine.
Konzerviranje kože treba obaviti čim je koža skinuta sa životinje. Danas se konzerviranje
uglavnom provodi soljenjem, sušenjem, hlađenjem i dezinfekcijom. Soljenje je dobro obavljeno
ako dana koncentracija soli, i to što prije, da počne kočiti razvoj bakterija i aktivnost proteolitičnih
enzima. Pri pravilno obavljenom soljenju na ohlađenoj koži navedena se koncentracija postiže u
koži pri temperaturi zraka od 10 do 20 oºC već za 34 sata. Ako je okolna temperatura viša od 30 ºC,
razgradnja je kože brža nego zasićenje vode kože solju. Ako je relativna vlaga zraka iznad 90%,
rezultat soljenja će biti slabiji, a ako je preniska –tj. ispod 75%, koža će se početi sušiti prije nego
se stvori dovoljno salamure na mesnoj strani. Konzerviranje soljenjem zasniva se na oduzimanju
vode (15%) pomoću kuhinjske soli, a ostala voda u koži prelazi u zasićenu otopinu NaCl. Na koži
nastaje stanje koje nepovoljno utječe na rad enzima i razvoj bakterija. Ovaj način konzerviranja ima
dobru stranu jer se tkivo kože ne mijenja a koža vrlo brzo primi izgubljenu vodu kod konzerviranja
bez oštećenja kožne supstance, i tako možemo, osobito kod debljih koža, dugo sačuvati kožarska
svojstva kože. Negativnosti koje proizlaze nakon konzerviranja kože soljenjem jesu što koža zadrži
mnogo vode, a to je opterećenje pri transportu. Sve to traži veliku pozornost pri uskladištenju jer
se lako kvare. Tanke kože bujne dlake, ako stoje duže od 30 dana, u manjoj ili većoj mjeri počinju
gubiti dlaku a jačina ispadanja je jačina što je temperatura prostorije viša. Konzerviranje sirovih koža
soljenjem obavlja se u hladnim prostorijama s temperaturom nižom od 15 ºC, a rok konzerviranih
krznarskih sirovina je do 30 dana za uobičajenu manipulaciju. Soljenje suhom soli jeftin je i
jednostavan postupak konzerviranja i traje od 4 do 6 dana (ponekada 14) na 5-20 ºC, a soljenjem u
slanoj otopini svi se dijelovi kože ravnomjerno izlažu soli i proces traje od 24 do 48 sati, sirove kože
prije soljenja otopinom moraju se oprati te zbog toga imaju manji postotak nečistoće. Kod soljenja
suhom soli sol se otapa samo na mesnom dijelu kože. Kože soljene suhom soli sadrže od 9,5 do
14% soli nakon soljenja, a kože soljene otopinom soli od 11 do 13%. Koža za vrijeme soljenja gubi
određenu količinu vlage koja je veće mase od mase soli koja se difundirala u kožu. Ovaj gubitak mase,
koji se nastavlja kasnije skladištenjem i sušenjem (isparivanjem), za vrijeme soljenja i skladištenja
nakon soljenja, nazivamo kalo. Kalo ovisi o vrsti kože (s obzirom na životinjsku vrstu), količini
masti, dlačnom pokrivaču, vrsti soli te o dobi životinje. Kože s većom količinom masti (ovce) imat
će manji gubitak mase nego kože koje ne sadrže mast (juneće) pod istim uvjetima soljenja. Masa
kože nakon soljenja povećava se kod koža s debelom vunom, a kod koža mlađih životinja, kod kojih
kolagen ima veću sposobnost da bubri, gubitak je vode manji negoli u starijih životinja pod istim
uvjetima soljenja i skladištenja. Ovaj je kalo manji kod mladih i dobro uhranjenih životinja. Kad kalo
prijeđe 20 % ulazne težine, znak je da se dio soli ponovno kristalizirao iz kožne vode, kože prelaze u
suho-slano stanje. Za konzerviranje krznarskih sirovina soljenjem suhom soli treba uzeti 30 do 50%
soli od težine svježe kože, a pri salamurenju treba na svakih 100 litara vode dodati 30 kg soli, a za
svaki kg kože u salamuri 0,25 kg soli. Tako Bayer navodi da je za prvo soljenje goveđih, bivolskih
i konjskih koža potrebno najmanje 25% soli od ulazne težine, a za svinjske teleće, pseće, ovčje,
janjeće, kozje i jareće najmanje 30% soli od ulazne težine kože.
Literatura
Bayer, Z. (1947.): Sirove kože divljači-Priručnik za izobrazbu stručnih kadrova, II nadopunjeno i prerađeno
izdanje. Nakladni Zavod Hrvatske Zagreb.
Bayer, Z. (1950.): Domaće sirove kože za krznarsku preradbu. Tehnička knjiga Zagreb.
Bayer, Z. (1978.):Sirova koža. Zagreb.
Standard GB1.001/1961.
Standad GB1.006/1985.
THE MOST COMMON JURIDICAL CASSES OF CATTLE SINCE
1923 -2007
NAJČEŠĆI SUDSKI SLUČAJEVI IZ GOVEDARSTVA OD 1923-2007.
Džaja P1., Z. Perić2, M. Vujić3, J. Kos4, Ž. Grabarević5, E. Šatrović6, J. Bagarić7, M.

Radačić8, B. Artuković5, A. Lokin9, *T. Zubak10
1
Zavod za sudsko i upravno veterinarstvo, Veterinarski fakultet u Zagrebu
2
Veterinarska stanica grada Zagreba
3
student
4
Klinika za kirurgiju, ortopediju i oftalmologiju, Veterinarski. fakultet. u Zagrebu
5
Zavod za opću patologiju i patološku morfologiju, Veterinarski fakultet u Zagrebu
Zavod za sudsko i upravno veterinarstvo, Veterinarski fakultet u Sarajevu
6
7
Uprava za veterinarstvo, Sarajevo
8
Dalmacija vino, Split
9
Veterinarska ambulanta Pakoštane
10
student diplomski rad
ABSTRACT:
At the Department for forensic and juridical veterinary medicine, Faculty of Veterinary medicine, University
of Zagreb there were elaborated up to 440 juridical expertise of cattle related issues since 1923rd to 2007th
or approximately 5.17 cases over the year. The earliest juridical expertise of cattle related issues were made in
1930-1, 1931-4, 1932-1, 1933-1, 1936-1, 1937-1, 1938-1 etc. The most common juridical cases are related to the
fattening of beefs and calves 90 (20,45%), then follow 53 (12,61%) cases related to calving problems, 39 (8,86%)
cases related to digestion system, 34 (7,72%) cases of infective diseases, 26 (5,90%) cases of intoxication, 20
(4,54%) cases are associated to assessment of meat validity, then there were 22 (5%) cases of abortions, and 21
(4,77%) of other cases. From the rest of 135 (30,69%) cases, there were 13 (2,95%) most common cases related
to parasitological diseases, then 12 (2,72%) cases of liver, kidney and spleen diseases, problems related to
artificial insemination and absence of placenta, 11 (2,5%) cases of determination of fatherhood and fertility,and
10 (2,27%) cases of udder disease and prolepsis of vaginae. From the rest of 56 (12, 72%) cases there are 8 (1,
85%) problems associated with castration of bulls, 7 (1, 59%) related to transport, 6 (1, 36%) related to puerperal
paresis, deficiency diseases, respiratory diseases and veterinary service responsibilities, and 4 (0, 9%) cases
associated to assessment of age, eyes diseases and gravity diagnostic. On the rest of 11 expertise goes 2,5%.
Key words: cattle, juridical cases
SAŽETAK
U Zavodu za sudsko i upravno veterinarstvo Veterinarskog fakulteta u Zagrebu u razdoblju od 1923.
do 2007.g. izrađeno je ukupno 440 sudskih ekspertiza iz govedarske problematike ili prosječno 5,17 slučajeva
godišnje. Najranije sudske ekspertize iz govedarske problematike izrađene su 1930.-1, 1931.-4, 1932.-1,1933.-
1,1936.-1,1937.-1,1938.-1 itd. Najučestaliji su sudski slučajevi vezani za tov junadi i teladi- 90 (20,45%),
u svezi s teljenjem bilo ih je 53(12,61%), probavnim sustavom 42 (9,5%), zaraznim bolestima 34 (7,72%),
intoksikacijama 23 (5,2%), procjenom valjanosti mesa 20 (4,54%), pobačajem 22 (5%)i ostalim 21 (4,77%).
Od ostalih slučajeva 135 (30,69%) najučestaliji su oni vezani za parazitarne bolesti- 13 (2,95%), bolesti jetre,
bubrega i slezene, problemi vezani za U.O. i zaostajanje posteljice imali su po 12 slučajeva (2,72%), određivanje
očinstva i neplodnosti 11 (2,5%) i bolesti vimena i izvala rodnice po 10 (2,27%). Od ostalih 56 slučajeva
(12,72%) na probleme vezane za kastraciju bikova otpada 8 (1,85), transport 7 (1,59%), ležanje poslije poroda,
deficitarne bolesti, bolesti dišnog sustava i odgovornost veterinarske službe po 6 (1,36%), procjenu starosti,
bolest očiju i dijagnostiku graviditeta po 4 (0,9%) slučajeva. Na ostalih 11 ekspertiza otpada 2,5%.
Ključne riječi: goveda, sudski slučajevi
UVOD
Od prvih održanih predavanja školske godine 1923./24. iz predmeta sudsko veterinarstvo prof.
dr. sc. Ljudevita Juraka navodi se da se izrađuju sudske ekspertize iz sporova u trgovini stokom iz
cijele bivše države, a o kojima se redovito raspravljalo na sjednicama Profesorskog vijeća. One su
uglavnom imale obilježje fakultetskog nadmišljenja-superarbitrija. Kasniji nastavnik predmeta toga
prof. dr. sc. Ivo Babić, koji preuzima nastavu sudskog veterinarstva školske godine 1929./30., počinje
s prikupljanjem materijala za forenzičku zbirku, i to ne samo ekspertiza izrađenih na Fakultetu već i
sudskih presuda kotarskih sudova na kojima se raspravljalo o sporovima u trgovini stokom i stočnim
proizvodima. Iako se navodi da je prve ekspertize izradio prof. Jurak, ipak je vidljivo da su prve
ekspertize u Zavodu za sudsko veterinarstva iz govedarstva izrađene 1930. g., to jest za vrijeme
prof.dr. Ive Babića. Poslije će sudski slučajevi s Fakulteta biti prosljeđivani stručnjacima Zavoda.
Ako broju sudskih slučajeva iz govedarske prakse (440), koji su izrađeni u Zavodu za sudsko i
upravno veterinarstvo, dodamo 233 sudska slučaja vezana za konjogojstvo (od 1927.—1994.) i 82
slučaja izvan suda, proizlazi da je u Zavodu izrađeno ukupno 440 +233 +82 sudska slučaja vezanih
za govedarstvo i konjogojstvo, ili prosječno 8,8 slučajeva godišnje, plus svi drugi sudski slučajevi
vezani za drugu problematiku u svezi sa životinja, proizvodima, sirovinama, otpadom i dr. Za vrijeme
drugog svjetskog rata od 1940. do 1946.g. ne postoji ni jedna sačuvana izrađena ekspertiza, pa prvi
sudski slučajevi počinju pristizati na Fakultet 1946.-2, 1947.-3 itd., a svoj vrhunac dosegnut će od
1970. do 1980. godine.
REZULTATI i RASPRAVA
Razdvajanje sudskih ekspertiza po tematici nije uvijek bilo jednostavno zato što se u jednom
slučaju navodi različita problematika, to jest ponekada je uzrok uginuća tražen u više dijagnoza,
odnosno više je problema koji su uzrok sudskog slučaja. Kroz navedeno razdoblje izrađeno je 440
sudskih ekspertiza, od čega najviše otpada na tov junadi (20,45%), zatim na probleme pri teljenju
(12,34%), na probavni sustav 9,5%, zarazne bolesti 7,72%, otrovanje 5,2%, pobačaje 5% i procjenu
valjanosti mesa 3,54%. Svi gore navedeni razlozi zbog kojih se vode sudski slučajevi zastupljeni
su po 20 i više puta. Od deset do trinaest sudskih slučajeva zastupljeni su zbog parazitarnih bolesti
(2,95%), bolesti jetre, bubrega i slezene, zbog problema vezanih za U.O., zaostajanja posteljice po
2,72%, određivanje očinstva 2,5% te zbog bolesti vimena i izvale rodnice po 2,27%. Na ove sudske
slučajeva otpada ukupno 364 (83,58%). Problemi vezani za kastraciju bikova rješavali su se 8 puta
(1,8%), transport 7 (1,59), odgovornost veterinarski organizacija, deficitarne bolesti , ležanje poslije
poroda i dišni sustav po 6 (1,36%). Po 4 puta (0,95%) rješavani su problemi vezani za procjenu
starosti, bolesti očiju i dijagnostiku graviditeta. Iz dolje navedene tablice nije teško zaključiti da
na ginekološke probleme, probleme i bolesti produkcije otpada ukupno 148 sudskih slučajeva ili
33,63%.
Tablica 1. broj sudski slučajeva razvrstani prema problemu nastanka
Tema broj sudskih slučajeva %
01 Tov junadi i teladi 90 20,45
02 Teško teljenje 53 12,61
03 Probavni sustav 42 9,5
04 Zarazne bolesti 34 7,72
05 Otrovanja 23 5,2
06 Pobačaj 22 5
70 Procjena valjanosti mesa 20 4,54
08 Ukupno 284 64,54
09 Parazitarne bolesti 13 2,95
10 Bolesti jetre, bubrega i slezene 12 2,72
11 Problemi vezani za UO 12 2,72
12 Zaostajanje posteljice 12 2,72
13 Određivanje očinstva i neplodnosti 11 2,5
14 Bolesti vimena 10 2,27
15 Izvala rodnice 10 2,27
16 Ukupno 80 18.18
17 Kastracija bikova 8 1,8
18 Transport 7 1,59
19 Odgovornost veterinarski organizacija 6 1,36
20 Deficitarne bolesti 6 1,36
21 Ležanje poslije poroda 6 1,36
22 Dišni sustav 6 1,36
23 Procjena starosti 4 0,9
24 Bolest očiju 4 0,9
25 Dijagnostika graviditeta 4 0,9
26 Ukupno 51 9
27 Svi ostali 25 5,68
Iz tablice 2 vidljivo je da najviše sudskih slučajeva iz govedarske problematike otpada na tov

junadi -90 (20,45), od čega zbog neispunjenja očekivanih rezultata otpada 46 (51,11%), pneumonije
14 (15,55%), prevelikog utroška hrane u tovu 9 (10%), nekvalitetne krmne smjese u tovu 6 (6,66%).
Na ove slučajeve otpada ukupno 75 (83,33%) od broja slučajeva u tovu ili 17% od ukupnog broja
slučajeva. Na svu ostalu problematiku u tovu otpada 16,66%.
Tablica 2. Sudski slučajevi u svezi s problemom tovu junadi.
% od broja % od
Tov teladi i junadi
vezanih za ukupnog broja
probavni sustav slučajeva
Problem Broj 90 20,45
Tov teladi i junadi problemi vezani za neočekivan rezultat 46 51,11 10,45
Pneumonije 14 15,55 3,18
Prevelik utrošak hrane 9 10 2,04
Nekvalitetna krmna smjesa 6 6,66 1,36
Produžen tov 4 4,44 0,9
Nedostatak hrane u tovu 2 2,22 0,45
Tov zimi 2 2,22 0,45
Otuđivanje junadi 1 1,11 0,225
Neredovito napajanje 1 1,11 0,225
Problem ulazne težine 1 1,11 0,225
Nepovoljni zooh. uvjeti 1 1,11 0,225
Bakteriološki loša hrana 1 1,11 0,225
Utrošak kukuruza u tovu 1 1,11 0,225
Prehrana sušenom sirutkom 1 1,11 0,225
Ukupno 90
Iz tablice 3. vidljivo je da na probleme vezane za pomoć pri teškom teljenju otpada 53
slučajeva (12,045%), od čega je najučestaliji problem vezan za stručnu pogrješku pri pomoći kod
teljenja- 16 (30,18%), na rupturu uterusa pri teljenju, bez obzira na odgovornost, 14 (26,41%),
uginuće krave nakon teljenja 5(9,43%), te na teško teljenje nepoznata razloga 4 slučaja (7,54%).
Navedena problematika zastupljena je s 39 slučajeva (73,58%), a na sve ostale otpada 14slučajeva
(26,42%).
Tablica 3. Sudski slučajevi u svezi s teškim teljenjem
% od broja slučajeva % od ukupnog broja
vezani za probavni sustav slučajeva
Sudski slučajevi Broj 53 12,045
Stručna pogreška 16 30,18 3,63
Ruptura uterusa 14 26,41 3,18
Uginuće krave nakon teljenja 5 9,43 1,13
Teško teljenje 4 7,54 0,90
Trauma poslije teljenja 3 5,66 0,68
Prevelik plod 2 3,77 0,45
Carski rez 2 3,77 0,45
Torzija maternice 2 3,77 0,45
Iskrvarenje nakon teljenja 1 1,88 0,225
Ozljeda laika pri teljenju 1 1,88 0,225
Odbijanje pružanja pomoći 1 1,88 0,225
Loša pomoć bolničara 1 1,88 0,225
Asfiksija ploda 1 1,88 0,225
Teljenje uz pomoć laika 1 1,88 0,225

U tablici 4 prikazani su sudski slučajevi nastali u svezi s problemom probavnog sustava- 42
(9,54%). Najbrojniji su problemi vezani za strano tijelo -26 (61,90%), upala crijeva i akutni nadam
po 4 (9,52%), a na svu ostalu problematiku vezanu za probavni sustav otpada 8 (19,1%) slučajeva.
Tablica 4. Sudski slučajevi nastali u svezi s probavnim sustavom

% od broja slučajeva % od ukupnog broja
vezani za probavni sustav slučajeva
Problem u svezi probavnog
Broj 42 9, 54
sustava
Strano tijelo 26 61,90 5,90
Upala crijeva 4 9,52 0,90
Akutni nadam 4 9,52 0,90
Alimentarna inoksikacija 3 7,14 0,68
Opstrukcija jednjaka 2 4,76 0,45
Alimentarna indigestija 2 4,76 0,45
Začep 1 2,38 0,225

Tablica 5 prikazuje sudske slučajeve vezane za zarazne bolesti kojih je bilo 34 (7,72%), od čega
su problemi vezani za tuberkulozu i tuberkulinizaciju zastupljeni s 13 (38,23%), liječenje bedrenice
i cijepljenje protiv bedrenice 9 (26,47%), slučajeva a dok na sve ostale bolesti otpada 12 (35,29%)
slučajeva.
Tablica 5. Sudski slučajevi svezi s pojavom zaraznih bolesti
% od broja slučajeva ve- % od ukupnog broja
zani za probavni sustav slučajeva
Zarazne bolesti Broj 34 7,72
Tuberkuloza i tuberkulinizacija 13 38,23 2,95
Bedrenica i cijepljenje bedrenice 9 26,47 2,04
Parainfluenca 2 5,88 0,45
Enzootska leukoza 2 5,88 0,45
Aujeczsky 1 2,94 0,225
Aktinomikoza 1 2,94 0,225
Trihomonijaza 1 2,94 0,225
Šuštavac 1 2,94 0,225
Parašuštavac 1 2,94 0,225
Slinavka i šap 1 2,94 0,225
Rinotraheitis 1 2,94 0,225
Spolni osip 1 2,94 0,225
Problemi vezani za intoksikaciju goveda bili su predmet 23 (5,22%) sudska slučaja, od čega je
najbrojnija pitanje, jesu li životinje otrovane- 5 (21,73%) slučajeva, te odgovornost za otrovanje i
otrovanje protumetiljom bili su predmet po 3 (13,04%) slučaja te otrovanje urejom i kuhinjskom
solju 2 (8,69%) slučajeva. Na ostale probleme otpada 8 slučajeva (34,78%).
Tablica 6. Sudski slučajevi u svezi s intoksikacijom goveda

% od broja slučajeva
% od ukupnog broja
vezani za probavni
slučajeva
sustav
Problem Trovanje Boj 23 5,22
Otrovanje 5 21,73 1,13
Odgovornost za otrovanje 3 13,04 0,68
Otrovanje protumetiljom 3 13,04 0,68
Otrovanje urejom 2 8,69 0,45
Otrovanje NaCl 2 8,69 0,45
Otrovanje Pb 1 4,35 0,225
Otrovanje meksakloretanom 1 4,35 0,225
Otrovanje kreazanom 1 4,35 0,225
Otrovanje neguvanom 1 4,35 0,225
Otrovanje severinom 1 4,35 0,225
Otrovanje distocidom 1 4,35 0,225
Otrovanje umjetnim gnojivom 1 4,35 0,225
Otrovanje tiadanom 1 4,35 0,225
Iz tablice 7 proizlazi da su problemi vezani za pobačaj zastupljeni u 22 (5%) sudske

ekspertize, od čega su najbrojniji određivanje uzroka pobačaja u -6 (27,27%), traumatski pobačaj u
4 (18,18%) te određivanje odgovornosti za pobačaj, određivanje uzroka uginuća ploda, te pobačaj
nakon tuberkulinizacije u po 3 (13,63%) ekspertize. Na ostale problemi odnose se 3 slučaja.
Tablica 7. Sudski slučajevi nastali zbog problema vezanih za pobačaj goveda
% od broja slučajeva vezani
% od ukupnog broja slučajeva
za probavni sustav
Problem-pobačaj Broj 22 5
Pobačaj-uzrok 6 27,27 1,36
Traumatski pobačaj 4 18,18 0,90
Odgovornost za pobačaj 3 13,63 0,68
Uginuće ploda 3 13,63 0,68
Brucelozni pobačaj 1 4,54 0,225
Pobačaj nakon tuberkulinizacije 3 4,54 0,225
Pobačaj nakon cijepljenja protiv bedrenice 1 4,54 0,225
Pobačaj-hernia uterusa 1 4,54 0,225
U tablici 8. prikazano je 17 (3,86%) sudskih slučajeva koji se odnose na procjenu valjanosti

mesa, od čega se 8 (47,05%) odnosi na valjanost procjene mesa, procjenu mesa -klanje iz nužde 3
(17,64%), 2 (11,76%) slučaja odnose se na prodaju nepregledana mesa. Na ostale probleme odnose
se 4 sudska slučaja.
Tablica 8. Sudski slučajevi vezani za procjenu valjanosti mesa

% od ukupnog broja slučajeva
vezanih za probavni sustav
Problem: procjena valjanosti mesa Broj 17 3,86
Je li procjena mesa valjana 8 47,05 1,81
Klanje iz nužde 3 17,64 0,68
Prodaja nepregledana mesa 2 11,76 0,45
Odgovornost za pregled 1 11,76 0,45
Nesavjestan pregled 1 5,88 0,225
Pregled-privredni pijrestup 1 5,88 0,225
Ritualno klanje 1 5,88 0,225
U tablici 9. prikazano je 13 (2,95%) sudskih slučajeva, od čega se na metiljavost odnosi

9 (69,23%) slučajeva, dok se ostala 4 slučaja odnose na ehinokokozu, cisticerkozu, distamozu i
sarkosporidiozu.
Tablica 9. Sudski slučajevi vezani za zarazne bolesti

PARAZITI 13 % od ukupnog broja slučajeva
vezanih za probavni sustav
Metiljavost 9 69,23 2,04
Ehinokokoza 1 7,69 0,225
Sarkosporidioza 1 7,69 0,225
Cisticerkoza 1 7,69 0,225
Distomatoza 1 7,69 0,225
U tablici 10 prikazano je 12 slučajeva vezanih za bolesti bubrega, jetre i slezene. Na krvavo

mokrenje odnose se 6 (50%), na pijelonefritis 3 (25%)a na kronične upale jetre, apscedirajuću upalu
slezene i nefritis odnose se tri sudska slučaja.
Tablica 10. Sudski slučajevi vezani za bolesti jetre, slezene i bubrega
BOLESTI JETRE, SLEZENE I BUBREGA Broj 12
Hematuria 6 50 1,36
Pijelonefritis 3 25 0,68
Kronična upala jetre 1 8,33 0,225
Apscedirajuća upala slezene 1 8,33 0,225
Nefritis 1 8,33 0,225
U tablicama 11,12,13 prikazano je po 12 (2,72%) sudskih slučajeva vezanih za umjetno

osjemenjivanje, određivanje neplodnosti i očinstva te zaostajanje posteljice.
Od 12 slučajeva vezanih za umjetno osjemenjivanje 9 (75%) se odnosi na stručnu pogrešku
pri liječenju, a 2 (16,66%) na pobačaj nakon umjetnog osjemenjivanja.
Tablica 11. Sudski slučajevi vezani umjetno osjemenjivanje
UO Broj 12 2,72
Sručna pogjreška 9 75 2,04
Pobačaj nakon UO-stručna pogrješka 2 16,66 0,45
UO-negravidnost 1 8,33 0,225
Tablica 12. Sudski slučajevi vezani za određivanje neplodnosti

Određivanje neplodnosti i očinstva 12 2,72
Procjena neplodnosti bika 8 66,66 1,81
Određivanje valjanosti pedigrea 2 16,66 0,45
Određivanje očinstva 1 8,33 0,225
Određivanje proizvodnih svojstava 1 8,33 0,225
Tablica 13. Sudski slučajevi vezani za zaostajanje posteljice u krava
Retencija sek. 12 2,72

Retenciaj sec. 7 58,33 1,59
Hidrops plodnih ovojnica i ret. Sec. 2 16,66 0,45
Retencija-Piometra 1 8,33 0,225
Retencija-ruptura uterusa 1 8,33 0,225
Retencija-endometritis 1 8,33 0,225
Tablica 14. Sudski slučajevi vezani za izvalu rodnice
Izvala rodnice 10 2,27

Izvala rodnice-pružanje pomoći pri
8 80 1,81
teljenju
Izvala rodnice-pogrješka u liječenju 2 20 0,45
Tablica 15. Sudski slučajevi vezani za bolest i nedostatke vimena
Bolesti i nedostaci vimena 10 2,27

Mastitis 5 50 1,13
Jamstvo za mliječnost 1 10 0,225
Nerazvijeno vime 1 10 0,225
Jamstvo za bolest sise 1 10 0,225
Jamstvo za zdravo vime 1 10 0,225
Nedostaci na sisama 1 10 0,225
Tablica 16. Sudski slučajevi vezani za kastraciju bikova

Kastracija bikova 8 1,81
Kastracija burdizzo kliještima 2 25 0,45
Katracija-stručna pogrješka 2 25 0,45
Sepsa poslije kastracije 1 12,5 0,225
Odgovornost za kastraciju 1 12,5 0,225
Katracija-šuštavac 1 12,5 0,225
Kastracija-parašuštavac 1 12,5 0,225
Tablica 17. Sudski slučajevi vezani za transport
Transport 7 1,59
Uginuće u transportu 3 42,85 0,68
Određivanje kala u transportu 2 28,57 0,45
Transport-akutna slabost srca 1 14,28 0,225
Transport teladi –kaznena odgovornost 1 14,28 0,225
Tablica 18. Sudski slučajevi u svezi s dišnim sustavom

Bolesti dišnog sustava 6 1,36
Upala pluća 5 5 83,33 1,13
Emfizem 1 16,67 0,225
Tablica 19. Ostali sudski slučajevi
Ležanje poslije poroda 6 1,36

Ležanje poslije poroda-uginuće i klanje 5 1,13
Defiicitarne bolesti 6 1,36

Procjena starosti prema zubima 4 0,90
Određivanje graviditeta 4 0,90
Bolesti očiju 4 0,90
Odgovornost veterinarski organizacija 6 1,36
Ostalo 35
U tablicama 14, 15 i 16 prikazani su sudski slučajevi vezani za izvalu rodnice, bolesti i

nedostatke vimena te kastraciju bikova. Od 10 sudskih slučajeva vezanih za izvalu rodnice 8 ih se
odnosi na optužbu veterinara koji je pomagao pri teškom porodu i nakon čije je intervencije nastala
izvala rodnice, a u 2 slučaja veterinar je optužen da je napravio pogrješku u liječenju. Od 10 sudskih
slučajeva vezanih za bolest i nedostatke vimena 5 se odnosi na mastitis, ostalih pet zastupljeno je po
jedanput, a odnose se na jamstvo za mliječnost, nerazvijeno vime, jamstvo za bolest sise, na jamstvo
za zdravo vime i sise. Od 8 sudskih slučajeva vezanih za kastraciju bikova po dva se odnose na
kastraciju burdizzo kliještima te stručne pogrješke koje su nastale obavljanjem kastracije. Ostala 4
slučaja odnose se na sepsu poslije kastracije, na odgovornost za kastraciju te na nastanak parašuštavca
i šuštavca nakon kastracije.
U tablici 17 prikazani su sudski slučajevi nastali zbog transporta životinja, a koji se odnose
na uginuće poslije transporta- u 3 slučaja, određivanje transportnog kala u 2 slučaja, te na akutnu
slabost srca i kaznenu odgovornost za transport junadi u po jedan slučaj. U tablici 18 prikazani su
sudski slučajevi vezani za probleme dišnog sustava, a koji se odnose na upalu pluća u 5 i emfizem
pluća u jednom slučaju. U tablici 19 prikazani su sudski slučajevi koji se odnose na ležanje poslije
poroda i deficitarne bolesti, na odgovornost veterinarskih organizacija u po 6 slučajeva, ležanje
poslije poroda u 5 slučajeva, te na procjenu starosti prema zubima, određivanje graviditeta i bolest
očiju u po 4 slučaja.
LITERATURA
Džaja P., J Perić (1994.). Pregled forenzičkih slučajeva zbog bolesti i mana u konja. Vet. st. 25,6,1994.
Pismohrana Zavoda za sudsko i upravno veterinarstvo.
Winterhalter M. Spomenica 1919-1969.. Zagreb 1969.
Outbreak of the BVDV induced gastro-neuropathy in a
feedlot calves around Tehran (Iran)
POJAVA BVDV-OM INDUCIRANE NEFROPATIJE KOD TELADI U

OKOLICI TEHERANA (IRAN)
Bazargani T.T.1, Hemmatzadeh F.2, Nadjafi J.3 and Sadeghi-Nasab A.*4
Department of Clinical Science, Faculty of Veterinary Medicine, University of Tehran, Iran.

2
Department of Microbiology, Faculty of Veterinary Medicine, University of Tehran, Iran.
3
Department of Pathobiology, Veterinary Reference Laboratory, Iran Veterinary Organization, Tehran, Iran.
4
Junior school of veterinary medicine, Bu-Ali Sina University, Clinical Sciences, Hamedan, Iran
*Corresponding author’s e-mail: sadeghinasabali@basu.ac.ir
Abstract
After an out break of a lethal disease with the signs of the CNS as well as the GI system (GIs) engagement
in 4-6 month old Holstein calves of a feedlot around Tehran, necropsy samples of GIs, liver, kidney, spleen and
lung from 3 died animals referred for histopathologic examination. Blood and formalin fixed ear notch samples
of 6 sick calves submitted for RT-PCR, Antigen-Capture ELISA (ACE) and Immunohistochemistry (IHC) of the
BVDV. Results of ACE of buffy coats were negative but RT-PCR of all 6 cases and IHC of 4 cases were positive
for BVDV infection. In the presence of clinical signs, macroscopic and microscopic pathology findings in the
GI and brain and laboratory results, we strongly suggest that the BVDV may represent a gastro-neuropathogen
strain. To the best of our knowledge, this is the first outbreak report of gastro-neuropathogenic BVDV infection,
maybe acquired postnatally.
Key words: BVDV, Gastro- neuropathogen strain, RT-PCR, Immunohistochemistry, Histopathology
Sažetak
Ustanovljena je pojava atipičnog i značajno težeg oblika infekcije BVDV-a, koja je zahvatila sve dobne
kategorije goveda. U ovom radu opisana je pojava BVDV-a u obliku nefropatije teladi.
Materijali i metode
Nakon pojave febrilne, letalne bolesti, sa znakovima CNS-a i gastrointestinalnim poremećajima kod teladi
Holsteinske pasmine u dobi od 4-6 mjeseci, izvršena je razudba, te su od tri uginule životinje uzeti uzorci
probavnog sustava, jetre, bubrega, slezene i pluća za patohistološku dijagnostiku. Od 6 bolesnih životinja uzet
je uzorak krvi, te uzorak uha fiksiran formalinom za različite anlize BVDV-a, tj. za RT-PCR, Antigen-Capture
ELISA (ACE) i imunohistokemiju (IHC) analizu. Klinička slika se sastojala od stomatitisa sa nekrozama na
nepcu, desnima, na dorzalnoj i ventralnoj strain jezika, običnih ili hemoragičnih proljeva i izrazite depresije,
ležanja i uginuća. Neka telad je pokazivala znakove nekoordinacije i konvulzija, te je takva uvijek i uginula.
Rezultati
Nađena je izrazita hiperemija, proširena i vrlo izražena hidropična degeneracija mukoznog sloja usta i
jednjaka, hiperemijai i infiltracija upalnim stanicama submukoze papilla buraga. U sirištu je pronađen jaki
edem, hiperemija s infiltracijom upalnih stanica i nekroza i erozije mukoze. Na mukozi debelog i tankog crijeva
nađeni su znakovi su cistične degeneracije. U uzorku mozga nađena je hiperemija meningi, glioza te neutrofilna
infiltracija leukocita infiltracija, dok je u malom mozgu prevladvala hiperemija.
Zaključak
Na osnovu kiničke slike, makroskopskih te mikroskopskih nalaza u probavnom sustavu i mozgu zaključili
smo da se radi o gastro-neurološkom soju BVDV-a. Akutni neurološki znakovi su se podudarali sa spomenutim
mikroskopskim i laboratorijskim nalazima. Uzevši u obzir stupanj lezija, zaključili smo da su životinje
uginule od akutnog meningoencefalitisa. Koliko nam je poznato, ovo je prvi opisani slučaj pojave postnatalne
neuropatogene BVDV infekcije.
Ključne riječi: BVDV, gastro-neuropatogen, RT_PCR, imunohistokemija, histopatologija
Introduction
Bovine viral diarrhea virus (BVDV) belongs to the Pestivirus genus, Flaviviridae family which
is an important worldwide viral pathogen of cattle causing many of disease syndromes (Brock, 2004;
Hemmatzadeh et al., 2006; Nettleton and Entrican, 1995). The virus has been described as affecting
the reproductive, respiratory, gastrointestinal, circulatory, immune, lymphatic, musculoskeletal,
integument and the central nervous systems (Brock, 2004). Prenatal infection of the BVDV can also
result in homologous immunotolerance and persistent infection (PI) and its complications as mucosal
disease (MD) in PI animals (Brock, 2004; Nettleton and Entrican, 1995).

In a Holstein breed feedlot around Tehran, with 800 populations which 270 of them stabled
in 3 separate yards, 4-6 month old calves were affected in severe outbreak of a fatal disease. At
risk animals transported in different party to the feedlot from dairy farms of around Tehran after
weaning. These calves fed on alfalfa, hay, corn silage, ground corn, ground oat, cotton seed meal,
soy bean meal, beet pulp. For dealing with disease at the first step, after history taking, at least 25
cases clinically examined carefully and 3 dead cases were necropsied. At the second step and nearly
3 weeks later, blood and ear notch samples were collected from 6 Holstein calves 4 to 6 months old
with the same clinical and macroscopic signs. Blood samples were collected from jugular vein in 10
ml vacutainer tubes contain 1 ml of 3.85% sodium citrate and delivered to the laboratory in the ice
containers (4 °C) maximum within 24 h.
The skin biopsies were collected from the distal part of the ear using an “ear notcher” to obtain a
cylindrical 1 cm diameter of the ear pinna. Notcher was washed with water and disinfected with 2%
formalin solution between each collection. Samples were fixed in 10% buffered formalin solution.
Formalin fixed specimens of palatine, esophagus, rumen, abomasum, small and large intestines,
brain, kidney, lung, liver, spleen 3 dead cases of disease were performed and referred to pathology
lab for sectioning and Hematoxylin-and-eosin staining.
3-1) Antigen-Capture ELISA (ACE): Detection of BVDV antigen in Buffy coat cells was
performed using a commercially available kit (Pestivirus antigen detection kit, Moredun Scientific
Limited, UK). According to the manufacturer’s instructions, after sample preparation and antigen
extraction, assay protocol at 450 nm within 30 minutes and based on recommended OD limits (C1
>0.8, C2 = 0.4-0.6, C3 = 0.2-0.4, C4<0.2) was performed.
3-2) Reverse Transcription–PCR (RT-PCR): Reverse transcription–PCR, as described (Vilcek
et al., 1994) and modified previously (Moakhar et al., 2004), was performed on buffy coat samples
from all examined calves.
TriPure isolation reagent (Roche diagnostic GmbH, Mannheim, Germany) was employed for
RNA extraction. After this stage cDNA was synthesized and then PCR procedure was performed
(Moakhar et al., 2004; Vilcek et al., 1994)
One primer set, forward (5’-ATGCCCTTAGTAGGACTAGCA-3’) and reverse
(5’-TCAACTCCATGTGCCATGTAC-3’) specific for all of pestiviruses was used for RT-PCR
according to Vilcek et al (1994) which was modified by Kargar Moakhar et al (2004). In this PCR
process, one positive cDNA derived from NADL strain and one negative cDNA obtained from non-
infected cell culture was used as positive and negative control, respectively. The electrophoresis
analysis of the PCR products was run in 1.5% agarose gel using TAE buffer at 100V for 45 min.
Visualization of ethidium bromide stained DNA bands was performed by a UV transilluminator and
gel images were printed using video camera and thermal printer.
3-3) Immunohistochemistry (IHC): From formalin fixed ear notch samples referred to pathology
lab serial sections were performed. Five-micrometer tissue sections were mounted on poly-L-lysine-
coated slides and stained for BVDV by using a manually procedure adapted from a previously
described technique (Haines et al., 1992). Anti-BVDV (pesti) monoclonal antibody labelled with
fluorescein isothiocyanate (BIO 316, Bio-X diagnostics kit, Belgium) was used. Stained sections
were examined by fluorescent microscopy. Positive IHC staining for BVDV was green fluorescent
evidnce within the cytoplasm of keratinocytes of epidermis and hair follicles, sebaceous epithelial
cells, mononuclear cells in dermis, vascular smooth muscle cells and chondrocytes.
Results
4-1) Clinical findings: Fever (40-42 ˚C), sever anorexia, hyperpnoea and coughing, nose
mucopurulent discharge, conjunctivitis, stomatitis with erosions in the palatine, gum, dorsal and
ventral side of tongue, simple or hemorrhagic diarrhea with or without melena and progressive weight
loss and severe depression, recumbency and death were the most important signs in the affected
calves. In addition, some calves showed incoordination and severe convulsion. All of calves with
these later signs died.
4-2) Macroscopic pathology findings: Besides the lesions mentioned in clinical findings section,
single and multifocal erosions of esophagus, ruminitis with clumping of its villie, multifocal erosive
abomasitis with dark containing were observed. Enteritis in small and large bowels with zebra line
and some time melna in large intestine were obvious sings. Hyperemia of the brain and cerebellum
surface was another symptom (Figure 1A).
4-3) Laboratory examination findings:
4-3-1) Microscopic pathology: Hyperemia, widespread and severe hydropic degeneration of
mucosal layer of mouth and esophagus and edema, hyperemia of submucosal layer with infiltration
of inflammatory cells in rumen villie were remarkable.
Severe edema, hyperemia, with infiltration of inflammatory cells to submucosal layer and
widespread necrosis and erosion of mucosal layer of abomasums were seen. Severe edema, hyperemia,
with extention of inflammatory cells to submucosal layer and widespread necrosis and erosion of
mucosal layer of small and large intestine with cystic degeneration of mucosal layer were obvious
signs.Hyperemia of meninges, gliosis and mild neutrophilic lymphocytic PVC in the brain specimen
(Figure 1B-D) as well as hyperemia of cerebellum were nervous microscopic pathology signs.
Figure 1) Hyperemia of the brain surface (A), meninges (B), Hyperemia & mild neutrophilic lymphocytic
PVC (C), gliosis (D) in the brain specimen (H&E staining, 10.20×)
Abnormalities of lung specimen including hyperemia, atelectasia and emphysema, hyperplasia

of pneumocytes and severe interstitial pneumonia, were observed. Interstitial nephritis with dilatation
of tubules, squamous forming of tubular cells as a reason of hyperemia and proteinuria (nephritic
syndrome) were detected in the kidney samples.
4-3-2) ACE, RT-PCR and IHC: Results of ACE test were negative in all of 6 cases, but 4 cases
were positive in IHC (Figure 2) and all cases were positive in RT-PCR.
Figure 2) Positive IHC staining for BVDV. Green fluorescent evidence within the cytoplasm of keratinocytes
(A1, A2, B3), sebaceous epithelial cells (C5, D6), mononuclear cells of dermis (C4), chondrocytes (D7).
Discussion
According to history, clinical, macroscopic and microscopic pathology findings and severity of
the outbreak, the disease is highly resembled to BVDV infection.
It is likely that the 4 IHC positive calves were undergoing an acute BVDV infection and were
viremic at the time of testing. Detection of BVDV in skin by IHC following acute or persistent
infection has been reported to be inconsistent (Baszler et al., 1995; Brodersen, 2004; Brock et
al., 1998; Cornish et al., 2006; Fredriksen et al., 1999; Grooms and Keilen, 2002; Haines et al.,
1992; Luzzago et al., 2006; Njaa et al., 2000; Ridpath et al., 2002; Thur et al., 1996). Principally,
interpretation of IHC sections is highly objective and this problem will be worsening when these
sections are prepared badly (Ellis et al., 1995), more than 2 weeks formalin fixation (Luzzago et al.,
2006), lack of sufficient virus antigen (Njaa et al., 2000) and presence of virus-antibody complex in
the examined skin sections (Baszler et al., 1995) are the likely reason for these results.
RT-PCR can detect genome of neutralized and semi neutralized viruses, in contrast, neutralizing
antibodies can mask viruses and make negative ACE results (Brock, 2004; Brock et al.,1998; Cornish
et al.,2006; Houe et al., 2006; Saliki and DuBois ,2004; Sandvik, 2005), and this might be the reason
for different results of RT-PCR and ACE. In contrast of, viral antigen may be detectable in tissues
for an extended time after the virus has been cleared from the blood (Cornish et al., 2005; Grooms
and Keilen, 2002) and is not affected by maternal (Grooms and Keilen, 2002) or humoral antibodies
(Brodersen, 2004).
It is speculated that cold, high velocity wind and remarkable difference between night and day
temperature stress and immunosuppressant effect of BVDV, accompanied by decline of maternal
immunity might be the reason for this severe incidence. Different type of GI tract lesions from mouth
to terminal intestine is the pathogenesis effect of BVDV (Brock, 2004; Nettleton and Entrican, 1995).
Furthermore, BVDV Type 2–Induced Meningoencephalitis in a 15-month-old, female Angus Heifer,
with a 48-hour history of central nervous system engagement is reported (Blas-Machado et al., 2004)
and to the best of our knowledge, this article is the second report of neuropathy of BVDV infection,
and first outbreak of gastro-neuropathy due to this virus infection acquired postnatally.
In general, little is known about the mechanisms of neuropathy and neurovirulence of BVDV in
cattle. The most commonly reported brain lesion in calves with transplacental infection of BVDV
is cerebellar hypoplasia often associated with hydranencephaly, hydrocephaly, microencephaly and
or porencephaly. The acute neurological signs observed in these cases were consistent with the
microscopic and laboratory findings described before and the severity of the lesions indicates that
these animals died from acute meningoencephalitis associated with BVDV infection (Blas-Machado
et al., 2004).
Like the first report (Blas-Machado et al., 2004) on the basis of our findings, we propose that
the BVDV detected in these cases may represent a neurovirulent strain of the virus. Additional
studies are needed to corroborate such proposed mechanisms of BVDV type 2 neurovirulence and
neuropathogenicity in cattle. Additional studies are needed to determine genotype and biotype of
virus and confirm such neuropathogenicity mechanisms of BVDV in cattle.
Acknowledgments
With the best thanks of Dr. Parvaneh Seifoori, Miss Tybeh Ghasemi and Mr. Mohammad Mehdi Ghaffari for
their experted supports and technical procedure in the microbiology and pathobiology lab.
References
Baszler, TV; Evermann, JF; Kaylor, PS; Byington, TC and Dilbeck, PM (1995). Diagnosis of naturally occurring
bovine viral diarrhea virus infections in ruminants using monoclonal antibody-based immunohistochemistry.
Vet. Pathol. 32, PP: 609-618.
Blas-Machado, U; Saliki, JT; Duffy, JC and Caseltine SL (2004). Bovine Viral Diarrhea Virus Type 2–Induced
Meningoencephalitis in a Heifer. Vet. Pathol. 41, PP: 190-194.
Brock, KV (2004). The many faces of bovine viral diarrhea virus. Veterinary Clinics of North America: Food
Animal Practice. Bovine Viral Diarrhea Virus. 20, PP: 1-3 & 76.
Brock, KV; Grooms, DL; Ridpath, JF and Bolin, SR (1998). Changes in levels of viremia in cattle persistently
infected with bovine viral diarrhea virus. J. Vet. Diagn. Invest.10(1),PP: 22-26
Brodersen, BW (2004). Immunohistochemistry used as a screening method for persistent bovine viral diarrhea
virus infection. Veterinary Clinics of North America: Food Animal Practice. Bovine Viral Diarrhea Virus.
20, PP: 85-93.
Cornish, TE; Olphen, AL; Cavender, JL; Edwards, JM; Jaeger, PT; Vieyra, LL; Woodard, LF; Miller, DF and
O’Toole D (2005).Comparison of ear notch immunohistochemistry, ear notch antigen-capture ELISA, and
buffy coat virus isolation for detection of calves persistently infected with bovine.viral diarrhea virus. J.
Vet. Diagn . Invest. 17, PP: 110–117.
Ellis, JA; Martin, K; Norman, GR and Haines, DM (1995). Comparison of detection methods for bovine viral
diarrhea virus in bovine abortions and neonatal death. J Vet Diagn Invest. 7: 433-436.
Fredriksen, B; Press, CM; Sandvik, T; Odegaard, SA and Loken, T (1999). Detection of viral antigen in placenta
and fetus of cattle acutely infected with bovine viral diarrhea virus.Vet. Pathol.36, PP: 267-275.
Hemmatzadeh, F; Mommtaz, H; Keyvanfar, H and Bani-hasan, E (2006). Antigenic pattern of BVDV isolated
in IRAN. Indian Veterinary Journal. 82(10), PP: 1048-1050.
Grooms, DL and Keilen, ED (2002).Screening of Neonatal Calves for Persistent Infection with Bovine Viral
Diarrhea Virus by Immunohistochemistry on Skin Biopsy Samples. Clin. Diagn. Lab. Immunol. July; 9(4),
PP: 898–900.
Haines, DM; Clark, EG and Dubovi, EJ (1992). Monoclonal antibody-based immunohistochemical detection of
bovine viral diarrhea virus in formalin-fixed, paraffin-embedded tissues. Vet. Pathol.29, PP: 27-32.
Houe, H; Lindberg, A and Moennig, W (2006). Test Strategies in Bovine Viral Diarrhea Virus Control and
Eradication Campaigns in Europe. J. Vet. Diagnos. Invest. 18, PP: 427-436.
Luzzago, C; Frigerio, M; Tolari, F; Mazzei, M; Salvadori, C; Del Piero, F and Arispici M (2006). Indirect
immunohistochemistry on skin biopsy for the detection of persistently infected cattle with bovine viral
diarrhoea virus in Italian dairy herds. New Microbiology. 29, PP: 127-131.
Moakhar, KR; Akhavizadegan, MA; Hemmatzadeh, F and Amini, F (2004). Genotyping of Different Pestivirus
Isolates by RT-PCR and RLFP technique. Arch. Razi Ins. 58, PP: 1-8.
Nettleton, PF and Entrican, G (1995). Ruminant pestiviruses. Br Vet J. 151, PP: 615-642.
Njaa, BL; Clark, EG; Janzen, EJ; Ellis, JA and Haines, DM (2000). Diagnosis of persistent bovine viral
diarrhea virus infection by immunohistochemistry staining of formalin-fixed skin biopsies. J. Vet. Diagn.
Investigation. 12,PP: 393-399.
Ridpath, JF; Hietala, SK; Sorden, S and Neill, JD (2002). Evaluation of the reverse transcription-polymerase
chain reaction/probe test of serum samples and immunohistochemistry of skin sections for detection of
acute bovine viral diarrhea infections. Journal of Veterinary Diagn Investigation. 14 (4), PP: 303-307.
Sagar, MG and Ridpath, JF (2005): Bovine Viral Diarrhea Virus: Diagnosis, Management and Control.Blackwell
Science Ltd. London, UK. PP: 123-124.
Saliki, JT and DuBois, WR (2004). Laboratory diagnosis of bovine viral diarrhea virus infections. Veterinary
Clinics of North America: Food Animal Practice. Bovine Viral Diarrhea Virus. 20, PP: 69-83.
Sandvik, T (2005). Selection and use of laboratory diagnostic assays in BVD control programs. Preventive Vet.
Med. 72, 1-2, 3-16.
Thur, B; Zlinszky, K and Ehrensperger, F (1996). Immunohistochemical detection of bovine viral diarrhea virus
in skin biopsies: a reliable and fast diagnostic tool. J. Vet.med. B 43, PP: 163-166.
Vilcek, S; Herring, AJ; Nettlton, PF; Lowings, JP and Paton, DJ (1994). Pestiviruses isolated from pigs, cattle
and sheep can be allocated into at least three genogroups using polymerase chain reaction and restriction
endonuclease analysis. Arch. Virol. 136, PP: 309-323.
Comparison of conventional and digital radiography of
phalangeal bone and soft tissue in cattle
Usporedba konvencionalne i digitalne radiografije

kosti i mekih česti falangi goveda
M. Šehić1, V. Butković, D. Stanin1, B. Škrlin1, B. Radišić2, J. Kos2

1
Department of Radiology, Ultrasound Diagnostics and Physical Therapy Faculty of Veterinary Medicine,
University of Zagreb, Heinzelova 55
2
Department of Surgery, Orthopaedics and Ophthalmology, Faculty of Veterinary Medicine, University of
Zagreb, Heinzelova 55
Abstract
Conventional radiological diagnostics using imaging on an x-ray film has been in use for more than a
century. The principle of this diagnostics lies in the detection of x-ray radiation on film which is then developed
relatively slowly, manually or mechanically, in dark rooms and then stored in overcrowded archives. The
diagnostic image is obtained by using cassettes in which the x-ray films are placed. The cassettes contain
fluorescent foils which transform the incoming x-ray radiation into light radiation of a certain spectrum. As the
film and the foil are in contact, this leads to a direct exposure of the x-ray film. The exposed film is developed by
a chemical process and contains a permanent recording of the organic structure which is of diagnostic interest.
New radiological diagnostic devices, contrary to the previous ones, do not use recording on the cassette, but
have digital detectors instead. Digital detectors transform the incoming x-ray into an analogous signal of a
certain level, which is then digitalized by means of an A/D converter. In this form the signal is being sent to
and is processed in adjoining computers. An image so obtained, displayed on the monitor, directly serves the
diagnostic purposes. It can be stored in the archive, shared with other computers in a network or printed on a
special printing device. Developed countries of the world in the last several years also use mobile digital devices
in large animal practice. We demonstrated the advantages of digital radiography over the conventional one by
imaging the bovine phalanxes using both methods. Digital radiography proved significantly better in the imaging
of fine structures of soft and bone parts of bovine phalanxes. The radiograms show the fine resolutions of digital
radiography images which have a higher quality than the xeroradiogram. The picture obtained in digital form is
ready for various kinds of subsequent processing which provides us with extraordinary possibilities for a faster
and more reliable diagnostics.
Sažetak
Konvencionalna radiološka dijagnostika koristi x-zrake i film već više od jednog sstoljeća.Princip je ove
dijagnostike u prolsasku x-zraka kroz tkiva i prenosi se na film koji se nakon toga razvija manuelno ili mehanički u
tamnoj komori a nakon toga se pohranjuje u zatvorenoj arhivi rendgenskih filmova. Nova radiološka dijagnostika
koristi digitalnu detekciju koja transformira ulazne x-zrake u analogni signal koji se potom digitalizira preko
A/D konvertera.Tako dobivena slika se čuva u kompjuteriziranom obliku ili se ispiše posebnim pisačem.
Razvijene zemlje svijeta zadnjih nekoliko godina koriste mobilne digitalne radiografske aparate osobito u
dijagnostci bolesti velikih životinja.Mi smo prikazali prednosti digitalne radiografije nad konvencionalnom u
prikazu članaka prsta goveda i to koštanih struktura i mekih česti.Napominjemo da slikedobivene digitalnom
radiografijom daju mogućnost dodatnog kompjuterskog procesuiranja koji će omogućiti još bržu i kvalitetniju
dijagnostiku
Introduction
The limping of cattle, regardless of the conditions of keeping, is usually due to diseased distal
parts of extremities. The hoofs are exposed to non-hygienic conditions, are infrequently trimmed and
are often traumatized. The diseases of hoofs and other phalanxes of various etiology demand thorough
clinical and radiological examinations. The outcome of radiological diagnostics is closely related to
the technique of imaging, the choice of foils and films and preparation of hoofs for radiography.
Present-day radiology uses more and more frequently the digital systems for imaging of human
or animal bodies and these systems gradually substitute analog devices in clinical practice. Digital
technology has been in use for quite a long time in computerized tomography (CT), ultrasonography,
magnetic resonance (MRI) and nuclear medicine. Experiences gained so far are mostly based on
analog imaging. An analog image is the standard radiographic recording on an x-ray film.
Conventional diagnostic image is obtained by using a cassette in which x-ray films are inserted.
Cassettes contain fluorescent foils which convert the incoming x-ray beam into light of a certain
spectrum. As the film and the foils are in contact, the x-ray film is directly exposed. After that, the
exposed film is developed by chemical means and it provides a lasting recording of the diagnostically
interesting organic structure.
Analog images are permanent. For instance, the black-and-white x-ray image of the thorax is
an analog image because it represents a permanent configuration of the intensity of light patches as
functional positions on the radiograph. In photography images are created when the light is focused
onto a film. In radiography x-rays pass through the patient and are projected on the x-ray film.
The digital procedure of image processing was first developed in NASA’s Jet Propulsion
Laboratory in the California Institute of Technology. The technology of digital processing continued
to spread quickly and found its application in fields such as astronomy, geology, forestry, agronomy,
cartography, military science and medicine. In medicine, a particularly fertile soil for this technology
is diagnostic imaging (Huang, 1999). Digital image processing is a multidisciplinary affair including
physics, mathematics, mechanical engineering and computer science.
Digital images are numerical representations or pictures of an object. The forming of digital
images requires a digital computer. Any kind of data entering the computer must first be digitalized,
i.e. converted into numbers. An important component here is the Analog to Digital Converter – ADC
which converts a permanent signal into individual signals or digital data (Luiten, 1995). The computer
receives digital data and processes them as required. The results of such processing are always digital
and can be shown as a digital image (Seeram, 1985). The future of digital imaging promises various
applications such as 3D imaging (Huang, 1999).
Digital radiographic systems are divided according to types of detectors into computed
radiography (CR) and direct digital radiography (DDR).
Computed radiography (CR) uses cassettes just as the standard radiography, but instead of film
and foil it uses plates coated with phosphorescent material, often called simply phosphorus plates,
though this term is not quite precise. The means of working with such cassettes is very similar to
conventional radiography, formats are the same, and the digital image is obtained on common points
which substitute the dark rooms. CR can be attached to existing radiographic devices for which
reason its implementation in a hospital environment is cheaper than the DR.
Direct digital radiography (DDR) uses special flat-panel detectors. The panel is installed in the
table or fixed onto a vertical gantry. DR systems can use an indirect conversion by means of a
glittering screen and a deposit of amorphous silicon or a direct conversion by means of amorphous
selenium. When the phosphorus plate is exposed to x-rays an analog latent image is formed. By
means of digitalizer and a scanner it is then transformed by digital conversion into a digital image.
The scanner in the digitalizer reads the data from the phosphorus plate line by line until the entire
plate is displayed.

The bovine phalanxes from the slaughterhouse were first filmed by conventional radiography,
and then by computed radiography (CR) or direct digital radiography (DDR). Radiography was
made in two basic projections. Analog radiographs were scanned and digitally processed. Computed
radiography and direct digital radiography were done in university hospital centres.
Computed radiography or the CR system uses a plate over and over again to obtain the image
instead of film. This plate contains a layer of photo-stimulating phosphorus in which the image is
stored. When the plate is exposed to x-rays, the electrons within the phosphorus crystals are set in
motion and find themselves in a state of semi-stable high energy. The CR scanner scans the plate by
means of laser beams. The laser energy releases the blocked electrons, creating a visible, emitting
light. This light is stored and converted into a digital bit sequence which encodes the digital image.
Phalanxes were imaged by the FUJIFILM PROFECT CS device, and the processing was done in the
software of the same device. The elements of imaging were the same as in the imaging of a human
knee.
Direct digital radiography uses devices with in-built FD – flat detector plates 35 x 43 cm in
size. DR system was designed to improve the possibilities of examination on two levels. First, the
system enables a significantly faster course of examination and, in addition, an examination can be
immediately repeated. Secondly, within and between the examinations, these systems can enhance
the course of work by means of network distribution of diagnostic images. After the imaging, itself
lasting only a few seconds, the images are ready for viewing on a monitor, and can be always be
retrieved from computer memory. Due to the fact that they are digital, they are always identical
enabling the production of multiple identical copies.
Amorphous selenium plate uses the amorphous selenium coating, a thin-film transistor (TFT) to
receive and convert the energy of x-rays directly into digital signals without the use of a scintillator
or phosphorus. As there is no scattering and an optimal signal to noise ratio, the quality of the image
roughly corresponds to a medium-grain film.
The amorphous silicon (a Si) flat plate uses a scintillator which consists of caesium iodide
or Gadolini oxysulphide which converts incoming x-rays into visible light. This light becomes
electricity by means of distribution of sensors of amorphous silicon. Earlier developments of the
detector of amorphous silicon manifested a high level of noise which makes amorphous silicon
usable only in real time.
Results
Conventional radiography of phalangeal bones of a cow from slaughterhouse was done in
two basic projections using the Bucky grid (foils and films are from the green spectre). In sagittal
projection elements of imaging 55 kV and 22 mAs were used (Fig. 1). The same elements were
used in the profile projection (Fig. 2). The same phalangeal bones were also imaged in two basic
projections by means of the direct digital radiography (DDR). The elements of imaging were similar
to those of conventional radiography (Figs. 3 and 4).
Fig. 1. Sagittal image of a cow’s phalangeal bone obtained by conventional radiography
Fig. 2. Sagittal image of the phalanx of the same cow obtained by computed radiography
The phalangeal bones of the second cow from the slaughterhouse were imaged by conventional
and computed radiography (CR). Elements of imaging by conventional radiography were 53 kV and
22 mAs in both projections (Figs. 5 and 6). The same projections were used in computed radiography
with approximately the same elements (Figs. 7 and 8).
Fig. 3. Profile image of a cow’s phalangeal bone obtained by conventional radiography
Fig. 4. Profile image of the phalanx of the same cow by computed radiography
Fig. 5. Sagittal image of a cow’s phalangeal bone obtained by conventional radiography

Fig. 6. Sagittal image of the phalanx of the same cow obtained by direct digital radiography
Fig. 7. Profile image of a cow’s phalangeal bone obtained by conventional radiography

Fig. 8. Profile image of the phalanx of the same cow by direct digital radiography
Comment
Computed radiography is classified as a system of digital imaging because it uses a computer
in the creation of the image. X-rays pass through the patient and reach appropriate detectors which
convert photons of x-rays into electrical or analog signals. These signals are stored and digitalized
(converted into numerical forms) for further computer processing. The process of digitalization of
data and the image processing are done with appropriate computers according to the type of image
processing required.
Numerous types of digital imaging in radiology use the processes of image processing, including
digital radiography and fluoroscopy, nuclear medicine, imaging by magnetic resonance, ultrasound
and computerized tomography.
The main objective of digitalization is that the digital image can be computer-processed, which
yields numerous advantages. These are:
- the image can be made to look more satisfactory for the viewer. Certain characteristics, such as
contours and shapes can be enhanced to improve the quality of the image;
- lower quality images can be filtered to remove the unwanted “noise”. Filtering can also help to
remove unnecessary fine details in the image, known in the technique as “soft”;
- the analysis of the image is also called the scan analysis. This procedure “aims to separate the
data contained in various objects in the scan” (Marion, 1991);
- the image offers the observer the possibilities to view specific shapes, contours or structures,
disregarding the others;
- sample recognition. A computer may “see” the structure and recognize the sample;
- geometric transformation. The image may be rotated or adapted to the screen by changing the
position of pixels;
- compressing of data. Compressing of a digital image is significant for the storing and transmitting
of data.
The last generation of digital detectors of x-rays are matrix detectors of x-rays. The main feature
of matrix detectors is that they consist of a large number of sub-millimetre detectors of x-rays,
electrically connected so as to form a matrix of a certain number of rows and columns which are
individually displayed.
The advantages of matrix detectors in relation to conventional radiography consist in the
following characteristics:
- high quality of the image. Matrix detectors have a superb sensitivity to incoming x-ray beams,
much better than the standard combination of x-ray film-plus-foil. A very small pixel size and a good
modulation transfer function enable a superb sharpness of diagnostic images;
- relatively high sensitivity of matrix detectors to x-rays and the possibilities of subsequent
digital processing of the image mean that these techniques will use smaller doses of radiation than
standard examination;
- a relatively simple integration of the matrix detector module with the classical radiographic
system and image processing in real time speeds up the diagnostic procedures many times over and
gives a simultaneous possibility of later digital image processing.
Due to the ability of matrix detectors to process static radiographic images, currently are being
developed matrix detectors which will serve to digitalize dynamic images (diascopy, angio procedures
and the like). Existing matrix detectors are capable of digitalizing 25 images per second. The quality
of the image remains equally good.
Digital images offer numerous advantages in the form of processing and handling the images.
In spite of numerous advantages, it is necessary to weigh numerous factors when deciding to switch
from conventional to digital radiography. This paper has given an overview of various imaging of
the phalangeal bone of cows by means of conventional and digital radiography. The images obtained
by the above methods were compared. Digital images have a higher quality in terms of greater
resolution, while the histogram was similar in both techniques. From the spectrum of digital imaging
techniques, CR and DDR systems were used.
Computed radiography and direct digital radiography have specific fields of application by using
various types of flat detectors. Present-day technology offers advantages of digital radiography over
the film-based ones.
SEROLOGICAL SURVEY OF MAEDI-VISNA IN SHEEP IN LUGO
(NORTH-WEST SPAIN)
SEROLOGICAL SURVEY OF MAEDI-VISNA IN SHEEP IN LUGO

(NORTH-WEST SPAIN)
Fernández, G.*; Lago, N.*; Pato, J.*;López, C.M.*; Díez-Baños, P.*; Cienfuegos, S*;
Viña, M.**
*Dpto. Patología Animal. Facultad de Veterinaria Universidad de Santiago de Compostela.

27002. Lugo. Spain. E mail: gonferna@lugo.usc.es
**ACIVO. Regional Association of Ovine Flocks. Galicia.Spain.
INTRODUCTION
Small ruminant lentiviruses (SRLV) are non-oncogenic and heterogeneous group of infectious
agents belong to the lentivirus subgroup and family of Retroviridae, causing multisystem diseases
in sheep and goats: maedi-visna (MV) and caprine arthritis encephalitis (CAE). Maedi-Visna virus
(MVV) causes chronic inflammatory disease in the lungs, joints, mammary glands and central
nervous system in sheep. Clinical disease caused by SRLV infection develops slowly and about 30%
of infected animals develop clinical disease.
The general consensus was that economic losses due to SRLV infection are significant.
MMV and the disease have been recognized in most major sheep-producing countries. No
country has data about MV seroprevalence in the entire state and only in France there is a national
accreditation scheme of MV-free flocks.
In Spain, MV was first described in 1984. The extent of the disease seroprevalence in the entire
country is not known, as Lugo district. The mayority of realized research in others districts of Spain
are about dairy sheep with an more intensive handling. These research show high percentages of
infection, so that in some districts it is difficult to find an uninfected flock. In some districs of Spain
there is an accreditation scheme of MV-free flocks.
Lugo is in northwest of Spain. In Lugo the ovine production are based in meat sheep and with
semiintensive handing. All important breeders have joined the regional association ACIVO and
participated in this study.
Transmission in a flock takes place predominantly between dam and lambs via infected
mononuclear cells in colostrum and milk. Horizontal transmission does occur, especially among
housed sheep.

All the sheep >6 month of age 6490 animals altogether, from 38 surveillance flocks from Lugo
district were sampled in the 2007 survey.
The sera was frozen to -20ºC until its processing.
All the sera were examined for MVantibodies with the Institut Pourquier maedi-visna/CAEV
ELISA test kit (Institut Pourquier, France) according to the manufacturer’s instructions. The true
individual prevalence was calculated with sensibility (Se) of 98,0 and specificity of 97,4 (Tolf et al.,
2007)
RESULTS AND CONCLUSIONS

The positive results of the serological research are shown in Table 1. The role of colostrum
and milk and horizontal repsiratory in SRLV transmission depend of several factors particularly the
sheep production system (Radostits et al., 2000). The production system of the flocks of this study
is semi-intensive, and the animals are several hours in the pasture every day and are not housed for
long periods in close confinement as in the dairy sheep. In the Spanish Autonomous Community
of the Basque Country (ACBC), infection is present in over 95% of dairy sheep flocks and 54% of
sheep with more than one year old were seropositive (González, 1989) and Autonomus Community
of Aragon with an 100% de flocks with seropositive sheeps (Rubio et al, 2005). The results of this
study show a flock prevalence lower than results found in other region of Spain.
Table 1. Prevalence of animals and flocks
Apparent individual prevalence (%) 24,8

True individual prevalence (%) (Se= 98,0; Sp=97,4) 28,7
Apparent flock prevalence (%) 81,6%
Apparent seroprevalences in herds of different sizes are shown in Table 2. These results indicate
that the prevalence of seropositive animals increases significantly with increasing flock size. In other
studies made in other regions of Spain, the average size of the flocks was high than in this study
(265 animals in Aragon). If consider only the breeders with more than 100 animals, flocks prevalece
is near to other studies made in Spain. It is logical to think than herds with less than 100 animals
have introduced less animals of another breeders and it has permitted that the disease didn´t come
so easily.
Table 2. Prevalence in herds of different sizes
Apparent Apparente
Nº flocks with seroprevalence seroprevalence
Size (>6 seropositive Apparent flock of total flocks of positive
month of age Nº flocks animals prevalence (%) (%) flocks (%)
1-100 13 7 53,8 3,9 6,4
101-200 15 14 93,3 14,6 15,4
>200 10 9 90,0 35,0 37,1
If only considerer the prevalence of positive breeders, we can see that it increase clearly with the
size of the flock (table 2). So the size of the flock relates with the possibility of presenting the disease
and with the seropositive animals percentage. To the program of control will be very important keep
the sanitary status of negative flocks, thinking as a source of replacement animals to other breeders in
spite of his smaller size. Also including in the serological studies small flocks with higher probability
of being free of MV can be interesting and they can be used as a source of replacement animals to
bigger flocks.
Flocks with apparent prevalence < 10%with different sizes are listed in table 3. The number of
flocks with prevalence < 10% decreases in the >200 animals group.
Table 3. Flocks with apparent prevalence < 10%
Size (>6 month of age) Nº flocks with apparent % flocks with apparent
prevalence < 10% prevalence < 10%
1-100 6 46,1
101-200 7 46,7
>200 2 20,0
In view of the specificity of the test, there are difficulties to classify breeders with very low
seroprevalence as free or not free. This fact make necessary to establish other criterions to know
the sanitary status of these breeders, like the origin of positive animals, results of later serological
controls (as much seropositive animals as hole flock), etc.
The flocks seroprevalence in Galicia (North of Spain) do necessary to establish a control program
of MV disease.
It is therefore important to clarify the actual routes utilised by the virus so that attempts to control
or eradicate SRLV infections could be made more efficient because it may allow developing specific
control strategies for particular sheep production systems.
REFERENCES
Gonzalez, L., Badiola, J.J., Gelabert, J.L., 1984. Neumonia progresiva (Maedi) en el ganado ovino del Pais
Vasco. Medic. Vet. 1,
277–284.
Lujan, L., Badiola, J.J., García Marín, J.F., Moreno, B., Vargas, M.A., Fernández de Luco, D., Pérez, V. 1993.
Seroprevalence of maedi-visna infection in sheep in the north-east of Spain. Prev. Vet. Med. 15, 181-190.
Ruz Ruvio, J.M., Picazo Purroy, R.M.(2005). Control del Medi-Visna: evolución de la seroprevalencia en
rebaños de raza Ojinegra (período 2002-2005). Jornadas SEOC.S. Spain. 322-324.
Toft, N., Akerstedt, J., Tharaldsen, J., Hopp, O. 2006. Evaluation of three serological test for diagnosis of Maedi-
Visna virus investion using latent class analysis. Vet. Microbiol. 120, 77-86
__________________________________________________________________________
This study was supported by the Research Project PGIDIT06RAG26101PR from Xunta de Galicia
Posters
Posteri
SPINAL CORD TISSUE DETECTION IN COMMINUTED BEEF IN A
PRIVATE ABATTOIR IN SOUTHERN TURKEY
Detekcija tkiva leđne moždine u usitnjenoj govedini iz

privatne mesnice u južnoj Turskoj
M. Kale a*, Ö. Kurşunb, A. S. Akcan Kalec, F. Pehlivanoğlud, S. Hasırcıoğlua, S. Yavrue
Department of Virology a, Food Hygiene and Technology b, Microbiology d, Faculty of Veterinary Medecine,
University of Mehmet Akif Ersoy, 15100, Burdur, TURKEY. c Ministry of Agriculture, State Control Labora-
tory, 15100, Burdur, TURKEY. Department of Virology e, Faculty of Veterinary Medecine, University of Selcuk,
42075, Konya, TURKEY. *Corresponding author. drmkalex@yahoo.com
Abstract
In this study, the distribution of Central Nervous System (CNS) tissue contamination on the joints of beef
during cutting of 88 carcass halves into edible meat parts in a private slaughterhouse was investigated. The high
level contamination (>0.4) was detected at the highest ratio on the neck (75.0%), antre cote steak (62.5%) and
thick flank (50.0%) areas. The moderate level contamination (< 0.4) was detected at the highest ratio on the
contre-filet (87.5%), sirloin steak (50.0%) and silver side (50.0%) areas. The low level contamination (< 0.3)
was detected at the highest ratio on the rump (62.5%) and contre-nuar (75.0%) areas. Both the moderate and
the low level contamination were found at the similar and highest ratio on the topside (37.5%) areas. The high
level contamination (>0.4) was found at the highest ratio on the knives (62.5%), cutting tables (62.5%), moving
cutting tables (100.0%) and aprons (100.0%). In conclusion, by this study the first time in Turkey, the level
of contamination of spinal cord tissue as CNS tissue on the joints of beef during cutting the carcasses into the
parts was shown. Additionally, the high level contamination risk was found on the knives used for cutting the
carcasses, cutting tables, moving cutting tables and aprons.
Keywords: SRM; spinal cord; joints of beef; edible meat; ELISA
Sažetak:
U ovom istraživanju ispitana je rasprostranjenost tkiva središnjeg živčanog sustava kroz zagađenost
zglobova toplih polutki 88 goveda, koja su rasječena u konzumno meso u privatnoj klaonici. Visok stupanj
prisutnosti živčanog tkiva (>0.4 uočen je na vratu (75,0% antre cote odresku ( 62,5% i području flama ( 50,0%.
Umjereno prisustvo tkiva SŽS-a (<0.4 je uočeno kod contre-fileta ( 87.5%, i mjestu rasjeka ( 50,0% . nizak
stupanj prisutnosti SŽS tkivom uočen je na sapima ( 62,5% i kontranuar području (75,0% . I umjerena i niska
kontaminacija utvrđena su u najvećem omjeru na površinskim područjima ( 37,5% toplih polutki. Visok stupanj
kontaminacije ( >0,4 je uočen najviše na noževima (62.5% , stolovima za rasijecanje ( 62,5%, pokretnim
radnim površinama (100%. Ovim istraživanjem smo po prvi put u Turskoj pokazali kontaminaciju tkivom
leđne moždine (SŽS) u zglobovima prilikom rasijecanja goveda u konzumnu govedinu. Dodatno je uočen visok
stupanj rizičnosti kontaminacije na noževima, radnim plohama, pokretnim radbim plohama i pregačama.
Ključne riječi:Leđna moždina, goveđe meso, ELISA
INTRODUCTION
Contamination of beef with CNS tissue including spinal cord has been a concern from the food
safety standpoint because of potential human health implications in relation to bovine spongiform
encephalopathy (BSE). Introducing CNS tissue (i.e., brain and spinal cord materials) to the edible
portion of the carcass is suspected of increasing the risk of human infection with new variant
Creutzfeldt-Jakob disease (vCJD). In an effort to prevent CNS tissue from being introduced into the
human food chain, the European Commission (EC) in 1997 endorsed a proposal to regulate the use
of specified risk materials (SRMs) such as brain and spinal cord presenting a BSE risk, and decided
that specified risk material (SRM) must not to be used in food effective October 1, 2000 (Hajmeer
et al., 2006).
The conventional slaughter practices at present primarily include the following critical processes:
captive bolt stunning, removal of head from the carcass and carcass splitting (Troeger, 2004). Current
slaughter methods may allow brain or spinal cord tissue to contaminate the carcass and enter the
food chain (Helps et al., 2002). Studies on the spreading of CNS tissue have been conducted by
many researchers (Helps et al., 2002; Hajmeer et al., 2003). These previous studies focused on that
the slaughter practice could disseminate spinal cord material over the carcass, the operator, and the
environment during the splitting process. But, current practices in the butchery of cattle have led to
concerns regarding the possible dispersion of CNS material to edible meat parts. Therefore, in the
present study, distribution of contamination of spinal cord tissue as CNS tissue on the joints of beef
during cutting the carcasses into the parts, the knives used for cutting the carcasses, cutting tables,
moving cutting tables and aprons were shown.

Sample collection and preparation for analysis The joints of beef during cutting of eighty
eight carcass halves into edible meat parts were used from a commercial beef abattoir in Burdur,
Southern Turkey. Samples were collected from edible meat parts of cattle carcass halves slaughtered
older than 30 months during twelve visits between August 2007 and January 2008. The samples were
collected from nine edible meat parts (neck, antre cote steak, contre-filet, sirloin steak, rump, silver
side, topside, contre-nuar and thick flank) on the carcass halves. The sample collection was performed
from knives, cutting tables, moving cutting tables and aprons after each cutting the carcasses into
the edible parts. Edible meat samples were prepared for this analysis by dipping a Dacron® fiber-
tipped sterile swab (Fisher Scientific, Houston, TX, USA) five times into the sample while rotating
the swab. The swab, containing approximately 50 mg of meat, was removed, and squeezed in a test
tube containing 1 ml sample dilution buffer containing sodium dodecyl sulfate (SDS). Also, the swap
samples were collected from knives, cutting tables, moving cutting tables and aprons, with the pre-
moisten the swabs (Fisher Scientific, Houston, TX, USA) into diluted 1 ml sample dilution buffer
containing SDS from 10 x 10 cm a representative areas, and before ELISA, the swabs were squeezed
thoroughly in test tubes.
Enzyme immunoassay for the quantitative analysis of risk material (CNS) in raw meat and
on contaminated surfaces A 100 μl sample was transferred from each test tube to an assay well. A
sufficient number of antibody-coated wells was inserted into the micro-well holder to accommodate
the number of samples and all standards tested. Enzyme conjugate (50 μl) was added to each well
containing sample, and the plate was incubated for 10 min. at room temperature. After incubation, the
liquid was poured out to empty the wells, and the micro-well holder tapped upside down thoroughly
against absorbent paper, so that the liquid added earlier was completely removed from the wells. The
wells were washed with 250 μl washing buffer and emptied as described earlier. A 100 μl volume
of substrate/chromogen was added to each well and mixed thoroughly; the plate was incubated for
5 min. at room temperature in the dark. The reaction was stopped by adding 100 μl stop solution to
each well. Optical density was determined by ELISA reader (MR-96A, Hamburg, Germany) with
a filter at 450 nm. Results were interpreted as indicated in the Ridascreen®risk material 10/5 kit
information booklet.
RESULTS AND DISCUSSION In this study, for the Ridascreen risk material 10/5, the samples
were accepted positive if the absorbance was equal to or more than the absorbance of standard 0.1%,
and we determined the cutoff value as 0.100. The low level contamination (< 0.3) and the high level
contamination (>0.4) were detected at the ratio on the neck as 25.0% and 75.0%, on the antre cote
steak as 12.5% and 62.5%, on the sirloin steak as 25.0% and 25.0%, on the rump as 62.5% and
25.0%, on the silver side as 12.5% and 37.5%, on the topside as 37.5% and 25.0%, on the thick
flank as 25.0% and 50.0%, respectively. Even though the low level contamination was not detected
in contre-filet, the high level contamination was found at the ratio as 12.5%. Although the high level
contamination was not detected in contre-nuar, the low level contamination was found at the ratio as
75.0%. The moderate level contamination (< 0.4) were detected at the ratio on the antre cote steak as
25.0%, on the contre-filet as 87.5%, on the sirloin steak as 50.0%, on the rump as 12.5%, on the silver
side as 50.0%, on the topside as 37.5%, on the contre-nuar as 25.0%, on the thick flank as 25.0%. But,
the moderate level contamination was not detected on the neck.
Troeger (2004) stated that further measures for minimizing the risk during head boning; meat
should not be cut from the parts with potentially high contamination risk (neck meat). In a research
project, ten different ground beef patties were obtained per plant, which were then sampled raw
and analyzed for Glial Fibrillary Acidic Protein (GFAP). As the initial data for this project was
being collected, it was clear that the major problem with contamination with CNS tissue occured
during the Advanced Meat Recovery (AMR) processing of beef neck bones. Well over 50% of the
samples of AMR tissue from beef neck bones had detectable to high levels (>5 ng/mg) of CNS
tissue as determined by the GFAP/ELISA method. In the study also, low level contamination in antre
cote steak (mean GFAP 0.140 ng/mg tissue), high level contamination in contre-filet (mean GFAP
0.495 ng/mg tissue), low level contamination in sirloin steak (mean GFAP 0.227 ng/mg tissue), low,
moderate and high level contaminations in rump, silver side, topside and contre-nuar parts (mean
GFAP 0.264, 0.306 and 0.478 ng/mg tissue as respectively), and high level contamination in thick
flank parts (mean GFAP 1.464 ng/mg tissue) were detected (National Cattlemen’s Beef Association,
2002). The results of our study in neck, rump, silver side, topside, contre-nuar and thick flank parts
are similar to the results of the study mentioned above.
Steaks produced from bone-in loin subprimals where the vertebral column bone is first
cut out may inherently leave residual SRMs on steak surfaces when undercut. Lopes et al. (2005)
evaluated current and alternative cutting methods that could be used to minimize the transfer of
SRM tissue during preparation of steaks from bone-in short loins. They indicated that surface areas
along the vertebral column cut line had detectable (0.100 and 0.215% / 100 cm2) and, thus, higher
SRM contamination compared to resulting steak surfaces or the cutting blade. These results imply
that steaks may be cut from bone-in subprimals prior to removal of vertebral column bone without
affecting transfer of SRM tissue at concentrations <0.100% / 100 cm2 to resulting steaks. In our
study, CNS contamination in contre-filet part of short loin was moderate (<0.4; 87.5%) level and high
level (>0.4; 12.5%). Also, in sirloin steak part of short loin, CNS distribution was low, moderate and
high level, and the highest ratio was detected for moderate level (<0.4; 50.0%). But, another study
had assessed contamination in the boning hall on the carcass. This indicated a significant reduction
in contamination in the boning hall and a much lower level (personal communication H. Anil). 1%
of the contamination on the carcass will be transferred to meat during boning and packing operations
(Comer and Huntly, 2003). Similary, Daly et al. (2002) reported that the primal cuts, forerib and
striploin receive the highest level of cord material during splitting. The level of contamination of
these primals is greatly reduced after de-boning.
Dorsal Root Ganglia (DRG) can be removed with meat during boning of beef carcasses. Reduced
risk equates to lower yield and more SRM. CNS tissue adheres to the split vertebral face after splitting
carcasses and contaminates boneless meat. To avoid carcass self contamination by CNS tissue,
alternatives to medial plane splitting must be implemented. Cross contamination of beef sides by
CNS tissue may occur if contact is made with other sides (e.g. during transfer to the chiller) (personal
communication H. Anil). Coore et al. (2004) have attempted to more accurately define the position of
the DRG by dissection of fresh carcasses. The dissection work has revealed a level of variation between
specimens with respect to the location of the DRG. Following sheet boning, all DRG were found to
remain with the vertebral column in contrast to that of traditional butchery in which several DRG
were found to have been removed with the meat. Pikse (2005) estimated the risk from these ganglia,
their way during slaughter and cutting procedures were observed. For this aim, thirty seven cutting
plants in Northern Germany were visited. For reasons of reproducibility, the trunk was separated into
five parts during observation (T1, T2-T6, T7-T13, L1-L6, S1-S5). Whereas the rear thoracic ganglia
(T7- T13) and sacral ganglia (S1-S5) mostly remained in natural connection with the column bones
and were littered as SRM, the ganglion stellatum (T1), the front thoracic ganglia (T2-T6) and also
the lumbal ganglia (L1-L6) went into the food chain in different percentages. For the other thoracic
ganglia (T1-T13) and the sacral ganglia (S1-S5) standard operation prescriptions for the removal of
the musculature that is associated with the spine and the removal of the transverse processes of the
vertebraes are needed. The lumbal ganglia (L1-L6) are hidden between the connective and fat tissues
of the filet chain. They could not be taken away in practise. In the current study, SRM ratios were
similar to SRM ratios detected in antre cote steak (moderate level) and rump (low level) parts.
Limited trials suggest that the DRG would not be removed from the bone during normal deboning
(Comer, 2003). In Turkish abattoirs the spinal cord is removed manually and the cavity is cleaned
using a steam spray device. The half carcasses are then cut into pieces for transport to incineration
plant. The carcasses may be cut into primals and sent to work stations where operators cut and trim
for specific cuts (“boneless” or “bone-in” meat). Removal of the spinal cord is performed manually
with a knife in Turkish abattoirs. When the spinal cord is removed, there is a risk that the remains of
the cord may be left on the vertebral column and the muscle of the back. In addittion, the vertebral
column is removed and cut through each joint into individual vertebrae with the aim of improving the
yield. This procedure creates a greater risk of contamination of SRM from the exposed DRG.
The low level contaminations (< 0.3) were detected at the ratio on the knives as 37.5% and on
the cutting tables as 12.5%. But, it was not determined on the moving cutting tables and aprons. In
addition, the moderate level contamination was detected only on the cutting tables as 25.0%. The high
level contamination (>0.4) were detected at same the ratio on the knives and cutting tables as 62.5%.
However, it was detected at same the ratio on the moving cutting tables and aprons as 100.0%.
If the spinal cord is not removed, it remains in certain cuts of beef and is hence available for
potential human consumption (e.g., T-bone steak). In addition, spinal cord left in the carcass can
contaminate the boning table. For older animals, such as bulls or cows, all vertebrae are likely
to be processed using AMR. If the facility does not process the spinal column using AMR, other
technology, such as vibration or hand held knives (e.g., Whizzard knives), are used to recover the
remaining meat attached to the bones (Cohen et al., 2001). During carcass processing and boning, the
amount of nervous tissue dropped onto the abattoir and boning room floors is estimated to be around
10% or 20 g from each animal (The Bureau of Rural Sciences, 2001).
The danger therefore exists of both cross-contamination due to spinal cord tissue that may adhere
to the knife, and direct contamination of the exposed areas of meat at the neck due to release of
cerebrospinal fluid and spinal cord tissue particles (Ramantanis, 2006). The best practice for control
of cross contamination during the slaughter process is a “two-knife” technique. For all knife cuts
with SRM contact, separate knives have to be used, with the best practice being to use a knife of a
different colour (e.g. red for SRM contact) (FAO, 2007). Prendergast et al. (2003) investigated the
concenrations of GFAP on operative’s aprons/knives, and meat being processed in the boning hall,
boning hall equipment and surfaces before, during, and at the end of boning operations. Significantly
higher concentrations of GFAP were recovered from the aprons than were recovered on knives. In the
current study similar results were found. In this study, although different knife is used in each halves
of carcasses, low and high level CNS contaminations were detected. If the same knife is used for
cutting other parts of the carcass there is a risk of cross contamination (Troeger, 2004). If we consider
the use of single knife for each carcass cutting and deboning in Turkey abattoirs, there is stil a risk for
contamination of edible meats for human consumption.
Troeger et al. (2002) investigated both 60 split carcasses which cut after removal of the whole
vertebral column and 60 split carcasses which cut without carcass splitting. In this study, they found no
CNS protein (GFAP) on all of the carcasses, protecting gloves and cutting tables in both applications.
But, in the abattoirs where we conducted this study in, since this kind of application is not performed,
high level SRM contamination was present in cutting tables, moving cutting tables and aprons. For
this reason, the regular presence of CNS tissue needs to be considered in relation to hazard analysis
and critical control point plans in Turkish abattoirs (e.g. we observed that the workers transport to
carcasses to cutting/deboning hall by embracing carcasses. Thus, we think that contamination of
aprons with SRM can occurs at this point).
We think that the potential contamination risk determined in this study may be caused by
dispersal of spinal cord material during the splitting of beef carcasses, during separation of spinal
cord and DRG from vertebral column by a knife, during transfer of carcasses to chilling rooms
after washing or carcass halves to deboning/cutting halls by embracing carcasses. Also, another
way of contamination with very low probability is dissemination of brain tissue during the stunning
procedure.
REFERENCES
1. ANIL, M.H., LOVE, S., HELPS, C.R., HARBOUR, D.A. (2002). Potential for carcass contamination with
brain tissue following stunning and slaughter in cattle and sheep. Food Control, 13, 431-436.
2. COHEN, J.T., DUGGAR, K., GRAY, G.M., KREINDEL, S., ABDELRAHMAN, H., HABTEMARIAM, T.,
ORYANG, D., TAMERU, B. (2001). Evaluation of the potential for bovine spongiform encephalopathy
in the United States. Research Project, Harvard Center for Risk Analysis Harvard School of Public Health
and Center for Computational Epidemiology College of Veterinary Medicine Tuskegee University. USA,
pp. 1-101.
3. COMER, P. (2003). Assessing exposure to BSE infectivity: The impact of the over thirty month rule in the
UK. CSL/JIFSAN Joint Symposium Food Safety and Nutrition: Risk Analysis. June 11-13, University of
Maryland, Maryland.
4. COMER, P.J., HUNTLY, P.J. (2003). TSE Risk Assessments-A decision support tool. Statistical Methods in
Medical Research, 12, 279-291.
5. COORE, R.R., ANIL, M.H., FISHER, A.V. (2004). Carcass contamination, dorsal root ganglia and common
butchery practice. Conference on Farm to Fork Food Safety: A Call for Common Sense Abstract Book. May
12th- 14th. Athens, Greece, pp.12.
6. DALY, D.J., PRENDERGAST, D.M., SHERIDAN, J.J., BLAIR, I.S., MCDOWELL, D.A. (2002). Use of a
marker organism to model the spread of central nervous system tissue in cattle and the abattoir environment
during commercial stunning and carcasses dressing. Applied and Environment Microbiology, 68, 791-
798.
7. FAO (2007). Management of transmissible spongiform encephalopathies in meat production. Course Manual
Project Capacity Building for Surveillance and Prevention of BSE and Other Zoonotic Diseases. Rome,
pp. 39-68.
8. HAJMEER, M., CLIVER, D.O., PROVOST, R. (2003). Spinal cord tissue detection in comminuted beef:
comparison of two immunologicalmethods. Meat Science, 65, 757–763.
9. HAJMEER, M., CLIVER, D.O., MARSDEN, J.L. (2006). Central nervous system tissue detection in meat
from advanced meat recovery systems. Meat Science, 72, 656-659.
10. HELPS, C.R., HINDELL, P., HILLMAN, T.J., FISHER, A.V., ANIL, M.H., KNIGHT, A.C., WHYTE, R.T.,
O’NIELL, D.H., KNOWLES, T.G., HARBOUR, D.A. (2002). Contamination of beef carcasses by spinal
cord tissue during splitting. Food Control, 13, 417-423.
11. LOPES, M., STOPFORTH, J., SUCRE, K., MIKSCH, R., GIDDENS, E., SAMADPOUR, M. (2005).
Alternative cutting methods to minimize transfer of specified risk materials during steak preparation from
bone-in short loins. IAFP Congress Abstract Book, August 15, Baltimore, Maryland, pp. 161.
12. NATIONAL CATTLEMEN’S BEEF ASSOCIATION (2002). Presence of central nervous system (CNS)
tissue in advanced meat recovery (AMR) products. http://www.beefusa.org/uDocs/amrreport.pdf (accessed
on August 15, 2005).
13. PISKE, K. (2005). BSE and cutting: The sympathetic trunk ganglia and their fate in northern German cutting
plants. PhD Thesis. Fachbereich Veterinärmedizin, Freie Universität Berlin, pp. 1-164.
14. PRENDERGAST, D.M., SHERIDAN, J.J., DALY, D.J., MCDOWELL, D.A., BLAIR, I.S. (2003).
Dissemination of central nervous system tissue from the brain and spinal cord of cattle after captive bolt
stunning and carcass splitting. Meat Science, 65, 1202-1209.
15. RAMANTANIS, S.B. (2006). Alternative cattle slaughtering technologies and/or measures reducing
the dissemination of central nervous system tissue during head handling, harvesting of cheek meat and
tongue and carcass splitting - A review. Veterinarski Arhiv, 76, 19-36.
16. THE BUREAU OF RURAL SCIENCES (2001). Risk assessment of abattoir effluent should BSE be found
in cattle in Australia. The NHMRC Special Expert Committee on TSEs, Commonwealth Department of
Agriculture, Fisheries and Forestry-Australia. June, Kingston, pp. 1-24.
17. TROEGER, K., SCHURR, B., WACHMANN, G., KOLB, R., BEHRSCHMIDT, M. (2002). Vorbeugende
maßnahmen gegen eine mögliche BSE-Gefährdung. Fleischwirtsch, 82, 129-135.
18. TROEGER, K. (2004). Overview of current and alternative slaughter practices. Biotechnology, Agronomy,
Society and Environment, 8, 275-281.
INVESTIGATION OF BOVINE VIRAL DIARRHEA VIRUS (BVDV)
INFECTION IN RELATION TO FERTILITY IN CATTLE
Istraživanje utjecaja BVD ( Bovine Viral Diarrhea) na

plodnost u goveda
Mehmet KALE1,†, Ayhan ATA2, Sibel YAVRU3, Orhan YAPKIÇ3, Oya BULUT3, Uğur
BÜYÜKYÖRÜK4, Mehmet Şükrü GÜLAY5, Oğuzhan AVCI3
Department of Virology 1,†, Theriogenology and Artificial Insemination2, Physiology5, Faculty of Veterinary
Medecine, Mehmet Akif Ersoy University, 15100, Burdur, TURKEY. 3 Department of Virology, Faculty of
Veterinary Medecine, Selçuk University, 42075, Konya, TURKEY.4 Holstein Breeding Associations, 15100,
Burdur, TURKEY. † Corresponding author: drmkalex@yahoo.com This Project was supported by TUBITAK
foundation (TOVAG-106O366)
Abstract
In this study, the blood serum and leukocyte samples were collected from 150 Holstein cows and 150
Holstein heifers with clinically healthy appearance. Antibodies (Ab) against BVDV were detected in 126 cow
serum samples and 102 heifer serum samples. BVD viral antigens (Ag) were detected in 32 cow leukocyte
samples and 11 heifer leukocyte samples. Viral genome was detected in 42 of the cow leukocyte samples and
24 of heifer leukocyte samples which were passaged on cell cultures.The differences of average conception
rates (CR) between BVDV (Ag-/Ab+ = seropositive) seropositive heifers and BVDV (Ag-/Ab- = seronegative)
seronegative heifers, and average age (day) between BVDV seropositive pregnant cows and BVDV seronegative
cows were found statistically important (P<0.05).No significant differences were detected in terms of average
service period (SP), age (day), CR and first insemination time (FSA) between the animals (both cows and
heifers) with persistently infected (PI) and non infected (P>0.05). In this group no pregnant cows and heifers
were present. Also, no significant differences were detected between non pregnant PI BVDV (Ag+/Ab-) cows
and heifers, and BVDV negative cows and heifers in terms of SP, age and FSA. CR of Ag+/Ab+ heifers for
BVDV was significantly different from the noninfected heifers (P<0.01). Average SP of Ag+/Ab+ pregnant
cows for BVDV was significantly different from the noninfected cows (P<0.05). PCR (+) cows and heifers for
BVDV (both pregnant and nonpregnant animals) were not significantly different from the noninfected animal
groups in terms of SP, age, CR and FSA (P>0.05). In conclusion, only fertility of BVDV (Ag-/Ab+) and BVDV
(Ag+/Ab+) heifers were affected from the infection. None of the cows and heifers with PI BVDV (Ag+/Ab-)
and BVDV PCR (+) test results had any effect on fertility parameters.
Keywords: Dairy cattle, bovine viral diarrhea virus, fertility, ELISA, PCR
Sažetak
U ovom radu analizirani su uzorci seruma i leukocita koji su uzeti od 150 krava i 150 zdravih bikova
pasmine Holstein.Protutijela protiv BVDV nađena u 126 uzoraka seruma krava i 102 uzorka seruma junica.
Virusni antigen nađen je u 32 uzorka leukocita krava i 11 uzoraka leukocita kod junica. Genom virusa nađen je
u 42 uzorka leukocita krava i u 24 uzorka kod bikova. Razlike od prosječnog stupnja koncepcije između BVDV
( Ag_/Ab+=seropozitivni) seropozitivnih junica i BVDV (Ag-/Ab-=seronegativni) seronegativnih bikova, te
između seropozitivnih bređih krava i BVDV seronegativnih krava statistički su značajne (p<0.05).Nije utvrđena
statistički značajna razlika u trajanju prosječnog servis perioda, stupnja koncepcije i vremena prve inseminacije
između životinja ( krava i junica) sa prisutnom infekcijom te neinficiranih životinja ( P>0.05). Stupanj
koncepcije Ag+/Ab+ junica za BVDV bio je statistički značajan u odnosu na neinficirane junice (P<0.01).
Prosječni servis period kod Ag+/Ab+ bređih krava bio je statistički značajan u odnosu na neinficirane krave
(P<0.05). PCR metodom za BVDV nisu uočene značajne razlike između inficiranih i neinficiranih životinja.
U ovoj skupini nisu bile ispitivane gravidne krave niti junice. Također nisu uočene značajne razlike između
negravidnih PI BVDV (Ag+/Ab-) krava i junica, te BVDV negativnih krava i junica u odnosu na SP, životnu do
bi FIT. Stupanj gravidnosti Ag+/Ab+ junica u odnosu na BVDV su se signifikantno razlikovale od neinficiranih
junica. Prosječni servis period Ag+/Ab+ gravidnih krava za BVDV se značajno razlikovao od neinficiranih
krava (p>0.05). PCR(+) krave i junice se po BVDV ( gravidne i negravidne životinje) se nisu signifikantno
razlikovale od neinficiranih skupina što se tiče SP. Zaključujemo da je jedino plodnost BVDV (Ag-/Ab+) I
BVDV (Ag+/Ab+) junica bila ugrožena infekcijom. Niti jedna od krava i junica s PI BVDV (Ag+/Ab-) i BVDV
PCR(+) rezultatima pretzrage nije pokazala promjene u bilo kojim pokazateljima plodnosti.
Ključne riječi:Mliječna goveda, virus bovine virusne diareje, plodnost, ELISA, PCR
INTRODUCTION
In general, cows that have recovered from an acute BVD infection develop a strong and usually
long-lasting immunity (MOERMAN et al., 1993). Infection with BVDV yields different outcomes
depending on the stage of pregnancy (ROEDER et al., 1986) such as fertilization problems, immune-
tolerant or PI calves, different degrees of malformations, fetal deaths, aborts or mummifications and
stillbirths (FRAY et al., 2000). BVDV infections negatively affect the calf health and reproductive
performance of the herd (MOERMAN et al., 1994). There are number of reports about effect of
BVDV infection on reproductive parameters such as pregnancy rates and calving (MCGOWAN
et al. 1993, RUFENACHT et al. 2001, VALLE et al. 2001). The economic significance of BVD
infections is enormous due to culling infected or PI cows (TAYLOR and Rodwell, 2001). It has been
concluded that BVDV has negative affect on fertility of cows (FRAY et al., 2000). Previous field
studies reported upto 44% decline in pregnancy rates (VIRAKUL et al., 1988, LARSSON et al.,
1994). However, there are also opposing studies (MEYLING and Mikel-Jensen, 1988).
In the current study 300 blood and leukocyte samples from multiparous cows (n=150) and heifers
(n=150) were collected in Burdur region (Turkey). BVDV-ELISA (Ab) test was used to detect BVDV
antibody in blood samples, whereas BVDV-ELISA (Ag) test was used for BVDV antigen detection.
BVDV RT-PCR test was also used for viral genome detection. Afterwards, fertility parameters
were evaluated between seropositive and seronegative, viral antigen (+) and viral antigen (-), and
viral genome (+) and viral genome (-) groups. Moreover, BVDV prevalence in the area and relation
among the tests were studied.
MATERIALS and METHODS

Animals: Three hundred Holstein-Freisian cows (n=150; 2 to 10 year old) and heifers (n=150; 13 to 24 months
old) kept at 120 different dairy farms in the province of Burdur, Turkey, and brought to The Holstein Breeding
Association of Burdur for AI was assigned to the trial. Body condition scores (BCS) were taken prior to artificial
insemination (1 to 5; FERGUSON et al., 1994) and animals with BCS lower than 2.5 were not included in
the study. Blood and leukocyte samples were collected from all animals. All dairy cows and heifers were examined
by experienced veterinarian vaginally per rectum, and were healthy and free of anatomical abnormalities of the
reproductive tract. No animals in the trial were vaccinated against BVDV prior to sampling period.
Estrus detection, artificial insemination (AI), and pregnancy checks: AI dates were recorded
by the inseminator and pregnancy diagnosis was performed by rectal palpation 6-8 weeks after AI. The records of
AI, pregnancy diagnosis and calving dates were obtained from the Holstein Breeding Associations data base. The
AI coincided with middle of estrus, as evidenced by CMD, high myometrial tone and contractility. In addition to
secondary signs of estrus, the stage of estrus cycle was confirmed by the presence of fluctuant Graafian Follicles and
the absence of corpus luteum by rectal palpation for all animals prior to AI. The AI was performed for the first time on
all unmated heifers and was the first time after postpartum in all cows. AI was performed using frozen-thawed semen
from a single bull containing at least ten million of motile spermatozoa (Alsole Benchmark Birbo, Consorzio
Semenzo-Italy via Masaccio, 11- 42010 Mancasale/Italy) with proven fertility. Semen was placed at the
corpus uteri for all cows and heifers. Breeding day (day 0) was accepted as equal to the day of onset of strong estrus
signs. Pregnancy was diagnosed by rectal palpation of heifers and cows at 8 weeks after AI. When AI
led to positive pregnancy check, it was defined as successful. If an animal declared non-pregnant by
rectal palpation or returned to heat, the AI was coded as unsuccessful.
Antibody detections in serum samples: Presence of antibodies BVDV in serum samples were
detected by BVD/MD/BD P80-ELISA kits (Institut Pourquier, France).
Antigen detection in leukocyte samples: ELISA kit (Bio-X Diagnostics, Belgium) was used to
detect Antigens against BVDV in leukocyte.
Preparation of cell culture: Madine Darby Bovine Kidney (MDBK) cell cultures were prepared
in Konya Selcuk University, Department of Virology. BVDV negative fetal calf serum (FCS; 10%;
Gibco, Paisley-Scotland, UK) was used for cell production. Prior to use, MDBK cell cultures were
checked for presence of BVDV antigens by BVD/BD Antigen Capture ELISA kits (Laboratory
Service International, France).
Preparation of leukocyte samples in Polymerase Chain Reaction (PCR):
Leukocytes were passaged one times in MDBK cell cultures prior to use in Reverse Transcriptase-
Polimerase Chain Reaction (RT-PCR). NucleoSpin® RNA Virus Kits (Macherey-Nagel, Germany)
were used for Viral RNA isolation from leukocyte samples. For detection of BVDV, an
amplification kit (Genekam Biotechnology AG, Germany) was used; cDNA and One-Step
PCR steps were carried by this kit. The end products from PCR were evaluated by electrophoresis
according to the procedures of Genekam Biotechnology AG®. Presence of bands after electrophoresis
was examined by white ultraviolet Tranilluminator (UVP Inc., Upland CA, USA).
Statistical Analysis of Data: Sensitivity, specificity and correlations among the tests used in this trial were
calculated with MINITAB by Pearson correlation. The differences between BVDV (Ag- /Ab+) / BVDV (Ag-
/Ab-), BVDV (Ag+ /Ab-) / BVDV (Ag- /Ab-), BVDV (Ag+ /Ab+) / BVDV (Ag- /Ab-) and BVDV (PCR+)
/ BVDV (PCR -) in average days open (OD), and age for cows and FSA for heifers were compared by Proc Mixed
procedure of SAS . CR for cows and heifers were compared by FREQ and LOGISTIC procedure of SAS.
RESULTS
Determination of Pregnancy rates and test results in cows and heifers: In pregnant cows
and heifers the highest seropositivity and lowest seropositivity-antigen rates were in ELISA (Ag-
/Ab+) and ELISA (Ag+/Ab+), respectively. On the other hand, the highest seropositivity and lowest
seropositivity-antigen rates for open cows and heifers were determined by ELISA (Ag-/Ab+) and
ELISA (Ag+/Ab-), respectively. No correlation was found between ELISA (Ab) and ELISA (Ag) or
ELISA (Ab) and PCR results. However, there was a positive correlation between ELISA (Ag) and
PCR (Correlation coefficient: + 0.770).
Reproductive parameters in BVDV (Ag- /Ab+) / BVDV (Ag- /Ab-) cows and heifers: In the
current study, average ages at the time of AI between BVDV (Ag- /Ab+) and BVDV (Ag- /Ab-) cows
differed significantly (P<0.01). Morover, pregnant BVDV (Ag- /Ab+) cows were older than pregnant
BVDV (Ag- /Ab-) cows (P<0.05). However, no differences for OD or CR were detected between
BVDV (Ag- /Ab+) and BVDV (Ag- /Ab-) cows. No difference for OD detected between pregnant or
open BVDV (Ag- /Ab+) and pregnant or open BVDV (Ag- /Ab-) cows. Pregnancy rates of BVDV
(Ag- /Ab+) heifers were higher than BVDV (Ag- /Ab-) heifers (P<0.05). However, FSA was similar
in two groups. In addition, FSA of pregnant or open BVDV (Ag- /Ab+) heifers was similar to FSA
of pregnant or open BVDV (Ag- /Ab-) heifers.
No difference in any of the reproductive parameters evaluated was different between BVDV
(Ag+ /Ab-) and BVDV (Ag- /Ab-) cows and heifers. In the current study, all BVDV (Ag+ /Ab-)
cows and heifers were open. In open BVDV (Ag+ /Ab-) cows and heifers, reproductive parameters
studied did not differ from BVDV (Ag- /Ab) cows and heifers.
Reproductive parameters for BVDV (Ag+ /Ab+) / BVDV (Ag- /Ab-) cows and heifers: No
difference in average OD, age (days) and CR of BVDV (Ag+ /Ab+) and BVDV (Ag- /Ab-) cows
were detected. In addition, difference in FSA for BVDV (Ag+ /Ab+) and BVDV (Ag- /Ab-) heifers
were not significant. However, CR of BVDV (Ag+ /Ab+) and BVDV (Ag- /Ab-) heifers were found
statistically important (P<0.01). There was a significant difference in OD of pregnant BVDV (Ag+ /Ab+)
and BVDV (Ag- /Ab-) cows (P<0.05). However, the difference in age was not significant between the
pregnant groups. In addition, no difference was detected between nonpregnant (Ag+ /Ab+) and BVDV
(Ag- /Ab-) cows in any of the parameters studied. No statistical difference was seen any of the reproductive
parameters between neither pregnant nor nonpregnant BVDV (Ag+ /Ab+) and BVDV (Ag- /Ab-) heifers.
Reproductive parameters for BVDV (PCR+) / BVDV (PCR-) cows and heifers: Average OD, age
(day) and CR between BVDV (PCR+) and BVDV (PCR-) cows were not significant. In addition,
no differences for FSA and CR in heifers were detected between BVDV (PCR+) and BVDV (PCR-)
groups. None of the reproductive parameters for pregnant and nonpregnant cows and heifers studied differed
significantly.
DISCUSSION
The prevalence of BVDV infected herds in individual countries most often ranges from 50%
to 90% in the world (HOUE, 1995). The prevalence of herds in Turkey has ranged from 14.3% to
100% (ÇABALAR and Karaoğlu, 1999). In the current study, prevalence of BVDV infection was
76% (228/300), and the prevalence was higher among the multiparous cows (84%). The infection
appears highly prevalent (60-85%) in mature dairy cows (HOUE, 1999). NIZA-RIBEIRO et al.
(2005) reported that non-vaccinated herds have prevalence of 23%. The prevalence was higher in
multiparous cows (42%) than heifers (14%). Another study in Sweden (n=711) the prevalence of
BVDV infection was 41% (BJÖRKMAN et al., 2000), and 35.3% of pregnant heifers had BVDV
(Ag-/Ab+).
There are numbers of studies reporting different prevalence rates for BVDV. Different rates
in different studies could be due to diverse management practices in different farms and countries
(VEGA et al., 1997, HOUE, 1999). In the current study, the prevalence of BVDV [ELISA (Ab), ELISA
(Ag) and PCR] was high. This could be due to different factors: 1) the number of animals housed
per square meter is high in Burdur, 2) cows, heifers and calves are housed in the same area without
separation, 3) new animals are introduced to the herds without screening for BVDV infection, 4)
herds do not monitored for BVDV infection regularly, 5) there are no control over animal movement
inside and/or outside the herds, and 6) no eradication program is present for PI animals.
Similar to the previous studies, prevalence of BVDV was higher in multiparous cows in the
current study. MOCKELIUNIENE et al. (2004) reported that rate of BVDV infection increases with
age because older cows have more chance to face with the infection. Similarly, MOCKELI et al.
(2003) compared the age of the animals and Open days (day), BVDV infection rates. In their study
439 cows divided to 8 different groups by age. The least amount of seropositive animals were in age
1. The cows that were 3 and 4 years old had higher prevalence rates. The highest groups were age
5 and older. They concluded that there was a positive correlation with age and prevalence rates for
BVDV.
It has been reported that BVDV infection affects fertility and therefore pregnancy rates (GRAHN
et al., 1984). BVDV infection also causes early aborts (LARSSON et al., 1994). In preplanned
experiments, animals infected with BVDV 9 days prior to their estrus had 50% lower CR than
controls. In addition, embrio quality and quantity was decreased significantly (KAFI et al., 1997).
MCGOWAN et al. (1993) infected Bos indicus cattle during the artificial insemination by using
BVDV contaminated sperms, and the CR of infected animals were lower than immune positive
ones. This could be due to the embryo-toxic effect of BVDV or direct effect on follicular function
and/or ovaries (ovaritis) (GROOMS et al., 1998). On the other hand, RUFENACHT et al. (2001)
showed that CR in BVDV seropositive and seronegative dairy cows did not differ significantly.
They also concluded that BVDV infection did not cause early embryonic deaths in first 45 days of
pregnancy. However, aborts were apparent from 46 to 120 days of pregnancy. In the current study CR
of seropositive and seronegative heifers were higher that that of seropositive and seronegative cows.
In addition CR were different in of seropositive and seronegative heifers (p<0.05). MCGOWAN et
al. (1993) also reported that BVDV seropositive and seronegative heifers had higher CR compared to
multiparous cows in the same herd. This is not surprising since there is an inverse relation between
age and CR (OLA REFSDAL, 2007).
In the current study CR between BVDV (Ag+/Ab+) and infection free cows were different
(p<0.05). In dairy cows, OD increases due to lower CR (MCDOUGALL, 2006). SWASDIPAN et al.
(2004) reported that OD of BVDV infected cows was 60 day longer than healthy cows. Moreover,
treatment methods used against fertility could also have negative effect on OD length (ROCHE et al.,
1998). The current study, on the other hand, did not detect any difference in FSA between infected
and healthy heifers. Similarly, VALLE et al. (2001) showed that BVDV infection had no effect on
OD in cows or FSA in heifers. In addition, BVDV had no affect on calving intervals. No difference
in FSA, service intervals, and average service for conception was detected between healthy and
BVDV seropositive heifers.
The current study concluded that presence of BVDV (Ag-/Ab+) and BVDV (Ag+/Ab+)
affected fertility only in heifers. Moreover no effect on fertility was detected for PI BVDV (Ag+/
Ab-) and PCR BVDV (+) cows and heifers. Previously, preplanned controlled studies have been
conducted to determine the effects of BVDV infection on fertility. Moreover, limited knowledge is
also available on naturally occurring BVDV infection in herds and its effect on fertility. Thus, it is
hard to give any conclusion about BVDV and fertility. Our current study suggests further studies
should be performed on specially BVDV seropositive and BVDV (Ag+/Ab+) cows and heifers in
different herd management practices. These studies should also include the animals showing clinical
symptoms of BVDV. We also think that studies should also distinguish the difference in different
BVDV serotypes.
REFERENCES
1. BJÖRKMAN, C., Alenius, S., Emanuelsson, U., Uggla, A., Neospora caninum and Bovine Virus Diarrhoea
Virus Infections in Swedish Dairy Cows in Relation to Abortion, The Veterinary Journal, 159, 201-6,
(2000).
2. ÇABALAR, M., Karaoğlu, T., Sığırlarda Bovine Viral Diarrhea (BVD) Virus Enfeksiyonuna Karşı Antikor
Varlığının Araştırılmasında Nötralizasyon Immunoperoksidaz (NPLA) ve Serum Nötralizasyon (SN)
Testlerinin Karşılaştırılması, Ankara Üniversitesi Veteriner Fakültesi Dergisi, 46, 249-55, (1999).
3. FERGUSON, J.D., Galligan, D.T., Thomsen, N., Principal Descriptors of Body Condition Score in Holstein
Cows, Journal of Dairy Science, 77, 2695-703, (1994).
4. FRAY MD, Paton DJ, Alenius S, The Effects of Bovine Viral Diarrhoea Virus on Cattle Reproduction in
Relation to Disease Control, Animal Reproduction Science, 60, 615-27, (2000).
5. GRAHN, T.C., Fahning, M.L., Zemjanis, R., Nature of Early Reproductive Failure Caused by Bovine Viral
Diarrhea Virus, Journal of the American Veterinary Medical Association, 185, 429-32, (1984).
6. GROOMS, D., Brock, K., Pate, J., Day, M., Changes in Ovarian Follicles Following Acute Infection with
Bovine Viral Diarrhea Virus, Theriogenology, 49, 595-605, (1998).
7. HOUE, H., Epidemiology of Bovine Viral Diarrhea Virus, Veterinary Clinics of North America: Food Animal
Practice, 11, 521-47, (1995).
8. HOUE, H., Epidemiological Features and Economical Importance of Bovine Viral Diarrhoea Virus (BVDV)
Infections, Veterinary Microbiology, 64, 89-107, (1999).
9. KAFI, M., McGowan, M., Kirkland, P., Jillella, D., The Effect of Bovine Pestivirus Infection on the
Superovulatory Response of Friesian Heifers, Theriogenology, 48, 985-96, (1997).
10. LARSSON, B., Niskanen, R., Alenius, S., Natural Infection with Bovine Viral Diarrhea Virus in a Dairy
Herd: A Spectrum of Symptoms Including Early Reproductive Failure and Retained Placenta, Animal
Reproduction Science, 36, 37-48, (1994).
11. MCDOUGALL, S., Reproduction Performance and Management of Dairy Cattle, The Journal of Reproduction
and Development, 52, 185-94, (2006).
12. MCGOWAN, M.R., Kirkland, P.D., Rodwell, B.J., Kerr, D.R., Carroll, C.L., A Field Investigations of the
Effects of Bovine Viral Diarrhoea Virus-Infection Around the Time of Insemination on the Reproductive
Performance of Cattle, Theriogenology, 39, 443-9, (1993).
13. MEYLING, A., Mikel-Jensen, A., Transmission of Bovine Viral Diarrhoea Virus (BVDV) by Artifical
İnsemination with Semen from a Persistently-Infected Bull. Veterinary Microbiology, 17, 97-105, (1988).
14. MOCKELI, R., Salomskas, A., Mockeli, V., 2003, Epidemiological Studies of BVDV and Herpes
Virus Infections in AI Centers in Lithuania, Farm Animal Reproduction: Reducing Infectious Diseases
Symposium, Jelgava-Latvia, (2003) pp: 32-4.
15. MOCKELIUNIENE, V., Salomskas, A., Mockeliunas, R., Petkevicius, S., Prevalence and Epidemiological
Features Of Bovine Viral Diarrhoea Virus Infection in Lithuania, Veterinary Microbiology, 99, 51–7,
(2004).
16. MOERMAN, A., Straver, P.J., De Jong, M.C., Quak, J., Baanvinger, T., Van Oirschot, J.T. A Long Term
Epidemiological Study of Bovine Viral Diarrhoea Infections in a Large Herd of Dairy Cattle, Veterinary
Record, 132, 622-6, (1993).
17. MOERMAN, A., Straver, P.J., De Jong, M.C., Quak, J., Baanvinger, T., Van Oirschot, J.T., Clinical
Consequences of a Bovine Virus Diarrhoea Virus Infection in a Dairy Herd: A Longitudinal Study,
Veterinary Quarterly, 16, 115-9, (1994).
18. NIZA-RIBEIRO, J., Pereira, A., Souza, J., Madeira, H., Barbosa, A., Afonso, C., Estimated BVDV-
Prevalence, Contact and Vaccine Use in Dairy Herds in Northern Portugal, Preventive Veterinary Medicine,
72, 81-5, (2005).
19. OLA REFSDAL, A., Reproductive Performance of Norwegian Cattle from 1985 to 2005: Trends and
Seasonality, Acta Veterinaria Scandinavica, 49, 1-7, (2007).
20. ROCHE, J.F., Austin, E., Ryan, M., O’Rourke, M., Mihm, M., Diskin, M., Hormonal Regulation of the
Oestrous Cycle of Cattle, Reproduction in Domestic Animals, 33, 227-31, (1998).
21. ROEDER, P.L., Jeffrey, M., Cranwell, M.P., Pestivirus Fetopathogenicity in Cattle: Changing Sequelae with
Fetal Maturation, Veterinary Record, 118, 44-8, (1986).
22. RUFENACHT, J., Schaller, P., Audige, L., Knutti, B., Küpfer, U., The Effect of Infection with Bovine Viral
Diarrhea Virus on the Fertility of Swiss Dairy Cattle, Theriogenology, 56, 199-210, (2001).
23. SWASDIPAN, S., McGowan, M.R., Bock, R., Estimating the Economic Impact of Bovine Viral Diarrhoea
Virus (BVDV) Infection During Pregnancy in Commercial Dairy Cattle, Revista Portuguesa de Ciéncias
Veterinarias, 127, 41, (2004).
24. TAYLOR, L., Rodwell, B., Outbreak of Foetal Infection with Bovine Pestivirus in a Central Queensland
Beef Herd, Australian Veterinary Journal, 79, 682-5, (2001).
25. VALLE, P.S., Martin, S.W., Skjerve, E., Larssen, R.B., Age at First Calving and Calving Interval in Bovine
Viral Diarrhoea Virus (BVDV) Sero-Converted Dairy Herds-A Longitudinal Study, Preventive Veterinary
Medicine, 51, 17-36, (2001).
26. VEGA, S., Bayon, M.C., Jiminez, T., Asensio, A., Mirat, F., Cid, D., Fuente, R., Prevalence of Bovine Viral
Diarrhoea Virus in the Cattle Population of Communidad de Madrid (Spain), The Third ESVV Symposium
on Pestivirus Infections, Lelystad-Netherlands, (1997) pp: 116-9.
27. VIRAKUL, P., Fahning, M.L., Joo, H.S., Zemjanis, R., Fertility of Cows Challenged with a Cytopathic
Bovine Viral Diarrhea Virus during an Outbreak of Spontaneous Infection with a Non-Cytopathic Strain,
Theriogenology, 29, 441-9, (1988).
DETECTION OF SPINAL CORD TISSUES AS BOVINE SPONGIFORM
ENCEPHALOPATHY SPECIFIED RISK MATERIAL (BSE-SRM) IN BEEF
CARCASSES DURING SPLITTING IN TURKEY
OTKRIVANJE TKIVA RIZIČNOG ZA PRIJENOS BSE PRILIKOM

ODVAJANJA GOVEĐIH POLOVICA U TURSKOJ
M. KALE1,*, O. KURSUN2, A. S. AKCAN KALE3, F. PEHLIVANOGLU4, A. GUNER5,

R. BASKAYA6, Y. DOGRUER5, C. OZTURK6
Department of Virology 1, †, Food Hygiene and Technology 2, Microbiology 4, Faculty of Veterinary Medecine,
Mehmet Akif Ersoy University, 15100, Burdur, TURKEY. 3 Ministry of Agriculture, State Control Laboratory,
15100, Burdur, TURKEY. 5Department of Food Hygiene and Technology, Faculty of Veterinary Medecine,
Selçuk University, 42075, Konya, TURKEY. 6School of Military, Food Control Laboratory, Selimiye, 34668,
Istanbul, TURKEY. †Corresponding author: drmkalex@yahoo.com
ABSTRACT
We have used an enzyme-linked immunosorbant assay (ELISA) to detect central nervous system (CNS)-
specific glial fibrillary acidic protein (GFAP) to show the presence of CNS material on the medial surface of each
half (left and right) of washed carcasses after splitting with a reciprocating saw. The high level contamination (≥
0.4) was detected at the highest ratio on the brisket + plate area surface of carcasses (33.3%). The moderate level
contamination (> 0.2) was detected at the highest ratio on the brisket + plate and loin areas surface of carcasses
(11.1%). The low level contamination (≥ 0.1) was detected at the highest ratio on the flank and hip areas surface
of carcasses (100.0%). The similar level contamination risk was found on both the right and left half of 72 beef
carcasses. Although no contamination was detected on the reciprocating saw, the low level contamination (≥
0.1) was detected on the floor where the splitting of the carcasses was performed. Even though the low level
contamination (≥ 0.1) was detected on all areas of the carcasses, even after washing, the moderate and high level
contamination were detected only on the chuck + rib, brisket + plate and loin areas.
SAŽETAK
U radu je primjenjena ELISA metoda u pretraživanju GFAP (glialni fibrilarni acidni proteini) u središnjem
živčanom sustavu kako bi se dokazalo da nakon odvajanja polovica goveda, još uvijek ima rezidua živčanog tkiva
na obje isprane tehnološki odvojene polovice. najveća kontaminacija bila je na plečkama, nešto manja na trupu
a najmanja na butinama polovica (33,3%, prema 11,1% i ispod 0,1%). u radu je pretraženo 72 goveđe polovice
pri čemu je ustanovljeno da su jednako kontaminirane i lijeve i desne. na strojevima za odvajanje polovica
nakon pranja nije bilo kontaminacije, dok je na podu prostorije u kojima se odvajaju polovice kontaminacija
bila neznatna.
INTRODUCTION
Bovine spongiform encephalopathy has been diagnosed first in Great Britain in 1986 (DEFRA
2004). The BSE agent has been shown to cause variant Creutzfeldt–Jakob Disease (vCJD) in humans
(Bruce et al. 1997). The infectious agent, most likely the pathological isoform of the prion protein
(PrPsc) (Collins et al. 2004) is mainly located in the CNS of infected animals (Dormont 2002). As a
consequence, the presence of CNS tissue in beef and beef products is banned in many countries, such
as USA, Canada, the countries of the European Commission, and Switzerland (Dormont 2002).
The most critical process stage, in terms of edible meat contamination with SRM, is the current
common practice of the longitudinal splitting of the carcass (Ramantanis 2006). Many researchers
(Anil et al. 2002; Helps et al. 2002; Prendergast et al. 2003; Lim et al. 2007) studied the contamination
of beef carcasses by spinal cord tissue during splitting. They demonstrated that the slaughter practice
could disseminate spinal cord material over the carcass, the operator, and the environment during
the splitting process. The conventional slaughter practices at present in Turkey primarily include the
following processes: removal of head from the carcass and carcass splitting. Studies on the spreading
of CNS tissue have been conducted by only two researchers on meat and meat products in Turkey
(Yesilbag and Kalkan 2005; Kale et al. 2007). But there has been no study conducted in Turkey on
the contamination of beef carcasses by spinal cord tissue during splitting in the abattoirs. This study,
therefore, was conducted to determine the level of contamination of beef carcass surfaces with CNS
tissue slaughtered with conventional method in the abattoirs in Turkey.

Sample Collection and Preparation A total of seventy-two beef carcasses were used from
two commercial beef abattoirs in Burdur, Southern Turkey. Samples were collected from cattle
carcasses slaughtered older than 30 months during six visits between March 2007 and August 2007.
All carcasses were splitted in approximately 45 min after slaughter with a reciprocating saw (built-in
washing function) [EFA 44 splitting saw, Maulbronn, Germany], with two sides of each carcass being
spray washed with water. Afterwards spray washing, samples were collected using a Dacron® fiber-
tipped sterile swab (Fisher Scientific, Houston, TX, USA), placed into a 2 ml test tube containing 1
ml of 0.5% SDS sample dilution buffer (Ridascreen, R-Biopharm, Darmstadt, Germany) and mixed.
The aliquoted samples were stored at 4 °C for 2 days. 48 h later the samples were brought to room
temperature and mixed shortly before the ELISA. Samples were collected from five defined areas
(chuck + rib was sagittal section of dorsal spines and centra of thoracic vertebrae, brisket + plate
was ventral section of costae and internal of thoracic cavity, loin was centra of lumbar vertebrae,
flank was ventral section of internal abdominal cavity, hip) on the medial surface of each half of the
split carcass, yielding 5 samples per carcass side. After each splitting, the reciprocating saw and floor
were washed and then 72 swab samples from the reciprocating saw and 72 floor swab samples (17
m2) were taken. All workroom floors were constructed of waterproof concrete.
ELISA for Raw Meat Samples A commercially available ELISA kit (Ridascreen risk material
10/5, R-biofarm GmbH), which detects GFAP as marker, was used. At the first step, 50 μl sample
extract or standard was left to separate wells. Four standards (0, 0.1, 0.2 and 0.4%) were used as
controls. After adding 50 μl of conjugate to the each well, the test plates were incubated at room
temperature for 10 min. Three-times washing and tapping were followed by the addition of 100 μl
of substrate/ chromogen solution. After second incubation at room temperature for 5 min in the dark,
100 μl of stop solution was added to each well and the ODs were measured at 450 nm.

For the Ridascreen risk material 10/5, the samples were accepted positive if the absorbance was
equal to or more than the absorbance of standard 0.1%, and we determined the cutoff value as 0.100.
The similar level contamination risk was found on both the right and left half of 72 beef carcasses.
The low level contamination (≥ 0.1) was detected at the highest ratio on the flank and hip areas
surface of carcasses (100%). The low level contamination (≥ 0.1) was detected at the lowest ratio on
the brisket + plate area surface of carcasses (55.5%). The moderate level contamination (> 0.2) was
detected at the highest ratio on the brisket + plate and loin areas surface of carcasses (11.1%). The
moderate level contamination (> 0.2) was not detected on the flank and hip areas surface of carcasses
(11.1%). The high level contamination (≥ 0.4) was detected at the highest ratio on the brisket + plate
area surface of carcasses (33.3%). The high level contamination (≥ 0.4) was not detected on the flank
and hip areas surface of carcasses.
Two proteins which are specific to the CNS have been identified. One of them is GFAP, a major
constituent of nonneural cells, and this makes up 10% of total spinal cord protein (Eng 1985). Daly et
al. (2002) investigated spread of spinal cord material during beef slaughter in three Irish commercial
beef abattoirs. In the study, 4 areas were sampled after splitting and washing of carcasses. The results
indicated that there was dispersal of GFAP onto meat as a result of splitting of the spinal column
during beef carcass dressing. In general, the highest concentrations of GFAP on carcasses were found
at sites brisket + plate, chuck + rib and loin along the vertebrae, after washing. Similarly in other
study, Lim et al. (2007) determined the higher level of contamination occured on the interior surface
of a total of sixty beef carcasses along the vertebral area. In their study, it was indicated that parts
chuck + rib, brisket + plate and loin of carcass were the most highly contaminated parts with specific
risk material. Also in our study, the high level contamination (≥ 0.4) was detected at highest ratio on
the brisket + plate area surface of carcasses (33.3%) and the moderate level contamination (> 0.2) was
detected at the highest ratio on the brisket + plate and loin areas surface of carcasses (11.1%). Some
researchers (Prendergast et al. 2003; Helps et al. 2002), also observed greatest CNS contamination
on areas chuck + rib and loin. But they determined less contamination on brisket + plate, flank and
hip areas. Wenther (2004) recommended that bones and SRM must be removed from beef cuts prior
to fabrication into steaks and roasts, from cattle 30 months of age and older. The most critical point
in terms of contamination of the meat surface with SRM is the currently common practise of sawing
the spine vertically in the middle with hand-guided belt-type saws. During carcass splitting, areas
closest to the vertebrae had the greatest risk of contamination by spinal cord material from the action
of the saw (Troeger 2004). The major source of CNS contamination on the carcass is from splitting
the spinal column. Most of the CNS material is spread on the medial cut surface of the carcass in the
vicinity of the vertebral column (Daly et al. 2002).
Baeuerle (2005) in his study for the evaluation of CNS contamination collected 1500 swab
samples from the inner left side of 375 carcasses. His results showed that of the four carcass regions
sampled, the sacral area represented the region with the lowest degree of contamination. Also, in
our study, both moderate and high level contamination was not detected on the hip area surface of
carcasses. The spinal cord is usually cut, on occasions along its length, spreading cord tissue along
the whole cut surface of the split carcass. This particularly affects the internal neck musculature
(Schwaegele et al. 2002). Schwaegele et al. (2002) found CNS protein (GFAP) positive in 82% of
internal surface of neck muscules of 107 half carcasses, and 70% of them had a high contamination
ratio. Low level contamination risk in sacral region may be due to the splitting of the carcasses start
from this region.
The percentage of carcasses with the low level contamination (≥ 0.1) was higher than the
percentage of the moderate and high level contaminated carcasses and this result proved that the
carcasses in the abattoirs are contaminated with CNS. This reveals that washing carcasses after
splitting by saw can not prevent the contamination with CNS. Studies conducted by Helps et al. (2002)
have shown the presence of CNS material on carcasses after splitting with a conventional band saw.
This contamination was still present after the carcass had been washed or steam-vacuum cleaned.
They noticed that in some cases washing served only to spread the material on the carcass, thereby
contaminating previously uncontaminated areas. On the other hand, Daly et al. (2002) reported that
the highest level of spinal cord protein was found along the spinal cord tract and again washing
was not an efficient cleaning method. The average number of cases of spinal cord tissue fragments
adhering to the carcass was assumed five cattle or 20%. There is a 20% chance that spinal cord tissue
fragments have not been completely removed, although washing the carcass is believed to reduce
the possibility of any fragments remaining to 2% or less (The Food Safety Commission/The Prion
Expert Committee 2005). Knight (2002) reported that typically 25-50 mg of CNS material was found
on each of the medial carcass surfaces, particularly along the cut vertebral surface with less in the
body cavity. A total of 100mg of CNS tissue was present on the cut surfaces of each carcass following
splitting and washing (Comer and Huntley 2003). Based on data from experiments that measured the
amount of spinal cord associated protein deposited on the carcass during splitting (Harbour 2001), the
base case assumes that approximately 0.001% (2.5 mg) of the spinal cord contaminates edible meat.
It was also reported that considerable variation was found in carcass contamination levels between
abattoirs, both in the same country and between countries (Anil et al. 1999; Anil et al. 2002).
Cross contamination risk exists mostly through utensils, knives, saws and sucking devices at
spinal cord removal. In most abattoirs a band saw is used to divide carcases into sides. Band saws
have a fine blade and teeth and produce very little sawdust. The saws are generally fitted with water
sprays that wash dust down the carcass. The alternative to the band saw is the reciprocating saw,
used in smaller abattoirs. This has a wider blade and larger teeth than the band saw. It cuts a wider
path through the backbone and is more likely to damage the spinal cord because of the wider cut
(Comer and Huntley 2003). The blade is sprayed with water which will run down the carcass into the
abdominal and thoracic cavity, and onto the neck and floor, with the risk of spreading SRM (sawdust
from the vertebral column and spinal cord). There is also a risk of the spinal cord remaining in on
half of the carcass carcase due to uneven splitting of the vertebral column (Food Standards Australia
New Zealand 2002). Daly et al. (2002) collected the swab samples from the saw used at carcass
splitting. The results indicated that there was dispersal of GFAP onto carcass splitting saw as a result
of splitting of the spinal column during beef carcass dressing. In their study were determined GFAP
onto carcass splitting saw at mean value 28 ng/mg. Helps et al. (2004) reported that under controlled
conditions in an experimental abattoir, between 23 and 135 g of tissue accumulated in the saw after
splitting five to eight carcasses. Many researchers also confirmed that the carcass-splitting saw poses
a particular risk in terms of cross-contamination of carcasses, equipment, surfaces and operatives
(Helps et al. 2002; Prendergast et al. 2003). But in our study, no contamination was detected on the
reciprocating saw which was washed after each splitting of 72 carcasses. This may be due to the
fact that reciprocating saw was fitted with water spray (to decrease the splashing worked minimal
level) and after splitting the spinal cord was removed from reciprocating saw manually by scratching
out with a thumb knife and rewashed with hot water (85°C). But it is not ignored that, the BSE
agent is resistant to routine methods of disinfection. As a result, chemical disinfection of containers,
vehicles, work surfaces, floors etc. exposed to contamination by SRM using standard disinfectants
is not practicable. Although caustic agents are partially effective and used in certain situations (such
as the decontamination of rendering plants), thorough cleaning by dilution with large volumes of hot
water and detergent is recommended for most circumstances (Schuett-Abraham 2002). Additionally,
to prevent the cross contaminations between carcasses during splitting or washing the carcasses were
kept 10 meter apart from each other.
Specific Risk Material, along with brain and spinal cord tissue being released during the handling
and boning of head and carcass splitting, will be dispersed in the blood during exsanguination, onto
the floors and walls, equipment, work surfaces and meat surfaces and onto the personnel in the
abattoir. Over the course of the day the contamination will accumulate, especially on personnel, with
some having higher levels of exposure than others. If the operatives in abattoirs are to be safeguarded,
the regular presence of CNS tissue needs to be considered in relation to the abattoir’s hazard analysis
and critical control point plans (Prendergast et al. 2003; ABAS 2001). During carcass processing
and deboning, the amount of nervous tissue dropped onto the abattoir and deboning room floors is
estimated to be around 10% or 20 g from each animal. It is also estimated that 30% of Australian
abattoirs sweep the floor before the washdown, and that in these abattoirs only 10% of the dropped
material remains on the floor or 2 g of infective tissue. In the worst case scenario 20 g of infectious
tissue will end up in the effluent with an average of 14.6 g and a minimum of 2 g (BRS 2001). In
total 72 floor swab samples which were collected after each splitting of 72 carcasses, the low level
contamination (≥ 0.1) was detected (100%). In the abattoirs the floor was being cleaned with hot
water (approximately at 60°C). The swab samples from the floor were collected after running hot
water was cut.
In this study, the low level contamination with spinal cord tissues as BSE-SRM was found in
most of 72 carcasses. However, the low level contamination was found on the floor where carcass
splitting was performed on. But, no contamination was detected on reciprocating saw. Thus, the
use of new techniques, removal of spinal cord, extraction off the vertebral column without splitting
and boning out the unsplit (unquartered carcase), were advised to prevent the mechanical damage
of spinal cord during splitting of the vertebral column and the contamination of meat products and
environments with spinal cord tissues as BSE-SRM. Likewise, with the recent North American cases
of BSE contaminated cattle, the demand for control technologies that efficiently remove SRMs from
bovine carcasses is on the rise. Research engineers at Food Science Australia (FSA), the nonprofit
joint venture of Australian Commonwealth Scientific and Industrial Research Organisation (CSIRO)
and the Australian Food Industry Science Centre (AFISC) have developed a control system using
ultrasonic feedback that automatically separates a carcass into beef sides using a standard meat
industry split saw and a robot. Following the completion of preliminary testing, the system is now
undergoing production trials at an Australian processing facility (LaBudde 2004).
In conclusion, the carcasses in the abattoirs in Turkey are contaminated at low level with BSE-
SRM and this may constitute a potential threat to public health.
REFERENCES
ABAS 2001. Spezielle maßnahmen zum schutz der beschäftigen vor infectionen durch BSE-Erreger.
Bundesgesundheitsbl-Gesundheitsforsch-Gesundheitsschutz. 44, 410-412.
ANIL, M.H., LOVE, S., WILLIAMS, S., SHAND, A., MCKINSTRY, J.L., HELPS, C.R., WATERMAN-
PEARSON, A., SEGHATCHIAN, J. and HARBOUR, D.A. 1999. Potential contamination of beef carcasses
with brain tissue at slaughter. Veterinary Record, 145, 460-462.
ANIL, M.H., LOVE, S., HELPS, C.R. and HARBOUR, D.A. 2002. Potential for carcass contamination with
brain tissue following stunning and slaughter in cattle and sheep. Food Control, 13, 431-436.
BAEUERLE, B. 2005. Contamination of beef carcasses with central nervous tissue during splitting. PhD.
Thesis Dissertation, pp. 1-114, München University, Germany.
BRS 2001. Risk assessment of abattoir effluent should BSE be found in cattle in Australia. http://www.affa.gov.
au/output/ruralscience.html (accessed January 21, 2008).
BRUCE, M.E., WILL, R.G., IRONSIDE, J.W., MCCONNELL, I., DRUMMOND, D., SUTTIE, A.,
MCCARDLE, L., CHREE, A., HOPE, J., BIRKETT, C., COUSENS, S., FRASER, H. and BOSTOCK,
C.J. 1997. Transmissions to mice indicate that ‘new variant’ CJD is caused by the BSE agent. Nature, 389,
498-501.
COLLINS, S.J., LAWSON, V.A. and MASTERS, C.L. 2004. Transmissible spongiform encephalopathies. The
Lancet, 363, 51-61.
COMER, P.J. and HUNTLY, P.J. 2003. TSE Risk Assessments–a decision support tool. Statistical Methods in
Medical Research, 12, 279-291.
DALY, D.J., PRENDERGAST, D.M., SHERIDAN, J.J., BLAIR, I.S. and MCDOWELL, D.A. 2002. Use of a
marker organism to model the spread of central nervous system tissue in cattle and the abattoir environment
during commercial stunning and carcasses dressing. Applied and Environment Microbiology, 68, 791-
798.
DEFRA 2004. BSE Statistics. http:// www.defra.gov.uk/animalh/bse/index.html (accessed January 21, 2008).
DORMONT, D. 2002. Prions, BSE and food. International Journal of Food Microbiology, 78, 181-189.
ENG, L.F. 1985. Glial fibrillary acidic protein (GFAP): The major protein of glial intermediate filaments in
differentiated astrocytes. Journal of Neuroimmunology, 8, 203-214.
FOOD STANDARDS AUSTRALIA NEW ZEALAND 2002. BSE risk assessment and risk management
strategy. Final Assessment Report, 06/03, pp. 1-142, Canberra, Wellington, Australia, New Zealand.
HARBOUR, D. 2001. Measures to reduce contamination of meat and environment with CNS tissue during
slaughter and processing of cattle and sheep. http://europa.eu.int/comm/research/press/1998/pr2710en.html
(accessed January 21, 2008).
HELPS, C.R., HINDELL, P., HILLMAN, T.J., FISHER, A.V., ANIL, M.H., KNIGHT, A.C., WHYTE, R.T.,
O’NIELL, D.H., KNOWLES, T.G. and HARBOUR, D.A. 2002. Contamination of beef carcasses by spinal
cord tissue during splitting. Food Control, 13, 417-423.
HELPS, C.R., FISHER, A.V., HARBOUR, D.A., O’NEILL, D.H. and KNIGHT, A.C. 2004. Transfer of spinal
cord material to subsequent bovine carcasses at splitting. Journal of Food Protection, 67, 1921-1926.
KALE, M., KURŞUN, Ö. and PEHLIVANOĞLU, F. 2007. Detection of central nervous system tissues as
Bovine Spongiform Encephalopathy specified risk material in processed and raw meat products in Turkey.
Journal of Food Safety, 27, 56-65.
KNIGHT, A.C. 2002. Dispersion of CNS material during splitting of cattle carcasses. In The OTM risk assessment
group on the 20th, September (O-RR/RAG3/20).
LABUDDE, R.A. 2004. BSE in the USA. Redux: How made are we getting? http://www.foodscience.afisc.
csiro.au (accessed January 21, 2008).
LIM, D.G., ERWANTO, Y. and LEE, M. 2007. Comparison of stunning methods in the dissemination of central
nervous system tissue on the beef carcass surface. Meat Science, 75, 622-627.
PRENDERGAST, D.M., SHERIDAN, J.J., DALY, D.J., MCDOWELL, D.A. and BLAIR, I.S. 2003.
Dissemination of central nervous system tissue from the brain and spinal cord of cattle after captive bolt
stunning and carcass splitting. Meat Science, 65, 1202-1209.
RAMANTANIS, S.B. 2006. Alternative cattle slaughtering technologies and/or measures reducing the
dissemination of central nervous system tissue during head handling, harvesting of cheek meat and tongue
and carcass splitting - a review. Veterinarski Arhiv, 76, 19-36.
SCHUETT-ABRAHAM, I. 2002. BSE-Präventivmaßnahmen bei der schlachtung von rindern. Berliner und
Münchener Tierarztliche Wochenschrift, 115, 125-130.
SCHWAGELE, F., MUELLER, E., FISCHER, K., KOLB, R., MOJE, M. and TROEGER, K. 2002. Nachweis
von gewebe des ZNS auf rinderschlachttierkörpern nach absaugen des rückenmarks. Fleischwirtschaft, 6,
1118-1120.
THE FOOD SAFETY COMMISSION/THE PRION EXPERT COMMITTEE 2005. Food safety risk assessment
related to measures against Bovine Spongiform Encephalopathy (BSE) in Japan. Prion Expert Committee
Report, 6, 1-54.
TROEGER, K. 2004. Overview of current and alternative slaughter practices. Biotechnology, Agronomy,
Society and Environment, 8, 275-281.
WENTHER, J. 2004. Bones that are designated as specified risk material (SRM) and must be removed from
cuts originating from animals of 30 months of age or older. http://www.aamp.com (accessed January 21,
2008).
YESILBAG, K. and KALKAN, A. 2005. Detection of central nervous system tissues as BSE specified risk
material in meat products in Turkey. Food Control, 16, 11-13.
Dobranić1, T., M. Samardžija1, D. Đuričić2, I. Harapin1, S. Vince1, D. Gračner1, N.

Prvanović1, J. Grizelj1, M. Karadjole1, Lj. Bedrica1, D. Cvitković1
Faculty of Veterinary medicine, Zagreb, Croatia1

Veterinary practice Đurđevac2Croatia1
Summary
The aim of this research was to establish metabolic profile of Boer goats during puerperium. For this
reason 14 Boer goats and 8 cross breed dairy goats in a German improved fawn type (control group) 2 to 4 years
old were used. Blood samples were taken every 72 hours from the 3rd untill 40th day after delivery. Following
parameters were determined: aspartate amminotransferase, gamma glutamiltransferase, alkaline phosphatase,
creatine kinase, glucose, total proteins, albumins, triglycerides, cholesterole, urea, creatinine, bilirubin i ß-
hidroxybutirate, Ca, P, Na, K, Cl and Mg. In the Boer goats significantly higher (P<0,05) levels of creatine kinaze,
GGT, alkaline phosphatase, glucose were noticed, whereas in the dairy goats significantly higher level (P<0,05)
of ß-hidroxybutirate, cholesterole, urea, phosphorus and AST were found. However, values of mentioned
parameters were within physiological levels in both groups. Statisticaly significant difference (P>0,05) between
the groups for any other biochemical parameter was not established. The conducted tests have shown that
group of Boer goats had no metabolic disorders although levels of some liver enzymes were increased. Since
Boer goats are poliestrus breed of goats, regarding obtained results we can assume that hypothalamus-pituitary-
ovarian axis would be reestablished in Boer goats during physiological time postpartum.
Sažetak
Istraživanjem smo željeli odrediti metabolički profil tijekom puerperija burskih koza. U tu svrhu
smo koristili 14 koza burske pasmine i 8 koza križanih u tipu njemačke srnaste koze (kontrolna skupina) u
dobi 2-4 godine. Uzorci krvi su uzimani svaka tri dana počevši od trećeg pa sve do 40. dana nakon poroda.
Određivali smo sljedeće pokazatelje: aspartat aminotransferazu, gama-glutamiltransferazu, alkalnu fosfatazu,
kreatin kinazu, glukozu, ukupne bjelančevine, albumine, trigliceride, kolesterol, ureju, kreatinin, bilirubin
i ß-hidroksibutirat, te Ca, P, Na, K, Cl i Mg. Ustanovili smo značajno višu (P<0,05) razinu kreatin kinaze,
GGT, alkalne fosfataze, glukoze i kalcija kod burskih koza, dok smo kod muznih koza ustanovili značajno
višu razinu (P<0,05) ß-hidroksibutirata, kolesterola, ureje, fosfora i AST-a. Za ostale biokemijske pokazatelje
nismo ustanovili značajnu razliku između skupina (P>0,05). Međutim, vrijednosti svih pokazatelja bile su u
normalnim fiziološkim granicama za obje skupine koza. Provedenim istraživanjem smo ustanovili da skupina
burskih koza nije imala metaboličke poremećaje neovisno o povišenoj razini nekih jetrenih enzima. Budući
je burska koza poliestrična pasmina koza, glede dobivenih rezultata možemo zaključiti da će u njih osovina
hipotalamus- hipofiza-jajnici biti uspostavljena tijekom fiziološkog razdoblja puerperija.
Uvod
Koza je sezonski poliestrična životinja u krajevima umjereno kontinentske klime, što znači da se
tjera samo u određeno vrijeme godine i to više ciklusa zaredom (Zarrouk i sur., 2001.). U postojbini
burske koze na južnoj polutki nije zabilježeno vrijeme potpune spolne neaktivnosti, a vrhunac
spolne aktivnosti je u jesen, dok je kasno proljeće i sredina ljeta vrijeme smanjene spolne aktivnosti.
(Greyling i Van Der Nest, 1990.). Smatra se da razina specifičnih metabolita u plazmi ne pokazuje
samo poremećaj, nego i daje signal osovini hipotalamus-hipofiza-jajnici o metaboličkom statusu
(Opsomer et al., 1999). Djelovanje enzima aspartat aminotransferaze (AST) je pokazatelj oštećenja
jetre (Reid i Roberts, 1982.), ali se javlja i kod bolesti kosturnog mišićja pa je potrebno kod životinje
odrediti i djelovanje kreatin kinaze (Forenbacher, 1993.). Kreatin kinaza ima tri izoenzima MM (u
mišićju), MB (miokard) i BB (mozak), pa je i pokazatelj oštećenja tih tkiva. Gama-glutamil transferaza
(GGT) je enzim vezan uz membranu stanice većine parenhimatoznih organa (jetra, slezena, bubrezi,
gušterača i tanka crijeva), a klinički se koristi isključivo za dokazivanje hepatobilijarnih bolesti.
Alkalna fosfataza je enzim prisutan u skoro svim tkivima (kosti, jetra, bubrezi, prostata, slezena,
mukoza duodenuma i neka krvna tjelešca), a važan je pokazatelj bolesti hepatobilijarnog sustava,
ostitisa, osteomalacije. (Ramadan i Harapin, 1998.). Razina glukoze u plazmi je niska tijekom ranog
puerperija u preživača (i do 30-tog dana), da bi se kasnije povećala, pa se smatra da razina glukoze u
krvi nije povezana s energetskim stanjem (Lucy i sur., 1991.). Određivanje razine ß-hidroksibutirata
(BHB) u serumu nam služi kao najpouzdaniji test za otkrivanje ketoze (Geishauser i sur., 2000.).
Početak ciklične aktivnosti jajnika u preživača u suodnosu je s povećanjem razine nezasićenih
masnih kiselina, BHB-a i ureje u plazmi (Grummer, 1993.). Cijelo vrijeme puerperija kod koza,
ukupni kolesterol je imao srednje vrijednosti 2,06-2,75 mmol/L, dok su vrijednosti ukupnih lipida
bile najniže do 7. dan post partum, a zatim su do 40. dana puerperija vrijednosti rasle (Krajničakova i
sur., 1999.). Poremećaji mijene tvari imaju najvažniju ulogu u patologiji puerperalnog razdoblja kod
preživača. Manjak energije često uzrokuje atoniju i hipotoniju maternice, a posljedica je usporena
involucija maternice. Razina glukoze je u fiziološkim granicama zbog visoke razine kortizola
(Subandrio i Noakes, 1997.). Atonija maternice i imunosupresija mogu biti posljedica fiziološkog i
metaboličkog stresa u preživača (Dobson i Smith, 2000.). Razina ketonskih tijela i slobodnih masnih
kiselina je na gornjoj fiziološkoj granici u puerperiju preživača (Kaczmarowski i sur., 2006.) što
ukazuje na manjak energije, lipolizu, supkliničku ketozu i masnu degeneraciju jetre (Grummer,
1993.; Bobe i sur., 2004.). Cilj našeg istraživanja bio je ustanoviti pouzdanost metaboličkog profila u
svrhu praćenja ciklične aktivnosti jajnika tijekom puerperija u burskih koza.
Materijal i metode
Životinje. Ovim su istraživanjem obuhvaćene 22 koze, 14 burskih i 8 križanih u tipu njemačke
srnaste koze u dobi od dvije do četiri godine. Koze su držane ekstenzivno na sjevernim obroncima
Bilogore: Čepelovečki breg, općina Đurđevac. Životinje su smještene u skupne nastambe i hranjene
jednako: livadno sijeno po volji, te oko 0,7 kg koncentrata po kozi dnevno. Obje su skupine koza
držane zajedno s jaradi, od jarenja do završetka istraživanja. Jarčevi su izdvojeni na nekoliko
kilometara udaljenosti kako bi se izbjegao učinak nazočnosti mužjaka («male effect»).
Skupljanje uzoraka krvi. Uzorke krvi smo uzimali s pomoću vacutainer pribora iz vene jugularis
svaka tri dana počevši od trećeg završno do četrdesetog dana puerperija. Krv je ostavljena najmanje
15 minuta na sobnoj temperaturi te smo je, prema Bage i sur., (2002), centrifugirali 15 minuta na
3.000 okretaja u minuti. Izdvojeni smo serum vrlo brzo (15 minuta) pohranili na temperaturu od -20
°C, sve do pretraga.
Određivanje razine biokemijskih parametara u krvi. Biokemijskim su analizama iz seruma
određivani: aspartat aminotransferaza, kreatin kinaza, gama-glutamiltransferaza, alkalna fosfataza,
glukoza, ukupne bjelančevine, ß-hidroksibutirat, albumini, trigliceridi, kolesterol, ureja, kreatinin,
bilirubin, kalcij, fosfor, natrij, kalij, klor i magnezij, a određivali smo ih standardno spektrofotometrijski
u laboratoriju Klinike za unutarnje bolesti na Veterinarskom Fakultetu, Sveučilišta u Zagrebu na
Olympus AU 600 analyser (Olympus Diagnostica GMBH, Hamburg, Germany), koristeći Olympus
reagense i standardne metode spektrofotometrije.
Statistička obrada podataka. Svi rezultati istraživanja obrađeni su statističkom metodom ANOVA
i Tukeyevim testovima post-hoc analize. Rezultati s P<0,05 smatrali su se statistički značajnima.
Rezultati
Četrdeset dana puerperija srednja vrijednost AST-a je iznosila 102,8 ± 2,32 U/L u burske, a
118,4 ± 3,10 U/L u koza križanih u tipu njemačke srnaste koze. Kod burskih koza srednje vrijednosti
Slika 1a. Usporedba srednjih vrijednosti biokemijskih pokazatelja u obje skupine koza (burske n=14; križane
n=8). Unutar istog stupca se značajno razlikuju vrijednosti različitog eksponenta
Slika 1b. Usporedba srednjih vrijednosti biokemijskih pokazatelja u obje skupine koza. (burske n=14; križane
n=8)Unutar istog stupca se značajno razlikuju vrijednosti različitog eksponenta
alkalne fosfataze (167,7 ± 18,13 U/L), kreatin kinaze (194,1 ± 13,09 U/L), GGT-a (53,25 ± 1,01 U/L)
bile su više od srednjih vrijednosti koza križanih u tipu njemačke srnaste koze (AP 52,9 ± 2,3 U/L,
CK 178,0 ± 8,2 U/L i GGT 41,9 ± 1,2 U/L) Vrijednosti glukoze kod burskih koza su iznosile od 3,1-
8,3 mmol/L (4,21 ± 0,07 mmol/L), a koza križanih u tipu njemačke srnaste koze od 2,3-4,6 mmol/L
(3,47 ± 0,06 mmol/L). Ukupne bjelančevine (70,8 ± 0,38 g/L kod burskih, a 70,6 ± 0,60 g/L kod
križanih) i albumini (33,33 kod burskih, te 35,4 ± 0,37 g/L kod križanih) su gotovo istih vrijednosti u
obje skupine koza. Srednja vrijednost triglicerida kod burskih koza je iznosila 0,28 ± 0,02 mmol/L, a
kod križanih 0,17 ± 0,01 mmol/L, te srednje vrijednosti kolesterola 2,31 ± 0,06 mmol/L kod burskih
i 3,31 ± 0,09 mmol/L križanih. Vrijednosti ß-hidroksibutirata su iznosile od 0,1 do 0,8 mmol/L (s
prosjekom od 0,28 ± 0,01 mmol/L) kod burskih koza i 0,1-2,9 mmol/L (0,62 ± 0,04 mmol/L) kod
koza križanih u tipu njemačke srnaste koza. Srednja vrijednost bilirubina je iznosila 4,04 ± 0,06
μmol/L kod burskih koza, a 4,16 ± 0,07 μmol/L kod koza križanih u tipu njemačke srnaste koze.
Vrijednost ureje se kretala od 0,83 do 11,85 mmol/L (4,39 mmol/L ± 0,18 mmol/L) u burskih koza,
a u kontrolne skupine od 2,41 do 16,36 mmol/L (6,71 ± 0,31 mmol/L). Srednja vrijednost kreatinina
je iznosila 72,35 ± 1,12 μmol/L u burskih koza, a 67,84 ± 1,30 μmol/L u kontrolne skupine koza.
Vrijednosti kalcija (2,39 ± 0,02 mmol/L) i fosfora (2,02 ± 0,06 mmol/L) su više kod burskih koza
nego kod koza križanih u tipu njemačke srnaste koze (Ca 2,17 ± 0,04 mmol/L i P 2,59 ± 0,10 mmol/
L). Ustanovili smo da su razine kalija (4,76 ± 0,08 mmol/L kod križanki, a 4,69 ± 0,07 mmol/L kod
burskih), magnezija (kod križanki 1,13 ± 0,02 mmol/L, a kod burskih koza 1,12 ± 0,02 mmol/L),
natrija (kod križanki 147,45 ± 1,02 mmol/L, a kod burskih koza 147,61 ± 0,65 mmol/L) i klora (kod
križanki 111,75 mmol/L, a kod burskih koza 113,19 ± 0,36 mmol/L) podjednake bez značajnih
razlika. (Grafikoni . i 2.).
Rasprava
Razina glukoze u krvi je važan pokazatelj funkcioniranja mijene tvari organizma (Ramadan i
Harapin, 1998.). Neki autori navode nižu razinu glukoze u postpartalnom periodu preživača kod
kojih je kasnio povratak ciklične aktivnosti jajnika (Huszenica i sur., 1988.), dok neki navode da je
razina glukoze u granicama normale (Samardžija i sur., 2006.). Mi smo ustanovili da postoji značajna
razlika između razine glukoze u serumima mliječnih koza kojima se nije vratila ciklična aktivnost u
puerperiju (ojarene u veljači i ožujku) prosječne razine 3,47 mmol/L, i burskih koza, koza s nižom
produkcijom mlijeka (mesna pasmina) kod kojih je razina glukoze značajno (P<0,05) viša 4,21
mmol/L. Djelovanje enzima AST-a je pokazatelj oštećenja jetre (Reid i Roberts, 1982.), ali se javlja
i kod bolesti kosturnog mišićja pa je potrebno odrediti i djelovanje kreatin kinaze (Forenbacher,
1993.). Herak i sur., (2000.) su pratili koncentraciju AST-a u krvi preživača tijekom puerperija, a
kako je aktivnost AST-a bila u fiziološkim granicama ustanovili su da nije bilo većih oštećenja jetre
kod preživača korištenih u istraživanju. Ustanovili su da preživači s cistama na jajnicima kod kojih
je kasnio povratak ciklične aktivnosti imaju značajno višu (P<0,05) razinu AST-a od preživača s
uspostavljenom cikličnom aktivnošću. Sukladne rezultate u preživača je dobio i Huszenicza i sur.
(1988.). U našem istraživanju smo dobili slične rezultate jer smo kod križanih koza dobili višu
(P<0,05) razinu AST-a od burskih koza, kod kojih se trebala uspostaviti ciklična aktivnost. Djelovanje
enzima alkalne fosfataze (AP), kreatin kinaze (CK) i gama-glutamil transferaze (GGT) bilo je više
u burskih koza nego u križanki kod kojih nije došlo do uspostave ciklične aktivnosti jajnika. Razina
ovih enzima je varirala od jedinke do jedinke. Sve vrijednosti su u fiziološkim granicama, osim GGT-
a, čije su granice od 20 U/L do 50 U/L. Prosječna vrijednost kod križanih koza iznosi 41,85 U/L, a
prosječna vrijednost kod burskih koza 53,26 U/L što možemo pripisati, najvjerojatnije, netoksičnom
zamašćenju jetre (Forenbacher, 1993.), jer iako su koze obiju skupina hranjene jednako, smatramo
da su burske koze ušle u istraživanje u boljoj tjelesnoj kondiciji, a moramo uzeti u obzir i pasminska
obilježja, iako u literaturi sličnih podataka nema. Krajničakova i sur., (2003.) i Vrzgula i sur., (1985.)
su ustanovili da je razina mikroelemnata Mg, Na, K i Cl u puerperiju koza u fiziološkim granicama. U
našim istraživanjima smo ustanovili da su razine K, Mg, Na i Cl podjednake kako kod burskih, tako i
kod križanih koza, bez značajnih razlika. Prosječna vrijednost Ca u serumu preživača u puerperalnom
razdoblju pada, a razina kalcija je obrnuto proporcionalna količini mlijeka (Ivanov i sur., 1990.).
Ustanovili smo, i u našem istraživanju, da koze križane u tipu njemačke srnaste koze, koje
imaju veću proizvodnje mlijeka, imaju 2,17 mmol/L prosječnu razinu kalcija u serumu, što je ispod
donje fiziološke granice dok burske koze (mesna pasmina) imaju značajno višu (P<0,05) prosječnu
razinu kalcija u serumu od 2,4 mmol/L. Prosječna razina fosfora kod križanki u tipu njemačke
srnaste koze je u našem istraživanju iznosila 2,58 mmol/L, a kod burskih znatno niža 2,02 mmol/
L. Krajničakova i sur., (2003.) ustanovili su da su ukupne bjelančevine u puerperiju koza iznosile
65,00 do 71,79 g/L, kolesterol 2,06 do 2,75 mmol/L, a ukupni lipidi od 1,76 do 2,27 g/L. Iako je
kolesterol osnova za sintezu steroida jajnika, ne smijemo zaboraviti njegovu ulogu nosača masnih
kiselina kod sinteze mlijeka, što smo i mi potvrdili u našem istraživanju, jer je razina u serumu
kod križanih koza značajno viša (P<0,01) nego kod burskih koza. Statistički se značajno (P<0,01)
snižavala razina triglicerida u puerperiju koza do 7. dana puerperija (Krajničakova i sur., 2003.), a
smatra se da je to povezano s kočenjem sinteze apoproteina i brojem njegovih receptora, koji su važni
za formiranje VLD-lipoproteina (very low density lipoproteins) kod sinteze progesterona (Grummer
i Caroll, 1988.). Nazifi i sur., (2002.) su odredili kod klinički zdravih koza koncentraciju triglicerida u
serumu od 0,11 do 0,22 mmol/L. Ustanovili smo da burske koze imaju značajno višu (P<0,05) razinu
triglicerida u serumu tijekom puerperija, nego križane koze u tipu njemačke srnaste koze. Nadalje,
ustanovili smo da je prosječna razina ukupnih bjelančevina u puerperiju koza gotovo jednaka kako
kod burskih koza, tako i kod križanki u tipu njemačke srnaste koze, a prosječna razina albumina
iznosila 33,33 g/L kod burskih, a kod križanih 35,40 g/L. Svako ispitivanje funkcije jetre započinje
određivanjem razine bilirubina u krvnom serumu, bez obzira postoji li žutica ili ne. Kod nekrobioze i
teške masne degeneracije jetre razina ukupnog bilirubina je 61,56 μmol/L, a spregnutog 44,46 μmol/
L, a fiziološke vrijednosti za kozu iznose 1,7-3,4 μmol/L (Forenbacher, 1993.). Mi smo u našem
istraživanju dobili prosječnu vrijednost bilirubina 4,16 μmol/L za križanke u tipu njemačke srnaste
koze, a u burskih koza je ta vrijednost iznosila 4,04 μmol/L, što bi potvrdilo druge autore (Kaneko i
sur., 1997.) koji navode znatno višu gornju fiziološku granicu (4,3 μmol/L, čak 6,5 μmol/L) za ukupni
bilirubin u serumu koza, jer uspoređujući jetrene enzime možemo reći da nema oštećenja jetre, a
vrijednosti bilirubina u našem istraživanju prelazile bi gornju fiziološku granicu. The conducted
tests have shown that group of Boer goats had no metabolic disorders although levels of some liver
enzymes were increased. Since Boer goats are poliestrus breed of goats, regarding obtained results
we can assume that hypothalamus-pituitary-ovarian axis would be reestablished in Boer goats during
physiological time postpartum.
Literatura
Bage, R., H. Gustafsson, B. Larsson, M. Forsberg, H. Rodriguez-Martinez (2002): Repeat breeding in dairy
heifers: follicular dynamics and oestrous cycle characteristics in relation to sexual hormone patterns.
Theriogenology, 57, 2257-2269.
Bobe, G., J. W. Young, D. C. Beitz (2004.): Invited review: Pathology, etiology, prevention, and treatement of
fatty liver in dairy cows. J. Dairy Sci. 87, 3105-3124.
Dobson, H., R. F. Smith (2000.): What is stress, and how does it affect reproduction? Anim. Reprod. Sci. 60,
743-752.
Forenbacher, S. (1993.): Klinička patologija probave i mijene tvari domaćih životinja, Svezak II, Jetra, HAZU,
Školska knjiga.
Geishauser, T., K. Leslie, J. Tenhag, A. Bashiri (2000.): Evaluation of eight cow-Side ketone tests in milk for
detection of subclinical ketosis in dairy cows. J. Dairy Sci. 83, 296-299.
Greyling, J. P. , M. Van der Nest (1990.): Ovulation in the Boer goat doe. Small Rumin. Res. 3, 457-464.
Grummer, R. R. (1993.): Etiology of lipid-related metabolic disorders in periparturient dairy cows. J. Dairy Sci.
76, 388-394.
Grummer, R. B., D. J. Caroll (1988.): A review of lipoprotein cholesterol metabolism importance to ovarian
function. J. Anim. Sci. 66, 3160-3173.
Herak, M., T. Dobranić, Melita herak, S. Milinković-Tur, V. Dolar (2000.): Krvna koncentracija glukoze,
bjelančevina, bilirubina i ureje te aktivnost aspartat transaminaze u krvi krava tijekom puerperija. Zbornik,
Drugi hrvatski veterinarski kongres, Cavtat, 267-272..
Huszenicza, G., J. Haraszti, L. Molnar, L. Solti, S. Fekete, K. Ekes, A. C. Yaro (1988.): Some metabolic
characteristics of dairy cows with different postpartum ovarian function. J. Vet. Med. A. 35, 506-515.
Ivanov, I., I. Rajić, M. J. Jovanović, M. Lalić (1990.): Concentration of calcium in the blood serum in high-
pregnant and lactating cows in intensive breeding. Vet. Glasnik 44, 359-364.
Kaczmarowski, M., E. Malinowski, H. Markiewicz (2006.): Some hormonal and biochemical blood indices in
cows with retained placenta and puerperal metritis. Bull. Vet. Inst. Pulawy 50, 89-92.
Kaneko, J. J., W. Harvey, M. L. Bruss (1997.): Clinical Biochemistry of Domestic Animals, 5 th edition Academic
Press, San Diego London Boston New York Sydney Tokyo Toronto.
Krajničakova, M., G. Kovač, M. Kostecky, I. Valocky, I. Maraček, I. Šutiakova, L. Lenhardt (2003.): Selected
clinico-biochemical parameters in puerperal period of goats. Bull. vet. Inst. Pulawy 47, 177-182.
Krajničakova, M., E. Bekeova, L. Lenhardt, V. Cigankova, I. Valocky, I. Maraček (1999.): Microscopic analysis
of the uterine endometrium in post parturient ewes. Acta Vet. Brno 68, 9-12.
Lewis, G. S. (1997.): Uterine health and disorders. J. Dairy Sci. 80, 984-994.
Lucy, M. C., C. R. Staples, F. M. Michel, W. W. Thatcher (1991.): Energy balance and size and number of
ovarian follicles detected by ultrasonography in early postpartum dairy cows. J. Dairy Sci. 74, 473-482.
Nazifi, S., H. R. Gheisari, F. Shaker (2002.): Serum lipids and lipoproteins and their correlations with thyroid
hormones in clinically healthy goats. Vet. Arhiv 75, 249-257.
Opsomer, G., Y. T. Grohn, J. Hertl, H. Laevens, M. Coryn, A. de Kruif (1999): Protein metabolism and the
resumption of ovarian cyclicity potpartum in high yielding dairy cows. Reprod. Dom. Anim., (Suppl. 6),
Proceedings of the 3rd Conference of the European Society for Domestic Animal Reproduction 54-57.
Ramadan, P., I. Harapin (1998.): Interna klinička propedeutika domaćih životinja. Veterinarski fakultet
Sveučilišta u Zagrebu.
Reid, I. M., J. Roberts (1982.): Fatty liver in dairy cows. In Practice 4, 164-169.
Samardžija, M., T. Dobranić, S. Vince, M. Cergolj, A. Tomašković, K. Đurić, J. Grizelj, M. Karadjole, D.
Gračner, Ž. Pavičić (2006): Beziehung zwischen Progesteron P4, IGF-I, Blutparameter und zyklischer
Ovarienaktivität der Kühe im Puerperium. Tierärztliche Umschau 61, 8; 421-427.
Subandrio, A. J., D. E. Noakes (1997.): Neutrophil migration into the uterine lumen of the cow: the influence
of endogenous and exogenous seks steroid hormones using two intrauterine chemoatractants. Theriogen.
47, 825-835.
Vrzgula, L., H. Seidel, J. Gardaš (1985.): Yearly dynamycs of haematological and biochemical indices in blood
serum of goats. Folia Vet. 29, 53-69.
Zarrouk, A., O. Souilem, P. V. Drion, J. F. Beckers (2001.): Caracteristiques de la reproduction de l`espece
caprine. Ann. Med. Vet. 145, 98-105.
NIVELES DE METALES TÓXICOS (As, Cd, Hg y Pb) EN HÍGADOS
DE BOVINOS CRIADOS EN INTENSIVO EN LA PROVINCIA DE LEÓN
(N.O. ESPAÑA).
TOXIC METAL CONCENTRATIONS (As, Cd, Hg y Pb) IN LIVER OF

BEEF CATTLE FROM PROVINCE OF LEON (NW SPAIN).
KONCENTRACIJE TOKSIČNIH METALA (As, Cd, Hg I Pb) U

JETRI TOVNE JUNADI S PODRUČJA LEONA (SJEVEROZAPADNA
ŠPANJOLSKA)
Escudero A1, González JR1, Miranda M2, Hernández J3, Lechuga A1, Castillo C3, Ben-
edito JL.3
1
Department of Medicine, Surgery and Veterinary Anatomy, University of Leon, 24071,
Spain.
2
Department of Clinical Veterinary Sciences, University of Santiago de Compostela, Lugo
27002, Spain.
3
Department of Animal Pathology, University of Santiago de Compostela, Lugo 27002,
Spain.
Abstract
The objective of this study was to determine the concentrations of four toxic elements (arsenic,
cadmium, mercury and lead) in the liver of beef cattle between 6 months and 2 years old from feedlots
localized in Leon, NW Spain. Sixty-two liver samples of caudal lobule (200 g approximately) from
all animals were analyzed by ICP-MS. The arithmetic mean concentrations in all animals (age and
sex combined) were 6.86 µg/kg/w.wt.; 19.9 µg/kg/w.wt.; 1.08 µg/kg/w.wt. and 9.53 µg/kg/w.wt. for
arsenic, cadmium, mercury and lead, respectively. Geometric mean concentrations were 5.10 µg/kg/
w.wt for As), 17.9 µg/kg/w.wt for Cd, 0.68 µg/kg/w.wt for Hg and 8.59 µg/kg/w.wt for Pb. Knowledge
of toxic metal concentrations in livestock is important for assessing the effects of pollutants on domestic animals
and protection of consumers.
Abstract
Svrha rada je odrediti koncentracije 4 toksična elementa (arsena, kadmija, žive i olova) u jetri tovne junadi
starosti 6 mjeseci do dvije godine iz tovilišta u Leonu, Španjolska. Analizirana su 62 uzorka kaudalnog lobula
jetre (200 g) od svake životinje primjenom ICP-MS tehnike. Srednja aritmetička koncentracija (s obzirom na
starost i spol) iznosila je 6.86 µg/kg/w.wt.; 19.9 µg/kg/w.wt.; 1.08 µg/kg/w.wt. i 9.53 µg/kg/w.wt. za arsen,
kadmij, živu i olovo.Geometrijska srednjakoncentracija je iznosila 5.10 µg/kg/w.wt za As), 17.9 µg/kg/w.wt za
Cd, 0.68 µg/kg/w.wt za Hg i 8.59 µg/kg/w.wt za Pb. Spoznaje o prisutnosti toksičnih metala u mesu vrlo su
važne zbog sigurnosti potrošaća.
Introducción
Está perfectamente demostrado que algunos metales como el arsénico (As), cadmio (Cd),
mercurio (Hg) o el plomo (Pb) pueden ejercer un efecto tóxico, disminuyen la productividad y los
índices reproductivos de los animales de abasto y afectan a la salud pública (Jensen, 1991; WHO,
1995; WHO, 2001).
Los metales se pueden incorporar al organismo humano y al de los animales a través de su
inhalación y por la ingestión de agua y alimentos, dependiendo en gran medida del grado de
contaminación del sitio de localización, así como los hábitos y recursos alimenticios de los individuos
(Alberti-Fidanza et al, 2003; Chen et al, 2003; Prankel et al, 2004). Estos elementos son tóxicos para
el ser humano y los animales, debido a su elevada concentración en el ambiente, pudiendo aumentar
sus efectos nocivos como consecuencia de su bioacumulación (Santos et al, 2004).
Material y Métodos
Muestras.La recogida de las muestras se llevó a cabo en el matadero municipal de León entre
Septiembre 2006 y Marzo 2007. Se recogieron muestras de un total de 62 animales, con edades
comprendidas entre los 6 meses y 2 años, descartando aquellos animales que por cuestiones sanitarias
fueran objeto de decomiso. Se registró la procedencia exacta de todos los animales mediante la
utilización del Documento de Identificación Bovina (DIB), garantizando la identificación de la
muestra (hígado) con el animal al que correspondía.
Las muestras de hígado se tomaron del lóbulo caudado (200 g aproximadamente), y conservaron
en bolsas de polipropileno debidamente identificadas, manteniéndolas refrigeradas hasta su transporte
en el mismo día al laboratorio.
Una vez en el laboratorio, las muestras se limpiaron de grasa, tejido conectivo y principales
vasos sanguíneos; de cada muestra de tejido se tomaron 3 submuestras de 10 g aproximadamente que
se colocaron en bolsas de polipropileno debidamente identificadas. Las muestras de cada animal se
introdujeron en una única bolsa identificada con el código del animal, congelándolas a -18ºC hasta
su posterior análisis laboratorial.
Digestiones.Todas las muestras de hígado (2 g aproximadamente) se pesaron de forma precisa en
los vasos de digestión utilizando una balanza electrónica SALTER-AND, modelo ER-60 A. A cada
muestra se le añadieron 5 ml de ácido nítrico concentrado, (Suprapur Grade, Merck 69%), 2 ml de
peróxido de hidrógeno 30% p/v y 1 ml de agua ultrapura. A continuación se cerraron los vasos y se
sometieron a un proceso de digestión en un sistema microondas (marca Milestone Ethos Plus) La
solución resultante se diluyó con agua ultrapura hasta un volumen final de 25 ml y se almacenó en
tubos de polipropileno hasta su posterior análisis químico.
Determinación laboratorial.La determinación de los niveles de los metales (As, Cd, Hg y
Pb), se llevó a cabo por Espectroscopia de Masa con Fuente de Plasma Acoplado (ICP-MS). Los
análisis se realizaron en el Laboratorio FISQUITECNAL perteneciente a los servicios centrales de la
Universidad de Santiago de Compostela.
Durante todo el estudio se llevó a cabo un estricto programa de control de calidad analítica. En
cada lote de 10 muestras se incluía un blanco y una muestra de material de referencia certificado.
El límite de detección de la digestión ácida se calculó como tres veces la desviación estándar de
los blancos. Los límites de cuantificación, expresados como la concentración de cada analito en el
tejido, se calcularon teniendo en cuenta el peso de la muestra y la disolución empleada. Los estudios
de recuperación analítica se llevaron a cabo empleando un Material de Referencia Certificado (Pig
Kidney CRM 186, BCR Reference Materials) con una concentración certificada de As (7,98 µg/l);
Cd (2572 µg/kg); Hg (1,97 µg/lg) y de Pb (306 µg/kg), obteniendo un porcentaje de recuperación de
98,7% para todos los metales, a excepción del mercurio en las muestras de uno de los lotes (29%).
Resultados y discusión
En la tabla 1 se encuentran representados los niveles de As, Cd, Hg y Pb en hígados de ganado
vacuno procedentes de la provincia de León. En nuestro estudio encontramos las siguientes niveles
medios: para arsénico (6,86 µg/kg); cadmio (19,9 µg/kg); mercurio (1,08 µg/kg) y plomo (9,53
µg/kg) en peso fresco. La concentración hepática de los diferentes metales tóxicos tienden a estar
sesgadas a la derecha, tal y como se demuestra por la presencia de una mediana y media geométrica
inferior a la media aritmética. Se determinaron unos valores de media geométrica de 5,10 µg/kg (As);
17,98 µg/kg (Cd); 0,68 µg/kg (Hg) y 8,59 µg/kg (Pb) de peso fresco en hígado. El comportamiento
de los datos en el caso de los niveles de metales en los tejidos, por ser tan variables los niveles de
concentración, resulta más adecuado el uso del valor de la mediana o de media geométrica para este
tipo de información (Langlands y col., 1987).
En la tabla 2 se presentan las concentraciones de metales obtenidas en otros estudios. Como se
puede observar, es amplio el rango de concentración de los diferentes metales en los diversos estudios
consultados. Son múltiples los factores que están relacionados con la variación de los niveles de
metales en el organismo como: la edad, raza, especie, sexo, estado reproductivo y nutricional, área
geográfica, nivel local de contaminación ambiental, grado de exposición al contaminante, sistema de
producción, entre otros; que justifican su concentración en los tejidos, como es el caso del hígado
(Al-Awadi et al, 2000; Reilly, 2002; Vahter et al 2006).
Los niveles de metales observados en nuestro estudio en general son más bajos que los observados
en estudios previos llevados a cabo en otros países y en España (ver tabla 2). Si lo comparamos con
un trabajo previo llevado a cabo en ganado vacuno en extensivo en la provincia de León (López-
Alonso et al., 2004) observamos que el nivel de contaminación por arsénico y mercurio sigue siendo
muy bajo, y que la contaminación por cadmio y plomo es menor, concretamente un 66 y un 69%
respectivamente.
La importancia de la valoración de los niveles metales en vísceras y tejidos de origen animal,
radica en la existencia de un riesgo potencial de que los diversos productos de origen animal y
fórmulas lácteas usados por el hombre, provengan de ganado alimentado y localizado en regiones
contaminadas. La determinación de la concentración residual de metales en los diferentes tejidos de
origen animal, es un importante indicador directo del grado de contaminación de estos productos; así
como un indicador indirecto del grado de contaminación ambiental local o periférica, principalmente
el suelo, agua, aire y flora de la zona en donde se localice el ganado (Prankel et al, 2004; Santos et
al, 2004; Calafat et al, 2006). Por lo anterior, se considera necesario el monitoreo periódico de las
concentraciones de los diferentes metales tóxicos en los alimentos y el ambiente para asegurar una
calidad y protección alimentaria.
Tabla 1. Niveles de As, Cd, Hg y Pb (µg/kg, peso fresco) en hígado de ganado vacuno en la provincia de León,
NO España.
Muestra As Cd Hg Pb
N 62 62 18 62
Media 6,86 19,9 1,08 9,53
D.E. 7,87 9,92 1,19 5,42
Media Geométrica 5,10 17,9 0,679 8,59
Mediana 4,09 16,8 0,656 7,94
Valor mínimo 2,06 7,14 0,081 4,29
Valor máximo 47,7 56,7 5,02 35,9
Tabla 2. Niveles de As, Cd, Pb y Hg en hígado de ganado vacuno en diferentes países. Representado como
medias aritméticas (µg/kg, peso fresco) y rango de valores entre paréntesis.
Autor As Cd Hg Pb
405
Amodio-Cocchieri et al, 1987 (Italia) 119,0 (38-320)
(100-1600)
60,0
Kramer et al, 1983 (Australia) <20,0 50,0 (<20-530)
(5-570)
Vos et al, 1987 (Holanda) 13 105,0 (7-360) (3,0-6,0) 170,0 (10-640)
Falandysz, 1993 (Polonia) 120,0 (5-850) 4,2 160,0 (10-910)

Kottferova y Koréneková, 1995 (Repú-
316,0 465,0
blica Eslovaca)
Doganoc, 1996 (Eslovenia) 90,0 (<3-620) 100,0 (<50-660)
Salisbury et al, 1991 (Canadá) 30,0
Farmer y Farmer, 2000 (Kazajstán) (50,0-790,0) (750-1020)
Abou-Arab, 2001 (Egipto) (121,0-556,0)

López-Alonso et al, 2004 (León, Es-
ND 59,6* (13-564) ND 28,0* (ND-320)
paña)
López-Alonso et al, 2000 (Galicia, 9,58-10.2* 7,56-83,3* 31,1-47,5*
España) (ND-401) (ND-7990) (ND-446,0)
11,7-12,4* 22,9-29,6* 20,7-38,1*
Miranda et al, 2005 (Asturias, España)
(ND-363) (3.39-221) (ND-411)
ND: < límite detección; *: media geométrica
Bibliografía
Abou-Arab AAK. Heavy metal contents in Egyptian meat and the role of detergent washing on their levels. Food
Chem Toxicol 2001;39:593-599.
Al-Awadi FM, Srikumar TS. Trace-element status in milk and plasma of Kuwaiti and non-Kuwaiti lactating
mothers. Nutrition 2000;16:1069-1073.
Alberti-Fidanza A, Burini G, Perriello G, Fidanza F. Trace elements intake and status of Italian subjects living
in the Gubbio area. Environ Res 2003;91:71-77.
Amodio-Cocchieri A, Fiore P. 1987. Lead and cadmium concentrations in livestock breed in Campania, Italy.
Bull Environ Contam Toxicol 39:40-464.
Calafat AM, Ye X, Silva MJ, Kuklenyik Z, Needham LL. Human exposure assessment to environmental
chemicals using biomonitoring. Int J Andrology 2006;29:166-171.
Chen H, Lee C, Liao P, Guo Y, Chen C, Su H. Associations between dietary intake and serum polychlorinated
dibenzo-p-dioxin and dibenzofuran (PCDD/F) levels in Taiwanese. Environ Res 2003;91:172-178.
Doganoc D. 1996. Lead and cadmium concentrations in meat, liver and kidney of Slovenian cattle and pigs from
1989 to 1993. Food Add Contam 13(2):237-241.
Falandysz, J. 1991. Manganese, copper, zinc, iron, cadmium, mercury and lead in muscle meat, liver and
kidneys of poultry, rabbit and sheep slaughtered in the northern part of Poland, 1987. Food Additives and
Contaminants. 8 (1): 71-83.
Kottferova J, Korenekova B. The effect of emissions on heavy metals concentrations in cattle from the area of
an industrial plant in Slovakis. Arch Environ Contam Toxicol 1995;29:400-405.
Kramer HL, Steiner JW, Vallely PJ. 1983. Trace element concentrations in the liver, kidney and muscle of
Queensland cattle. Bull Environ Contam Toxicol 30:588-594.
Langlands, J.P.; Donald, G.E.; Smith, A.J. 1987. Analysis of data collected in a residue survey: copper and zin
concentrations in liver, kidney and muscle in Australian sheep and cattle. Aust. J. Exp. Agric. 1987. 27:
485-491.
López Alonso, M.; Benedito, J.L.; Miranda, M.; Castillo, C.; Hernández, J.; Shore, R.F. 2000. Toxic and trace
elements in liver, kidney and meat from cattle slaughtered in Galicia (NW Spain). Food Additives and
Contaminants. 17(6): 447-457.
López Alonso, M.; Prieto Montaña, F.; Miranda, M.; Castillo, C.; Hernández, J.; Benedito, J.L. 2004. Interactions
between toxic (As, Cd, Hg, and Pb) and nutritional essential (Ca, Co, Cr, Cu, Fe, Mn, Mo, Ni, Se, Zn)
elements in the tissues of cattle fron NW Spain. Biometals. 17: 389-397.
Miranda M, López-Alonso M, Castillo C, Hernández J, Benedito JL. 2005. Effects of moderate pollution on
toxic and trace metal levels in calves from a polluted area of Northern Spain. Environ Int 31:543-548.
Prankel SH, Nixon RM, Phillips CJC. Meta-analysis of feeding trials investigating cadmium accumulation in
the livers and kidneys od sheep. Environ Res 2004;94:171-183.
Reilly C. Metal contamination of food, 2nd Ed. Elsevier Applied Science. New York, 2002.
Salisbury, C.D.C.; Chan, W.; Saschenbrecker, P. 1991. Multielement concentrations in liver and kidney tissues
from five species of Canadian slaughter animals. J. Assoc. Off. Anal. Chem. 74 (4): 587-591.
Santos EE, Lauria DC, Porto da Silveira CL. Assesment of daily intake of trace elements due to consumption of
foodstuffs by adult inhabitants of Rio de Janeiro city. Sci Tot Environ 2004;327:69-79.
Vahter M, Akesson A, Lidén C, Ceccatelli S, Berglund M. Gender differences in the disposition and toxicity of
metals. Environ Res 2006.
Vos G, Hovens JPC, Delft WV. 1987. Arsenic, cadmium, lead and mercury in meat, livers and kidneys of cattle
slaughtered in The Netherlands during 1980-1985. Food Add Contam 4(1):73-88.
World Health Organization (WHO). International Program for Chemical Safety Inorganic Lead. Environmental
health criteria 165. Inorganic lead. Geneva, 1995.
Este trabajo ha sido subvencionado por la Junta de Castilla y León (España) Referencia: LE035A06.
Agradecemos su colaboración al Departamento de Bioquímica de la Universidad de Santiago de Compostela y
a la Empresa Ganadera de D. Laurentino Marcos.
STARVED PERIOD IN LATE GESTATION: EFFECTS ON EWES AND
LAMBS
RESTRICCIÓN DEL ALIMENTO EN LA GESTACIÓN AVANZADA:

EFECTOS SOBRE LA OVEJA Y SOBRE EL CORDERO
UTJECAJ GLADOVANJA TIJEKOM KASNE GRAVIDNOSTI NA OVCU I

JANJAD
Benech A1, Cal L2, Martín A2, Da Silva S1, Lataste V1, Torío R2, Fernández Rodríguez
F3, González Montaña JR2, Prieto Montaña F2 y Rodas E1.
1.
Faculty of Veterinary Science. University de la República. Montevideo, Uruguay. E-mail: alebenech@
hotmail.com
2.
Department of Veterinary Medicine, Surgery and Anatomy, University of León, 24071, Spain.
3. Regional laboratory of Animal Health. Junta de Castilla y León. León, Spain.
SUMMARY
The extensive ovine farming depends too much on the weather conditions and especially on the availability
of food. It was evaluated the effect of food restriction in the final pregnancy stage. It was used double purpose
ewes (meat-wool) maintained in extensive conditions, which it was known breed date. At the 142-d of pregnancy,
animals were divided in three groups. The first group animals had a starved period for 24 h; second one for 48
h and the other group was considered as testing group. It was determined the glycemia, seric cortisol, ketonuria
and urinary pH twice at day in all ewes, as well as glycemia and seric cortisol in lambs at the moment of birth.
Whereas, was determined the vitality and evolution in each lamb during two weeks. All starving ewes showed
significant decrease of glycemia and urinary pH, and increased of ketonuria. It was observed an increase of
blood cortisol level due to stress period for food restriction. All the lambs from starving ewes showed lower
weight than the control group, but those differences disappeared at 15 days-old. There were no differences in
glycemia, blood cortisol, neither in the open field test parameters. There is not difference for mortality rate
among the groups. We can conclude that 24 or 48 hours of starvation from 142nd day of pregnancy caused low
weight in stillbirth, but this condition they could recovered into the two first weeks of life. Mortality rate and
open field test parameters were not affected in the first week.
RESUMEN
Las explotaciones extensivas ovinas son muy dependientes de las condiciones climáticas y sobre todo de
la disponibilidad de alimento. Hemos evaluado la repercusión, tanto sobre las ovejas como sobre las crías, de
la restricción de alimento realizada en la fase final de gestación. Utilizamos ovejas de doble aptitud carne-lana
explotadas en régimen extensivo con fecha de cubrición conocida. En el día 142 de la gestación las ovejas
se dividieron en tres grupos. Un grupo se sometió a un ayuno de 24 horas, otro grupo se mantuvo en ayuno
durante 48 horas y el resto de las ovejas permanecieron en el pasto como grupo control. En las ovejas se midió
la glucemia, el cortisol sérico, la cetonuria y el pH urinario cada 12 horas, así como la glucemia y el cortisol
sérico de los corderos en el momento del nacimiento. Asimismo se valoró la vitalidad y la evolución de los
corderos durante las dos primeras semanas de vida. En los grupos sometidos a ayuno las ovejas presentaron
una disminución significativa de la glucemia y del pH urinario, así como un incremento de la cetonuria. El
incremento del cortisol sanguíneo parece tener su origen en la respuesta de adaptación de la oveja a la restricción
alimentaria. Los corderos de las ovejas sometidas a ayuno presentaron menor peso que los del grupo control,
esas diferencias desaparecieron a los 15 días del parto. No se encontraron diferencias en la glucemia ni el cortisol
sanguíneo en el momento del parto, ni en los períodos parto-estación, ni parto-succión; así como tampoco en
la prueba de actividad de los corderos. No se observaron diferencias entre los grupo en la mortalidad. Podemos
concluir que en las ovejas un ayuno de 24 ó 48 h a partir del día 142 de gestación conduce al nacimiento de
corderos más livianos, si bien estos logran una recuperación del peso dentro de los primeros 15 días de vida.
Además no se vio aumentada la mortalidad, ni disminuyó la actividad de los corderos a la semana de vida.
Sažetak
Ekstenzivno ovčarenje umnogome zavisi o klimatskim uvjetima te posebice o raspoloživosti krmiva.
Proučili smo utjecaj restriktivne prehrane tijekom završne faze gravidnosti, kako na ovce tako i na janjad.
Korištene su ekstenzivno držane ovce, kombiniranih proizvodnih svojstava (meso-vuna) sa poznatim datumom
parenja. Točno 142. dana gravidnosti životinje su podijeljene u 3 skupine. Jedna je grupa podvrgnuta 24, druga
48 satnom postu, dok su preostale ovce nastavile pasti kao kontrolna skupina. U ovaca je svako 12 sati mjerena
glikemija, serumski kortizol, ketonurija i ph mokraće, kao i glikemija te serumski kortizol u janjadi neposredno
nakon poroda. Jednako tako procjenjivala se vitalnost i razvoj janjadi tijekom prva dva tjedna života. U grupama
ovaca podvrgnutih gladovanju utvrđeno je znakovito smanjenje glikemije i ph urina, kao i porast ketonurije.
S druge pak strane, čini se da je porast krvnog kortizola nastao kao adaptacijski odgovor ovce na restrikciju
prehrane. Janjad ovaca podvrgnutih postu je imala manju težinu, nego janjad kontrolne skupine. Razlike su
nestale 15 dana nakon poroda. Nisu utvrđene razlike u glikemiji i krvnom kortizolu u vrijeme poroda, kao
ni u trajanju razudoblja porod-ustajanje, porod-sisanje te u probama aktivnosti janjadi. Nisu utvrđene razlike
između grupa u mortalitetu. Možemo zaključiti kako u ovaca post u trajanju od 24 ili 48 sati počevši 142.
dana gravidnosti dovodi do rađanja janjadi manje tjelesne mase, koja nadoknadi isti manjak unutar prvih 15
dana života. Nadalje, nije utvrđen povećani mortalitet kao ni smanjena aktivnost janjadi tijekom prvog tjedna
života.
INTRODUCTION
Las condiciones de cría extensiva en que se producen los ovinos en Uruguay hacen que la
alimentación de la oveja gestante sea muy dependiente de las condiciones climáticas. Por ello es
posible que al final de la gestación el aporte de las praderas naturales no sea suficiente para las
demandas energéticas que requiere el feto en crecimiento.
La tasa de crecimiento fetal está influenciada significativamente por el ambiente uterino, quien
a su vez es modulado por hormonas, factores de crecimiento y nutrientes. Por tal motivo, el estado
nutricional de la madre puede afectar el desarrollo y crecimiento de la placenta y del feto (Robinson,
1983; Robinson, 1996) ya que una mala nutrición de la madre durante 7 a 21 días entre los días 124 y
138 lleva a una reducción del 50 % en la captación neta de glucosa a nivel umbilical y de la glucemia
fetal (Leury et al, 1990).
Aunque muchos autores coinciden en que las necesidades nutricionales del feto son bajas al
comienzo y en la mitad de la gestación (Wallace, 1948; Geenty, 1997; Père, 2003; Rhind, 2004;
Montossi, 2005), se ha encontrado que una baja nutrición de la madre en todos los estadios de la
preñez pueden afectar al crecimiento fetal (Rhind et al, 1989; Abecia et al, 1997; Bloomfield et al,
2003; Fahey et al, 2005).
Los efectos de una baja nutrición han sido largamente estudiados en los animales de producción,
particularmente en los rumiantes ya que muchas veces son explotados en zonas marginales en las
cuales el aporte de nutrientes es bajo (Rhind, 2004). Sin embargo existe escasa bibliografía sobre la
evaluación del efecto del ayuno agudo sobre la viabilidad de los corderos.
El objetivo del presente trabajo es evaluar el efecto de la restricción alimenticia, al final de la
gestación, tanto sobre la oveja como sobre el cordero.
El protocolo experimental del presente trabajo fue aprobado por la Comisión Honoraria de
Experimentación Animal (CHEA) de la Universidad de la República, Uruguay y se realizó en el
Campo Experimental Nº 2 de laFacultad de Veterinaria (Libertad, Km 42,5 ruta Nº1, San José,
Uruguay, 34º, 38´ S y 56º,39´º W).
Se utilizaron 30 ovejas preñadas de raza Corriedale obtenidas de una rebaño de 50 animales
cuyos celos fueron sincronizados mediante el uso de esponjas intravaginales conteniendo 60 mg/
esponja de medroxiprogesterona (Sincrocel®, Santa Elena) durante 12 días (Romano et al, 1993).
La cubrición se realizó con dos carneros de raza Corriedale a los que se les preparó con arneses
marcadores. Los carneros se introdujeron en el corral donde se encontraban las ovejas el mismo día
en que se retiraron las esponjas intravaginales y dos veces por días se controló la monta. Las ovejas
marcadas en la grupa fueron separadas, registrándose el día en que fue cubierta cada oveja como día
cero de la gestación, la que se confirmó mediante ecografía transabdominal entre los días 50 y 60 de
la monta (Buckrell, 1988). En el día 142 de gestación los animales se dividieron en tres grupos al
azar: Grupo A) 10 ovejas se sometieron a un ayuno total para sólidos de 24 h, Grupo B) 10 ovejas se
sometieron a un ayuno total para sólidos de 48 h y Grupo C) 10 ovejas que permanecieron a campo
como grupo control.
En las ovejas se registró el peso corporal y se tomaron muestras de sangre y orina cada 12 h para
determinar glicemia y cortisol en sangre y cuerpos cetónicos (CC) y pH en orina. En los corderos se
registró el peso al nacimiento, a los 15 días y al momento del destete (2 meses de edad), la mortalidad
dentro de los 3 primeros días de vida, el tiempo que tardaron en erguirse sobre las 4 patas y que
mamaron calostro por primera vez. También se obtuvo una muestra de sangre de cada cordero al
momento del nacimiento para determinar glucosa y cortisol y se realizó una prueba de actividad de
“campo abierto” (open field) a la semana de vida.
Para el estudio estadístico se utilizó el programa informático SPSS 13.0.

Al final del protocolo el grupo control registró un aumento de peso del 1,2% (p<0,001) con respecto
a su peso inicial. Las ovejas del grupo sometido a ayuno durante 24 h presentaron una pérdida de peso
de un 5% de su peso inicial, mientras que las ovejas del grupo encerrado durante 48 h perdieron en
promedio un 11% de su peso inicial.
A las 12 horas de ayuno los grupos A y B mostraron un descenso significativo de la glucemia (p
< 0,001) que se vio reflejado en la presencia de altos niveles de CC y descenso significativo del pH
en orina. Este hecho fue descrito por Dufield (2000) quien afirma que la presencia de CC en la orina
se corresponde con cetosis subclínica. Una oveja del grupo B debió ser retirada por presentar signos
de Toxemia de la Gestación, lo que demuestra el alto riesgo de producción de esta enfermedad por
la restricción de comida al final de la gestación. También se observó aumento del cortisol en suero,
posiblemente como respuesta a la hipoglucemia causada por el ayuno (Cal y col, 2006).
Los corderos nacidos de los grupos A y B fueron significativamente más livianos que los corderos
nacidos del grupo control (p < 0,05). Posiblemente la hipoglucemia provocada por restricción de
comida repercutió en la glucemia fetal, llevando al feto a utilizar menos glucosa con el consecuente
retraso en el crecimiento (Liggins y Thorburn, 1994). Sin embargo el peso a los 15 días y al destete
no mostró diferencias entre los grupos, mostrando la capacidad de crecimiento compensatorio ya
descrito por Banchero y col (2005) en los corderos mellizos con respecto a los partos simples.
La restricción de comida al final de la gestación no afectó los períodos parto-estación ni parto-
succión, al contrario de lo encontrado por Dwyer y col (2003) de que los corderos más pesados tienen
un mayor porcentaje de éxito en encontrar la teta, así como tampoco se registraron diferencias en la
prueba de actividad de “campo abierto” realizada a la semana de vida. La glucemia y el cortisol en
suero al nacimiento no mostraron diferencias entre los grupos. En los grupos tratados no aumentó
la mortalidad de los corderos, que se encontró dentro de los valores registrados históricamente en el
país (del 10 al 35 %) (Mari, 1987).
REFERENCES
Abecia, J.A; Lozano, J.M; Forcada, F; Zarazaga, L (1997). Effect of level of dietary energy and
protein on embrio survival and progesterona production on day 8 of pregnancy in Rasa Aragonesa
ewes. Anim. Reprod. Sci. (48): 209-218.
Banchero, G; Quintans, G; Milton, J; Lindsay, D (2005). Comportamiento maternal y vigor de los
corderos al parto: Efecto de la carga fetal y la condición corporal. Reproducción ovina: recientes
avances realizados por el INIA, Treinta y Tres, Uruguay,pp: 85-102.
Bloomfield, F.H; Oliver, M.H; Hawkins, P; Campbell; M; Phillips, D.J; Gluckman, P.D; Challis,
J.R; Harding, J.E (2003). A periconceptional nutritional origin for noninfectious preterm birth.
Science (300): 561–562.
Buckrell, B.C (1988). Application of ultrasonogrphy in reproduction in sheep and goats.
Theriogenology (29): 11-20.
Cal, L; Benech, A; Abreu, M.N; Borteiro, C; Cruz, J.C; Ricciardi, L; Godiño, L; Nievas, C; Rodas,
E; González Montaña, J.R (2006). Evaluaciónpreliminar del riesgo de aparición de toxemia de
la gestación en ovejas bajo diferentes manejos nutricionales y sometidas a ayuno de 48 horas.
VETERINARIA (Montevideo), vol. 41 (161-162): 39-44.
Duffield, T (2000). Subclinical ketosis in lactating dairy cattele. Vet. Clin. North Am.:Food An.
Pract., vol. 16 (2): 231-251.
Dwyer, C.M; Lawrence, A.B; Bishop, S.C; Lewis, M (2003). Ewe-lamb behaviours at birth are
affected by maternal undernutrition in pregnancy. British J. Nutr. (89): 123-136.
Fahey, A.J; Brameld, J.M; Parr, T; Buttery, P.J (2005). The effect of maternal undernutrition before
muscle differentiation on the muscle fiber development of the newborn lamb. J Anim Sci. vol.83,
(11):2564-2571.
Geenty, K.G (1997). A guide to improve lambing percentage of farmers and advisors. Rev 200 by
2000.
Leury, B.J; Bird, A.R; Chandler, K.D; Bell, A.W (1990). Glucose partitioning in the pregnant ewe:
effects of undernutrition and exercise. British J. Nutrition (64): 449-462.
Liggins, G. C.y Thorburn, G. D (1994). Initiation of parturition. In: Marshall´s Physiology of
Reprodaction, Pregnancy and lactation, Part Two, Fetal Physiology, Parturition and Lactation G.
E. Lamming (Editor),4th edn., Vol. 3,. Chapman and Hall, London.
Mari, J (1987) Enfermedades que afectan la supervivencia del cordero. En: Enfermedades de los
lanares. Tomo III. J. Bonino (Ed). Hemisferio Sur, Montevideo – Uruguay.
Montossi, F; De Barbieri, I; Digiero, A; Martinez, H; Nolla, M; Luzardo, S; Mederos, A; San Julián,
R; Saint, W; Levratto, J; Furgoni, J; Lima, G; Costales, J (2005) La esquila preparto temprana:
Una nueva opción para la mejora reproductiva ovina.En: Seminario de actualización técnica.
Reproducción ovina: recientes avances realizados por el INIA, Treinta y Tres, Uruguay, pp: 85-
102
Père, M.C (2003). Materno-foetal exchanges and utilisation of nutrients by the foetus: comparision
between species. Reprod. Nutr. Dev. (43): 1-15.
Rhind, S.M (2004). Effect of maternal nutricio non fetal and neonatal in reproductive development
and function. Anim Reprod Sci 82-83: 169-181.
Rhind, S.M; McKelvey, W.A.C; McMillen, S.R; Gunn, R.G; Elston, D.A. (1989). Effect of restricted
food intake, before and/or after mating, on the reproductive performance on greyface ewes.
Anim. Prod. (48): 149-155.
Robinson J J. (1983) Nutrition of the pregnant ewe. En: Sheep Production. London, Butterworths.
Robinson, J.J. (1996). Nutrition and reproduction. Am. Reprod. Sci. (42): 25-34.
Romano, J.E y Benech, A (1996). Effects of service and vaginal-cervix anaesthesia on estrus duration
in dairy goats. Theriogenology (45): 691-696.
Wallace, L.R (1948). The growth of the fetal lamb before and after birth in relation to the level of
nutrition. J.Agric. Sci. (38): 17-302.
Bone metabolism in dairy ewes during lactation
Koštani metabolizam u mliječnih ovaca tijekom

laktacije
Filipović, Natalija1, Nikica Prvanović2, T. Mašek3, Ž. Mikulec3, Z. Stojević1

1
Department of Physiology and Radiobiology, Faculty of Veterinary Medicine University of Zagreb
2
Clinic for Obstetrics and Reproduction, Faculty of Veterinary Medicine University of Zagreb
3
Department of Animal Nutrition, Faculty of Veterinary Medicine University of Zagreb
Summary
Pregnancy and lactation induce changes in mineral metabolism and may compromise the skeletal integrity.
Due to a high milk production of dairy ewes lactation is a metabolically demanding process. A rapid increase
in milk production in the beginning of lactation causes increase the need for calcium and phosphorus, which
cannot be adequately satisfied by absorption from the digestive tract. The consequence is an elevated rate of
bone resorption. The aim of this study was to investigate the changes in concentration of bone remodelling
markers in relation to the hormonal changes and milk production during lactation in dairy ewes. The research
was conducted on ten crossbred Istrian X East Friesian dairy ewes. During the experimental period the ewes
received 1 kg/ewe/day of concentrate mixture, 0.3 kg/ewe/day Lucerne hay and were allowed to graze from 7:00
a.m. to 15:00 p.m. and from 18:00 p.m. to 21:00 p.m. on rotational mixed grass pasture. The concentrate mixture
was composed of corn (35%), barley (20%), sunflower meal (16%), wheat bran (16%), soybean meal (8%),
and vitamin-mineral mixture (5%). Samples for blood analyses were taken in five times during the experiment:
10 days before lambing (D -10), on day 10 (D +10), day 20 (D +20), day 90 (D +90) and on day 130 after
lambing (D +130). Concentrations of crosslinked carboxyterminal telopeptide of type I collagen, a marker
of bone resorption (CTx); parathyroid hormone (PTH), estradiol 17β (E17 β), and activity of bone specific
alkaline phosphatase, a marker of bone synthesis (BAP) were determined in blood serum by using commercial
ELISA kits. A statistically significant influence of experimental period was observed for CTx (p<0.0001), BAP
(p<0.0001), E17 β (p<0.001), milk quantity (p<0.001) and milk protein yield (p<0.0001). The concentration of
CTx was significantly lower on D +90 in comparison with D -10 and D +20 (p<0.05 and p<0.001) and on D
+130 in comparison with D -10, D +10 (p<0.05) and D +20 (p<0.001). The activity of BAP was significantly
higher on D +90 in comparison with D -10 (p<0.01), D +10, D +20 and D +130 (p<0.001). The concentration of
E17 β was significantly higher on D -10 in comparison with D +10 (p<0.05), D +20, D +90 and D +130 (p<0.01).
The milk protein yield was significantly higher on D +20 in comparison with D+10 and D +130 (p<0.01) and
on D +90 in comparison with D +10 (p<0.05). A statistically significant correlation between the milk protein
yield and concentration of CTX (r = 0.75; p<0.0001) and activity of BAP (r = - 0.50; p<0.01); between the
activity of BAP and concentration of CTx (r = - 0.46; p<0.01) and PTH (r = - 0.33; p<0.05); and between the
concentration of PTH and E17 β (r = 0.66; p<0.0001). The changes in the CTx concentration indicate to high
rate of bone resorption in the late pregnancy and early lactation that decreased in the late lactation and was
directly related to the milk production rate. The changes in the activity of the BAP prove decreased rate of bone
synthesis in the late pregnancy and early lactation that increased in the late lactation and was inversely related to
the milk production rate. The bone resorption and the bone synthesis were inversely related during lactation in
ewes. The concentration of the PTH was inversely related to the rate of bone synthesis that is consistent to the
role of PTH in osteoblasts activity. The relation of PTH and E17 β concentrations shows that the regulation of
bone metabolism in late pregnancy and early lactation is, similarly to other species, at least in part, influenced
by estradiol changes. The presented data confirm a high mobilisation of minerals from skeleton during late
pregnancy and early lactation in dairy ewes. The level of bone loss was directly related to the milk production
rate. In comparison with data from literature for dairy cows, the similar influence of lactation on bone resorption
was observed for ewes, but in dry period the rate of bone resorption was higher in ewes indicating relatively
higher need for minerals in the late pregnancy in ewes. Observed changes in levels of bone markers are consistent
to data from literature for East Friesian ewes, but earlier decrease of bone resorption rate was observed in the
present investigation that was related to shorter lactation and earlier fall of milk production rate.
Key words: bone metabolism, ewes, dry period, lactation, milk production
Sažetak
Istražen je utjecaj kasne gravidnosti i laktacije na koncentraciju biljega koštane pregradnje u krvnom
serumu ovaca. Istraživanje je provedeno na deset križanih mliječnih ovaca (istarske X istočnofrizijska). Uzorci
krvi uzimani su 5 puta tijekom pokusa: 10 dana prije janjenja (D -10), 10. dan (D +10), 20. dan (D +20),
90. dan (D +90) i 130. dan poslije janjenja (D +130). U uzorcima krvnog seruma određene su koncentracije
paratireoidnog hormona (PTH), križno povezanog C-terminalnog telopeptida kolagena tipa I (CTx) – pokazatelja
koštane resorpcije; estradiola 17 β (E17 β), te aktivnosti koštane alkalne fosfataze (BAP) – pokazatelja koštane
sinteze. Statistički značajan utjecaj istraživanih razdoblja utvrđen je za CTx (p<0.0001), BAP (p<0.0001), E17 β
(p<0.001), količinu mlijeka (p<0.001) i ukupnu količinu bjelančevina u mlijeku (p<0.0001). Koncentracija CTx
bila je značajno niža u razdoblju D +90 u usporedbi s D -10 i D +20 (p<0.05 i p<0.001), te u razdoblju D +130
u usporedbi s D -10, D +10 (p<0.05) i D +20 (p<0.001). Aktivnost BAP bila je značajno viša u razdoblju D +90
u usporedbi s D -10 (p<0.01), D +10, D +20 i D +130 (p<0.001). Koncentracija E17 β bila je značajno viša u
razdoblju D -10 u usporedbi s D +10 (p<0.05), D +20, D +90 i D +130 (p<0.01). Ukupna količina bjelančevina
u mlijeku bila je značajno viša u razdoblju D +20 u usporedbi s D+10 i D +130 (p<0.01) i u razdoblju D +90 u
usporedbi s D +10 (p<0.05). Statistički značajna korelacija utvrđena je između ukupne količine bjelančevina
u mlijeku i koncentracije CTX (r = 0.75; p<0.0001) i aktivnosti BAP (r = - 0.50; p<0.01); između aktivnosti
BAP i koncentracije CTx (r = - 0.46; p<0.01) i PTH (r = - 0.33; p<0.05); kao i između koncentracije PTH i E17
β (r = 0.66; p<0.0001). Rezultati istraživanja ukazuju na povećani opseg koštane resorpcije i smanjeni opseg
koštane sinteze tijekom kasne gravidnosti i rane laktacije u ovaca, koji je izravno povezan s količinom ukupnih
bjelančevina dnevno izlučenih mlijekom, kao pokazateljem proizvodnje.
Ključne riječi: koštani metabolizam, ovce, suhostaj, laktacija, proizvodnja mlijeka
Uvod
Gravidnost i laktacija induciraju promjene u metabolizmu minerala koje mogu utjecati na
integritet kostura. Visoka proizvodnja mlijeka u mliječnih krava, ovaca i koza metabolički je vrlo
zahtjevan proces. U početku laktacije dolazi do naglog porasta proizvodnje mlijeka. Navedeno
uzrokuje porast potreba za kalcijem i fosforom, koje se ne mogu u potpunosti zadovoljiti resorpcijom
ovih minerala iz probavnog trakta, već se moraju nadoknaditi iz zaliha u kosturu (Liesegang i sur.,
2000). Tako je u mliječnih krava tijekom prvih 6 – 8 tjedana laktacije bilanca kalcija negativna
i kostur gubi oko 13% svojeg sadržaja kalcija (Horst i sur., 2005). U laktaciji i zadnjoj trećini
gravidnosti kod žena također je utvrđen povećani obim koštane pregradnje (Kovacs i Kronenberg,
1997). Metabolizam minerala reguliran je djelovanje brojnih hormona, od kojih se najvažnija uloga
pripisuje paratireoidnom hormonu (PTH). PTH potiče razgradnju koštane mase, poticanjem osteocitne
osteolize, kao i posrednim povećanjem broja i aktivnosti osteoklasta. Osim što potiče resorpciju
kosti, PTH istodobno ima i anaboličke učinke na koštano tkivo (Swarthout i sur., 2002; Jilka, 2007).
U bubrezima PTH povećava reapsorpciju kalcija u distalnim kanalićima bubrega i koči reapsorpciju
fosfata u proksimalnim kanalićima bubrega, kočeći izlučivanje kalcija i potičući izlučivanje fosfata
mokraćom, te potiče tvorbu 1,25 dihidroksi vitamina D3, koji utječe na povećanu razgradnju koštane
mase i povećava apsorpciju kalcija i fosfata iz crijeva (Genuth, 1988). Opseg koštanog prijetvora
može se pratiti posredno, mjerenjem biljega koštane pregradnje u krvi i mokraći, kao pokazatelja
aktivnosti koštanih stanica (Delmas, 1995). Križni povezanog C-terminalni telopeptid kolagena tipa
I (carboxyterminal crosslinked telopeptide of type I collagen, CTx), je jedan od produkata razgradnje
kolagena tipa I (koji je glavna komponenta organskog dijela koštanog matriksa) i jedan od najčešće
korištenih biljega koštane razgradnje u ljudi (Delmas, 1995). Koštanospecifična alkalna fosfataza
(bone specific alkaline phosphatase, BAP), je enzim osteoblasta mjerenje čije aktivnosti se učestalo
koristi kao biljeg opsega koštane sinteze (Delmas, 1995). Osim u humanoj medicini, primjena
navedenih biljega sve više se koristi i u istraživanjima koštanog metabolizma u domaćih životinja
(Liesegang i sur., 2000; 2006; 2007; Lepage i sur., 2001; Holtenius i Ekelund, 2005; Seebeck i sur.,
2005). U vezi s navedenim, istražen je utjecaj kasne gravidnosti i laktacije na koštani metabolizam
mliječnih ovaca, te njegova povezanost s kretanjem proizvodnje mlijeka, kao i hormonalnim
promjenama karakterističnim za ovo razdoblje.
Materijal i metode
Istraživanje je provedeno na deset križanih mliječnih ovaca (istarske X istočnofrizijska). Tijekom
pokusnog razdoblja obrok se sastojao od 1 kg smjese i 0.3 kg sijena lucerne po ovci dnevno uz
ispaša od 7:00 do 15:00 h i od 18:00 do 21:00 h na pregonskom pašnjaku zasijanom djetelinsko-
travnom smjesom. Smjesa se sastojala od kukuruza (35%), ječma (20%), suncokretove sačme (16%),
pšeničnog brašna (16%), sojine sačme (8%), i vitaminsko mineralnog premiksa (5%). Uzorci krvi
uzimani su 5 puta tijekom pokusa: 10 dana prije janjenja (D -10), 10. dan (D +10), 20. dan (D
+20), 90. dan (D +90) i 130. dan poslije janjenja (D +130). Nakon grušanja i centrifugiranja (2000
x g/20 minuta/4°C), iz uzoraka je izdvojen krvni serum. Uzorci za određivanje aktivnosti BAP i
koncentracije PTH su pohranjeni na -60°C, a ostali na -20°C. Koncentracija/aktivnost pojedinih
pokazatelja koštanog metabolizma određena je metodom ELISA, korištenjem gotovih kompleta
reagensa: Intact PTH (Parathyroid Hormone) ELISA (Biomerica, Newport Beach, SAD) za PTH;
Serum CrossLaps® ELISA (Nordic Bioscience Diagnostics, Denmark) za CTx; Metra BAP EIA Kit
(Quidel Corporation, San Diego, USA) za BAP; i VITROS Estradiol Reagent Pack (Ortho-Clinical
Diagnostics, Amersham, UK) za E17β. Tijekom analiza nije se odstupalo od uputstava proizvođača.
Uzorci mlijeka uzimani su usporedno s uzorcima krvi. Količine proizvedenog mlijeka do odbića
određene metodom po Benson-u i sur. (1999), a nakon odbića vaganjem količine mlijeka ispuštene
u menzuru iz uređaja za mužnju. Koncentracija bjelančevina u mlijeku određena je metodom
infracrvene spektrofotometrije (Milcoscan FT 120, Foss, Danska). Rezultati su statistički obrađeni
korištenjem računalnog paketa Statistica 7 (StatSoft, USA): analizom varijance (One way ANOVA),
post-hoc Tukey testom i određivanjem koeficijenta linearne korelacije. Razlike su smatrane statistički
značajnima ako je p<0.05.
Rezultati
Statistički značajan utjecaj istraživanih razdoblja utvrđen je za CTx (p<0.0001), BAP (p<0.0001),
E17 β (p<0.001), količinu mlijeka (p<0.001) i ukupnu količinu bjelančevina u mlijeku (p<0.0001).
Koncentracija CTx bila je značajno niža u razdoblju D +90 u usporedbi s D -10 i D +20 (p<0.05 i
p<0.001), te u razdoblju D +130 u usporedbi s D -10, D +10 (p<0.05) i D +20 (p<0.001). Aktivnost
BAP bila je značajno viša u razdoblju D +90 u usporedbi s D -10 (p<0.01), D +10, D +20 i D +130
(p<0.001). Koncentracija E17 β bila je značajno viša u razdoblju D -10 u usporedbi s D +10 (p<0.05),
D +20, D +90 i D +130 (p<0.01). Ukupna količina bjelančevina u mlijeku bila je značajno viša u
razdoblju D +20 u usporedbi s D+10 i D +130 (p<0.01) i u razdoblju D +90 u usporedbi s D +10
(p<0.05). Statistički značajna korelacija utvrđena je između ukupne količine bjelančevina u mlijeku
i koncentracije CTX (r = 0.75; p<0.0001) i aktivnosti BAP (r = - 0.50; p<0.01); između aktivnosti
BAP i koncentracije CTx (r = - 0.46; p<0.01) i PTH (r = - 0.33; p<0.05); kao i između koncentracije
PTH i E17 β (r = 0.66; p<0.0001).
Tablica 1. Deskriptivna statistika za istraživane pokazatelje u mliječnih ovaca tijekom kasne gravidnosti i laktacije
Table 1. Descriptive statistics for investigated parameters in dairy ewes during late pregnancy and lactation
BAP PTH E17 β (pmol/ milk protein
CTx (ng/mL)
(U/L) (pg/mL) L) (g/day)
Days -10 4,5
1,38 ±0,57 4
21,00 ±10,96 151,80 ±75,96 2,3,4,557,80 ±62,29
+10 5
1,31 ±0,53 4
11,50 ±5,48 161,00 ±141,65 128,20 ±12,90 3,4,5
3,49 ±0,95
before/
+20 4,5
1,69 ±0,60 4
12,10 ±4,46 170,30 ±68,80 125,90 ±11,99 2,4,5
5,08 ±1,49
after
+90 1,3
0,54 ±0,15 1,2,3,5
35,20 ±10,74 144,80 ±102,40 125,40 ±10,66 2,3
2,27 ±0,52
calving +130 1,2,3
0,43 ±0,19 4
19,80 ±9,69 171,30 ±82,22 125,90 ±7,50 2,3
1,95 ±0,50
Superskripti označavaju prema kojoj skupini postoji statistički značajna razlika.; Superscriptes denotes
statistically significant differences between groups.
Rasprava
Istražen je utjecaj kasne gravidnosti i laktacije na koštani metabolizam ovaca, praćenjem
koncentracija biljega koštane pregradnje u krvnom serumu. Kretanje koncentracija CTx ukazuje
na visoki opseg koštane resorpcije u kasnoj gravidnosti i ranoj laktaciji, koji se smanjio u
kasnoj laktaciji i bio izravno povezan s proizvodnjom mlijeka, izraženom kroz količinu ukupnih
bjelančevina dnevno izlučenih mlijekom. Kretanje aktivnosti BAP ukazuje na smanjeni opseg
koštane sinteze tijekom kasne gravidnosti i rane laktacije, koji je porastao u kasnoj laktaciji i bio
obrnuto proporcionalan s količinom bjelančevina izlučenih mlijekom. Navedeno je u suglasju s
podacima iz literature dobivenim istraživanjima na mliječnim kravama, ovcama i kozama, u kojima
je u početku laktacije utvrđen je povećani opseg koštane resorpcije i smanjeni opseg koštane sinteze
(Liesegang i sur., 2000; 2006; 2007; Holtenius i Ekelund, 2005; Filipović i sur., 2008). Opseg
koštane resorpcije i sinteze bili su obrnuto proporcionalni tijekom laktacije u ovaca. Koncentracija
PTH negativno je korelirala s opsegom koštane sinteze, što je u suglasju s ulogom PTH u poticanju
aktivnosti osteoblasta (Swarthout i sur., 2002; Jilka, 2007). Povezanost koncentracija PTH i E17 β
pokazuje da je regulacija koštanog metabolizma u kasnoj gravidnosti i ranoj laktaciji kod ovaca,
slično ostalim vrstama (Kovacs i Kronenberg, 1997; Filipović i sur., 2008), barem djelomično pod
utjecajem promjena koncentracije estradiola u cirkulaciji. Prikazani rezultati potvrđuju visoki opseg
mobilizacije minerala iz kostura tijekom kasne gravidnosti i rane laktacije u mliječnih ovaca. Opseg
gubitka koštane mase bio je izravno povezan s proizvodnjom mlijeka. Kao pokazatelj proizvodnosti
korištena je ukupna količina bjelančevina izlučena dnevno mlijekom. U usporedbi s podacima iz
literature za mliječne krave (Liesegang i sur., 2000; Holtenius i Ekelund, 2005; Filipović i sur.,
2008), utvrđen je sličan utjecaj laktacije na koštanu resorpciju kod ovaca, ali u suhostaju je opseg
koštane resorpcije bio visok u ovaca, što ukazuje na relativno visoke potrebe za mineralima u kasnoj
gravidnosti kod ovaca. Uočene promjene razine koštanih biljega u suglasju su s podacima iz literature
za istočnofrizijske ovce (Liesegang i sur., 2006; 2007), ali je u našem istraživanju utvrđen raniji pad
opsega koštane resorpcije tijekom laktacije, što je najvjerojatnije bilo povezano s kraćom laktacijom
i ranijim padom produkcije mlijeka.
Literatura
Benson, M. E., M. J. Henry, R. A. Cardellino (1999): Comparison of weigh-suckle-weigh and machine milking
for measuring ewe milk production. J. Anim. Sci. 77, 2330-2335.
Delmas, P. D. (1995): Biochemical markers of bone turnover. Acta Orthop. Scand. 66 (Suppl 266), 176-182.
Filipović, N., Z. Stojević, M. Zdelar-Tuk, V. Kušec (2008): Plasma parathyroid hormone-related peptide and
bone metabolism in periparturient dairy cows. Acta Vet. Hung. 56, 235–244.
Genuth, S. M. (1988): Endocrine System. U: Berne, R. M., M. N. Levy, Physiology, 2nd edition, The C. V.
Mosby Company, St. Louis, Washington, D. C., Toronto, Hrvatsko izdanje, Medicinska naklada, Zagreb,
pp 819-1023.
Holtenius, K., A. Ekelund (2005): Biochemical markers of bone turnover in the dairy cow during lactation and
the dry period. Res. Vet. Sci. 78, 17-19.
Horst, R. L., J. P. Goff, T. A. Reinhardt (2005): Adapting to the Transition Between Gestation and Lactation:
Differences Between Rat, Human and Dairy Cow. J. Mammary Gland Biol. Neoplasia. 10, 141-156.
Jilka, R. L. (2007): Molecular and cellular mechanisms of the anabolic effect of intermittent PTH. Bone. 40,
1434-1446.
Kovacs, C. S., H. M. Kronenberg (1997): Maternal-Fetal Calcium and Bone Metabolism During Pregnancy,
Puerperium, and Lactation. Endocr. Rev.18, 832-872.
Lepage, O. M., B. Carstanjen, D. Uebelhart (2001): Non-invasive assessment of equine bone: an update. Vet.
J. 161, 10-22.
Liesegang A., R. Eicher, M. L. Sassi, J. Risteli, M. Kraenzlin, J. L. Riond, M. Wanner (2000): Biochemical
markers of bone formation and resorption around parturition and during lactation in dairy cows with high
and low standard milk yields. J. Dairy Sci. 83, 1773-1781.
Liesegang A., J. Risteli, M. Wanner (2006): The effects of first gestation and lactation on bone metabolism in
dairy goats and milk sheep. Bone. 38, 794-802.
Liesegang A., J. Risteli, M. Wanner (2007): Bone metabolism of milk goats and sheep during second pregnancy
and lactation in comparison to first lactation. J. Anim. Physiol. Anim. Nutr. (Berl) 91, 217-225.
Seebeck P, Bail HJ, Exner C, Schell H, Michel R, Amthauer H, Bragulla H, Duda GN. (2005): Do serological
tissue turnover markers represent callus formation during fracture healing? Bone. 37, 669-677.
Swarthout, J. T., R. C. D’Alonzo, N. Selvamurugan, N. C. Partridge (2002): Parathyroid hormone-dependent
signaling pathways regulating genes in bone cells. Gene. 282, 1-17.
Activity of glutathione peroxidase in sperm and blood
serum of simmental breeding bulls
Aktivnost glutation peroksidaze u spermi i krvnom

serumu bikova simentalske pasmine
I. Majić-Balić1, S. Milinković-Tur2, J. Piršljin2, B. Beer Ljubić2, A. Orak1, P. Božić3

1
Centar for reproduction and animal breeding, Potočka 20, Križevci, Croatia
2
Department of physiology and radiobiology, University of Zagreb, Faculty of veterinary medicine, Heinzelova
55, Zagreb, Croatia
3
Centar for reproduction and animal breeding, Planinska 2b, Zagreb, Croatia
Sažetak
Glutation peroksidaza je enzim koji ima ključnu ulogu u zaštiti stanica od oksidativnih oštećenja
uklanjajući vodikov peroksid kao i druge hidroperokside. Porodicu glutation peroksidaza čine četiri izoenzima
koji u aktivnom centru sadrže element selen i jedan izoenzim koji ne sadrži selen. Membrana spermija bogata
je višestrukonezasićenim masnim kiselinama koje su vrlo osjetljive na oksidaciju pri čemu nastaju lipidski
hidroperoksidi. Aktivnost antioksidativnih enzima u citoplazmi spermija je ograničena, te je stoga sastav sjemene
plazme vrlo važan u očuvanju integriteta i oplodne sposobnosti spermija. Mnogobrojni okolišni, fiziološki i
genetski čimbenici djeluju na smanjenje kvalitete sperme i mogu dovesti do neplodnosti životinje te je stoga
cilj rada bio utvrditi promjene aktivnosti glutation peroksidaze u spermi i krvnom serumu rasplodnih bikova
simentalske pasmine različite dobi. Uzorci sperme uzimani su pomoću umjetne vagine, a uzorci krvi punkcijom
v. jugularis od dvije skupine bikova: devet mlađih bikova starih između dvije i četiri godine i osam bikova starih
između šest i deset godina. Volumen ejakulata, koncentracija spermija te progresivna pokretljivost određeni su
u ejakulatu bikova. U izoliranim spermijima i krvnom serumu bikova određena je aktivnost izoenzima glutation
peroksidaze ovisne o selenu (SeGSH-Px), dok je u sjemenoj plazmi određena aktivnost ukupne glutation
peroksidaze (ukupna GSH-Px), SeGSH-Px kao i aktivnost glutation peroksidaze neovisne o selenu (neSeGSH-
Px). Aktivnost SeGSH-Px u krvnom serumu starijih bikova bila je značajno viša u odnosu na aktivnost kod
mlađih životinja (144,63 ± 48,79 U/L odnosno 80,67 ± 31,14 U/L; p<0,01). Usporedbom aktivnosti ukupne
GSH-Px i njenih izoenzima u spermijima i sjemenoj plazmi bikova utvrđene su vrlo ujednačene vrijednosti u
promatranim skupinama. Ocjenom volumena i koncentracije ejakulata kao i progresivne pokretljivosti spermija
u navedene dvije dobne skupine bikova nisu utvrđene značajne razlike. Navedeni rezultati ukazuju da dob utječe
na aktivnost glutation peroksidaze u krvnom serumu, no ne i na aktivnost ovog enzima u spermi rasplodnih
bikova simentalske pasmina.
Abstract
Glutathione peroxidase is an enzyme which plays a key role in protection of cells from oxidative damages
by removing hydrogen peroxide and organic peroxides. Family of glutathione peroxidase consists of four
isoenzymes and et the active site they contain selenium and one isoenzyme which does not contain selenium.
Sperm membrane is rich in polyunsaturated fatty acids susceptible to oxidation, which leads to creation of
lipid hydroperoxides. Activity of antioxidant enzymes in sperm cytoplasm is limited, so the composition of
seminal plasma is of crucial importance in preserving integrity and fertilization capacity of the sperm. Several
environmental, physiological and genetic factors affect reduction of sperm quality and can lead to infertility
of an animal, so the objective of this study was to define variations in activity of glutathione peroxidase in
sperm and blood serum of breeding bulls of Simmental breed of different ages. Sperm samples were collected
with artificial vagina and blood samples through punction v. jugularis from two groups of bulls: nine younger
bulls aged between two and four years and eight bulls aged between six and ten years. Volume of ejaculate,
sperm concentration and progressive motility were analyzed in the samples. Activity of selenium dependent
glutathione peroxidase (SeGSH-Px) was determined in isolated sperms and blood serum of bulls, whereas in
seminal plasma the activity of total glutathione peroxidase (total GSH-Px), SeGSH-Px was measured, as well
as activity of non-selenium dependent glutathione peroxidase (nonSeGSH-Px). Activity of SeGSH-Px in blood
serum of older bulls was significantly higher when compared to the activity of younger animals (144,63 ± 48,79
U/L, vs. 80,67 ± 31,14 U/L; p<0,01). Comparison of activity of total GSH-Px and its isoenzymes in sperm and
seminal plasma of bulls indicated very homogenous values in observed groups. No significant differences were
observed in evaluation of volume and concentration of ejaculate, as well as progressive motility of sperms in the
two age groups of bulls. Obtained results indicate that age influences the activity of glutathione peroxidase in the
blood serum, but it does not affect the activity of this enzyme in the sperm of Simmental breeding bulls.
Uvod
Razmnožavanje je temeljni proces koji omogućuje životinjama i ljudima prijenos gena na
potomstvo. Postoji veliki broj radova koji upućuju na to da stvaranje reaktivnih spojeva kisika
(ROS, eng. reactive oxygen species) i njihovo uklanjanje pomoću antioksidansa igra veliku ulogu
u plodnosti. U etiologiji mnogobrojnih bolesti pa tako i kao uzrok neplodnosti u ljudi navodi se
oksidativni stres. Tijekom oksidativnog stresa ne dolazi samo do poremećaja fluidnosti membrane
spermija zbog oksidativnih oštećenja lipida nego i do oštećenja integriteta DNA u jezgri spermija
(Agarwal i sur., 2003). Ova oštećenja mogu ubrzati proces apoptoze zametnih stanica dovodeći do
smanjenja broja spermija, smanjenja kvalitete sjemena i neplodnosti.
Neka od opisanih oksidativnih oštećenja mogu biti uklonjena, no spermiji su stanice s
vrlo ograničenim antioksidativnim kapacitetom zbog svoje specifične građe. Naime, aktivnost
antioksidativnih citoplazmatskih enzima je vrlo niska (Aitken i sur., 1989) što spermije čini
jedinstvenim s obzirom na stupanj osjetljivosti na oksidativni stres. Nadalje, plazmatska membrana
spermija sisavaca bogata je višestrukonezasičenim masnim kiselinama te je osjetljiva na oštećenja
izazvana ROS pri čemu se razvija lipidska peroksidacija (Sikka, 1996).
U antioksidativnoj zaštiti spermija sudjeluje veliki broj antioksidativnih spojeva u samoj stanici
kao i u sjemenoj plazmi koji kompenziraju mali antioksidativni kapacitet samih spermatozoa (Agarwal
i sur., 2003). Naročitu važnost imaju enzimi glutation peroksidaza (Imai i sur., 2001; Vaisberg i sur.,
2005), superoksid dismutaza, katalaza kao i glutation (Imai i sur., 2001).
Glutation peroksidaza je enzim koji ima ključnu ulogu u zaštiti stanica od oksidativnih oštećenja
uklanjajući vodikov peroksid i organske hidroperokside (Michiels i sur., 1994). Porodicu glutation
peroksidaza čine četiri izoenzima koji u aktivnom centru sadrže element selen i jedan izoenzim koji
ne sadrži selen (Halliwell i Gutteridge, 1999).
Mnogobrojni okolišni, fiziološki i genetski čimbenici djeluju na smanjenje kvalitete sperme i
mogu dovesti do neplodnosti životinje te je stoga cilj rada bio utvrditi promjene aktivnosti glutation
peroksidaze u spermi i krvnom serumu rasplodnih bikova simentalske pasmine različite dobi.
Materijali i metode
Istraživanje je provedeno na 17 bikova simentalske pasmine. Životinje su grupirane u dvije
skupine: devet mlađih bikova starih između dvije i četiri godine i osam bikova starih između šest i
deset godina. Bikovi su držani u jednakim hranidbenim i smještajnim uvjetima tijekom istraživanja.
Hranjeni su dva puta dnevno sa 8 kg krmne smjese, oko 10 kg livadnog sijena, 6 kg sjenaže, slame po
volji, te im je na raspolaganju bila stočna sol (MISSOL KR) za lizanje. Bikovi su napajani pomoću
automatskih pojilica.
Uzorci sperme uzimani su pomoću umjetne vagine, a uzorci krvi punkcijom v. jugularis.
Serum je dobiven centrifugiranjem krvi na 1500 g/15 minuta. Sjemena plazma je odvojena nakon
centrifugiranja uzoraka sperme na 1000 g/15 minuta. Talog spermija je resuspendiran u destiliranoj
vodi kako bi se izazvala liza spermija te je uzorak centrifugiran 3000 g/15 minuta.
Volumen ejakulata, koncentracija spermija te progresivna pokretljivost određeni su u ejakulatu
bikova. Volumen polučenih ejakulata određivao se očitavanjem na graduiranom spermoprimaču.
Koncentracija spermija u ejakulatima određena je elektronskim brojačem «PHOTOMETAR SDM 5-
mini tub». Progresivna pokretljivost spermija ocjenjena je binokularnim mikroskopom «OLYMPUS»
model BX 50 F s ugrađenim spermotermom.
U izoliranim spermijima i krvnom serumu bikova određena je aktivnost izoenzima glutation
peroksidaze ovisne o selenu (SeGSH-Px) metodom po Paglia and Valentine (1967), dok je u sjemenoj
plazmi određena aktivnost ukupne glutation peroksidaze (ukupna GSH-Px) metodom po Lawrence
i Burku (1976), SeGSH-Px kao i aktivnost glutation peroksidaze neovisne o selenu (neSeGSH-Px).
Aktivnost neSeGSH-Px izračunata je kao razlika ukupne GSH-Px i SeGSH-Px.
Aktivnost glutation peroksidaze u izoliranim spermijima i sjemenoj plazmi izražena je po
gramu bjelančevina koje su određene metodom po Lowry i sur. (1951) s goveđim albuminom kao
standardom.
Rezultati su prikazani kao srednja vrijednost ± standardna devijacija. Značajnost razlika među
rezultatima provjerena je t-testom i Mann-Whitney U testom, korištenjem računalnog programa
Statistica 7.1. Razlike se smatraju statistički značajnim ako je p < 0,05.
Rezultati
Rezultati aktivnosti glutation peroksidaze u spermijima, sjemenoj plazmi i krvnom serumu
bikova su prikazani su tablici 1.
Aktivnost SeGSH-Px u krvnom serumu starijih bikova bila je značajno viša u odnosu na aktivnost
kod mlađih životinja (144,63 ± 48,79 U/L odnosno 80,67 ± 31,14 U/L; p<0,01). Usporedbom
aktivnosti ukupne GSH-Px i njenih izoenzima u spermijima i sjemenoj plazmi bikova utvrđene su
vrlo ujednačene vrijednosti u promatranim skupinama.
Tablica 1. Aktivnost glutation peroksidaze u spermijima, sjemenoj plazmi i krvnom serumu bikova
Stariji bikovi (n=8) Mlađi bikovi (n=9) P<

Spermiji
SeGSH-Px 833,42 ± 495,42 602,33 ± 150,26 ns
(U/g bjelanč.)
Ukupna GSH-Px 1359,96 ± 337,97 1368,03 ± 179,89 ns
Sjemena plazma
SeGSH-Px 418,72 ± 163,08 448,89 ± 93,47 ns
(U/g bjelanč.)
neSeGSH-Px 941,23 ± 239,82 919,14 ± 156,79 ns
Krvni serum (U/L) SeGSH-Px 144,63 ± 48,79 80,67 ± 31,14 0,01
Rezultati volumena ejakulata, koncentracije i progresivne pokretljivosti spermija bikova

prikazani su tablici 2. Ocjenom volumena i koncentracije ejakulata kao i progresivne pokretljivosti
spermija u navedene dvije dobne skupine bikova nisu utvrđene značajne razlike (p>0,05).
Tablica 2. Volumen ejakulata, koncentracija i progresivna pokretljivost spermija bikova
Stariji bikovi (n=8) Mlađi bikovi (n=9) P

Volumen ejakulata (ml) 4,73 ± 2,72 2,84 ± 1,08 ns
Koncentracija spermija (*109/ml) 1,25 ± 0,28 1,18 ± 0,30 ns
Progresivna pokretljivost (%) 80,00 ± 9,01 79,50 ± 11,41 ns
Rasprava
Pod utjecajem brojnih okolišnih, genetskih čimbenici kao i dobi dolazi do smanjenje
kvalitete sperme i neplodnosti kod ljudi (Sikka, 1996). Rutinske analize sjemena podrazumijevaju
makroskopsku (volumen, boja, miris, konzinstencija) i mikroskopsku (pokretnjivost, morfološke
osobitosti, koncentracija spermija) ocjenu. Na osnovi rezultata ovih analiza uzorci sjemena bikova
se uzimaju za duboko smrzavanje ili se odbacuju kao nedovoljno kvalitetni. U ovom istraživanju
rezultati volumena ejakulata, koncentracije spermija i progresivne pokretljivosti u obje skupine
bikova su bile ujednačene.
Neka istraživanja pokazuju da je ocjena kvalitete sjemena samo na osnovi makroskopskog i
mikroskopskog pregleda nedostatna te se predlaže određivanje dodatnih biokemijskih pokazatelja
u spermijima i sjemenoj plazmi. Kako oksidativni stres igra veliku ulogu u plodnosti životinja za
procijenu kvalitete uzoraka sperme raspoldnih bikova u radu smo određivali aktivnost glutation
peroksidaze.
Za održavanje plodnosti naročito je važna fosfolipid hidroperoksidna glutation peroksidaza
(Vaisberg i sur., 2005), izoenzim ovisan o selenu koji ima ulogu u spermatogenezi i funkciji
spermija, a smanjena aktivnost dovodi do smanjene plodnosti (Imai i sur., 2001; Imai i Nakagawa,
2003.). Aktivnost glutation peroksidaze u spermi rasplodnih bikova u korelaciji je s progresivnom
pokretljivošću spermija (Vaiseberg i sur., 2005).
U ovom istraživanju u sjemenoj plazmi bikova utvrđena je dvostruko veća aktivnost izoenzima
glutation peroksidaze neovisne o selenu u usporedbi s izoenzimima ovisnim o selenu što je u skladu
s rezultatima Bilodeau i sur. (2000).
U radu je određena aktivnost glutation peroksidaze ovisne o selenu u krvnom serumu te je
utvrđeno da njena aktivnost sa dobi raste.
Navedeni rezultati ukazuju da dob utječe na aktivnost glutation peroksidaze u krvnom serumu,
no ne i na aktivnost ovog enzima u spermi rasplodnih bikova simentalske pasmina.
Literatura
Agarwal, A., A. Ramadan, M. D. Saleh, M. A. Bedaiwy (2003): Role of reactive oxygen species in the
pathophysiology of human reproduction. Fert. Steril. 4, 829-843.
Aitken, R. J., J. S. Clarkson, S. Fishel (1989): Generation of Reactive Oxygen Species, Lipid Peroxidation, and
Human Sperm Function. Biol. Reproduct. 40, 183-197.
Bilodeau, J. F., S. Chatterjee, M. A.´ Sirard, C. Gagnon (2000): Levels of antioxidant defenses are decreased in
bovine spermatozoa after a cycle of freezing and thawing. Mol. Reproduct evelopm 55, 282–288.
Halliwell, B., J. M. C. Gutteridge (1999): Free radicals in biology and medicine. 3rd edition. Oxford University
Press, 134-140.
Imai, H., K. Suzuki, K. Ishizaka, S. Ichinose, H. Oshima, I. Okayasu, K. Emoto, M. Umeda, Y. Nakagawa (2001):
Failure of the Expression of Phospholipid Hydroperoxide Glutathione Peroxidase in the Spermatozoa of
Human Infertile Males. Biol. Reproduct. 64, 674–683.
Imai, H., Y. Nakagawa (2003): Biological significance of phospholipid hydroperoxide glutathione peroxidase
(PHGPx, GPx4) in mammalian cells. Free Rad. Biol. Med. 2, 145-169.
Lawrence, R. A., R. F. Burk (1976): Glutathione peroxidase activity in selenium-deficient rat liver. Biochem.
Biophis. Res. Com. 4, 952-958.
Lowry, O. H., N. J. Rosebrough, A. L. Farr, R. J. Rendal (1951): Protein measurement with the Folin phenol
reagent. J. Biol. Chem. 193, 265-267.
Michiels, C. M., M. Raes, O. Toussaint, J. Remacle (1994): Importance of Se-lutathione peroxidase, catalase and
Cu/Zn-SOD for cell survival against oxidative stress. Free Rad. Biol. Med. 17, 235-248.
Paglia, D. E, W. N Valentine (1967): Studies on the quantitative and qualitative characterization of erythrocyte
peroxidase. J Lab Clin Med 1, 158-169.
Sikka, S. C. (1996): Oxidative stress and role of antioxidants in normal and abnormal sperm function. Frontiers
in Bioscience 1, 78-86.
Vaisberg, C. N., L. V. Jelezarsky, B. Dishlianova, T. A. Chaushev (2005): Activity, substrate detection and
immunolocalization of glutathione peroxidase (GPx) in bovine reproductive organs and semen.
Theriogenology 2, 416-428.
Interactive fat supplementation changed the milk
quality and plasma thyroid hormone concentration in
Simmental cows
DODATAK NEŽAŠTIĆENE MASTI U OBROK MIJENJA KVALITETU

MLIJEKA I KONCENTRACIJU HORMONA ŠTITNJAČE U
SIMENTALSKIH KRAVA
Marenjak1*, T. M., Nina Poljičak-Milas1,Jasna Piršljin2, Blanka Beer Ljubić2, Ivančica

Delaš3
1
Faculty of Veterinary Medicine University of Zagreb, Department of Pathophysiology
2
Faculty of Veterinary Medicine University of Zagreb, Department of Physiology and Radiobiology
3
School of Medicine University of Zagreb, Department of Chemistry and Biochemistry
Abstract
Ten healthy multiparous Simmental cows in mid-lactation, with average 4,34 % of milk fat and 3,61 % of
milk protein, were appointed for five weeks simple change-over feeding trial. The cows were randomly assigned
in two groups, one treatment per group. Treatment 1 (WSO-diet) consisted of 41% concentrate, 33% perennial
ryegrass haylage, 26% corn silage in DM, and Treatment 2, (SO-diet) comprised of WSO diet supplemented with
200 g of non-protected sunflower oil per cow and day. Milk production and the majority of milk components did
not change significantly regarding the treatment, apart the milk urea concentration that increased in Treatment
2. The milk fatty acid profile was modified with the significant decrease in lauric, miristic and palmitic acid
(4,23 vs. 3,64; 12,52 vs. 10,85; 31,21 vs. 24,50), and the increase in stearic, vaccenic, linoleic and conjugated
linoleic acid (CLA) (10,70 vs. 15,26; 0,61 vs. 0,96; 2.55 vs. 3,61; 0,71 vs.1,57) content. No remarkable changes
in eicosapentaenoic and docosahexaenoic acid milk content, as well as in the index of milk lipid peroxidation
were identified. The concentration of total tetraiodothyronine (T4) in plasma increased in Treatment 2 whereas
no changes in total triiodothyronine (T3) concentration were detected. The positive correlation between CLA
and T4 was determined (r=0,38; p<0,05). We may suspect that supplementation of low content of interactive
sunflower oil in the diet influenced the thyroid hormone secretion and partially modified the fatty acid profile
of milk fat, with lowering effect on unfavourable lauric and palmitic acid, and raising the dietary source of
bioactive CLA in raw milk.
SAŽETAK
U istraživanje je bilo uključeno deset zdravih višetelki simentalske pasmine s prosječnim udjelom
mliječne masti od 4,34 % i mliječnim bjelančevinama od 3,61 %. Životinje su nasumce odabrane za provođenje
jednostavnog “change-over” hranidbenog tretmana tijekom pet tjedana, te su bile podijeljene u dvije skupine
sa po jednim hranidbenim tretmanom po skupini. Tretman 1 (WSO-obrok) sadržavao je 41% koncentrata, 33%
sjenaže engleskog ljulja i 42% kukuruzne silaže u ST obroka, a Tretman 2 (SO-obrok) je sadržavao WSO obrok
kojemu je dodano 200 g nezaštićenog suncokretova ulja po kravi dnevno. Proizvodnja mlijeka i većina mliječnih
sastojaka nije se značajnije mijenjala, izuzev ureje koja je značajno porasla u Tretmanu 2. Sadržaj masnih
kiselina u mlijeku se značajno promijeno s obzirom na tretman s utvrđenim značajno smanjenim udjelom
laurinske, miristinske i palmitinske kiseline (4.23 vs. 3.64; 12.52 vs. 10.85; 31.21 vs. 24.50) te uvećanim udjelom
stearinske, vakcenske, linolne i konjugirane linolne kiseline (CLA) (10.70 vs. 15.26; 0,61 vs. 0.96; 2.55 vs. 3.61;
0.71 vs.1.57) u Tretmanu 2. Nisu utvrđene značajne promjene sadržaja eikozapentaenske i dokozaheksaenske
kiseline, kao ni indeksa lipidne peroksidacije u mlijeku krava u pokusu. Koncentracija ukupnog tiroksina (T4) u
plazmi se povećala, dok je koncentracija trijodtironina ostala nepromijenjena u Tretmanu 2. Utvrđena je značajna
pozitivna korelacija između CLA i T4 (r=0,38; p<0,05). Na temelju ovog istraživanja možemo pretpostaviti da
je dodatak interaktivnog suncokretovoga ulja u obrok simetalskih krava utjecao na sekreciju hormona štitnjače
i djelomično promijenio masnokiselinski profil mlijeka, smanjivši udio nepovoljnih kiselina (palmitinske i
laurinske) te povećao udio bioaktivne konjugirane linolne kiseline u sirovom mlijeku.
*Corresponding author: Tel. +385 1 2390 183; fax; +385 1 2390 184; E- mail: marenjak@vef.hr
Introduction
In order to change the milk fatty acid composition and increase the polyunsaturated fatty acid
content in milk fat, development of protected fats and fatty acids are intensively studied for the
application in the dairy cows’ diet. On the other hand, the dietary fat may influence the dairy cows’
health and production. The energy metabolism in animals and humans is regulated with both fatty
acids and thyroid hormones. Thyroid hormones play a key role in the up-regulation of a variety of
metabolically-related processes such as body temperature, heart rate, cellular repair, metabolism
of energy stores, and milk production (Lima et al., 2001). It should be emphasised that thyroid
hormones influence the fatty acid synthesis and metabolism (Blennemann et al., 1992), stimulate de
novo liver cholesterol synthesis (Müller and Seitz, 1984), and vice versa, fatty acids may affect the
thyroid hormones plasma level. There are some evidences, from the experiments with rodents and
humans, about the influence of the dietary fat on the thyroid hormone activity (Rosołowska-Huszcz
and Lachowicz, 2006). Rather less data are available from the experiments with ruminants. The
results of Marenjak et al. (2007) indicate that the supplementation of non-protected polyunsaturated
fatty acids (PUFA) in concentrate mixture changed the milk fatty acid composition and increased
the total blood cholesterol level in mid-lactating Simmental cows. The influence of the interactive
fats on the blood lipid concentration and milk fatty acid profile was detected but the level of action
was not clear. The objective of our research was to extend the knowledge in the area of dairy cows
energy metabolism and milk production, and to clarify possible model of action of interactive fat
supplementation and its effect on the milk fatty acid composition.

Ten multiparous mid-lactating and healthy Simmental cows, were appointed to simple change
over feeding trial in duration of five weeks with four weeks pre-trial period. The ingredients and the
chemical composition of the diet are presented in Table 1. The basal diet (WSO- treatment 1) and
the diet in pre-trial period comprised of 26% corn silage, 33% perennial ryegrass haylage, and 41%
concentrate in DM, and in the experimental diet (SO - treatment 2) where the concentrate mixture in
the basal diet was partly replaced with 2 % of non-protected sunflower oil. The concentrate mixture
was prepared on the daily bases on the farm. The cows were housed indoors with ad libitum water
supply in two separate feeding lots at the same stable. After four weeks of the same feeding procedure,
cows were randomly selected in two groups and fed one of the previously described diets. After
seven days wash out period the change over was applied. The milk and blood samples were collected,
once in pre-trial period, and four times during the trial period, 14th and 21st day after the introduction
of sunflower oil to the concentrate mixture of each animal group. The cows were milked and fed two
times daily each day, at 7 a.m. and 7 p.m.
The blood samples were collected from the v. jugularis in BD vacutainer tubes (LH 85 I.U.)
with lithium heparin as the anticoagulant agent, 3-4 hours after the feeding. The blood samples
were transported at +4 °C to the laboratory where plasma was separated after the centrifugation at
3000 rpm for 15 min. and stored at -20 ºC until analyses. The thyroid hormone concentration was
determined by time-resolved fluoroimmunoassay (Perkin Elmer Life and Analytical Sciences, Turku,
Finland) on a 1234 Delfia Research Fluorimeter, Wallac, Turku, Finland. Intra-assay precision within
run was CV= 6,8%, inter-assay precision between run was 5,9%, for both analyses.
Table 1. Ingredients and chemical composition of the basal (WSO) and experimental (SO) diet
Diet
WSO SO
Ingredients (% of DM)
Perennial ryegrass haylage 33 33
Corn silage 26 26
Concentrate mixa 41 39
Sunflower oil 2
Chemical composition
Dry matter (%) 63,1 63
Crude protein (CP) 16,9 16,8
RUP % DM 4,87 4,85
RUP % CP 31,29 31,24
Ether extract 4,4 5,2
Acid detergent fiber 14,1 13,6
Neutral deterget fiber 24,5 23,6
Ca 0,44 0,47
P 0,34 0,35
Mg 0,38 0,40
NEL Mcal/kgb 1,81 1,83
ME Mcal/kgb 4,30 6,82
a
Concentrate mix. consisting of: 33,3 % barley, 44,5 % corn, 11,1% soybean meal (WSO) and 9,1 % of
soybean meal (SO), 5,6 % Protamilk, 5,5 % Profisan Sano, GmbH) bEstimated using NRC (2001) for dietary
ingredients DM-dry matter;: RUP-rumen undegradible protein;NEL-net energy of lactation; ME-metabolisable
energy
The milk samples for the standard milk components analyses, index of milk lipid peroxidation,
and somatic cell count (SCC) were taken from the composite of the morning milking for each
cow separately. The milk was placed in the 40 ml plastic container, and transported at 4 °C to the
laboratory where milk constituents (protein, fat, lactose, and solid-non fat; SNF) were regularly
controlled by the automatic analyser (MilcoScan 4000, Denmark), and somatic cell count (SCC) was
determined by Fossomatic 5000 (Denmark). The index of milk lipid peroxidation was estimated by
determination of thiobarbituric acid reactive substances (TBARS) concentration and milk superoxide
dismutase (SOD) activity in raw milk. The TBARS concentration was determined with the TROTTA
et al. method (1982) on the Helious Thermospectronic, Helios Delta spectrophotometer (Unicam,
Cambridge, UK) at 25 °C. The absorption peak was measured at 532 nm and the concentration was
calculated using molar extinction coefficient of 1.5 x 105. Total SOD activity (E.C. 1.15.1.1) was
measured using commercial kit (RANSOD, “Randox”, Ireland) on automatic analyser SABA 18
(AMS, Italy) at 37 °C.
The milk samples for the fatty acid analyses were collected as a 1:1 composite of the morning
and evening milk samples from each cow separately. The milk samples were stored at – 20 °C until
analysed for the fatty acid composition by GC procedure (GC chromatograph SRI 8619C, Qadrex
Corporation, New Haven). Lipid extraction and washing of the extract was done according to the
method of Folch et al. (1957). The preparation of fatty acid methyl esters (FAME) was carried out
according to the ISO 14156-IDF 172:2001 and ISO 15884-IDF 182:2002. Aliquots of FAME in
chloroform (1 µL) were fractionated with a fused silica capillary column (Carbowax 0212051; 30 m
x 0.25 mm i.d. x 0.25 µm filter thickness) using H2 as a carrier gas with a flow of 60 mL/min. The
injector and detector temperatures were 160 °C and 230 °C, respectively. The initial oven temperature
was held at 100 °C for 10 min, then increased to 160 °C at 10 °C per min and held for 7 min, and
finally increased to 220 °C at 5 °C per min and held for 15 min. All fatty acids determined in this trial
were identified by comparing the retention times with methylated standards (Sigma Aldrich Chemie,
GmbH and Supelco, USA). The CLA standards were purchased from Matreya INC., PA, USA. The
quantification of FAME was done using nonadecanoic acid as an internal standard. The milk urea
concentration was measured by colorimetric method using the commercial kit (Herbos Dijagnostika,
Sisak, Croatia) on the
The data were analysed as a change over using the ANOVA/MANOVA model of Statistica
(version 7; 2005, StatSoft, Inc. USA) with the treatment as a class variable. Correlation coefficients
were obtained using linear regression models.The significance of the difference between
means was evaluated by Tukey LSD test taking p < 0,05 as significant, unless indicated otherwise.
Results
The data of the milk yield, milk components and oxidative stability in milk of Simmental cows
included in the trial were presented in Table 2. Although, the milk production was not significantly
different between two treatments, slightly higher milk production was noted in the SO treatment.
The similar could be perceived for the milk protein, SNF, and lactose content, whereas the milk fat
content was slightly lower. The only significant shift was determined for the milk urea concentration,
that was higher in the SO treatment (Table 2.), but still in the normal range for respective group of
cows. The SOD activity was higher and TBARS lower in the SO treatment, but not at the significant
level.
Table 2. Production and oxidative stability of milk in Simmental cows according to the treatment (WSO-basal
diet; SO-experimental diet)
Treatment 1- WSO (N=30) 2- SO (N=20)

Milk production L/d 18,2 ± 0,96 20,4 ± 1,32
Milk fat (%) 4,32 ± 0,09 4,29 ± 0,15
Milk protein (%) 3,61 ± 0,08 3,72 ± 0,03
Milk urea (mmol/L) 3,06 ± 0,20 3,72 ± 0,14*
Lactose (%) 4,66 ± 0,03 4,70 ± 0,04
SNF1 (%) 9,02 ± 0,06 9,13 ± 0,09
SOD2 U/g prot 254,44 ± 21,27 279,98 ± 19,59
TBARS3 µmol/g prot 0,13 ± 0,01 0,12 ± 0,01
The results were expressed as mean ± SEM;*p<0,05; 1SNF-solid-non fat;2SOD-superoxide
dismutase;3TBARS- thiobarbituric acid reactive; substances
The milk fatty acid profile changed significantly between the treatments in the study. The major
changes were perceived in the group of fatty acids with 18 carbon atoms in the chain and medium
chain fatty acids (Table 3.). The content of lauric (C12:0), miristinic (C14:0) and particularly palmitic
acid (C16:0) decreased, whereas stearic (C18:0) linoleic (LA), trans- vaccenic (TVA) and conjugated
linoleic (cis-9, trans-11 C18:2; CLA) acid increased significantly in the SO treatment. Higher, but
not significant increase in alfa-linolenic (α-LNA), arachidonic (AA), eicosapentaenoic (EPA) and
docosahexaenoic (DHA) acids concentration was remarked.
The plasma level of total thyroxine (T4) and triiodothyronine (T3) had opposite trend in the two
treatments (Figure 1.). The significant increase in T4 was detected in SO treatment (Figure 1.). The
positive correlation between CLA and T4 was presented in Figure 2.
Table 3. Fatty acid composition in Simmental cows milk according to the treatment (WSO-basal diet; SO-
experimental diet)
Treatment 1- WSO (N=30) 2- SO (N=20)

Fatty acids (g/100g of fatty acids)
C8:0 1,04 ± 0,29 0,67 ± 0,16
C10:0 2,71 ± 0,14 2,43 ± 0,20
C12:0 4,23 ± 0,11 3,64 ± 0,24*
C14:0 12,52 ± 0,32 10,85 ± 0,81*
C16:0 31,21 ± 1,03 24,50 ± 2,03**
C18:0 10,70 ± 0,88 15,26 ± 1,66**
C18:1 n 9 20,59 ± 0,79 19,7 ± 1,43
C18:1 n 7 t11 (TVA) 0,61 ± 0,08 0,96 ± 0,09*
C18:2 n 6 (LA) 2,55 ± 0,18 3,61 ± 0,25***
C 18:2 n7 cis-9, trans-11 (CLA) 0,71± 0,08 1,57± 0,24***
C18:3 n 3 (α-LNA) 0,48 ± 0,13 0,78 ± 0,33
C20:4 n6 (AA) 0,15 ± 0,05 0,27 ± 0,11
C20:5 n3 (EPA) 0,35 ± 0,07 0,52 ± 0,19
C22:6 n3 (DHA) 0,16 ± 0,07 0,32 ± 0,13
The results were expressed as mean ± SEM;*p<0,05; **p<0,01; ***p<0,001
Discussion
Many attempts have been made in order to produce advantageous meat and milk fatty acid
composition for human consumption. The various feeding procedures were applied and different
sources of dietary fat where tested. Three major groups of fats are available for the dairy cows or
beef steers nutrition: rumen-inert, rumen-active and protected fats. In this study we have chosen the
rumen-active fats of plant origin with higher content of polyunsaturated fats (PUFA), mostly linoleic
acid, that theoretically provide the precursor for the CLA and trans-C18:1 fatty acid production. The
linoleic acid may have toxic effect on the rumen bacteria, but according to Koppova et al. (2006)
it may be a stimulus for the bacterial growth. Therefore, our scope was to test the influence of non-
protected sunflower oil on the milk production and fatty acid composition of milk fat, and also to
determine the oxidative stability of raw milk. On the other hand, our objective was to determine
the possible effect of sunflower oil treatment on the concentration of plasma thyroid hormones and
possible interrelationship with the milk fatty acid composition.
In our study, the supplementation of interactive fat did not affect the animal production and cows
remained healthy during and after the trial, with no remarkable changes detected in milk fat and other
milk components content, except for the milk urea concentration that was significantly higher in SO
treatment. It is known that the measuring of blood or milk urea is good supplementary tool to control
the adequacy of protein fed to dairy cows (Oltner and Wiktorsson, 1983; Marenjak et al. 2000).
We may suspect that the linoleic acid stimulated the growth of rumen bacteria which are important
source of dietary protein for the dairy cattle and the milk production. Therefore, the significant
tre a tm e n t; L S Me a n s
V e rti c a l b a rs d e n o te 0 ,9 5 c o n fi d e n c e in te rva l s
2 ,2
2 ,1
2 ,0
1 ,9
T3 nmol/L
1 ,8
1 ,7
1 -W S O 2- S O
tre a tm e n t
tr eatment; LS M eans
T ukey H SD test; var iable T 4 nmol/L; p= 0,023
Appr oximate Pr obabilities for Post H oc T ests
Er ror : Between M S = 136,66, df = 26,000
90
*
85
80
75
T4 nmol/L
70
65
60
1- WSO 2- SO
tr eatment
Figure 1. Concentration of total thyroxine (T4) and triiodothyronine (T3) in the blood plasma of Simmental
cows regarding the treatment
Scatter plot: T 4 nmol/L vs. C LA ,cis9 tr ans11 ( C asewise M D deletion)

C LA ,cis9 tr ans11 = - ,3973 + ,01897 * T 4 nmol/L
C or r elation: r = 0,370;p< 0,05
3,5
3,0
2,5
2,0
1,5
CLA ,cis9 trans11
1,0
0,5
0,0
30 40 50 60 70 80 90 100
T 4 nmol/L
Figure 2. Correlation matrix between the plasma total thyroxine (T4) and the conjugated linoleic acid (cis-9,
trans-11 C18:2; CLA) concentration in Simmental cows’ milk
increase of milk urea concentration and less remarkable increase of milk protein content (Table 2)
could be a consequence of the sunflower oil supplementation in the diet. Furthermore, the fatty acid
composition of milk fat was significantly changed regarding the treatment (Table 3.) with no influence
on the milk fat content, thus we may expect on the one hand, the improvement in healthfulness and
functional properties of milk, and on the other hand, the retaining of the economic value for the milk
producer. Several authors demonstrated the alterations in the duodenal flow and plasma fatty acids
concentration in the milk fat and the modification of milk fatty acid composition due to the various fat
source infusion or supplementation to the dairy cattle (Kalscheur et al., 1997; Petit, 2003; Bell et al.,
2006). In our study, the incorporation of the non-protected sunflower oil into the concentrate mixture
resulted in the lower milk content of miristic, lauric and palmitic acids, that are nutritionally derived,
LDL- cholesterol raising factors for humans. At the same time the significantly higher concentration
of stearic, linoleic and bioactive conjugated linoleic acid (cis-9, trans-11 C18:2; CLA) was observed
with slightly, but not significantly lower content of oleic acid (Table 3.). The five fold increase of
the stearic acid content was expected because of the biohydrogenation in the rumen. In contrast, the
significant increase in the vaccenic acid (trans -11 C18:1; TVA) content was determined due to the
incomplete biohydrogenation processes of linoleic acid by rumen bacteria of group A. It is partially
transferred to the mammary tissue and via activity of ∆9-desaturase converted to cis-9, trans-11
C18:2 (CLA). Therefore, the increase of the CLA content in milk resulted from two possible sources:
one from the rumen synthesis and another comes from the endogenous synthesis by the desaturation
of TVA in the mammary gland that accounts for 64 % of the overall milk CLA synthesis according
to Grinarii et al. (2000). Therefore, from our study we may conclude that the interactive sunflower
oil supplementation resulted in the incomplete biohydrogenation and consequently the increase in
CLA and TVA content was observed. The active pathway of the synthesis of CLA from TVA was
also documented in humans (Adolf et al., 2000) with several intestinal bacterial species recognised
for such ability (Alonso et al., 2003, Coakley et al., 2003). Among all milk fatty acids analysed in
our study, only CLA content was positively correlated with T4 (r = 0,370; p<0,05; Figure 2.) and
both values increased in the SO treatment (Table 3.; Figure 1.). Hence synergy in action on the lipid
metabolism of both CLA and T4 might be hypothesised. The influence of thyroid hormones on the
lipid metabolism is well documented and various thyroid states can modulate the lipid metabolism
by activating the lipogenic enzymes, such as lipoprotein lipase and fatty acid synthetase, leading
to the increase of fatty acids concentration in plasma (Müller and Seitz, 1984). In our study, the
concentration of thyroxin was increased during the SO treatment (Figure 1.) and the increase in
the total blood cholesterol level was also determined during the supplementation of non-protected
sunflower oil in the Simmental cows diet (Marenjak et al., 2007). The concentration of T4 in our
study was higher compared to the values reported by Kaneko (1997) for both treatments, whereas
the concentration of T3 ranged over the referent values (from 2,01 nmol/L in WSO to 1,99 nmol/L
in SO treatment). The increase in PUFA content provided in the free form from the sunflower oil,
may directly affect the liver, adipose tissue and mammary gland fatty acid metabolism through the
expression of the lipogenic genes as it was presented by Harvatine and Bauman (2006). The higher
concentration of T4 may enhance the mitochondrial oxidation of fatty acids in many tissues, but
according to the Müller and Seitz (1984), the increase of cytosolic de novo synthesis, desaturation
and elongation of fatty acids could also be expected. The positive correlation between the milk
CLA content and the plasma T4 concentration revealed the potentially same regulatory mechanism
involved in the particular fatty acid synthesis and thyroid hormone responsiveness to the dietary
PUFA in Simmental cows from our study. Regulatory mechanism of PUFA on the metabolically
related proceses in ruminants should be futher studied.
Acknowledgement
The research was supported by the grant of Ministry of Science, Education and Sports, Republic of Croatia.
References
Adolf, R. O., S. Duval, E. A. Emken (2000): Biosythesis of conjugated linoleic acid in humans. Lipids 35, 131-
135.
Alonso, L., E. P. Cuesta, S. E. Gilliland (2003): Production of Free Conjugated Linoleic Acid by Lactobacillus
acidophilus and Lactobacillus casei of Human Intestinal Origin. Journal of Dairy Science 86, 1941-1946.
Bell, J. A., J. M. Griinari, J.J. Kennelly (2006): Effect of safflower oil, flaxseed oil, monensin, and vitamin E on
concentration of conjugated linoleic acid in bovine milk fat. Journal of Dairy Science 89, 733-748.
Blennemann, B., Y. K. Monn, H. C. Freake (1992): Tissue-specific regulation of fatty acid synthesis by thyroid
hormone. Endocrinology 130, 637-643.
Coakley, M., Ross, R. P., Nordgren, M., Fitzgerald, G., Devery, R., Stanton, C. (2003): Conjugated linoleic acid
biosynthesis by humanderived Bifidobacterium species. Journal of Applied Microbiology 94,138–145.
Folch, J., M. Lees, G. H. Sloane-Stanley (1957): A simple method for the isolation and purification of total lipids
from animal tissues. Journal of Biological Chemistry 226, 497-509.
Griinari, J. M., B. A. Corl, S. H. Lacy, P. Y. Chouinard, K.V. Nurmela, D. E. Bauman (2000): Conjugated linoleic
acid is synthesized endogenously in lactating dairy cows by Delta (9)-desaturase. Journal of Nutrition
2285- 2291.
Harvatine, K. J., D. E. Bauman (2006): SREBP1 and thyroid hormone responsive spot 14 (S14) are involved in
the regulation of bovine mammary mipid synthesis during diet-dnduced milk fat depression and treatment
with CLA. The Journal of Nutrition 136, 2468-2474.
Kalscheur, K. F., B. B. Teter, L. S. Piperova, R. A. Erdman (1997): Effect of fat source on trans fatty acid flow
in lactating dairy cows. Journal of Dairy Sciece 80, 2115-2126.
Kaneko, J. J., J. W. Harvey, M. L. Bruss (1997): Clinical biochemistry of domestic animals. Fifth Edition.
Academic Press, Inc. San Diego. CA.
Koppova, I., F., Lukash, J. Kopečny (2006): Effect of fatty acids on growth of conjugated linoleic acid producing
bacteria in rumen. Folia microbiologica 51, 291-293.
Lima, F. R. S., A. Gervais, C. Colin (2001): Regulation of microglial development: A novel role for thyroid
hormone. Journal of Neuroscience 21, 20028-2038.
Marenjak, T. S., N. Poljičak-Milas, R. Turk, B. Kampl (2000): Possibility of metabolic control in cows by milk
protein and urea determination. Veterinarski arhiv 70 (Suppl.), 251-257.
Marenjak, T. S., N. Poljičak Milas, I. Delaš (2007): Blood lipids and proportion of fatty acids, especially CLA
in milk of Simmental cows fed with unprotected sunflower oil. 5th Euro Fed Lipid Congress, Gothenburg,
Sweden, 16. - 19. 09. 2007, p.215.
Müller, M. J., H. J. Seitz (1984): Thyroid hormone action on intermediary metabolism. Part II: Lipid metabolism
in hypo- and hyperthyroidism. Klinische Wochenschrift 62, 49-55.
Oltner, R., H. Wiktorsson (1983): Urea concentration in milk and blood as influenced by varying amounts of
protein and energy to dairy cows. Livestock Production Science 10, 457-467.
Petit, H.V. (2003): Digestion, milk production, milk composition, and blood composition of dairy cows fed
formaldehyde flaxseed or sunflower seed. Journal of Dairy Science 86, 2637-2646.
Rosołowska-Huszcz, D., K. Lachowicz (2006): Influence of dietary fat on thyroid hormone plasma concentrations.
New Medicine 1, 15-18.
Trotta, R. J., S. G. Sullivan, A. Stern (1982): Lipid peroxidation and hemoglobin degeneration in red blood cells
exposed to T-utyl hydroperoxide. Biochemical Journal, 204 (1982), 405-415.
Seasonal changes in lipid composition of bovine serum
and seminal plasma
Utjecaj godišnjih doba na sastav masnih tvari u serumu i

sjemenoj plazmi bikova
Blanka Beer Ljubić1, Renata Laškaj2, Jasna Piršljin1, Ivanka Majić-Balić3, Terezija
Silvija Marenjak4, Suzana Milinković-Tur1
1
Zavod za fiziologiju i radiobiologiju, Veterinarski fakultet, Zagreb, Hrvatska
2
Klinika za infektivne bolesti, Zagreb, Hrvatska
3
Centar za reprodukciju u stočarstvu, Križevci, Hrvatska
4
Zavod za patološku fiziologiju, Veterinarski fakultet, Zagreb, Hrvatska
Abstract
A key feature in the function of the spermatozoa is the lipid composition of seminal plasma and sperm
membrane. Lipid molecules are transferred from blood plasma to the accessory sex glands through blood-
seminal plasma barrier. Cholesterol is the major free sterol in ejaculated bovine sperm. Importance of
cholesterol in process of spermatozoa capacitation is well known. The aim of this study was to investigate
seasonal variations of the bovine blood serum and seminal plasma lipid concentrations. The experiment was
carried out on 19 Simmental breeding bulls at the age of 2 -10 years. Blood samples were collected from the v.
jugularis and bovine semen with an artificial vagina once per season. Serum concentrations of total cholesterol,
high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), triacylglycerols,
free fatty acids (FFA) and lipoprotein electrophoretic patterns were determined. Seminal plasma concentrations
of total cholesterol, HDL-C and LDL-C were assayed. Serum concentrations of total cholesterol and LDL-
C were significantly higher in the winter (2,51±0,46 mmol/L;. 0,56±0,11 mmol/L; ( x ±SD) compared with
values determined in blood samples collected in the spring period (2,13±0,38 mmol/L; 0,42 ± 0,08 mmol/L).
Triacylglycerol concentrations in bovine serum were higher in the winter (0,23±0,06 mmol/L) than in the summer
(0,18±0,05 mmol/L) or in the autumn period (0,17±0,05 mmol/L). There were significant differences between
serum FFA concentrations in blood samples collected in the autumn (0,19±0,07 mmol/L) compared with those
collected in the summer (0,14±0,05 mmol/L) or in the winter (0,14±0,03 mmol/L). The absolute concentrations
of serum HDL and LDL lipoproteins in electrophoretic tracings in the winter (2,49±0,89 mmol/L; 0,36±0,21
mmol/L) were significantly higher than in the spring period (1,82±0,54 mmol/L; 0,17±0,09 mmol/L). Seasonal
variations were found in seminal plasma total cholesterol and HDL-C with higher concentrations in the winter
(1,02±0,47 mmol/L; 0,09±0,04 mmol/L) than in the summer (0,61±0,30 mmol/L; 0,06±0,01 mmol/L). The
results of this study demonstrate seasonal variation in bovine serum and seminal plasma lipid levels. Observed
changes of cholesterol concentrations in seminal plasma are associated with extracellular lipid utilisation and
appear to be useful biochemical marker of sperm quality.
Sažetak
Građa i uspješnost spermija u oplodnji jajne stanice ovisi o sastavu masnih tvari u staničnoj
membrani i sjemenoj plazmi. Molekule masnih tvari prenose se do akcesornih spolnih žlijezda.
Kolesterol je osnovni, slobodni sterol u spermi bikova i ima ključnu ulogu u procesu kapacitacije
spermija. Cilj ovog istraživanja je utvrditi utjecaj godišnjih doba na koncentracijue masnih tvari u
serumu i sjemenoj plazmi bikova. Istraživanje je provedeno na 19 bikova simentalske pasmine u dobi
od 2 do 10 godina. Uzorci krvi uzimani su punkcijom v. jugularis, dok su uzorci sperme uzimani
pomoću umjetne vagine jednokratno tijekom četiri godišnja doba. U serumu je određena koncentracija
ukupnog kolesterola, kolesterola vezanog na lipoproteine visoke (HDL-C) i niske gustoće (LDL-C),
triglicerida, slobodnih masnih kiselina (SMK) i elektroforeza serumskih lipoproteina. U sjemenoj
plazmi je određena koncentracija ukupnog, HDL-C i LDL-C kolesterola. Koncentracija ukupnog
kolesterola i LDL-C u serumu bikova bila je značajno veća u zimi (2,51±0,46 mmol/L;. 0,56±0,11
mmol/L; ( x ±SD) u odnosu na vrijednosti dobivene u uzorcima seruma prikupljenim u proljeće
(2,13±0,38 mmol/L; 0,42±0,08 mmol/L). Tijekom zime, koncentracija triglicerida u serumu bikova
bila je veća (0,23±0,06 mmol/L) od vrijednosti dobivenih u ljetnom (0,18±0,05 mmol/L) i jesenskom
(0,17±0,05 mmol/L) periodu. Koncentracija SMK u serumu bila je značajno veća u jesen (0,19±0,07
mmol/L) u odnosu na ljetne (0,14±0,05 mmol/L) i zimske (0,14±0,03 mmol/L) uzorke. Analizom
elektroforetograma utvrđeno je da su apsolutne koncentracije HDL i LDL frakcija bile značajno
veće u zimskim (2,49±0,89 mmol/L; 0,36±0,21 mmol/L) u odnosu na proljetne uzorke (1,82±0,54
mmol/L; 0,17±0,09 mmol/L). Koncentracija ukupnog kolesterola i HDL-C u sjemenoj plazmi bikova
bila je veća u zimi (1,02±0,47 mmol/L; 0,09±0,04 mmol/L) u odnosu na ljeto (0,61±0,30 mmol/
L; 0,06±0,01 mmol/L). U istraživanju su uočene promjene koncentracija masnih tvari u serumu i
sjemenoj plazmi bikova tijekom godišnjih doba. Koncentracija kolesterola u sjemenoj plazmi bikova
povezana je s iskorištavanjem masnih tvari u spermi te bi njeno određivanje moglo postati koristan
biokemijski pokazatelj u procjeni kvalitete sperme.
Uvod
Proizvodnja i reproduktivne kvalitete usko su povezane sa zdravljem životinja. Određivanje
masnih tvari u serumu životinja, pa tako i bikova, dio je pretraga u sklopu metaboličkog profil
testa kojim se prati zdravlje životinja (PAYNE i PAYNE, 1987). Masne tvari, naročito trigliceridi i
slobodne masne kiseline, važni su pokazatelji energetskog statusa monogastričnih životinja, dok u
preživača mjerenje koncentracije slobodnih masnih kiselina (SMK) te u stanovitoj mjeri određivanje
koncetracije slobodnog i estera kolesterola mogu ukazivati na opskrbu energetskim supstratom i
metabolički obrat masti (HERDT, 1991; KATOH, 2002; SEIFI i sur., 2007).
Umjetno osjemenjivanje u stočarskoj proizvodnji ima veliko zdravstveno i ekonomsko
značenje. U govedarskoj proizvodnji, važno je za selekciju i unapređivanje govedarstva jer se njime
mogu unaprijediti proizvodne sposobnosti goveda. Kvaliteta sjemena procjenjuje se na osnovi
makroskopskih (volumen, boja, miris, konzinstencija) i mikroskopskih (pokretljivost, morfološke
osobitosti, koncentracija) analiza. Uzorci sjemena visoke kvalitete čuvaju se duboko smrznuti.
Procesi zamrzavanja i odmrzavanja dovode do trajnih oštećenja spermija čime se smanjuje njihova
pokretljivost i sposobnost oplodnje (CEROLINI i sur., 2001; JANETT i sur., 2003) tako da se već
dugi niz godina nastoji poboljšati tehnika dubokog zamrzavanja spermija kao i sastav razrijeđivača
sjemena. Dosadašnja istraživanja su pokazala da na kvalitetu sjemena osim vrste, dobi i individualnih
razlika, utječe i promjena godišnjih doba. Utjecaj godišnjih doba na kvalitetu sjemena utvrđen je i
kod ljudi (CHEN i sur., 2003) i kod životinja (ARGOV i sur., 2007; JANETT i sur., 2003).
Građa i uspješnost spermija u oplodnji jajne stanice ovise o sastavu masnih tvari u staničnoj
membrani spermija i sjemenoj plazmi. Oplodnji jajne stanice prethodi proces kapacitacije praćen
promjenama u sastavu masnih tvari u membrani spermija. Promjene su vezane uz izlazak kolesterola
iz membrane spermija i vezanje na bjelančevine u sjemenoj plazmi i spolnom traktu ženskih životinja
(WITTE i SCHÄFER-SOMI, 2007). Osim kolesterola, u sjemenoj plazmi se nalaze i trigliceridi
čijom oksidacijom spermiji zadovoljavaju svoje energetske potrebe. Prisustvo VLDL receptora na
membrani omogućava spermijima unos i iskorištavanje triglicerida (ARGOV i sur., 2007). Intenzivan
metabolizam lipida nastavlja se i nakon ejakulacije, a dodatak razrijeđivača bogatog lipidima
osigurava bolju kavalitetu spermija nakon odmrzavanja (CEROLINI i sur., 2001).
Cilj ovog istraživanja bio je utvrditi promjene u sastavu masnih tvari u serumu i sjemenoj plazmi
bikova tijekom godišnjih doba, te utvrditi postoji li povezanost promjena masnih tvari u serumu s
promjenama u sjemenoj plazmi bikova.
Materijali i metode
Istraživanje je provedeno na 19 bikova simentalske pasmine u dobi od 2 do 10 godina
prosječne tjelesne težine 1177±100 kg. Tijekom istraživanja bikovi su držani u zasebnim ležištima s
pregradama od cjevastih metalnih prečki na vezu pomoću kožnog ovratnika. Prije svakog polučivanja
sjemena bikovi se izvode iz staje, privezuju za vrtuljak i kreću oko 30 minuta u svrhu pripreme za
polučivanje.
Bikovi su hranjeni dva puta dnevno. Količinu i kemijski sastav krmne smjese i krmiva prikazuje
tablica 1. Bikovi su napajani pomoću automatskih pojilica. zorci krvi i sperme uzimani su jednokratno
tijekom svakog godišnjeg doba. Uzorci krvi uzeti su iz v. jugularis, u BD Vacutainer SST. Serum
je dobiven centrifugiranjem krvi na 1500 g/15 minuta. Uzorci sperme dobiveni su pomoću umjetne
vagine. Sjemena plazma je odvojena nakon centrifugiranja uzoraka sperme na 1000 g/15 minuta.
Serum i sjemena plazma su do analize pohranjeni na -80 oC. Uzorci krvi i sperme uzimanu su od 8:00
do 10:00 sati.
U krvnom serumu određena je koncentracija ukupnih masnih tvari, triglicerida, slobodnih
masnih kiselina (SMK), kolesterola vezanog na lipoproteine visoke gustoće (HDL-C), kolesterola
vezanog na lipoproteine niske gustoće (LDL-C) i slobodnog kolesterola gotovim kompletima tvrtke
Randox (Irska), na biokemijskom analizatoru SABA 18 (AMS, Italija). Elektroforeza serumskih
lipoproteina je obavljena reagensima tvrtke MALTA Chemetron (Italija), a međusobni odnos i
apsolutna koncentracija lipoproteinskih frakcija određena je na Glob-Al Scan denzitometru (MALTA
Chemetron, Italija). U sjemenoj plazmi bikova određena je koncenracija HDL-C, LDL-C i slobodnog
kolesterola gotovim kompletima tvrtke Randox (Irska), na biokemijskom analizatoru SABA 18
(AMS, Italija).
Tablica 1. Količina i kemijski sastav obroka za bikove u pokusu
KEMIJSKI SASTAV
sir. sir.
sir. pepeo sir. mast vlaga
bjelančevine vlakna
(%) (%) (%)
KOLIČINA (%) (%)
krmna
8 kg 18,0 15,0 10,0 - 13,5
smjesa*
sjenaža 6 kg 10,2 32,4 6,15 1,8 31,5
livadno sjeno 10 kg 5,8 28,5 6,02 2,1 14,4
slama po volji 2,3 39,8 5,3 1,1 15,6
misol** po volji
voda po volji
* žitarice, sporedni proizvodi u proizvodnji ulja, sporedni proizvodi industrije škroba, alkohola i vrenja, mlinarstva,
sušeni biljni proizvodi, mineralna krmiva te mineralno-vitaminski dodaci (Ca 0,80%, P 0,35%, Na 0,20%, vitamin A 7500
U/kg, vitamin D3 1000 U/kg, vitamin E 10 mg/kg) * 1% Mg, 39% Na, 3000 mg/kg Zn, 1200 mg/kg Mn, 24 mg/kg Co, 20
mg/kg Se, 20-30 mg/kg J
Rezultati su obrađeni statističkim programom Statistika (data analysis software system) version
7.1 (Stat Soft, Inc. 2005) i prikazani kao srednja vrijednost ± standardna devijacija ( x ±SD).
Značajnost razlika među rezultatima tijekom godišnjih doba provjerena je analizom varijance i
Tukey testom ukoliko se radilo o normalnoj razdiobi, a Kruskall-Wallisovom analizom varijance i
testom sume rangova za sve grupe ukoliko je nulta hipoteza odbačena. Razlike se smatraju statistički
značajnim ako je p<0,05. Međusobna povezanost promatranih pokazatelja ispitana je linearnom
korelacijom uz korištenje navedenog statističkog programa.
Rezultati
Na slici 1. prikazane su koncentracije triglicerida i slobodnih masnih kiselina u serumu bikova
tijekom četiri godišnja doba. Koncentracija triglicerida u serumu bikova bila je značajno veća u
zimskom razdoblju (0,23±0,06 mmol/L) (p<0,05) u odnosu na vrijednosti dobivene u ljeto (0,18±0,05
mmol/L) i jesen (0,17±0,05 mmol/L). Najveća koncentracija slobodnih masnih kiselina određena je
u uzorcima prikupljenim u jesen (0,19±0,07 mmol/L), te je bila statistički značajno veća (p<0,05)
u odnosu na vrijednosti dobivene u ljetnom (0,14±0,05 mmol/L) i zimskom razdoblju (0,14±0,03
mmol/L).
0,25 a
abc
a
0,20 bc b
abc
bc
0,15 c
mmol/L
0,10
0,05
0,00
trigliceridi SMK
proljeće ljeto jesen zima
Slika 1. Koncentracije triglicerida i slobodnih masnih kiselina u serumu bikova tijekom četiri godišnja doba.
Histogrami s različitim abcsuperskriptom statistički se značajno razlikuju (p<0,05).
Koncentracije ukupnog kolesterola, HDL-C i LDL-C u serumu bikova tijekom četiri godišnja
doba prikazane su na slici 2. Koncentracija ukupnog kolesterola i LDL-C u serumu bikova bila
je statistički značajno veća (p<0,05) u zimskom razdoblju (2,51±0,46 mmol/L; 0,56±0,11 mmol/
L) u usporedbi s vrijednostima dobivenim u proljeće (2,13±0,38 mmol/L; 0,42±0,08 mmol/L).
Koncentracija HDL-C u serumu bikova nije pokazala značajne promjene tijekom različitih godišnjih
doba (p>0,05).
3,00
b
2,50 ab ab
a
2,00
mmol/L
1,50
1,00
b
a ab ab
0,50
0,00
kolesterol HDL-C LDL-C
Slika 2. Koncentracije ukupnog kolesterola, HDL-C i LDL-C u serumu bikova tijekom četiri godišnja doba.
Histogrami s različitim abcsuperskriptom statistički se značajno razlikuju (p<0,05).
Koncentracije lipoproteinskih frakcija u serumu bikova tijekom četiri godišnja doba prikazane
su na slici 3. Usporedbom koncentracija HDL i LDL lipoproteina u serumu bikova, utvrđene su
značajno veće (p<0,05) vrijednosti u uzorcima dobivenim u zimskom (2,49±0,89 mmol/L; 0,36±0,21
mmol/L) u odnosu na proljetno razdoblje (1,82±0,54 mmol/L; 0,17±0,09 mmol/L).
3,00
2,50
b
ab ab
2,00 a
1,50
g/L
1,00
0,50 ab ab b
a
0,00
HDL V LDL LDL
proljeć e ljeto jes en z im a
Slika 3. Koncentracije lipoproteinskih frakcija u serumu bikova tijekom četiri godišnja doba. Histogrami s
različitim abcsuperskriptom statistički se značajno razlikuju (p<0,05).
Na slici 4. prikazane su koncentracije ukupnog kolesterola, HDL-C i LDL-C u sjemenoj plazmi

bikova tijekom četiri godišnja doba. Koncentracija ukupnog kolesterola i HDL-C u sjemenoj plazmi
bikova bila je statistički značajno veća (p<0,05) u zimskom razdoblju (1,02±0,47 mmol/L; 0,09±0,04
mmol/L) u odnosu na vrijednosti dobivene u ljeto (0,61±0,30 mmol/L; 0,06±0,01 mmol/L).
1,20
a ad
1,00
0,80
mmol/L bc
b
0,60
0,40
0,20 b bc
abc a
0,00
kolesterol HDL-C LDL-C
Slika 4. Koncentracije ukupnog kolesterola, HDL-C i LDL-C u sjemenoj plazmi bikova tijekom četiri godišnja
doba. Histogrami s različitim abcsuperskriptom statistički se značajno razlikuju (p<0,05).
Rasprava
Rezultati načinjenog istraživanja pokazali su da su u krvnom serumu rasplodnih bikova najveće
koncentracije triglicerida, ukupnog kolesterola, LDL-C kao i LDL i HDL lipoproteinske frakcije
izmjerene u zimskom razdoblju, a SMK u jesen. Također, u sjemenoj plazmi raspodnih bikova u zimi
su izmjerene najveće koncentracije ukupnog i LDL kolesterola.
Koncentracija masnih tvari u serumu važna je u procijeni kvalitete obroka, odnosno energetskog
statusa životinja. Oksidacijom triglicerida oslobađaju se masne kiseline koje se u stanici mogu
esterificirati i pohraniti ili oksidirati pri čemu povećana koncentracija SMK ukazuje na mobilizaciju
masnih rezervi uzrokovanu negativnom energetskom bilancom obroka. U odnosu na fiziološke
vrijednosti za SMK u mliječnih krava, koje navodi WHITAKER (2000) te u usporedbi sa vrijednostima
WENSVOORT i sur. (2004) u deva i ostalih preživača u uvjetima negativne energetske bilance, u
ovom istraživanju vrijednosti SMK u serumu bikova bile su u granicama fizioloških vrijednosti,
iako je utvrđeno da su u uzorcima dobivenim u jesen vrijednosti bile značajno veće nego u ostalim
godišnjim dobima. Navedeni nalaz bi mogao biti posljedica nešto veće mobilizacije tjelesnih rezervi
nakon ljetnog razdoblja, odnosno neiskorištavanja bikova u rasplodne svrhe.
S obzirom da je netopiv u vodi, kolesterol se u sjemenoj plazmi i u serumu nalazi vezan s
molekulama bjelančevina u komplekse lipoproteina no njihov udio u ova dva medija je različit
(OCHOA i MARCHELLO, 1991). Koncentracija HDL-a u serumu bikova u ovom je istraživanju
bila najveća, nešto manja bila je koncentracija VLDL-a, dok je najmanje bilo LDL-a. Ovi su rezultati
u skladu s istraživanjem CHAPMAN i FORGEZ (1985) i OCHOA i MARCHELLO (1991). Frakcije
HDL i LDL u serumu bikova mijenjale su se tijekom istraživanja te su tako utvrđene značajne razlike
između proljetnog i zimskog razdoblja (slika 3.).
Osnovna funkcija HDL i LDL u serumu je prijenos kolesterola. Frakcija HDL prenosi kolesterol
iz perifernih stanica u jetru, a LDL prenosi kolesterol do stanica perifernih tkiva. I dok se koncentracija
HDL-C u serumu bikova tijekom godine nije značajno mijenjala, koncentracija LDL-C bila je veća
u zimi u odnosu na sva ostala godišnja doba, a značajno veća nego u proljeće. Koncentracija LDL-
kolesterola u serumu pokazala je sezonske promjene i kod ljudi (OCKENE i sur., 2004; KELLY,
2005) najvjerojatnije zbog promjena načina prehrane, aktivnosti tijekom godina i temperature okoline
kao i kombinacije svih pobrojanih utjecaja.
Na osnovi volumena, koncentracije i pokretljivosti spermija odabiru se uzorci sjemena za duboko
smrzavanje. Dosadašnja istraživanja su pokazala da se kvaliteta sjemena mijenja tijekom godine i
kod ljudi (CHEN i sur., 2003) i kod životinja (FUERST-WALTL i sur., 2006), a javljaju se i značajne
individualne razlike (JANETT i sur., 2003). CHEN i sur. (2003) su utvrdili da je kod ljudi najveća
koncentracija spermija i najveći postotak morfološki normalnih u zimskom razdoblju. JANETT i sur.
(2003) su jesenske uzorke sjemena pastuha proglasili najkvalitetnijim jer su i nakon zamrzavanja
zadržali dobra morfološka svojstva dok su ARGOV i sur. (2007) sjeme najlošije kvalitete dobili u
ljetnom uzimanju uzoraka sperme bikovima. FUERST-WALTL i sur. (2006) su istraživanjem na
bikovima utvrdili različitu osjetljivost na temperaturu okoline, kako u vrijeme uzimanja uzoraka,
tako i u vrijeme sazrijevanja spermija.
Neka istraživanja pokazuju da je ocjena kvalitete sjemena samo na osnovi makroskopskog
i mikroskopskog pregleda nedostatna (AGROV i sur., 2007; TURBA i sur., 2007) te se predlaže
određivanje dodatnih biokemijskih pokazatelja u spermijima i sjemenoj plazmi (BRINSKO i sur.,
2007). Analizom uzorka sjemena pastuha sa smanjenom plodnošću nepoznatog uzroka utvrđeno je
da imaju smanjenu koncentraciju kolesterola u sjemenoj plazmi (BRINSKO i sur., 2007). Smanjena
koncentracija kolesterola potvrđena je i u poznato lošim ljetnim uzorcima bikova čak i onda kada
su ocijenjeni kao dobri na temelju broja i morfoloških osobitosti spermija (ARGHOV i sur., 2007).
Ovakove rezultate potvrđuje i ovo istraživaje. Koncentracija ukupnog kolesterola u sjemenoj plazmi
bikova bila je značajno veća u uzorcima uzetim u zimskom u odnosu na ljetno razdoblje. Kolesterol
zajedno s fosfolipidima čini osnovu fizikalnog integriteta stanica i daje fluidnost staničnoj membrani.
Specifičnu ulogu kolesterol ima u membrani spermija jer odvajanjem s membrane spermija započinje
ključni korak u procesu kapacitacije i akrosomske reakcije bez kojih nema oplodnje jajne stanice
(WITTE i SCHÄFER-SOMI, 2007). Osim toga, utvrđeno je da dodatak kolesterola u razrijeđivače
prije procesa smrzavanja povećava otpornost spermija na stres izazvan procesima zamrzavanja i
odmrzavanja čime spermij zadržava svoju pokretljivost i sposobnost oplodnje jajne stanice (MOORE
i sur., 2005; ZAHN i sur., 2002).
U ovom istraživanju je utvrđeno da se kolesterol u sjemenoj plazmi nalazi raspoređen u dvije
lipoproteinske frakcije, HDL i LDL, pri čemu je koncentracija LDL-C višestruko veća od HDL-C.
Veću koncentraciju LDL-C utvrdili su ARGOV i sur. (2007) kod bikova kao i YOUSEF i sur. (2006)
kod kunića. Koncentracija LDL-C se nije značajno mijenjala tijekom različitih godišnjih doba, no
bila je znatno veća u zimsko doba (slika 4). Ovi rezultati potvrđuju da kvaliteti sperme doprinosi
povećana koncetracija LDL-C jer su zimski uzorci poznato dobre kvalitete (CHEN i sur., 2003) dok
je najniža u ljeto kad je sperma i najlošija. Lipoproteini niske gustoće štite membrane spermija od
oštećenja nastalih tijekom odmrzavanja, no iako se točan mehanizam još uvijek istražuje, MOUSSA
i sur. (2002) su utvrdili da dodatak LDL iz žumanjka jajeta u razrijeđivač za spermu bikova značajno
doprinosi zadržavanju pokretljivosti spermija nakon odmrzavanja. Isto tako, poznato je da je
sperma nerasta najosjetljivija na stres izazvan zamrzavanjem-odmrzavanjem, a dodatkom LDL-a u
razrijeđivač postiže se značajano poboljšanje kvalitete sjemena nakon odmrzavanja (JIANG i sur.,
2007).
Slika 5. Linearna korelacija LDL-C u sjemenoj plazmi i SMK u serumu (lijevo) i HDL-C u sjemenoj plazmi i
VLDL u serumu (desno) bikova tijekom četiri godišnja doba.
U istraživanju je utvrđena povezanost koncentracija masnih tvari u serumu i u sjemenoj plazmi.

Koncentracija slobodnih masnih kiselina u serumu bikova bila je u negativnoj korelaciji s LDL-
C u sjemenoj plazmi bikova (r=-0,30, p<0,05; slika 5) tako da mobilizacija masnih rezervi može
nepovoljno djelovati na kvalitetu sjemena dovodeći do smanjenja koncentracije LDL-kolesterola u
sjemenoj plazmi koja je uočena u spermi smanjene kvalitete.
Uočena je korelacija VLDL frakcije lipoproteina u serumu i HDL-C u sjemenoj plazmi (r=0,25,
p<0,05; slika 5). VLDL donosi trigliceride u periferne stanice preko vlastitih receptora (ARGOVi
sur., 2007). BRITES i sur. (1998) su utvrdili da u serumu postoji povezanost VLDL-triglicerida s
HDL-kolesterolom jer metabolizam lipoproteina znači međusobnu izmjenu lipidnih i proteinskih
sastojaka. Pa tako, djelovanjem bjelančevine koja prenosi estere kolesterola (eng. cholesterol ester
transfer protein, CETP) dolazi do prijenosa kolesterol estera s HDL na VLDL pri čemu nastaju
subfrakcije VLDL u serumu vrlo bogate kolesterolom (BRITES i sur., 1998). S druge strane, u
sjemenoj je plazmi koncentracija HDL-C izrazito mala dok je za proteinski dio utvrđeno da sudjeluje
u početku procesa kapacitacije (THÉRIEN i sur., 1998). Daljnjim istraživanjima treba utvrditi na koji
način VLDL utječe na količinu HDL-C.
Rezultati ovog istraživanja pokazuju da se sastav masnih tvari u serumu i sjemenoj plazmi bikova
mijenja tijekom godišnjih doba. Promjene koncentracije kolesterola u sjemenoj plazmi povezane su s
iskorištavanjem izvanstaničnih lipida u smislu očuvanja integriteta membrane spermija. Određivanje
koncentracije kolesterola u sjemenoj plazmi bikova moglo bi postati koristan dodatak standardnoj
procjeni kvalitete sjemena.
Literatura
ARGOV, N., D. SKLAN, Y. ZERON, Z. ROTH (2007): Association between seasonal changes in fatty-acid
composition, expression of VLDL receptor and bovine sperm quality. Theriogenology. 67, 878-885.
BRINSKO, S. P., C. C. LOVE, J. E. BAUER, M. L. MACPHERSON, D. D. VARNER (2007): Cholesterol-to-
phospholipid ratio in whole sperm and seminal plasma from fertile stallions and stallions with unexplained
subfertility Anim. Reprod. Sci. 99, 65-71.
BRITES, F. D., C. D. BONAVITA, M. CLOËS, M. J. YAEL, J. C. FRUCHART, G. R. CASTRO, R. W.
WIKINSKI (1998): VLDL compositional changes and plasma levels of triglycerides and high density
lipoprotein Clin. Chim. Acta. 269,107-124.
CEROLINI S., A. MALDJIAN, F. PIZZI, T. M. GLIOZZI (2001): Changes in sperm quality and lipid composition
during cryopreservation of boar semen. Reproduction. 121, 395-401.
CHAPMAN, M. J., P. FORGEZ (1985): Lipid transport systems: some recent aspects in swine, cattle and trout
during development. Reprod. Nutr. Develop. 25, 217-226.
CHEN, Z., T. TOTH, L. GODFREY-BAILEY, N. MERCEDAT, I. SCHIFF, R. HAUSER (2003): Seasonal
variation and age-related changes in human semen parameters. J. Androl. 24, 226-231.
FUERST-WALTL, B., H. SCHWARZENBACHER, C. PERNER, J. SÖLKNER (2006): Effects of age and
environmental factors on semen production and semen quality of Austrian Simmental bulls. Anim. Reprod.
Sci. 95, 27-37.
HERDT, T. H. (1991): Relationship of fat metabolism to health and performance in dairy cattle. Bov. Pract. 26,
92–95.
JANETT, F., R. THUN, S. BETTSCHEN, D. BURGER, M. HASSIG (2003): Seasonal changes of semen quality
and freezability in Franches-Montagnes stallions Anim. Reprod. Sci. 77, 213-221.
JIANG, Z. L., Q. W. LI, J. H. HU, W. Y. LI, H. W. ZHAO, S. S. ZHANG (2007): Improvement of the quality
of boar cryopreservation semen by supplementing with low density lipoprotein in diluents. Cryobiol. 54,
301-304.
KATOH, N. (2002): Relevance of apolipoproteins in the development of fatty liver and fatty liver-related
peripartum diseases in dairy cows. J. Vet. Med. Sci. 64, 293–307.
KELLY, G. S. (2005): Seasonal variations of selected cardiovascular risk factors. Alter. Med. Rev. 10, 307-
320.
MOORE, A. I., E. L. SQUIRES, J. K. GRAHAM (2005): Adding cholesterol to the stallion sperm plasma
membrane improves cryosurvival. Cryobiol. 51, 241-249.
MOUSSA, M., V. MARTINET, A. TRIMECHE, D. TAINTURIER, M. ANTON (2002): Low density
lipoproteins extracted from hen egg yolk by an easy method: cryoprotective effect on frozen-thawed bull
semen. Theriogenology. 57, 1695-1706.
OCHOA, M. F., J. A. MARCHELLO (1991): Bovine lipoprotein and apolipoprotein profiles as influenced by
sex and growth. J. Anim. Sci. 69, 4030-4038.
OCKENE, I. S., D. E. CHIRIBOGA, E. J. STANEK, M. G. HARMATZ, R. NICOLOSI, G. SAPERIA, A. D.
WELL, P. FREEDSON, P. A. MERRIAM, G. REED, Y. MA, C. E. MATTHEWS, J. R. HEBERT (2004):
Seasonal variations in serum cholesterol. Arch. Intern. Med. 164, 863-870.
PAYNE, J. M., S. PAYNE (1987): Indicators of energy status. In: The metabolic profile test. Oxford university
press, , Oxford, New York, Tokio. Pp. 17-26.
SEIFI, H. A., M. GORJI-DOOZ, M. MOHRI B. DALIR-NAGHADEH, N. FARZANEH (2007): Variations
of energy-related biochemical metabolites during transition period in dairy cows. Comp. Clin. Pathol. 16,
253- 258.
THÉRIEN, I., R. MOREAU, P. MANJUNATH (1998): Major proteins of bovine seminal plasma and high-
density lipoprotein induce cholesterol efflux from epididymal sperm. Biol. Reprod. 59, 768-776.
TURBA, M. E., P. FANTINATI, C. BERNARDINI, F. GENTILINI, M. L. BACCI, M. FORNI (2007):
Relationships between innovative and traditional parameters to investigate semen quality in pigs. Anim.
Reprod. Sci. 99, 72-81.
WENSVOORT, J., D. J. KYLE, E. R. ORSKOV, D. A. BOURKE (2004): Biochemical adaptation of camelids
during fasting. J. Camel Science. 1, 71-75.
WHITAKER, D. A. (2000): Use and interpretation of metabolic profiles. In: The health of dairy cattle. (A. H.
Andrews ed.) Blackwell Science Ltd, Oxford, UK.
WITTE, T. S., S. SCHÄFER-SOMI (2007): Involvement of cholesterol, calcium and progesterone in the
induction of capacitacion and acrosome reaction of mammalian spermatozoa. Anim. Reprod. Sci. 102,
181-193.
YOUSEF, M. I., F. M. EL-DEMERDASH, K. I. KAMIL, F. A. M. ELASWAD (2006): Ameliorating effect of
folic acid on chromium(VI)-induced changes in reproductive performance and seminal plasma biochemistry
in male rabbits. Reprod. Toxicol. 21, 322-328.
ZAHN, F. S., F. O. PAPA, J. A. DELL’AQUA (2002): Cholesterol incorpotation on equine sperm membrane:
effects on post-thaw sperm parameters and fertility. Theriogenology. 58, 237-240.
EFFECT OF DONOR BREED ON BOVINE OOCYTE RECOVERY AND
IN VITRO EMBRYO DEVELOPMENT AFTER OVUM PICK UP
Utjecaj pasmine goveda na jajne stanice dobivene

postupkom transvaginalne ultrazvučne punkcije I
embrionalni razvoj in vitro
M. Karadjole1, I. Getz1, N. Macesic1, M. Samardzija1, T. Karadjole1, G. Bacic1, Z.

Makek1, T. Dobranic1, M. Knezevic2, G. Perculija2, D. Cvitkovic1
1
Faculty of Veterinary Medicine, University of Zagreb
2
Faculty of Agriculture, University of Zagreb
Abstract
Ultrasound guided transvaginal oocyte recovery, also known as Ovum Pick-Up (OPU), and in vitro embryo
production (IVP) provides an alternative mean to increase the number of offspring from genetically valuable
cows. The objective of this study was to investigate the effect of two different cattle breeds on oocyte recovery
rate, quality and subsequent embryo development after transvaginal ovum pick up. Transvaginal ultrasound
guided (Pie Medical, the Netherlands) oocyte collection was performed in 8 nonlactating donor cows (4
Holstein-Friesian and 4 Charolais). Cows were synchronized with PGF2α and stimulated with pFSH, twice a
day during two days (Folltropin®, Bioniche, a total dose: 200 mg NIH-FSH-P1). OPU was performed 24 hours
after the last FSH injection and procedure was repeated every second week for eight consecutive weeks. The
number of aspirated follicles, the number of retrieved oocytes and oocyte recovery rate were recorded. The
collected oocytes were morphologicaly evaluated and subsequently submitted to in vitro embryo production.
The cleavage rates on Day 2, the total number of morulas (M) and blastocysts (Bl) on Day 7 and the numbers
of hatched blastocysts (hBl) on Day 9 were recorded. Significantly more follicles were aspirated from Charolais
cows (p<0.05). The same group also yielded higher quality oocytes than the Holstein-Friesian cows (p<0.05).
No differences in recovery rates, cleavage rates, blastocyst rates and hatched blastocyst rates were observed
between two breeds. Although we observed some breed differences related to the number of follicles and
oocyte quality, further investigations are necessary to provide more data on breed influences on superovulatory
response, oocyte number, quality and developmental competence.
Key words: cow, breed, ovum pick up, oocyte recovery, in vitro embryo development.
Sažetak
Transvaginalna ultrazvučna punkcija jajnih stanica, kratko nazvana Ovum Pick-Up (OPU) i proizvodnja
zametaka in vitro (IVP) pruža mogućnost dobivanja većeg broja potomaka od genetski vrijednih krava. Cilj
ovog istraživanja bio je usporediti utjecaj dviju pasmina goveda na postotak aspiriranih jajnih stanica nakon
transvagnalne ultrazvučne punkcije, njihovu kvalitetu i embrionalni razvoj in vitro. Transvaginalna ultrazvučna
puncija (Pie Medical, Nizozemska) provedna je na 8 zasušenih krava davateljica (4 Holštajn-frizijske i 4
Charolais pasmine). Krave su sinkronizirane sa PGF2α i stimulirane sa pFSH, dva puta dnevno tijekom dva
dana (Folltropin®, Bioniche, a total dose: 200 mg NIH-FSH-P1). OPU je izeden 24 sata nakon zadnje FSH
injekcije a postupak je ponavljan svaka dva tjedna tijekom dvomjesečnog razdoblja. Bilježen je broj aspiriranih
folikula, broj aspiriranih jajnih stanica i uspjeh aspiracije. Aspirirane jajne stanice morfološki su ocjenjene
te je praćena njihova sposobnost dozrijevanja, oplodnje i uzgoja in vitro. Ocjena razvoja goveđih zametaka
provedena je po fazama: drugog dana uzgoja zabilježen je broj brazdanih zametaka; sedmog dana broj morula
i blastocista te devetog dana broj izvaljenih blastocista. U krava Charolais pasmine aspiriran je značajno veći
broj folikula (p<0.05) što je rezultiralo i većim brojem jajnih stanica dobre kvalitete (p<0.05). Unatoč tome, nisu
utvrđene razlike u uspjehu aspiracije, postotku brazdanja te broju formiranih blastocista. Iako su ustanovljene
razlike vezane uz broj folikula i kvalitetu aspiriranih jajnih stanica, potrebna su daljnja istraživanja kako bi
dobili više podataka o pasminskom utjecaju na superovulacijski odgovor, broj jajnih stanica, njihovu kvalitetu
te sposobnost razvoja in vitro.
Ključne riječi: krava, pasmina, aspiracija jajnih stanica, embrionalni razvoj in vitro
Introduction
Ultrasound guided transvaginal oocyte recovery, also known as Ovum Pick-Up (OPU) is a
reliable technique for harvesting immature bovine oocytes from live donors. In conjunction with in
vitro embryo production (IVP), this technique provides an alternative mean to increase the number
of offspring from genetically valuable cows (Galli et al., 2001). OPU could be applyed in animals
of various physiological state (cyclic, non cyclic, early pregnancy) and of all ages, including calves,
prepubertal heifers and older cows with reproductive disorders or those who fail to respond to
superovulation protocols (Hasler, 2003). The success of OPU considerably depends on the number
and the quality of retrieved oocytes per session. A key factor confounding the predictability and
reliability of in vitro embryo production is variability in the quality or competence of harvested
oocytes (Reis et al., 2002). The in vitro developmental competence of oocytes is related to follicle size,
estrous cycle stage and the level of atresia influenced by other follicles, mainly the dominant follicle
(Machatkova et al., 2004). Numerous factors can affect the number of oocytes recovered by Ovum
Pick-Up such as genetic background (Roschlau et al., 2003), age, nutrition, parity, lactational status
and milk yield (Snijders et al., 2000). The proportion of antral follicles yielding developmentally
competent oocytes can also be influenced by external factors such as gonadotropine administration
(Fry et al., 1994). Also, significant effect of breed on follicle sizes, oocyte number, morphological
quality of the oocytes retrieved by OPU and subsequent embryo development was reported (Lopes
et al, 2006).
The aim of the present study was to investigate the effect of two different cattle breeds on number
of follicles, oocyte recovery rate, quality and subsequent embryo development after transvaginal
Ovum Pick-Up.

The study was carried out using 8 healthy, normally cycling cows (mean age 4,6 years), divided
into two groups according to the breed. Group A was Holstein-Friesian (HF) and group B Charolais
(CH) breed. Cows were synchronized with two prostaglandin F2α treatments at 11-day interval.
The gonadotropine treatment was initiated between 9 and 10 days after induced oestrus. Treatment
consisted of pFSH (Folltropin®, Bioniche Animal Health, Ireland), twice a day, during two days. The
total amount of pFSH administered was 200 mg NIH-FSH-P1 in 4 equivalent doses. Ultrasound-
guided Ovum Pick-Up was performed 24 hours after the last FSH injection. Superovulation and
OPU/IVF procedures were repeated every 14 days during 2 months (a total of 4 aspirations per cow).
All media and reagents, unless otherwise stated, were from Sigma, Germany.
The OPU procedure and oocyte recovery
Oocyte collection using OPU technology was performed according to standard procedure
described by Pieterse et al. (1988) and Getz (2004). Briefly, xylazine hydrocloride was administered
i.m. (Xyilapan, Chassot; 0,25 ml/100 kg) to all animals, following an epidural anaesthesia (4 ml of
2% lidocaine hydrocloride) prior to transvaginal aspiration of oocytes. A 7.5 MHz sector transvaginal
transducer of an ultrasound scanner (Pie Medical, the Netherlands) mounted on a holder with a grip
was used to guide the needle (18G disposable needle, attached to the stainless steel guidance) through
the vagina into the ovary. All visible follicles (≥2mm) were punctured and the contents collected in
a sterile 15 mL tube (Falcon) with aspiration medium (TCM hepes supplemented with antibiotics,
heparine and bovine serum albumine) attached to a suction pump to ensure constant aspiration
pressure. The follicular fluid obtained by aspiration were transfered into an embryo transfer filter
(Minitub™, Germany). The recovered oocytes were identified under a stereomicroscope, counted
and morfologically classified into four categories (Makek et al., 1998). The number of aspirated
follicles, the number of retrieved oocytes and oocyte recovery rate were recorded.
In vitro embryo production
Oocytes were recovered from the embryo filter and transferred into a culture dish with TCM
hepes supplemented with 10% of FCS. Oocytes of grade 1 and 2 with intact cumulus investment and
evenly granulated cytoplasm were matured in vitro in TCM 199 bicarbonate medium supplemented
with 10% FCS, FSH/LH (Pergonal, 75/75 IU, Serono), 1 µg/ml estradiol-17ß and 100 µM cysteamine.
Oocytes were incubated in groups of 10 in 50 µL droplets of maturation media under mineral oil for
24 h at 38.5°C with 5% CO2 in humidified air. The expanded COCs were washed in HEPES-TALP
medium supplemented with 6 mg/mL BSA-FAF and transferred into 40 µL droplets of IVF medium
under mineral oil. In vitro fertilization was performed in modified Tyrode’s bicarbonate buffered
solution supplemented with 10 µg/mL heparin, 5 µg/mL hypotaurine, 5 µg/mL epinephrine and 6
mg/ml BSA-FAF. In all experiments, frozen semen from the same bull was used. Sperm preparation
for IVF on BoviPure® gradient was accomplished according to Samardzija et al., (2006). The final
concentration was adjusted to 1×106 spz/mL. Incubations were carried out at 39°C in 5% CO2 in air
for 24 h. After the sperm-oocytes co-incubation, the presumptive zygotes were denuded from cumulus
cells and spermatozoa and washed in HEPES-TALP medium and in culture medium. Fertilized
oocytes were cultured in vitro in synthetic oviductal fluid (SOF) with amino acids and 8 mg/mL
BSA without glucose for 48 h and then transferred in SOF with 1.5 mM glucose. The embryos were
cultured in vitro until Day 9 at 39°C in 5% CO2, 5% O2 ,90% N2 atmosphere with maximum humidity.
Cleavage was assessed 48 hours post insemination (hpi) and blastocyst development was recorded on
Days 7 and 9 (Day 0= day of IVF). Evaluation of embryos was performed under a stereomicroscope
using standard morphological criteria.
All results were statistically analyzed with ANOVA (StatSoft, Statistic, 7.1.) and with Tukey’s
tests post-hoc analysis.
Results
For the four Holstein-Friesian cows, a total of 126 follicles were punctured during four OPU
sessions and 75 oocytes were collected. For the four Charolais cows, a total of 198 follicles were
punctured during four OPU sessions and 115 oocytes were collected.
There were significantly more follicles on the ovaries of Charolais cows (13.2 versus 8.4,
P<0.05). This was reflected in significantly higher number of grade 1 and 2 oocytes recovered from
Charolais cows (6.3 versus 3.7, P<0.05) (Table 1.).
Table 1. Number of follicles punctured and oocyte morphology in Holstein-Friesian and Charolais cows (mean
± S.E.M.)
Number Number of Number of Number of

Oocyte
of follicles recovered grade 1-2 grade 3-4
Animal breed recovery rate
punctuired per oocytes per oocytes per oocytes per
per animal
animal animal animal animal
Holstein-
Friesian 8.4 ± 0.55a 5.0 ± 0.63 59.6 ± 0.06 3.7 ± 0.51a 1.2 ± 0.27
Charolais
13.2 ± 1.32b 7.6 ± 1.23 59.2 ± 0.05 6.3 ± 1.02b 1.0 ± 0.22
Values with different superscripts differ between columns

ab
A total of 58 oocytes from HF and 100 oocytes from CH cows were submitted to IVM/IVF/IVC.
There were no significant differences regarding to cleavage rate, blastocyst rate or hatched blastocyst
rate between two breeds (Table 2.).
Table 2. Developmental competence of OPU derived oocytes after in vitro maturation, fertilization and culture
in Holstein-Friesian and Charolais cows (mean ± S.E.M.)
Blastocyst yield
Hatched blastocyst
Animal breed Number of oocytes Cleavage rate (%) (%)
yield (%) Day 9
Day 7
Holstein-Friesian
58 88.7 ± 0.04 51.0 ± 0.14 24.3 ± 0.1
Charolais
100 86.5 ± 0.01 40.6 ± 0.07 16.6 ± 0.05
Discussion
Our study about efficiency of Ovum Pick-Up in cows from two different breeds shows that
Charolais donor cows yielded higher mean number of follicles punctured and higher number of good
quality oocytes recovered by OPU than Holstein-Friesian donor cows. However, irrespective to the
breed, oocytes of similar quality (grade 1-2) had a similar developmental ability and no differences
were found related to the proportion of good quality oocytes undergoing in vitro fertilization and
subsequent development to the blastocyst stage.
Numerous factors can affect the number of oocytes recovered by Ovum Pick-Up. Merton et
al. (2003) demonstrated that the oocyte yield was dependent on the OPU team, in particular the
technitian manipulating the ovaries. The proportion of antral follicles yielding developmentally
competent oocytes can also be influenced by external factors such as gonadotropine administration.
Also, different biological aspects such as genetic background (Roschlau et al., 2003.), breed (Duc
et al., 2003; Lopes et al., 2006) or external factors such as nutrition, menagment practice, parity,
lactational status, milk yield (Mac-Millan et al., 1996; Snijders et al., 2000) can affect the oocyte
recovery rate after OPU.
Breed differences have previously been reported for slaughterhouse derived oocytes (Domingez,
1995) and for the oocytes collected by OPU (Schernthaner et al., 1999; Duc et al., 2003; Faber et
al., 2003). The study about efficiency of OPU in cows from five different breeds (Schernthaner et al.
,1999.) reported that Charolais breed showed the best results in average of all parameters investigated,
which were number of follicles, number of oocytes recovered, number of embryos produced,
traferred and the percentage of pregancies. On contrary, Holstein-Friesian donor cows showed poor
results concerning the number of follicles, oocytes and IVP-useful oocytes per puncture session. This
finding was in agreement with our results where Charolais donor cows showed significantly better
results in number of follicles punctured (13.2 versus 8.4 follicles in Charolais and Holstein-Friesian,
respectively). The number of embryos of grade 1 and 2 was also higher in Charolais donor cows
(6.3 versus 3.7) which is related to the higher number of follicles aspirated. Lopes et al. (2006.) also
reported significant effect of breed on the morphological quality of the oocytes recovered by OPU.
In the present study the developmental competence of good quality oocytes (grade 1-2) to reach
the morula/blastocyst stage at day 7 and hatched blastocyst stage at day 9 of in vitro culture, was
similar between Charolais and Holstein-Friesian breed. There was no differences in the proportion
of good quality (grade 1-2) oocytes undergoing in vitro fertilization and subsequent development to
the blastocyst stage.
In conclusion, we reported that Charolais donor cows showed significantly better results in
number of follicles punctured and number of grade 1 and 2 embryos recovered by OPU, but there
was no differences in developmental competence of retreived oocytes of similar quality between two
breeds. Although we observed some breed differences related to the number of follicles punctured
and quality of recoverd oocytes, further investigations are necessary to provide more data on breed
influences on superovulatory response, oocyte recovery, quality and developmental competence.
References
1. Duc NH., Uoc NT., Ty LV., Hanh NV., Thanh NT., Bui LC., Anh NT., Huu QX., Nguyen BX.: Potential for
in vitro production of embryo from follicular oocyte from yellow and yellow-red sindhi crossbred cattle.
Theriogenology 2003, 59, 442.
2. Fry RC., Simpson TL., Squires TJ., Parr RA., Damanik RM.: Factors affecting transvaginal oocyte pick up
in heifers: Theriogenology 1994, 41:197 (Abstract).
3. Galli C., Crotti G., Notari C., Turini P., Duchi R., Lazzari G.: Embryo production by ovum pick up from
live donors. Theriogenology 2001, 55, 1341-1357.
4. Getz I.: Uspješnost stimulacije jajnika krava u postupku transvaginalne ultrazvučne punkcije i uzgoja in
vitro goveđih zametaka. Doktorska disertacija, Zagreb, 2004.
5. Hasler JF.:The current status and future of commercial embryo transfer in cattle. Anim Reprod Sci 2003,
79, 245-264.
6. Lopes AS., Martinussen T., Greve T., Callesen H.: Effect of days post-partum, breed,and Ovum pick-up
scheme on bovine oocyte recovery and embryo development. Reprod Dom Anim 2006, 41, 196-203.
7. Machatkova M., Krausova K., Jokesova E., Tomanek M.: Developmental competence of bivine oocytes:
effect of follicle size and the phase of follicular wave on in vitro embryo production. Theriogenology 2004,
61, 329-335.
8. Makek Z., Getz I., Cergolj M., Herak M., Tomašković A., Dobranić T., Sušić V.: Selection of immature
bovine oocytes as the preliminary phase of in vitro fertilization. Vet. Arhiv 1998, 68, 109 -119.
9. Merton JS., De Roos AP., Mullaart E., De Ruigh L., Kaal L., Vos PL.: Factors affecting oocyte quality and
quantity in commercial application of embryo technologies in the cattle breeding industry. Theriogenology,
2003, 59:651-674.
10. Pieterse MC., Kappen KA., Kruip ThAM., Taverne MAM.: Aspiration of bovine oocytes during transvaginal
ultrasound scanning of the ovaries. Theriogenology 1988, 30, 751-762.
11. Roschlau K., Kuwer A., Kuhnt C., Poppe P., Roschlau D., Johanning S., Michaelis U., Dexne U.: Individuelle
varianzen in der Ausbeute an Embryonen nach OPU/IVP. In: Proceedings of the 30th Ann.Meeting AET-D,
2003, Marieensee, Germany. German ET-Association (AET-d), Marieensee Neustadt, Germany, pp. 3-4.
12. Samardzija, M., Karadjole M., Getz I., Makek Z., Cergolj M., Dobranić T.: Effects of bovine spermatozoa
preparation on embryonic development in vitro. Reproductive Biology and Endocrinology 2006,4;58.
13. Snijders SEM., Dillon P., O’Callaghan D., Boland MP.: Effect of genetic merit, milk yielj, body condition
and lactation number on in vitro oocyte development in diary cows. Theriogenology 2000, 53, 981-989.
14. MacMillan KL., Lean IJ., westwood CT.: the effects of lactation on the fertility of diary cows. Aust Vet J
1996, 73, 141-147.
15. Domingez MM.: Effects of body condition, reproductive status and breed on follicular population and
oocyte quality in cows. Theriogenology 1995, 43, 1405-1418.
16. Faber DC., Molina JA., Ohlrichs CL., Vander Zwaag DF., Ferre LB.: Commercialization of animal
biotechnology. Theriogenology 2003, 59, 125-138.
17. Schernthaner W., Wenigerkind H., Stojkovic M., Palma GA., Mödl J., Wolf E., Brem G.: Pregnancy rate
after Ultrasoun guided Follicle aspiration in nonlactating Cows from different breeds. J. Vet. Med. A 1999,
46, 33-37.
18. Reis A., Staines ME., Watt RG., Dolman DF., McEvoy TG.: Embryo production using defined oocyte
maturation and zygote culture media following repeated ovum pick-up (OPU) from FSH stimulated
Simmental heifers. Anim Reprod Sci 2002, 72, 137-151.
THE ETIOLOGY AND PREVALENCE OF INTRAMAMMARY
INFECTION OF DAIRY GOATS IN REGIONS OF NORTH CROATIA
ETIOLOGIJA I PREVALENCIJA INTRAMAMARNIH INFEKCIJA KOZA

U SJEVERNOJ HRVATSKOJ
Nino Maćešić1, Marijan Cergolj1, Nikica Prvanović1, Marko Samardžija1, Tugomir

Karadjole1, Martina Karadjole1, Goran Bačić1, Tomislav Dobranić1, Antun Kostelić2,
Miroslav Benić3
1
Faculty of Veterinary Medicine, University of Zagreb
2
Faculty of Agriculture, University of Zagreb
3
Croatian veterinary institute
Abstract
The aim of this of study was to determine the etiology and prevalence of intramammary infections (IMI)
of dairy goats in north Croatia. Milk samples (n=606) were taken from 303 goats from randomly selected
sheep flocks (n=5). The herds ranged in size from 40 to 114 dairy goats in lactation. All goats were French
alpine breed. The goats were reared under intensive system, in stalls without dry lot. Milking was conducted
in parlor by milking machine in a bucket. Milk samples were tested with bacteriological analyses and 122
samples were positive. Prevalence of IMI was 20,1% (n=122) of all udder-half samples examined. The most
prevalent mastitis agent was Staphylococcus aureus 72,1% (n=88 udder-half samples). Other prevalence were
Bacillus spp. 13% (n=16 udder-half samples), coagulasa-negative Staphylococci (CNS) 9,8% (n=12 udder-half
samples), Streptococcus group D 4,1% (n=5). Salmonella spp. and Listeria monocytogenes were not detected.
The prevalence of IMI between left and right udder half were not significant.
Key words: goat, intramammary infection, bacteriological analysis, milk
Sažetak
Istraživanje je provedeno u svrhu određivanja etiologije i prevalencije intramamarnih infekcija mliječnih
koza u sjevernoj regiji Hrvatske. Uzeti su uzorci mlijeka (n=606) od 303 životinje iz nasumično odabranih stada
(n=5). Stada su se kretala od 40 do 114 mliječnih koza francuske alpske pasmine u laktaciji. Koze su držane
intenzivno, stajski, bez ispusta. Mužnja se obavlja u izmuzištu, strojno, u kantu. Bakteriološkom pretragom
600 uzoraka mlijeka dobili smo 122 bakteriološki pozitivnih uzoraka. Prevalencija intramamarnih infekcija
bila je 20,1% (n=122) od svi pregledanih uzoraka polovina vimena. Najučestaliji uzročnik mastitisa bio je
Stapylococcus aureus 72,1% (n=88 uzoraka polovina vimena). Bacillus spp. izoliran je iz 13% uzoraka (n=16),
koagulaza negativni Staphylococci (CNS) kod 9,8% (n=12), Streptococcus skupine D 4,1% (n=5). Salmonella
spp. I Listeria monocytogenes nisu izdvojene. Prevalencija intramamarnih infekcija između lijeve i desne
polovine vimena nije bila značajna.
Ključne riječi: koze, intramamarne infekcije, bakteriološka pretraga, mlijeko
Uvod
Europska unija (EU) ima 1,5% (11,730,164 grla u 2002) svjetske populacije koza. Četiri zemlje
(Italija, Grčka, Španjolska, i Francuska) u Mediteranskoj zoni imaju 91% cijelokupne europske
populacije koza i 95% proizvodnje kozijeg mlijeka (FAO, 2002).
U Republici Hrvatskoj uzgaja se oko 80.000 koza, a Hrvatski stočarski centar je temeljem
zahtjeva za ostvarivanjem državnih novčanih potpora za držanje rasplodnih koza tijekom 2006.
godine evidentirao ukupno 52.397 grla kod 1.072 uzgajivača, pri čemu su evidentirana samo stada
s najmanje 20 odraslih grla, što je u 2006. godini bio minimalno potreban broj grla da bi uzgajivač
ostvario novčanu potporu.
U tri priobalne županije (Zadarska, Šibensko-kninska i Splitsko dalmatinska županija)
evidentirano je ukupno 27.816 koza ili 53,09% od ukupnog broja evidentiranih koza. U pasminskom
sastavu na ovim prostorima dominira hrvatska šarena koza (HSC, 2006).
U kontinentalnom dijelu Republike Hrvatske dominiraju inozemne mliječne pasmine, a među
njima je najzastupljenija francuska alpina. Najveći broj koza u kontinentalnom dijelu Republike
Hrvatske evidentiran je u Varaždinskoj, Međimurskoj i Bjelovarsko-bilogorskoj županiji (9.675 grla
ili 18,46% od ukupnog broja registriranih koza).
U Hrvatskoj je higijenska ispravnost kozjeg mlijeka regulirana zakonom (Pravilnik o kakvoći
svježeg sirovog mlijeka, NN 102/00). Minimalni uvijeti kojima treba udovoljavati kozije mlijeko
određeni su prema ukupnom broju bakterija u mlijeku dok granična vrijednost za broj somatski
stanica nije definirana. Preduvijet za proizvodnju higijenski ispravnog mlijeka i sira je zdravo vime,
stoga intramamarne infekcije imaju veliku važnost u proizvodnji kozjeg mlijeka.
Materijali i metode
Uzorci mlijeka uzeti su od 303 mliječne koze sa pet različitih, nasumično odabranih farmi u
sjevernoj Hrvatskoj (Varaždinska županija, Međimurska županija ). Veličina stada kretala se od 40-
114 životinja. Sve koze bile su francuske alpske pasmine. Životinje su držane intezivno u stajama
bez ispusta. Hranjene su sijenom, koncentratom i vodom koji su bili dostupni ad libidum. Mužnja se
obavljala u izmuzištu pomoću stroja za mužnju. Koze su se muzle dva puta dnevno.
Uzorci mlijeka uzeti su od svake životinje jednokratno. Prije uzorkovanja vrhovi sisa su očišćeni
5% alkoholom. Prvi mlazovi mlijeka su izmuzeni, a slijedećih 10 ml mlijeka iz svake polovine
vimena je aseptički uzeto u odvojenu sterilnu epruvetu. Uzorci su se držali na +4 ºC do bakteriološke
pretrage.
Rezultati i rasprava
Ukupno je uzeto 606 uzoraka iz svih polovina vimena od 303 koze sa pet farmi. Bakteriološkom
pretragom uzoraka dobili smo 122 bakteriološki pozitivana uzorka, pa je prevalencija infekcije
kod svih pregledanih uzoraka iznosila 20,1%. Između koza koje su imale mastitis, 66,4 % je imalo
unilateralnu infekciju vimena, dok su ostale imale inficirane obje polovine vimena. Koze kod kojih
je zabilježena infekcija obje polovine vimena imale su 70,7% infekcija sa Staphylococcus aureusom
i 29,3% sa koagulaza negativnim satafilokokima.
Najučestaliji uzročnik mastitisa bio je Stapylococcus aureus 72,1% (n=88 uzoraka polovina
vimena). Bacillus spp. izoliran je iz 13% uzoraka (n=16), koagulaza negativni Staphylococci (CNS)
kod 9,8% (n=12), Streptococcus skupine D 4,1% (n=5). Salmonella spp. I Listeria monocytogenes
nisu izdvojene. Prevalencija intramamarnih infekcija između lijeve i desne polovine vimena bila je
potpuno jednaka 50% i 50% što je slično rezultatima drugih autora koji su istraživali mastitise koza
(Moroni i sur., 2005).
Prevalencija infekcije s obzirom na vrstu uzročnika i zahvaćenu četvrt prikazana je u tablici 1.
Tablica 1. Izolirani mikroorganizmi i prevalencija (% - odnos inficiranih polovica vimena) infekcije kod lijeve
i desne polovice vimena koza
Polovica vimena
Vrsta mikroorganizma
Lijeva polovica (n=61) Desna polovica (n=61)
Svi uzročnici 50% 50%
Staphylococus aureus 75,4% 68,9%
CNS 8,2% 8,2%
Ostali 16,4% 22,9%
Tablica 2. Izolirani mikroorganizmi i prevalencija infekcije (%) od uzetih uzoraka mlijeka

Stado
Vrsta mikroorganizma
A(n=106) B(n=104) C(n=80) D(n=88) E(n=228)
Ukupna prevalencija 14,1 31,7 25 26,1 14
Staphylococcus aureus 60 100 100 100 12,5
Bacillus spp. 0 0 0 0 50
CNS 13,3 0 0 0 31,2
Streptococcus tip D 26,6 0 0 0 3,1
Escherichia coli 0 0 0 0 3,1
Najveća skupina patogena bila je Staphylococcus spp. koja je izolirana iz 100 bakteriološki
pozitivnih uzoraka mlijeka (82% pozitivnih uzoraka). Najzastupljeni iz te skupine bio je S.aureus
koji je izdvojen iz 88 uzoraka mlijeka a CNS su izdvojeni iz 12 uzoraka Na tri farme (B, C, D)
sa prevalencijom infekcije od 25% do 31,6% izoliran je S.aureus iz svih (100%) bakteriološki
pozitivnih uzoraka (Tablica 2.). Tako visoku prevalenciju infekcije sa S.aureusom možemo povezati
sa izostankom izlučivanja kronično oboljelih životinja te izostankom provođenja adekvatnih
higijenskih mjera tijekom mužnje. Zbog svoje patogenosti S. aureus je najznačajniji patogen
mliječne žlijezde koze. Infekcije vimena sa S. aureusom mogu biti subkliničke, kronične, akutne, a u
najtežem obliku i gangrenozne. Rezistentni su na antibiotsku terapiju zbog sposobnosti da obitavaju
intracelularno i u L-oblicima te zbog smještaja unutar mikroapscesa u vimenu (Sears i sur., 1987;
Smith i Sherman, 1994). Terapija životinja u suhostaju, izlučivanje kronično oboljelih životinja iz
stada te provedba higijenskih mjera tijekom mužnje osnovne su kontrolne mjere za smanjenjem
novih infekcija (Robertson, 1999). Drugi najzastupljeniji mikroorganizam u ovom istraživanju bio
je Bacillus spp. koji je izoliran iz 13% bakteriološki pozitivnih uzoraka a svi pozitivni uzorci kod
kojih je izoliran bili su sa farme E gdje su izolirani kod 50% uzoraka. Na farmi E prevalencija
infekcije sa S.aureusom je 12,5% što je u sukladno ranije provedenim istraživanjima (Manser, 1986;
East i sur, 1987; Hall i Rycroft, 2007). Pojavnost Bacillusa spp. u tolikoj mjeri može se povezati sa
lošim postupcima vođenja farme a slično je zabilježio i Kalogridou-Vassiliadou (1991). Koagulaza
negativni stafilokoki (CNS) izolirani su iz 9,8% pozitivnih uzoraka. Na farmi A izolirani su iz 13,3%,
a na farmi E 31,2% pozitivnih uzoraka dok nisu zabilježeni na farmama B, C, i D. Stafikokoki koji
su najčešće uzročnici supkliničkih mastitisa kod koza su uglavnom koagulaza negativni stafilokoki-
CNS. Prevalencija CNS-a raste kod nedostatka adekvatne higijene tijekom mužnje ili upotrebe
neispravnog stroja za mužnju. Na taj način dolazi do izražaja oportunistička priroda ove skupine
mikroorganizama. Iako su CNS manje patogeni od S.aureusa oni mogu dovesti do perzistentnog
supkliničkog mastitisa i čak do kliničkog mastitisa (Deinhofer i Pernthaner, 1995; Contreras i sur.,
1997.) kao i stvaranja termostabilnog enterotoksina (Meyrand i sur., 1999; Udo i sur, 1999). Glavni
CNS patogeni koji uzrokuju intramamarne infekcije nalaze se na koži vimena i sisa koza (Valle i
sur., 1991). Smatra se da su postupci kod mužnje pogodovni za njihov ulazak u vime u terenskim
uvijetima. Na isti način, različiti postupci sanitacije koji se koriste kod mužnje mogu objasniti razliku
u prevalenciji supkliničkih intramamarnih infekcija između stada mliječnih koza (East i sur, 1987).
Streptococcus skupine D izolirani su iz 4,1 % pozitivni uzoraka. Streptokoki kao uzročnici
mastitisa ne predstavljaju skupinu osobito učestalih patogena na farmama koza i obično se pojavljuju
u manje od 5-10% slučajeva mastitisa kod koza (Contreras i sur., 2003).
Zaključci
Stapylococcus spp. bila je najučestalija skupina bakterija koja je izolirana iz polovina vimena
mliječnih koza u sjevernoj Hrvatskoj. Unutar te skupine a i kao pojedinačni uzročnik najučestaliji je
bio S.aureus.
Literatura
1. CONTRERAS, A, CORRALES, J.C., SANCHEZ, A, SIERRA, D (1997): Persistence of subclinical
intramammary pathogens in goats throught lactation. J. Dairy Sci. 80, 2815-2819.
2. CONTRERAS, A., LUENGO, C., SANCHEZ, A., CORRALES, J.C (2003): The role of intramammary
pathogens in dairy goats. Livest. Prod. Sci. 79, 273–283.
3. DEINHOFER, M., PERNTHANER¸A. (1995): Staphylococcus spp.as a mastitis-related pathogens in goat
milk. Vet. Microbiol. 43, 161-166
4. EAST, N.E., BIRNIE, E.F., FARVER, T.B. (1987): Risk factors associated with mastitis in dairy goats. Am.
J. Vet. Res. 48 5 (1987), pp. 776–779.
5. HALL, S.M., RYCROFT, A.N. (2007): Causative organisms and somatic cell counts in subclinical
intramammary infections in milking goats in the UK, Veterinary Record 160 (1) (2007), pp. 19-22
6. KALOGRIDOU-VASSILIADOU (1991): Mastitis-related pathogens in goat milk. Small Rumin. Res. 4 2
(1991), pp. 203–212.
7. HRVATSKI STOČARSKI CENTAR (2006): Godišnje izvješće za 2006. godinu, Hrvatski stočarski centar,
str.127
8. FAOSTAT, 2002. Agriculture Statistic (online: http://www.fao.org.), FAO, Rome, Italy
9. MORONI,P., PISONI,G., RUFFO,G., BOETTCHER,PJ. (2005): Risk factors for intramammary infections
and relationship with somatic-cell counts in Italian dairy goats. Prev Vet Med 69(3-4): 163-73
10. MANSER, P.A. (1986): Prevalence, causes and laboratory diagnosis of subclinical mastitis in the goat. Vet.
Rec. 118 20 (1986), pp. 552–554.
11. MEYRAND, A., MONTET, M.P., BAVAI, C., RAY-GUENIOT, S., MAZUY, C., GASPARD, C.E.,
JAUBERT, G., PERRIN, G., VERNOZY-ROZAND, C. (1999): Risk linked to an enterotoxigenic strain of
Staphylococcus lentus during the manufacture and ripening of raw goats’milk Camembert-type cheeses.
Rev. Med. Vet. 150 (8–9), 703–708.
12. PRAVILNIK O KAKVOĆI SVJEŽEG SIROVOG MLIJEKA (2000), NN, 102/00
13. ROBERSON, J.R. (1999): Epidemiology of Staphylococcus aureus on dairy farms. In: Proceedings of the
38th Annual Meeting of the National Mastitis Council, 14–17 February, Arlington, VA, (1999), p. 38.
14. SEARS, P.M., FETTINGER, M., MARSH-SALIN, J. (1987): Isolation of Lform variants after antibiotic
treatment in Staphylococcus aureus bovine mastitis. J. Am. Vet. Med. Assoc. 191, 681±684
15. SMITH, M.C., SHERMAN, D.M. (1994): Mammary gland and milk production. In: Goat Medicine, Lea
and Febiger, Philadelphia, PA, USA, pp. 474±479.
16. UDO, E.E., AL-BUSTAN, M.A., JACOB, L.E., CHUGH, T.D. (1999): Enterotoxin production by
coagulase-negative staphylococci in restaurant workers from Kuwait City may be a potential cause of food
poisoning. J. Med. Microbiol. 48, 819–823.
17. Valle et al., J. Valle, S. Piriz, R. De la Fuente and S. Vadillo (1991): Staphylococci isolated from healthy
goats. J. Vet. Med. B. 38, pp. 81–89.
PHENOTYPE AND PRODUCTIVE CHARACTERISTICS OF DUBIAN
ZECKEL SHEEP
FENOTIPSKE I PROIZVODNE KARAKTERISTIKE OVCE DUBSKE

PRAMENKE
Šakić Vedad, Katica Velija, Crnkić Ćazim, Softić Almira, Brdarić Maja
Veterinary Faculty of Sarajevo University, Bosnia and Herzegovina
Summary
Sheep breeding is important part of animal breeding in Bosnia and Herzegovina. More than 1.000.000
hectars of pasturing area in highlands provide optimal conditions for production of food of high biological
value, including lamb and cheese. Sheep breeding, completely integrated in land and climatic resources, is
still under traditional way of production without significant changes in production technology. In post-war
period almost complete young female sheep population is reserved for breeding. According to the assessments
of breeding specialists there are over 1.000.000 sheep in Bosnia and Herzegovina today. Zeckel sheep is a
dominant local breed with a number of varieties with different phenotype and productive traits. According
to literature data, varieties of Zeckel sheep like Dubian, Kupreska, Privorian, Glasinacka, Kljucka-Vrcarska,
Podveleska, Stolacka-Humnjacka represents about 25% of total sheep population in pure breeding. Dubian
sheep is combined production sheep type milk-meat-wool, and represents a sheep with the highest milking
capacity among sheep species of Bosnia and Herzegovina. This research was preformed during the year 2006 at
Vlasic mountain in the central part of Bosnia and Herzegovina. Nine flocks divided in different age groups (2, 3
and over 3 years) were included in investigation of basic body measures and production performances. Results
were (mean±SD): body weight 75,85 ± 0,31 kg, height at withers 77,17 ± 0,11 cm, body length 85,07 ± 0,19 cm,
breast circumference 10,43 ± 0,04 cm. Average milk yield of all age groups were 47,05 l per head. With activities
on breeding selection and appropriate feeding it would be possible to improve production performances and
phenotype characteristics of sheep. Data on phenotype characteristics obtained in this study indicate a need for
changes of present standards of Dubian sheep.
Key words: dubian sheep, phenotype, production performances
Sažetak
Uzgoj ovaca zauzima značajno mjesto u stočarstvu Bosne i Hercegovine, budući da velika pašnjačka
prostranstva od preko 1.000.000 ha u brdsko-planinskom području pružaju optimalne uslove za proizvodnju
biološki vrijedne hrane, posebno jagnjećeg mesa i ovčijeg sira. Ovčarstvo je u potpunosti integrisano u zemljišne
i klimatske resurse, te je zadržalo tradicionalan način proizvodnje bez značajnijih tehnoloških promjena. U
postratnom periodu cjelokupan ženski podmladak ostavlja se za priplod, odnosno proširenu reprodukciju.
Danas je, na teritoriju Bosne i Hercegovine, prema procjenama u uzgoju preko 1.000.000 grla ovaca. Pramenka
je dominantna, jedina autohtona pasmina u uzgoju, i kao takva ima veći broj sojeva različitih fenotipskih i
proizvodnih osobina. Prema podacima iz literature, sojevi poput Dubske, Kupreške, Privorske, Glasinačke,
Ključke - Vrcarske, Podveleške, Stolačke - Humnjačke čine oko 25% ukupne populacije ovaca u čistom uzgoju.
Dubska pramenka proizvodno predstavlja kombinovani soj – mlijeko, meso, vuna i najmliječnija je od svih
bosanskohercegovačkih sojeva pramenke. Istraživanje po dobnim skupinama (2, 3 i preko 3 godine) osnovnih
tjelesnih parametara i proizvodnih osobina u 9 stada je provedeno tokom 2006. godine na planini Vlašić
– Srednjebosanski Kanton, Bosna i Hercegovina. Prosječni utvrđeni osnovni tjelesni parametri cjelokupnog
uzorka obje spolne skupine su: tjelesna masa 75,85 ± 0,31 kg, visina do grebena 77,17 ± 0,11 cm, dužina trupa
85,07 ± 0,19 cm, obim cjevanice 10,43 ± 0,04 cm. Prosječna proizvodnja mlijeka ovaca svih dobnih skupina
po grlu iznosila je 47,05 litara po laktaciji. Uzgojno selekcijskim radom i odgovarajućom ishranom, moguće je
poboljšati prosječnu proizvodnju mlijeka ovaca i fenotipske osobine. Utvrđeni fenotipski parametri ukazuju na
potrebu promjene dosadašnjeg standarda dubske pramenke.
Ključne riječi: dubska pramenka, fenotip, proizvodne osobine
Uvod
Uzgoj ovaca zauzima značajno mjesto u stočarstvu Bosne i Hercegovine budući da velika
pašnjačka prostranstva od preko 1.000.000 ha u brdsko-planinskom području pružaju optimalne
uslove za proizvodnju biološki vrijedne hrane, posebno jagnjećeg mesa i ovčijeg sira namijenjenih
domaćem i inostranom tržištu. Ovčarstvo je u potpunosti integrisano u zemljišne i klimatske resurse,
te je zadržalo tradicionalan način proizvodnje bez značajnijih tehnoloških promjena.
Danas je, na teritoriji Bosne i Hercegovine, prema procjenama, u uzgoju preko 1.000.000 grla
ovaca. Pramenka je dominantna, jedina autohtona pasmina u uzgoju, i kao takva ima veći broj sojeva
različitih fenotipskih i proizvodnih osobina.
Najznačajniji soj je Dubska pramenka. Nastala je i danas najviše rasprostranjena u širem području
planine Vlašić (Srednja Bosna), na nadmorskoj visini od 800-1200 metara. Glavne odlike ove ovce,
kao i većine pramenki, su izražena otpornost i skromnost u zahtjevima, te prilagodljivost na različite
hranidbene i klimatske uvjete. Većina sojeva pramenke je kasnozrela, pa tako i dubska. Godine 1991.
brojno stanje ove ovce u Bosni i Hercegovini se procjenjivalo na 140.000 grla. Od ovog broja 54%
se odnosilo na priplodne ovce. Međutim, u toku agresije na Bosni i Hercegovinu (1992-95) taj broj se
smanjio usljed migracije u susjedne zemlje i prodaje koja izlazi van tržišnih kriterija. Danas je teško
utvrditi precizan broj dubske premenke jer grla nisu markirana niti umatičena, ali je procjena da je
broj sličan onome iz 1991. godine. Godine 1992/93 godine u Hrvatsku je preseljeno oko 10 000 grla
dubske ovce. Danas ih najviše ima u Zapadnoj Slavoniji i Lici (3).
Dubska pramenka spada među najkrupnije sojeve pramenke, duge i grube vune te, kao ostali
sojevi, pripada skupini ovaca kombiniranih proizvodnih svojstava meso-mlijeko-vuna. Prsa su joj
prilično duboka, ali relativno uska, što je opća odlika svih pramenki. Vrat je dug, slabije do osrednje
mišićav, a greben dobro izražen. Leđna linija je duga, ravna i pravilna, završava s dugim repom.
Trup se nalazi na čvrstim, jakim i pravilno postavljenim nogama. Papci su crni, pravilni, jaki i čvrsti.
Glava je srednje razvijena s polustršećim, najčešće crno pigmentiranim ušima. Ovce i ovnovi mogu
biti šuti i rogati. Glava je obično bijele boje s manje ili više crno pigmentiranim stranama lica od
usna do očiju. Duž čela i nosnog dijela do nozdrva i vrha gornje usne pruža se bijela traka u vidu lise.
Ovnovi imaju ispupčen profil glave, a ovce ravan. Tijelo je prekriveno otvorenim runom sastavljenim
od dugih (22.63 cm), šiljastih i bičastih pramenova koji nerjetko sežu sve do zemlje. Trbuh, donji
dijelovi nogu, a ponekad i vrat, nisu obrasli vunom, nego gustom dlakom. Runo je u najvećem broju
slučajeva bijele boje, iako ima pojava manjeg boja grla s crnim ili sivim runom.
Cilj ovog istraživanja je bio mjerenje nekih od osnovnih tjelesnih parametara kako bi se utvrdile
promjene tjelesnog okvira današnjeg tipa dubske pramenke koje bi poslužile kao osnov pri izradi
prijedloga Pravilnika o uzgojnim i morfološkim standardima dubske pramenke u cilju zaštite iste.
Materijal i metode
Istraživanje osnovnih tjelesnih parametara i proizvodnih osobina 20 ovnova i 284 ovce iz 9 stada
je provedeno na području planine Vlašić u naseljima Vitovlje, Mehurići, Han Bila, Ovnak, Maglići,
Rakite, Jankovići i okolini grada Jajce tokom 2006. godine. Broj grla u svih 9 stada je iznosio
1260 ovaca. Uzgajivači stada imaju dugu tradiciju uzgoja ovaca, ali niti jedno istraživano grlo nije
umatičeno i uključeno u uzgojno-selekcijski rad. Izvršena je procjena dobi po zubima svakog grla
pojedinačno. Nakon procjene dobi i utvrđivanja spola grla su podijeljena u sljedeće dobne grupe: do 2
godine, od 2-3 godine i preko 3 godine dobi. Uzimanje tjelesnih mjera (visine grebena, dužine trupa)
izvršeno je Lydtinovim štapom, a opseg cjevanice pomoću vrpce. Tjelesna masa ovaca utvrđena je
pojedinačnim vaganjem na vagi preciznosti ± 0,2 kg. Kontrolom mliječnosti standardnom metodom
(periodično mjerenje) utvrđena je dnevna produkcija mlijeka u intervalima od po 30 dana (raspon
26-33 dana ili svake 4 sedmice) tokom laktacije nakon dojnog perioda.
Dobiveni rezultati statistički su obrađeni primjenom analize varijanse uz testiranje razlika srednjih
vrijednosti pomoću Duncanovog testa višestrukih intervala. Odnosi između pojedinih parametara
ispitani su izračunavanjem koeficijenta korelacije, a cjelokupna statistička obrada urađena je u
programu MS Excel 2003.
Utvrđeni tjelesni parametri cjelokupnog uzorka obje spolne skupine bili su: tjelesna masa 75,85
± 0,31 kg, visina do grebena 77,17 ± 0,11 cm, dužina trupa 85,07 ± 0,19 cm i obim cjevanice 10,43
± 0,04 cm. Utvrđeni tjelesni parametri kod ovnova bili su: tjelesna masa 77,59 ± 3,73 kg, visina do
grebena 78,33 ± 0,74 cm, dužina trupa 87,33 ± 1,31 cm i obim cjevanice 11,59 ± 0,15 cm. Tjelesni
parametri kod ovaca bili su: tjelesna masa 74,89 ± 0,21 kg, visina do grebena 76,92 ± 0,11 cm, dužina
trupa 84,69 ± 0,16 cm i obim cjevanice 10,34 ± 0,03 cm. Statistički značajne razlike između ovnova
i ovaca utvrđene su za dužinu trupa na nivou p<0,05 i obim cjevanice na nivou p<0,01. Utvrđene
fenotipske karakteristike po dobnim skupinama prikazane su u tabeli 1.
Tabela 1. Utvrđene fenotipske karakteristike ovaca po dobnim skupinama
Table 1. Phenotype characteristics of sheep by age classes
Visina do grebena,
Dužina trupa, cm Obim cjevanice, cm
Tjelesne mjere Tjelesna masa, kg cm
Lenght of the trunk, Circumference of the
Body measures Body weight, kg Height of withers, cm
cm leg, cm
< 2 godine < 2 years
Mean 72,23a 76,55a 83,70a 10,45
SD 8,37 2,69 3,43 0,67
Min. 50 69 75 10
Max. 90 87 92 13
2-3 godine 2-3 years
Mean 76,30b 77,11b 85,25b 10,44
SD 6,53 1,94 3,64 0,65
Min. 65 70 76 10
Max. 120 84 100 13
> 3 godine > 3 years
Mean 75,38b 77,37ac 85,36b 10,45
SD 3,37 1,52 2,37 0,50
Min. 65 73 78 10
Max. 84 83 89 11
abc
srednje vrijednosti u istoj koloni sa različitom slovnom oznakom razlikuju se signifikantno na novou p<0,05
Jaki koeficijenti korelacije utvrdjeni su kod ovnova izmedju tjelesne mase i visine grebena
(r=0,836), tjelesne mase i dužine trupa (r=0,890), te tjelesne mase i obim cjevanice (r=0,709)
(Grafikoni 1, 2 i 3). Isti koeficijenti kod ženskih životinja nisu bili ovako visoki, a samo je u slučaju
korelacije između tjelesne mase i dužine rupa koeficijent bio statistički značajan (r=0,546) (Grafikon
1).
ženski muški
110
y = 0,3118x + 63,143; r= 0,890

100
dužina trupa, cm
90
80
y = 0,4221x + 53,076; r= 0,546
70
40 60 80 100 120
tjelesna masa, kg
Grafikon 1. Odnos tjelesne mase i dužine trupa kod ovaca i ovnova

Graph. 1. Relationship between body weight and lenght of the trunk in sheep and ram
ženski muški
90
y = 0,1654x + 65,5; r=0,836
visina grebena, cm
85
80
75 y = 0,0854x + 70,528; r=0,172
70
40 60 80 100 120
tjelesna masa, kg
Grafikon 2. Odnos tjelesne mase i visine grebena kod ovaca i ovnova

Graph. 2. Relationship between body weight and height of withers in sheep and ram
ženski muški
14
y = 0,0292x + 9,3298; r= 0,708

13
Obim cjevanice, cm
12
11
y = -0,0193x + 11,783; r= -0,145
10
40 60 80 100 120
tjelesna masa, kg
Grafikon 3. Odnos tjelesne mase i obima cjevanice kod ovaca i ovnova

Graph. 3. Relationship between body weight and circumference of the leg in sheep and ram
Slična istraživanja vanjštine hrvatskih autohtonih pasmina rađena su od strane Pavić i sur. (7),
gdje su komparativno predstavljeni i dobiveni rezultati istraživanja tjelesnih mjera dubske pramenke.
Usporedbom rezultata Pavić i sur. (7) sa našim rezultatima istraživanja vanjštine dubske pramenke
dolazimo do zaključka da se naši rezultati bitno razlikuju, što potvrđuju vrijednosti tjelesne mase
odraslih ovaca od 70,74 kg, visine grebena 66,76 cm, dužine trupa 73,86 cm i opsega cjevanice 8,68
cm. Komparacijom naših rezultata sa rezultatima autora (2, 4, 5, 6, 8, 9, 11) koji su istraživali fenotip
drugih sojeva pramenke (Rabska, Lička, Paška i Istarska) dolazimo do već potvrđenih saznanja da
dubska pramenka predstavlja najkrupniji soj pramenke na ovim prostorima.
Prosječna utvrđena mliječnost po ovci u 9 istraživanih stada je iznosila 46,94 litara. Dobivena
vrijednost se odnosi na količinu pomuženog mlijeka od kraja dojnog perioda do kraja laktacije, dok
jedan dio nepomuženog mlijeka posišu jagnjad i ta količina je relativna i iznosi 50 – 60% ukupne
količine tokom laktacije. Preciznije rezultate (ukupnu mliječnost po grlu) moguće je utvrditi samo
u kontrolisanim uslovima uzgoja, a takve uslove nismo imali. Dobiveni rezultati se, obzirom na
vremensku distancu, teško mogu komparirati sa rezultatima Šmalcelja i sur. (12) koji su utvrdili
prosječnu mliječnosti stada od 87 kg mlijeka kod dubske pramenke. Antunec i sur. (1) pak navode da
tokom prosječne laktacije od 235 dana dubska pramenka proizvede čak 137 litara mlijeka.
Današnje stanje mlječnosti vlašićkih ovaca ukazuje da razlike među stadima dosta variraju, dok
su unutar istog stada prilično postojane iz godine u godinu. Prosječna dužina perioda muže je 130-140
dana, a veliki dio proizvedenog mlijeka posisaju jagnjad koja se mlijekom hrane po volji praktično
sve do mjeseca maja. Obzirom da najveći dio populacije ovaca na Vlašiću čini dubska pramenka čiji
proizvodni potencijal prelazi 240 litara mlijeka u toku laktacije, a period muže je moguće produžiti i
do 240 dana (10), navedeni podaci o današnjem stanju su poražavajući.
Zaključak
Utvrđeni fenotipski parametri (tjelesna masa, visina grebena, dužina trupa i obim cjevanice)
ukazuju na potrebu promjene dosadašnjeg standarda dubske pramenke jer su morfometrijske
parametri značajno povećani u odnosu na ranije literaturne podatke. Kvalitetnim uzgojno selekcijskim
radom i odgovarajućom ishranom, moguće je poboljšati prosječnu proizvodnju mlijeka i fenotipske
karakteristike dubske pramenke. Ovu ovcu potrebno je uzgajati u čistoj krvi i po mogućnosti njen
uzgoj prenijeti i na druga područja sa visokokvalitetnim pašnjačkim površinama.
Literatura
1. Antunac N., i sur. (2002): The effect of stage of lactation on milk quality and number of somatic cells in
sheep milk. Milchwissenschaft 57 (6), 310-311.
2. Mioč B., Pavić Vesna, Barać Z. (1998): Odlike eksterijera ličke pramenke. Stočarstvo 52 (1) 93-98.
3. Mioč B., Pavić Vesna, Posavi M., Sinković Karmen (1999): Program uzgoja i selekcije ovaca u Republici
Hrvatskoj, Zagreb.
4. Mioč B., Ivanković A., Pavić Vesna, Barać Z., Sinković Karmen, Marić I. (2003): Odlike eksterijera i
polimorfizmi proteina krvi dubrovačke ovce. Stočarstvo 57 (1) 3-11.
5. Mioč B., Pavić Vesna, Ivanković A., Barać Z., Vnučec I., Čokljat Z. (2004): Odlike eksterijera i polimorfizmi
proteina krvi krčke ovce. Stočarstvo 58 (5) 331-341.
6. Mioč B., Pavić Vesna, Sušić V.: Ovčarstvo. Hrvatska mljekarska udruga, Zagreb, S.423. Zagreb, 2007.
7. Pavić Vesna, Mioč B., Barać Z. (1999): Odlike eksterijera travničke pramenke. Stočarstvo 53 (2) 83-89.
8. Pavić Vesna, Mioč B. (1997): Creska sheep – sheep of the island Cres. Stočarstvo 51(1) 47-51.
9. Pavić Vesna, Mioč B., Barać Z., Vnučec I., Sušić V., Antunac N., Samaržija Dubravka (2005): Vanjština
paške ovce. Stočarstvo 59 (2) 83-90.
10. Piplica Slavica: Hemijski sastav i energetska vrijednost sijena šire regije planine Vlašić. Specijalistički rad,
Veterinarski fakultet, Sarajevo 1999.
11. Posavi M., Ernoić M., Ozimec R., Poljak F. (2002): Hrvatske pasmine domaćih životinja. Ministarsvo
zaštite okoliša i prostornog uređenja Republike Hrvatske, Zagreb, 56-58.
12. Šmalcelj I. (1937): Vlašićka ovca. Poljoprivredni glasnik 2.
Metastatic cholangiocarcinoma in a cow - case report
Metastatski kolangiocelularni karcinom krave –

prikaz slučaja
Grabarević, Ž.1, Seiwerth, S.2, Čorić, M.2, Šoštarić-Zuckermann, I.C.1, Hohšteter, M.1,
Artuković, B.1, Beck, A1, Gudan-Kurilj, A.1, Džaja, P.3, Švić, L.4
1
Veterinary Faculty, University of Zagreb, Department of General Pathology and Pathological Morphology,
Heinzelova 55, Zagreb
2
Medical School, University of Zagreb, Institute of Pathology, Šalata 3b, Zagreb,
3
Veterinary Faculty, University of Zagreb, Department of Forensic Veterinary Medicine, Heinzelova 55,
Zagreb
4
Veterinary Ambulance Pazin, Pazin
Summary
The case of liver tumor with lung metastasis is presented. Based on the histopathological and
immunohistochemical (positive cytokeratine staining and negative anti-hepatocyte antigen) findings the tumor
was classified as anaplastic cholangiocellular carcinoma.
Key words: cholangiocellular carcinoma, histopathology, immunohistochemistry, cow.
Sažetak
U radu je prikazan tumor jetre s metastazama u jetri. Temeljem obavljenih histopatoloških i
imunohistokemijskih analiza (negativna reakcija na antihepatocitni antigen i pozitivna na citokeratine) tumor
je klasificiran kao anaplastični kolangiocelularni karcinom, što predstavlja vrlo rijedak nalaz u veterinarskoj
onkologiji.
Ključne riječi: Kolangiocelularni karcinom, histopatologija, imunohistokemija, krava.
Introduction
Bile duct carcinoma (cholangiocarcinoma) has been described in all domestic animals with the
exception of swine. From the literature it seems that this tumour although very uncommon, could
be the most frequent in cattle (Monlux et al., 1956.; Anderson and Sandison, 1967.). Because of
the scarcity of this tumor, estimates of its incidence are not accurate. This paper presents the gross,
histopathologic, and immunohistochemical findings of a bovine cholangiocarcinoma with metastasis
to the lungs, found in cowe during a routine postmortem inspection at an abattoir. The animal was of
normal appearance at the time of slaughter.

In February 2006, two samples of the bovine tissue (liver and lungs) were submitted to
histopathological analysis. The samples were taken from abattoir during routine postmortem
inspection. During postmortem veterinary examination of the carcass, large numbers of small white-
pink, firm, nonencapsulated nodules, several milimeters in diameter, were found multinodulary
distrubuted throughout all liver lobes and lung parenchyma.
Representative sections of the liver and lungs were fixed in 10% neutral-buffered formalin,
processed routinely, and embedded in paraffin. Tissue sections were cut to 4 µm thickness and stained
with hematoxylin and eosin, periodic acid–Schiff (PAS) and PAS diastasis.
A standard indirect immunoperoxidase protocol was used for immunohistochemistry (ABC-
Elite; Vector Laboratories, Inc., Burlingame, CA). For immunohistochemical studies, the primary
antibodies (Dako) used were: monoclonal anti–hepatocyte (Hep Par 1) at a dilution of 1:25, CK 18
at a dilution 1:25, CK 19 at a dilution 1:50, carcinoembryonic antigen (CEA) at a dilution 1:25 and
alpha-feto protein at a dilution 1:300. A high-temperature (20 minutes in a pressure cooker) treatment
procedure with antigen unmasking solution (Vector Laboratories, Inc.) was used to enhance the
staining. The primary antibody was omitted for negative controls.
Results
Histopathologically, primary liver tumor and its metastases in the lungs were very similar. Tumor
was composed of predominately cords and islets of malignant cells which were heavily vacuolated
(Fig. 1). Some individual cells were PAS positive. In the liver, but not in the lungs, abundant
connective tissue was present with scirrhous response (Fig. 2) in some parts of tumor. In the lungs,
nests of neoplastic cells were surrounded with fine connective tissue stroma. Cells did not resemble
normal biliary epithelium, cytoplasm was vacuolated in most cells, and there were pleomorphism,
anisonucleosis and anisocytosis. Mitoses were rare. Nuclei were round with vesicular appearance
(Fig. 3). There was also a compression of the adjacent hepatic parenchyma at the tumor margins
(Fig. 1).
Immunohistochemical analysis showed that liver cells were positive for anti-hepatocyte antigen
while tumor cells had negative reaction (Fig. 4). Tumor cells were mildly to moderately positive (Fig.
5) on cytokeratine staining (CK 18 and CK 19). CEA and alpha-feto protein were negative.
Fig. 1. Cords and islets of predominately vacuolated tumor cells with abundant connective tissue stroma.
Liver. H&E.
Fig. 2. Scirrhous tumor response. Liver. H&E.
Fig. 3. Pulmonary metastasis with nests of tumor cells separated with delicate fibers. Visible cellular pleomor-
phism, anisonucleosis and anisocytosis. Lung. H&E.
Fig. 4. Anti-hepatocyte antigen. Hepatocytes are positive (brown reaction) and tumor cells are negative
(center). Liver. Immunohistochemistry, ABC method.
Fig. 5. CK 19. Mild to moderate positive cytokeratine reaction in tumor cells. Liver. Immunohistochemistry,
ABC method.
Discussion
Based on the gross findings, histopathological and immunohistochemical data it can be concluded
that this tumor was cholangiocellular metastatic anaplastic carcinoma. Histopathology of the tumor
was mostly consistent with the features of cholangiocellular carcinoma (Cullen and Popp, 2002.;
Cullen, 2007.) which was confirmed with immunostaining. Namely, tumor cells were negative and
hepatocytes were positive for anti-hepatocyte antigen, and in the same time there were positive
cytokeratine reaction which is normal finding in biliary epithelium cells. As Jeong et al. (2005)
already stated, the significance of the PAS positive cells needs further investigation.
Literature
Anderson LJ, Sandison AT. Tumors of the liver in cattle, sheep and goats. Cancer 21: 289-301; 1967.
Cullen JM, Popp JA. Tumors of the liver and gall bladder. In: Tumors in domestic animals, Fourt edition,
Meuten DJ, ed. Iowa State Press, Ames, 2002.
Cullen JM. Liver, Biliary System, and Exocrine Pancreas. In: Pathologica basis of veterinary disease, Fourth
edition, McGavin MD and Zachary JF, eds. Mosby Elsevier, St. Louis, 2007.
Jeong WI, Do SH, Sohn MH et al. Hepatocellular Carcinoma with Metastasis to the Spleen in a Holstein Cow.
Vet Pathol 42:230-232; 2005.
Monlux AW, Anderson WA, Davis CL. A survey of tumors occuring in cattle, sheep and swine. Amer J Vet Res
17: 646-677; 1956.
POLIMORFISMO DEL GENE CSN1S2 NELLA CAPRA SARDA
POLIMORFIZAM GENA CSN1S2 U SARDINIJSKE KOZE
Dettori1, M.L., G.M. Vacca1, V. Carcangiu1, M. Pazzola1, M. Sanna1, G. Maricosu2, P.P.

Bini1
1
Dipartimento di Biologia Animale, via Vienna 2, 07100 Sassari, Italy
Associazione Regionale Allevatori della Sardegna, via Cavalcanti 8, 09128 Cagliari, Italy
2
ABSTRACT
The gene codifying for αs2-casein, CSN1S2, is characterized for the presence of seven alleles associated
with three synthesis levels: the “strong” alleles A, B, C, E, F, associated with the production of about 2.5 g/l of
αs2-casein for allele; “intermediate” allele D, associated with 1,5 g/l of αs2-casein for allele; the “null” allele 0,
that in homozygosis determines the almost total absence of this protein in milk. The present research was carried
out in order to assess allele frequencies at the CSN1S2 locus in Sarda goat and to check possible effects of the
genotype on milk composition. Two hundred and twenty lactating goats belonging to 20 different farms located
in Central Sardinia, were utilized in this trial. In the middle of lactation, after having determined the daily milk
production of all the animals, a milk sample was collected in order to measure fat, protein and lactose percentage
(Milko-scan), freezing point (thermistore cryoscope), pH, SCC (Fossomatic) and CMT (Bacto-scan). At the
same time, a peripheral blood sample was collected. DNA was isolated from leucocytes using a commercial kit
(Puregene DNA isolation kit, Gentra, Qiagen) and then analysed with different methods based on PCR. Allele
Specific PCR was used to reveal the presence of the A, B, C alleles; the E, F, D and 0 alleles were investigated
by PCR-RFLP. The Genepop software was used to evaluate allele frequencies and the equilibrium according
to the Hardy Weinberg (HW) law. Milk production and milk composition data was submitted to GLM analysis
in order to highlight possible correlations with the genotype of this casein fraction. Genotype frequencies were
as follows: AA, 0.136; AB, 0.009; AC, 0.082, AE, 0.032; AF, 0.264; CC, 0.023; CE, 0.023; CF, 0.250; EF,
0.077; FF, 0.105. The F allele showed the highest frequency (0.400), followed by the A (0.330), C (0.200),
E (0.066) and in the end by the B allele (0.005). No subject was found carrying the D and 0 alleles for this
locus. The analysis of allele frequencies according to HW law showed the occurrence of disequilibrium in the
goat population; departure from HW equilibrium at the CSN1S2 locus was due to an excess of heterozygotes.
The goats we analysed had an average milk yield of 840 g/day, characterized by high fat (5.05%) and protein
content (4.19%). Lactose percentage showed the typical values of the species (4.89%) as well as the freezing
point (-0.568 °H) and the pH (6.72). The log TMC value (5.10), which is an indicator of the hygiene-sanitary
conditions of the farm, shows the existence of good breeding conditions, despite manual milking and farm
structural precariousness. The log SCC value (6.22) may appear high, when compared to the other domestic
species, but it is similar to that detected in other goat breeds, reared in different managerial realities. Statistical
analysis did not show any significant link between the detected genotypes and the mean values of milk chemical,
physical and cytological parameters and productive levels. It is likely that the αs2-casein fraction did not exert
any significant effect on the samples we analysed, because the intermediate and null alleles did not occur. This
confirms the Sarda goat aptitude to the production of milk suitable for cheese making and on the other hand, the
high variability of the analysed gene suggests further investigations aimed at finding the defective alleles, which
may allow the production of milk suitable for direct human consumption, in particular destined to those people
with cow milk intolerance.
Key words: goat, milk, casein, CSN1S2 locus.
Sažetak
Gen koji kodira αs2-kazein, CSN1S2, karakteriziran je prisutstvom 7 alela povezanih s 3 nivoa sinteze:
jaki aleli A, B, C, E i F povezani s produkcijom oko 2,5g/L αs2-kazeina po alelu; srednji alel D, povezan s 1,5
g/L αs2-kazeina po alelu; nulti alel 0 koji u homozigozi određuje gotovo potpuni nedostatak te bjelančevine u
mlijeku. Ovo istraživanje izvedeno je kako bi se odredilo frekvencije alela na CSN1S2 lokusu u Sardinijske koze
i provjerilo moguće učinke genotipa na sastav mlijeka. U ovom je istraživanju korišteno 220 koza u laktaciji
sa 20 različitih farmi iz središnje Sardinije. U sredini laktacije, nakon što je određena dnevna proizvodnja
mlijeka svih životinja, uzimani su uzorci mlijeka kako bi se odredio postotak masti, bjelančevina i laktoze
(Milko-scan), točka ledišta (thermistore cryoscope), pH, SCC (Fossomatic) i CMT (Bacto-scan). Istovremeno
su uzimani uzorci krvi. DNK je izolirana iz leukocita koristeći komercijalni kit (Puregene DNA isolation kit,
Gentra, Qiagen) i zatim analizirana različitim PCR metodama. Alelno specifičan PCR se koristio kako bi se
otkrilo prisutstvo A, B i C alela; E, F, D i 0 aleli su istraživani PCR-RFLP-om. Genepop software je korišten
u procjeni učestalosti alela i ravnoteže po Hardy Weinberg (HW) zakonu. Podatci o proizvodnji i sastavu
mlijeka podvrgnuti su GLM analizi kako bi se naglasilo moguće korelacije sa genotipom te kazeinske frakcije.
Učestalost genotipa bila je kako slijedi: AA 0,136; AB 0,009; AC 0,082; AE 0,032; AF 0,264; CC 0,023; CE
0,023; CF 0,250; EF 0,077 te FF 0,105. Najveću učestalost je imao F alel (0,400), a zatim A (0,330), C (0,200), E
(0,066) te na kraju B alel (0,005). Nisu nađeni uzorci koji bi nosili D i 0 alele na tom lokusu. Analiza frekvencija
alela po HW zakonu pokazala je pojavu disekvilibrija u populaciji koza; što odstupa od HW ravnotežja na
CSN1S2 lokusu zbog prekomjernih heterozigota. Proučavane koze imale su prosječnu produkciju mlijeka od
840 g/dan, karakteriziranu visokom masnoćom (5,05%) i sadržajem bjelančevina (4,19%). Postotak laktoze bio
je u tipičnim okvirima za koze (4,89%) jednako kao točka ledišta (-0,568°H) i pH (6,72). Log TMC vrijednost
(5,10) koja je pokazatelj higijensko sanitarnih uvjeta na farmi ukazuje na dobre uzgojne uvjete, unatoč ručnoj
mužnji i nesigurnoj strukturi farme. Log SCC vrijednost (6,22) se može činiti visokim, u usporedbi s drugim
domaćim životinjama, ali je sličan onome u drugih pasmina koza uzgajanih u različitim uvjetima. Statistička
analiza nije pokazala nikakve znakovite veze među utvrđenih genotipa i srednjih vrijednosti sastava mlijeka,
fizikalnih i citoloških parametara te nivoa proizvodnje. Čini se da αs2-kazein frakcija ne ispoljuje značajniji
učinak u analiziranim uzorcima jer se srednji i nulti aleli nisu pojavili. To potvrđuje sposobnost sardinijske
koze da proizvodi mlijeko prikladno za proizvodnju sira, a s druge strane, velika varijabilnost analiziranih gena
sugerira daljnja istraživanja s ciljem pronalaska defektivnih alela, koji bi mogli omogućiti proizvodnju mlijeka
prikladnog za izravnu ljudsku konzumaciju, posebice za ljude s netolerancijom kravljeg mlijeka.
Ključne riječi: koza, mlijeko, kazein, CSN1S2 loku
INTRODUZIONE
L’allevamento e la valorizzazione delle razze autoctone rappresenta un’efficace opportunità
sia per potenziare importanti settori zootecnici che per lo sviluppo delle aree di interesse. La
tutela di un biotipo animale e del luogo di allevamento, oltre alla conservazione della biodiversità
e dell’ambiente, è garanzia di tipicità e genuinità dei prodotti (Boyazoglu et al., 2005). La capra
Sarda, con circa 200.000 capi, rappresenta un enorme serbatoio di biodiversità dal quale è possibile
attingere per ottenere numerose tipologie di prodotto. Questo se utilizzato nel modo più idoneo, può
contribuire alla stessa salvaguardia della razza ed al mantenimento di un comparto che in Sardegna
ha notevole importanza economica e sociale (Carcangiu et al., 2006). Nei piani di selezione della
razza non vengono ancora presi in considerazione quegli aspetti qualitativi del latte che possono
far valorizzare meglio il prodotto. A differenza di quanto avviene in altri Paesi europei, infatti, non
esiste, se non come prospettiva futura, un programma di caratterizzazione genetica degli animali
in relazione, ad esempio, alle diverse caseine la cui variabilità genetica si associa ad importanti
variazioni delle caratteristiche chimiche e tecnologiche del latte (Barbieri et al., 1995). Le quattro
frazioni caseiniche, αs1, αs2, β e κ, sono codificate da altrettanti geni strettamente associati tra loro.
Nella capra, l’intero complesso genico è localizzato sul cromosoma 6, in un segmento di DNA di
circa 250 Kb, nel seguente ordine: CSN1S1 (codificante per l’αs1-caseina), CSN2 (codificante per la
β-caseina), CSN1S2 (codificante per l’αs2-caseina), CSN3 (codificante per la k-caseina) (Threadgill
e Womack 1990). I geni CSN1S1 e CSN2 sono separati da una distanza di 12 kb e sono trascritti
in maniera convergente (Leroux e Martin, 1996). L’organizzazione genomica del locus caseinico
è altamente conservata tra i mammiferi, sebbene da una specie all’altra sia stata osservata una
grande variabilità quantitativa e qualitativa (Rijnkels, 2002). Le indagini condotte finora su diverse
razze caprine hanno messo in evidenza che tutte e quattro le frazioni caseiniche sono polimorfiche.
L’esistenza di questa grande variabilità costituisce un elemento importante ai fini del miglioramento
genetico dei caprini, in quanto offre la prospettiva di diversificare la produzione in relazione alla
sua destinazione finale: trasformazione casearia, latte alimentare, latte ipoallergenico (Ramunno
et al., 2007). La comprensione dei meccanismi da cui dipende la produzione e la composizione
del latte possono contribuire a sviluppare strategie per migliorare o finalizzare la composizione
del latte. La caseina αs2 caprina, fosfoproteina costituita da 208 aminoacidi, si ritiene sia uno dei
maggiori allergeni presenti nel latte e che i minori rischi del manifestarsi di una reazione allergica,
nei soggetti alimentati con latte di capra, dipendano dalla elevata omologia con il latte umano, nel
quale alcune lattoproteine risultano assenti (El-Agamy, 2007). Nel latte umano, infatti, non è stata
rivelata la presenza di αs2-caseina (Martin et al., 1996), sebbene nel locus caseinico umano siano
stati identificati due geni αs2-simili, denominati CSN1S2A e CSN1S2B. Per la sequenza CSN1S2A
è stata rivelata la presenza di trascritti nella ghiandola mammaria in lattazione umana, ma non è noto
se questi siano tradotti in sequenze peptidiche stabili, mentre per CSN1S2B non è stato identificato
nessun trascritto specifico (Rijnkels, 2003). Il gene CSN1S2 è il più lungo tra i geni che codificano
per le caseine, si estende per un tratto di DNA di circa 18,5 Kb, ed è organizzato in 18 esoni di
dimensioni variabili tra 21 e 266 coppie di nucleotidi (Groenen et al., 1993). Nella capra, il locus
CSN1S2 si caratterizza per la presenza di 7 alleli associati a tre livelli di sintesi: alleli “forti” A,
B, C, E, F, associati ad una produzione di circa 2,5 g/l di αs2-caseina per allele; “intermedio” D,
associato ad una produzione inferiore (1,5 g/l) di αs2-caseina rispetto agli alleli forti; “nullo” 0 che
in omozigosi determina la quasi totale assenza di caseina αs2 nel latte (Ramunno et al., 2001b). Lo
scopo della presente ricerca è analizzare la struttura genetica della capra Sarda al locus CSN1S2 e di
valutare le eventuali correlazioni tra il genotipo e le caratteristiche produttive degli animali.
MATERIALI E METODI
La ricerca è stata condotta su 220 capre di razza Sarda, appartenenti a 20 allevamenti dislocati
in altrettanti comuni della Sardegna Centrale. In ciascun allevamento sono state scelte, con criterio
casuale, 11 capre in lattazione. Su tutti gli animali dopo aver misurato la produzione giornaliera
è stato raccolto un campione di latte per determinare la percentuale di grasso, proteine e lattosio
(Milko-scan), l’indice crioscopico (Crioscopio a termistori), il pH, il CCS (Fossomatic), l’urea e
il CMT (Bacto-scan). Contestualmente da ciascun animale è stato effettuato un prelievo di sangue
periferico. Il DNA, estratto dai leucociti con l’utilizzo del kit Puregene DNA isolation (GENTRA)
è stato analizzato con l’ausilio di diversi metodi basati sulla PCR. La variante CSN1S2 B è
caratterizzata, rispetto alla variante A, da una transizione G→A al nt 10 dell’esone 9, questo comporta,
nella sequenza proteica, la sostituzione dell’acido glutammico in posizione 64 con un residuo di
lisina, mentre l’evento mutazionale responsabile della comparsa della variante CSN1S2 C è una
transversione A→T, localizzata al quinto nucleotide dell’esone 16, che determina, a livello proteico,
la sostituzione Lys167→Ile (Bouniol et al., 1994). La ricerca di queste variazioni, nel DNA genomico,
è stata realizzata mediante AS-PCR (Ramunno et al., 2000). L’allele CSN1S2 F si caratterizza per
una transizione G→C al nucleotide 13 dell’esone 3, responsabile della sostituzione aminoacidica
Val7→Ile, la mutazione viene rivelata mediante PCR-RFLP (Ramunno et al., 2001b). La variazione
(C83G) che caratterizza l’allele CSN1S2 E, come avviene per la variante C, si verifica nell’esone 16,
e determina la sostituzione aminoacidica Pro193→Arg nella proteina matura, è rivelata mediante PCR-
RFLP (Veltri et al., 2000). Entrambi gli eventi molecolari che contraddistinguono gli alleli CSN1S2
D e 0 si trovano nell’esone 11. Il primo presenta una delezione di 106 nt, comprendente gli ultimi 11
nt dell’esone 11 e i primi 95 nt dell’introne successivo (Ramunno et al., 2001b), mentre l’allele nullo
presenta una transizione (G→A) al nucleotide 80 dell’esone 11, che determina la formazione di uno
stop-codon prematuro e di conseguenza l’apparente assenza di sintesi di αs2-caseina (Ramunno et
al., 2001a). La loro presenza è indagata mediante PCR-RFLP (Ramunno et al., 2001b). Le frequenze
alleliche e l’equilibrio secondo la legge di Hardy-Weinberg sono state valutate utilizzando il software
Genepop. I dati relativi alle produzioni ed alla composizione del latte sono stati sottoposti ad analisi
di varianza per evidenziare un eventuale effetto del genotipo relativo a questa frazione caseinica.
RISULTATI
Nella tabella 1 vengono illustrate le frequenze alleliche riscontrate al locus CSN1S2.
Tabella 1 – Frequenze genotipiche ed alleliche del gene CSN1S2 in capre di razza sarda
CSN1S2 n. Frequenze Genotipiche CSN1S2 Frequenze Alleliche

AA 30 0,136 A 0,330
AB 2 0,009 B 0,005
AC 18 0,082 C 0,200
AE 7 0,032 E 0,066
AF 58 0,264 F 0,400
CC 5 0,023
CE 5 0,023
CF 55 0,250
EF 17 0,077
FF 23 0,105
Complessivamente sono stati identificati 10 differenti genotipi; quelli più frequenti sono risultati
AF e CF che da soli rappresentano più del 50% del campione esaminato. L’allele B è risultato il
più raro essendo stato rivelato, allo stato eterozigote, solo in 2 soggetti, mentre gli alleli D e 0 sono
risultati assenti. Le frequenze alleliche mostrano decisa predominanza degli alleli F ed A. L’analisi
delle frequenze alleliche, secondo la legge di HW, ha dimostrato che la popolazione analizzata
presenta, per questo locus, una situazione di disequilibrio, dovuta ad un eccesso di eterozigoti. Nella
tabella 2 si riportano, per ciascun genotipo trovato i valori medi della produzione giornaliera e della
composizione chimica, fisica e citologica del latte.
Tabella 2 - Valori medi (± d.s.) dei parametri lattei in funzione dei diversi genotipi al locus CSN1S2
Genotipo CSN1S2 AA AB AC AE AF CC CE CF EF FF
n. 30 2 18 7 58 5 5 55 17 23
Peso media 826,4 1025,0 860,4 704,8 864,5 926,8 716,4 861,5 800,0 818,6
(g/d) d.s. 472,0 534,1 347,4 370,9 400,4 363,5 249,0 396,1 339,9 277,2
Grasso media 5,11 4,78 5,22 5,51 5,05 4,05 5,66 5,05 4,81 5,05
(%) d.s. 0,89 0,40 1,39 1,18 1,28 1,58 1,57 1,42 1,29 1,06
Proteine media 4,25 4,05 4,24 4,36 4,14 3,85 4,73 4,24 4,16 4,03
(%) d.s. 0,61 0,16 0,68 0,44 0,58 0,97 0,54 0,63 0,60 0,51
Lattosio media 4,89 4,62 4,90 4,87 4,91 5,01 4,88 4,93 4,73 4,84
(%) d.s. 0,32 0,12 0,23 0,27 0,26 0,10 0,22 0,29 0,28 0,26
Criosc. media -0,569 -0,551 -0,569 -0,567 -0,568 -0,569 -0,565 -0,568 -0,570 -0,567
(°H) d.s. 0,007 0,022 0,008 0,003 0,007 0,006 0,004 0,006 0,014 0,008
pH media 6,69 6,81 6,70 6,71 6,73 6,70 6,80 6,71 6,70 6,74
d.s. 0,07 0,13 0,08 0,08 0,07 0,06 0,04 0,09 0,09 0,07
CCS media 6,31 6,62 6,13 5,92 6,20 6,05 6,21 6,23 6,24 6,22
(Log) d.s. 5,56 5,75 5,62 5,18 5,64 5,54 5,59 5,95 5,99 5,92
CMT media 4,36 4,83 4,26 4,74 5,51 4,00 4,56 4,95 4,74 4,60
(Log) d.s. 4,08 4,32 4,04 4,23 5,17 3,48 4,18 4,58 4,32 4,34
L’analisi della varianza non ha evidenziato alcun legame significativo tra genotipo e parametri
chimici, fisici e citologici del latte, né con i livelli produttivi degli animali. Mediamente le capre da
noi esaminate producevano 840 g di latte al giorno, con un contenuto elevato in grasso e proteine pari
rispettivamente al 5,05% e al 4,19%. Il lattosio si attestava su valori tipici della specie (4,89%) così
come il punto crioscopico (-0,568 °H) ed il pH (6,72). I valori del CMT si mostravano mediamente
buoni (log 5,10), così come quelli del CCS (log 6,22).
DISCUSSIONE
Per i genotipi AF e CF, le frequenze ritrovate in questa popolazione di capre sarde sono più
elevate rispetto a quanto trovato da Ramunno et al., (2000) in una popolazione locale allevata nella
penisola Sorrentina, dove il genotipo più frequente risultava essere AA (22,5%). Nel presente lavoro
gli alleli F (0,40), A (0,33) e C (0,20) risultavano quelli con frequenza maggiore, rivelando valori
molto simili a quanto riscontrato da Sacchi et al., (2005) in diverse razze di origine mediterranea.
Al contrario, Bouniol et al., (1994) riportano che nelle razze Alpine e Saanen l’allele CSN1S2 A
è il più frequente (0,85) mentre per l’allele C è stata stimata una frequenza dello 0,11%. Gli alleli
B ed E presentavano frequenze particolarmente basse, inferiori a quanto trovato da Sacchi et al.
(2005) in diverse razze italiane. Nel campione esaminato non è emersa la presenza delle varianti
difettive D e 0, che finora si sono rivelate molto rare (frequenze inferiori al 5%: Sacchi et al., 2005;
Marletta et al., 2005), mentre Kusza et al., (2005) riportano, in capre da latte ungheresi, una frequenza
particolarmente elevata per l’allele 0 (15%). Affinché i polimorfismi relativi ad un singolo gene
del locus caseinico siano informativi, è necessario considerarli contestualmente ai geni a cui sono
associati. Infatti, la sintesi delle caseine risulta essere estesamente co-regolata, ovvero la regolazione
negativa dell’espressione proteica in seguito a mutazione in un gene caseinico può risultare nella
regolazione positiva delle altre caseine (Hayes et al., 2006). A causa di questo meccanismo di
compensazione, risulta difficile valutare gli effetti sui caratteri produttivi del latte di un unico SNP
(Single Nucleotide Polymorphism), per questa ragione sarebbe opportuno utilizzare le informazioni
derivate dall’intero aplotipo caseinico (Hayes et al., 2006). A questo proposito si ritiene opportuno
segnalare che nei soggetti del presente lavoro è stata rilevata anche la presenza degli alleli difettivi
delle frazioni αs1 (CSN1S1 F, E, 01 ed N) e della β-caseina (CSN2 01) (Vacca et al., dati non
pubblicati). La presenza di alleli difettivi della frazione β è stata riscontrata anche nei maschi della
stessa razza (Vacca et al., 2005). In relazione al test di HW la capra Sarda per il locus CSN1S2 ha
evidenziato una situazione opposta a quella descritta da Marletta et al., (2005) in capre appartenenti
alla razza Girgentana, dove il disequilibrio, nella distribuzione delle frequenze alleliche, era dovuto
ad un deficit, e non all’eccesso, di eterozigoti. Per quanto riguarda le misurazioni quali-quantitative,
le produzioni, in media risultano inferiori a quelle fornite da razze ad elevata attitudine lattifera, ma il
latte esaminato si caratterizza per gli elevati tenori in materia utile. Come già riscontrato in precedenti
indagini svolte su questa razza da Vacca et al. (2002), la capra Sarda si contraddistingue, quindi,
per gli elevati tenori in grasso e proteine. I dati relativi ai lipidi, infatti, dimostrano come questi
valori siano superiori a quelli riportati in letteratura per capre di razze maggiormente produttive
(Castagnetti et al., 1984; Pizzillo et al., 1994) e simile a quelli di altre capre rustiche (Casoli et al.,
1986). Anche per il tenore in proteine, il confronto con le altre razze depone a favore della capra
Sarda (Duranti et al., 1991; Freschi 1992). I valori del CMT, indicatore della situazione igienico-
sanitaria delle aziende, segnalano buone condizioni di allevamento, nonostante la mungitura venisse
effettuata manualmente ed in condizioni di precarietà strutturale. Sebbene il contenuto in cellule
somatiche possa sembrare elevato, se confrontato con altre specie domestiche, risulta simile a quello
che si rileva in diverse razze caprine allevate in differenti realtà manageriali (Fekadu et al., 2005).
Nel campione da noi analizzato, la frazione αs2-caseina non ha esercitato un’influenza significativa
sulla composizione del latte, presumibilmente per l’assenza degli alleli intermedio e nullo. Questo
dato se da un lato conferma l’attitudine delle capre di razza Sarda alla produzione di un latte da
destinare prevalentemente alla trasformazione casearia, dall’altro, vista l’elevata variabilità del gene
considerato, stimola ulteriori indagini volte ad individuare gli alleli deboli o nulli. Il ritrovamento
di questi permetterebbe la produzione di un latte da destinare al consumo diretto ed in particolare
rivolto agli individui con sensibilità allergica a questa proteina.
BIBLIOGRAFIA
Barbieri M.E., Manfredi E., Elsen J.M., Ricordeau G., Bouillon J. et al. (1995). Effects of the alpha s1-casein
locus on dairy performances and genetic-parameters of Alpine goats. Genet. Sel. Evol. 27: 263-265. Bouniol C.,
Brignon G., Mahé, M.F., Printz C. (1994). Biochemical and genetic analysis of variant C of caprine αs2-casein
(Capra hircus). Anim. Genet., 25: 173-177. Boyazoglu J, Hatziminaoglou I., Morand-Fehr P. (2005). The role
of the goat in society: Past, present and perspectives for the future. Small Rum. Res., 60: 13-23. Carcangiu V.,
Mura M.C., Vacca G.M., Bini P.P. (2006). Sardinian goat breeding and utilisation of environmental resources.
In Animal products from the Mediterranean area. EAAP Pubblication n. 119. Wageningen Academic Publishers,
249-254. Casoli C., Duranti E., Debenedetti A., Lucaroni A. (1986). Rilievi preliminari sulla produzione e sulle
caratteristiche chimiche del latte di capra di razza popolazione umbra. Il Latte, 11: 650-658. Castagnetti G.B.,
Chiavari C., Losi G. (1984). Caratteristiche chimico-fisiche ed attitudine tecnologica del latte di razze caprine ad
elevata potenzialità produttiva. Scienza e Tecnica Lattiero-Casearia, 35: 109-132. Duranti E., Bosi G., Casoli C.,
Costarelli S., Lucaroni A., Morgante M., Todini L. (1991). Valutazione di alcuni parametri chimici e tecnologici
del latte di capra di popolazione rustica umbra in relazione a diversi fattori di variabilità. IX Congr. ASPA, 1019-
1027. El-Agamy E.I. (2007). The challenge of cow milk protein allergy. Small Rum. Res., 68: 64-72. Fekadu B.,
Soryal K., Zeng S., Van Hekken D., Bah B., Villaquiran M. (2005). Changes in goat milk composition during
lactation and their effect on yield and quality of hard and semi-hard cheeses. Small Rum. Res. 59: 55-63. Freschi
P., Sciaraffia F., Massari M. (1992). Caratteristiche chimiche di latti caprini della Basilicata. X Congr. SIPAOC,
256-258. Groenen M.A.M., Dijkhof R.J.M., Verstege A.J.M., van der Poel J.J. (1993). The complete sequence
of the gene encoding bovine αs2-casein. Gene, 123: 187-193. Hayes B., Hagesæther N., Ådnøy T., Pellerud G.,
Berg P.R., Lien S. (2006). Effects on production traits of haplotypes among casein genes in Norwegian goats
and evidence for a site of preferential recombination. Genetics, 174: 455-464. Kusza S., Veress G., Kukovics
S., Jávor A., Sanchez A., Angiolillo A., Bősze A. (2007). Genetic Polymorphism of αs1- and αs2-caseins in
Hungarian Milking Goats. Small Rum. Res., 68: 329-332. Leroux C., Martin P. (1996). The caprine alpha s1
and beta-casein genes are 12kb apart and convergently transcribed. Goat αs1 casein alleles. A potential tool
in selection of individuals carrying alleles associated with a high level protein synthesis. Anim. Genet., 27:
93. Marletta D., Bordonaro S., Guastella A.M., Criscione A., D’Urso G., (2005). Genetic polymorphism of
the calcium sensitive casein in sicilian Girgentana and Argentata dell’Etna goat breeds. Small Rum. Res., 57:
133-139. Martin P., Brignon G., Furet J.P., Leroux C. (1996). The gene encoding αs1-casein is expressed in
human mammary epithelial cells during lactation. Lait, 76: 526-37. Pizzillo M., Cogliandro E., Rubino R.,
Fedele V. (1994). Capacità produttiva e caratteristiche qualitative del latte delle principali razze caprine allevate
nel mezzogiorno. XI Congr. SIPAOC, 431-434. Ramunno L., Pauciullo A., Mancusi A., Cosenza G., Mariani
P., Malacarne M. (2007). Influenza del polimorfismo genetico delle caseine calcio-sensibili su caratteristiche
strutturali, nutrizionali, attitudine casearia e proprietà ipoallergeniche del latte di capra. Scienza e Tecnica
Lattiero-Casearia, 58: 257-271. Ramunno L., Longobardi E., Pappalardo M., Rando A., Di Gregorio P., Cosenza
G., Mariani P., Pastore N., Masina P. (2001a). An allele associated with a non-detectable amount of αs2-casein in
goat milk. Anim. Genet. 32: 19-26. Ramunno L., Cosenza G., Pappalardo M., Longobardi E., Gallo D., Pastore
N., Di Gregorio P., Rando A., (2001b). Characterization of two new alleles at the goat CSN1S2 locus. Anim.
Genet., 32: 264-268. Ramunno, L., Pappalardo M., Cosenza G., Pastore N., Gallo D., Grimaldi G., Rubino R.,
Calandrelli M., Rando A. (2000). Caratterizzazione genetica ai loci delle caseine αS1, β e αS2 di una popolazione
caprina allevata nella Penisola Sorrentina. XIV Congr. SIPAOC, Vietri sul mare (SA) Italy, 321-324. Rijnkels M.,
Elnitski L., Miller W., Rosen J.M. (2003). Multispecies comparative analysis of a mammalian-specific genomic
domain encoding secretory proteins. Genomics, 82: 417-432. Rijnkels M. (2002). Multispecies comparison
of the casein gene loci and evolution of casein gene family. J. Mammary Gland Biol. Neoplasia, 7: 327-345.
Sacchi P., Chessa S., Budelli E., Bolla P., Ceriotti G., Soglia D., Rasero R., Cauvin E., Caroli A. (2005). Casein
haplotype structure in five Italian goat breeds. J. Dairy Sci., 88: 1561-1568. Threadgill D.W., Womack J.E.
(1990). Genomic analysis of the major bovine milk protein genes. Nucleic Acid Res, 18: 6935-6942. Vacca
G.M., Carcangiu V., Ghibellini A., Galioto M., Cancedda M., Bini P.P. (2002). La qualità del latte della capra
Sarda. X Congr. FeMeSPRum., Tunis, Pubblicato su C.D. Vacca G.M., Dettori M.L., Sanna M., Porqueddu M.,
Carcangiu V. (2005). Polymorphism of the CSN1S1, CSN1S2 and CSN2 genes in Sarda bucks. It. J. Anim. Sci.
Proceedings of ASPA 16th Congress, Turin Italy, 116. Veltri C., Lagonigro R., Pietrolà E., D’Andrea M., Pilla F.,
Chianese L. (2000). Molecular characterisation of the goat αs2-casein E allele and its detection in goat breeds of
Italy. 7th International Conference on Goats, Tours France, 727.
Ringraziamenti - Ricerca eseguita con fondi CIPE: APQ ricerca Intervento P5a “Biodiversità animale”
ANALYSIS OF GROWTH CURVE OF CROSSES RUBIA GALLEGA X
NELLORE BY MEANS OF MICHAELIS-MENTEN EQUATION
ANALISIS DE LA CURVA DE CRECIMIENTO DE CRUCES DE RUBIA

GALLEGA X NELORE MEDIANTE LA ECUACION DE MICHAELIS-
MENTEN
Sanchez, L1, Cantalapiedra, J.A. 1, Carril, J. A.2, Iglesias, A.1

1
Dpto. Anatomía y Producción Animal. Universidad de Santiago de Compostela. 27002. Lugo. lusaga@lugo.
usc.es
2
Asociación de Criadores de la Raza Rubia Gallega (ACRUGA) arrakis.es/~acruga
SUMMARY
The crosses of Galician Blond x Nellore are being systematically valued since, in the year 2000, the Breeders’
Association of Blonde Galician Breed (ACRUGA) designed the planning of the same ones to determine the
productive behavior and its capacity of adjustment to the systems of production of meat in Brazil. The aim of
this work consisted of the study of the growth of animals of Galician Blond x Nelore by using Michaelis-Menten
Equation. This study used data collected on 76 individuals of Rubia Gallega x Nellore born in the farm Mosquera
Grandal (Buri, Sao Paulo Brasil). The data considered were measurements of weight collected at birth, weaning
(7 months of age) and monthly from 8 to 11 months of age. The used function was Michaelis-Menten. Means of
the individual growth curve parameters for Body weight were calculated. By means of different technologies of
adjustment of this growth curve, we have verified that the not linear method presents a better quality represented
by minor values for the average square of the combined mistake and a greater facility of convergence, providing
estimations adjusted to the reality, which allow a suitable biological interpretation of the parameters of the
studied model.
Key Words. Rubia Gallega. Nellore.Growth curves. Michaelis-Menten equation.
RESUMEN
Las cruces de Rubio Gallego x Nelore se están valorando sistemáticamente puesto que desde el
año 2000, la Asociación de Criadores de la Raza Rubia gallega (ACRUGA) diseñó la planificación de
los mismos para determinar el comportamiento productivo y su capacidad del ajuste a los sistemas de
producción de carne en Brasil. El objetivo de este trabajo consistió en el estudio del crecimiento de
animales de Rubia Gallega x Nelore usando la ecuación de Michaelis-Menten. Este estudio utilizó los
datos recogidos de 76 animales de Rubia Gallega x Nelore en la granja Mosquera Grandal (Buri, Sao
Paulo Brasil). Los datos considerados fueron medidas del peso recogidas en el nacimiento, destete
(7 meses de la edad) y mensualmente a partir de los 8 a los 11 meses de la edad. La función usada
fue la de Michaelis-Menten. Se calcularon las medias de los parámetros individuales de la curva del
crecimiento para el peso corporal. Por medio de diversas tecnologías de ajuste hemos verificado que
el método no linear presenta una mejor calidad de ajuste, representada por menores valores para el
cuadrado medio del error combinado y una mayor facilidad para la convergencia, proporcionando
valoraciones ajustadas a la realidad, lo que permite una interpretación biológica conveniente de los
parámetros del modelo estudiado.
Palabras clave. Rubia Gallega. Nelore. Curvas de crecimiento. Ecuación Michaelis-Menten.
INTRODUCCION
Una vez introducida la raza bovina Rubia Gallega en Brasil, se están realizando cruzamientos
con la raza Nelore, a fin de combinar las cualidades de rusticidad y adaptación a medios hostiles de
esta última con las características de especialización para la producción de carne y precocidad de la
Rubia Gallega, a la vez que se mejora la precocidad sexual de la población cebuína.
En este sentido uno de los aspectos a abordar es el crecimiento, el cual puede ser expresado en
términos numéricos, ya que cuando se realizan sucesivas pesadas de un animal de forma sistemática
y regular, es posible construir una curva de peso en función de la edad. Conocer el crecimiento es
fundamental puesto que presenta una relación directa con la producción de carne en cantidad y
calidad, producto final de de la explotación del ganado vacuno de carne.
Diversas funciones de crecimiento no lineales relacionando peso-edad, han sido probadas tanto
en bovinos (Nobre et al., 1987; López et al., 2000; Machado et al., 2004; Mazzini et al., 2004);
asimismo se ha realizado la interpretación de algunos de sus parámetros biológicos contrastando
la dificultad de su ajuste, cuestión ésta referida también por diversos autores en diferentes especies
ganaderas, sobre todo cuando se utilizan pequeños conjuntos de datos lo que provoca ligeros desvíos
que influyen en la precisión de las curvas (Nobre et al., 1987; Machado et al., 2004 Mazzini et al.,
2004).
La ecuación de Michaelis-Menten (Michaelis & Menten,1913) es utilizada ampliamente en la
literatura para describir matemáticamente diversas reacciones químicas permitiendo determinar la
velocidad de reacción de las mismas. De acuerdo a lo descrito por López et al. (2000), si se adapta
convenientemente se puede utilizar para determinar el crecimiento de los animales ya que, dados
sus buenos resultados, resulta equiparable a funciones usuales como las de Gompertz y Richards.
Aunque los trabajos con esta ecuación son muy escasos, ha mostrado su eficacia para describir el
crecimiento del ganado vacuno (Manzini et al., 2004; Machado et al., 2004).
Este trabajo tiene como objetivo verificar la capacidad de ajuste de la ecuación de Michaelis-
Menten mediante metodologías lineales y no lineales, a observaciones de peso-edad de bovinos
cruzados de Rubia Gallega x Nelore
MATERIAL Y METODOS
Para el presente trabajo se utilizó un rebaño base de 76 animales de la raza Nelore. Se registraron
los pesos al nacimiento, 210, 240, 270, 300 y 390 días criados en la granja Mosquera & Grandal del
estado de Burí, Sao Paulo (Brasil) mantenidos en sistema extensivo sobre un pasto de Brizantia..
Las reproductoras fueron inseminadas con toros de la raza Rubia Gallega. Los partos se
sucedieron con normalidad en la primavera y otoño, destetándose todos los animales (machos y
hembras) a los 7 meses de edad. Estos animales, mantenidos con lactancia natural, recibieron la
siguiente alimentación complementaria:
Durante 209 días un pienso prestarter a razón de 700 gr / animal y día, con una composición
de 18% de PB, 2,5% de Extracto etéreo, 7% de fibra, 13% de humedad, 10% materia mineral, 1,2%
de calcio y 0,5% de fósforo. Después de 150 días de iniciado el anterior y durante 145 días se
complementó con 2.600 gr / animal y día de un pienso con el 40% de PB, 2% de EE, 15% de fibra y
18% de minerales. Los últimos 80 días de confinamiento recibieron además , por animal y día, 18 kg
de silo de maíz y 3.700 gr de harina de maíz. El total de alimento, sin contabilizar la leche materna y
el consumo de pasto, fue de 2.400 gr de concentrado y 18 kg de silo de maíz, por animal y día.
La ecuación de Michaelis-Menten (Michaelis & Menten, 1913), es ampliamente utilizada para
evaluar la cinética de procesos enzimáticos y se expresa como sigue:
Y = ρx/x+δ: siendo Y, la velocidad de reacción; x, la concentración del sustrato; ρ la velocidad
máxima de reacción y δ la concentración del sustrato una vez conseguida la velocidad máxima. Los
parámetros ρ y δ pueden ser estimados a partir del ajuste. Según López et al., (2000) y Machado et
al., (2005), en la utilización de esta ecuación para estudios de crecimiento es posible asumir que:
Y es el peso de los animales en la edad x, ρ sería el peso adulto del animal y δ sería una medida de
precocidad, que representaría el intervalo de tiempo transcurrido para conseguir la mitad del peso
adulto, es decir, cuanto menor sea el valor de éste parámetro mas precoz resultaría el animal.
El trabajo de crecimiento con esta ecuación realizado por Machado et al.,(2004), utiliza, entre
otras, las siguientes expresiones de ajuste que pueden ser representadas como sigue:
no lineal lineal I lineal II

Y = ρx / x+δ 1 (δ/ρ) 1 δ x
1/Y = ___
+
_____
+
___
x /Y = ___
+
___
+
xe
ρ x e ρ ρ
donde el término e representa el error aleatorio, e ~N(0,σ2).
La comparación entre las expresiones fue probaba por Machado et al., (2005) en lo referente
a la calidad de ajuste, representada por el valor del cuadrado medio del error combinado y por la
interpretación biológica de los parámetros evaluados, con resultados satisfactorios en ganado Nelore,
por lo que decidimos incorporar esta metodología. Para el desarrollo de la misma se emplearon los
programas Simfit v. 5.5 y el software estatístico R (R Development Core Team, 2004), concretamente
las funciones nlme.nlsList (No lineal) y lm (Lineal).
RESULTADOS Y DISCUSION
La curva ajustada de la ecuación de Michaelis-Menten se muestra en la gráfica 1.
Grafica 1. Curva ajustada para la ecuación de Michaelis-Menten
Las estimaciones medias de los parámetros y la evaluación de la calidad de los ajustes se muestran
en la tabla 1.
Tabla 1. Estimaciones medias de los parámetros, intervalos de confianza (95%) y Cuadrado Medio del error
combinado para el ajuste de las distintas formas de la ecuación de Michaelis-Menten a datos de peso-edad de
animales del cruce RG X Nellore.
Ecuación Parámetro Media CME

ρ 132,12
No lineal 835,47
δ 111,91
ρ 99,36
Lineal I 1326,98
δ 90,63
ρ 136,66
Lineal II 1100,66
δ 110,00
De acuerdo a la tabla 1, la forma de ajuste No lineal mostró valores menores para el CME
combinado, y en consecuencia una calidad de ajuste mayor. El modelo Lineal I es la de peor
comportamiento, lo que coincide con el trabajo de Machado et al., (2005) en Nelore.
Respecto a la evaluación de la calidad de los ajustes del modelo lineal de acuerdo con el test
de Durbin-Watson, el modelo no presentó autocorrelación residual pues los valores medios de este
estadístico (1,424) no fueron significativos.
CONCLUSIONES
Con el uso del modelo de Michaelis-Menten fue posible calcular los pesos de los animales con
una aceptable precisión. Este modelo parece deseable para explicar el crecimiento del cruzamiento
de Rubia Gallega x Nelore.
BIBLIOGRAFIA
López, S.; France, J.; Gerrits, W.J.J.; Dhanoa, M.S.; Hunphries, D.J.; Dijkstra, J. 2000. A generalized
Michaelis-Menten equation for the analysis of growth. Journal of Animal Science, v.78, p. 1816-1828.
Machado, E. J., Muniz, J. A., Fonseca, F. 2004. Análise da curva de crescimento por meio da equação deMichaelis-
Menten. Estatística e Experimentação Agropecuária.
Mazzini, A. R., Muniz, J. A., Fonseca, F., Henrique de Aquino, L. 2004. Equação de Michaelis-Menten
generalizada na análise de crescimento de bovinos. 49ª Reunião da Região Brasileira da Sociedade
Internacional de Biometría. Brasil.
Michaelis, L.; Menten, M.L.1913. Die kinetik der invertinwirkurg. Biochemische Zeitschrift,v. 49, 334-336.
R Development Core Team. R: A language and environment for statistical computing. R Foundation for Statistical
Computing, Vienna, Austria. ISBN 3-900051-00-3, 2004. URL http://www.R-project.org.
Santoro, K. R. 2005. Adequação de modelos não lineares a observações peso-idade de crescimento de bovinos
com ganho compensatório. 49ª Reunião da Região Brasileira da Sociedade Internacional de Biometría.
Brasil.
Santos, S. A., Souza, G.S., Oliveira, M.R., Sereno, J.R.1999.Using nonlinaer models to describe heigth growth
curves is Pantanero horses. Pesq. Agropec. Bras., v.34, n.7, p.1133- 1138.
Schinckel, A. P., Ferrell, J., Einstein, M. E., Pearce, S. A., Boyd, R.D. 2003. Analysis of Pig Growth From Birth
to Sixty Days of Age. Swine Research Report. Purdue University p. 57-67.
COMPARISON OF MINERAL LEVELS IN BONE AND BLOOD SERUM
OF CATTLE IN NORTHWESTERN TURKEY*
USPOREDBA RAZINE MINERALA U KOŠTANOM SUSTAVU I KRVI

KRAVA U SJEVEROZAPADNOJ TURSKOJ
Remzi GÖNÜL1, Abdullah KAYAR1, Tanay BİLAL2, M. Erman OR1, Çağla PARKAN1,
H. Tamer DODURKA1, Tevfik GÜLYAŞAR3, Bora BARUTÇU4
1
Department of Internal Medicine, Veterinary Faculty, Istanbul University,
34320, Avcilar, Istanbul/Turkey
Animal Nutrition and Nutritional Diseases Department, Veterinary Faculty, Istanbul University, 34320,
2
Avcilar, Istanbul, Turkey

3
Department of Biophysics, Trakya University Medicine Faculty, Edirne/Turkey
4
Department of Biophysics, Cerrahpasa Medicine Faculty, Istanbul University,
Cerrahpasa-Istanbul/Turkey
*
“The present work was supported by the Research Fund of Istanbul University. Project Number:
73/15052003.”
ABSTRACT
In order for the mineral levels in the body to be accurately determined, it is essential to determine the mineral
content of bones together with that of blood serum. In this study, blood serum and bone samples were collected
from cattle in and around the provinces of Istanbul, Tekirdağ, Kırklareli, and Edirne and it was attempted to
determine reference values. In each region, blood and bone samples were collected from 100 heads of cattle
and phosphorus (P), Calcium (Ca), and Magnesium (Mg) proportions were calculated. According to the results,
it was found that the levels of P, Ca, and Mg in bone samples of the cattle in Northwest of Turkey were 132.76
± 17.84, 333.23 ± 163.02 and 2.38 ± 0.32 mg/g, respectively, while mineral levels in blood serum were 7.88 ±
1.05, 10.80 ± 0.71 and 2.37 ± 0.68 mg/dL, in the same order. It was thought that these values might constitute
a reference point for serial measurements that would be made for keeping the cattle in our region under control
against metabolic diseases.
Key Words: Cattle, Blood Serum, Bone, Phosphorus, Calcium, Magnesium.
Sažetak
Kako bismo mogli objektivno procijeniti razine minerala u organizmu važno je odrediti razine minerala u
kostima i krvnom serumu. u ovom je radu analiziran serum i kosti goveda sa područja istanbul, tekirdağ, kirklareli
i edirne sa svrhom određivanja referentnih vrijednosti. na svakom području uzet je uzorak od 100 goveda na
kojima je određena razina fosfora, kalcija,i magnezija te su izračunati njihovi međusobni omjeri. pokazalo se da
razine fosfora, magnezija i kalcija u goveda u navedenim područjima iznose 132.76±17.84, 333.23±163.02 i
2.38±0.32 mg/g, dok su vrijednosti istih tih minerala u serumu iznosile 7.88±1.05, 10.80±0.71 i 2.37±0.68 mg/
dl. smatramo da bi navedene referentne vrijednosti mogle poslužiti kao polazišna točka za ozbiljnija mjerenja
koja bin mogla poslužiti kontroli metaboličkih poremećaja goveda u pretraženim područjima.
Introduction
In domestic animals, trace elements play an important role in growth, reproduction and their
livestock productivity. Despite this fact, mineral deficiency or imbalances are still frequently
encountered phenomena almost anywhere in the world that cause serious economic loss (4, 6, 13). In
cattle, diseases such as parturient paresis (hypocalcemia), grass tetany (hypomagnesemia), and left-
side and right-side displacement of the abomasum (alkalemia, hypochloremia and hypocalcemia) are
characterised by electrolyte deficiencies and generally become obvious in the first phase of lactation.
Their negative economic impact is considerable (2, 4, 5, 8).
For this reason, elements such as calcium and phosphorus-containing minerals are of importance
for cattle both during their growth and after they have reached maturity (12, 13). Their exists also a
well-known relationship between the level of phosphorus deposits in the body and diseases such as
botulism. This connection has prompted scientists to investigate the mineral levels in body tissue and
body fluids (1). However, in quite a few cases, electrolyte imbalances are difficult to detect because
the animals affected show no clinical symptoms (4). Consulting organisations recommended by the
Working Groups of the Agricultural Research Commission (ARC) have also stated the necessity to
determine the major minerals in cattle breeding as a matter of priority (12). In case the increased
demand for electrolytes during pregnancy, birth and other physiologically demanding events cannot
be met by the animals’ ration, the skeletal system serves as an important source for the plasma calcium
demand in order to preserve its concentration (8, 9, 10, 12, 14). Because of this protective mechanism,
the mineral concentration in blood is no good indicator for the level of mineral concentrations in
animals (1). For a number of reasons, the blood samples taken for the determination of mineral
concentrations do not provide reliable results. A variety of factors such as exercise, excitation during
blood sampling, the hour of the day, the feeding hours, the season, the animal’s age and the point the
blood is drawn from have an influence on the results (1, 13). Mineral deficiency observed in the blood
serum is of doubtful value as an indicator of correct calcium and phosphorus levels in an animal due
to the fact that they are replenished from mineral depots in the bones (1). For this reason, researchers
emphasize the importance of measuring both the mineral levels in blood serum and in the bones in
order to obtain a correct picture of the mineral concentrations of the entire body. This guideline to
mineral content measurements of the body has led to a demand for new researches on this subject (1,
8, 10, 12). The ensuing investigations have yielded significant results for the clinical evaluation of
metabolic diseases (1).
Only a limited number of studies have so far been carried out in Turkey on the effects of trace
elements in animals (11). The objective of this investigation is the determination of the level of
minerals in both blood serum and bones of cattle under different physiological conditions in
Northwestern Turkey. With this research, reference values for cattle in the region would be obtained
which are necessary for the use of bone tissue mineral concentrations in routine clinical diagnostics.
The lack of such reference values currently poses the biggest obstacle to the application of such a
method. Evaluation of bone biopsy samples has become an important method for the detection of
a number of metabolic diseases in animals before they become acute, and offers the opportunity
of continuous monitoring of pregnant, lactating or growing animals (1). The establishment of this
method as a diagnostic tool in veterinary medicine would help in obtaining additional disease-
related information on the levels of Ca, P and Mg in bones which would support the development of
successful treatments in cases of parturient paresis, grass tetany, phosphorus deficiency and a number
of other diseases where classical methods prove inconclusive.

Cattle in and around the provinces of Istanbul, Tekirdağ, Kırklareli and Edirne served as material
of this study. From each region older than 24 months female animals of holstein breed were analysed.
They were from different herds with different feeding regimes. From each region clinically healthy
100 heads of cattle delivered to the abattoir were examined. Blood samples were taken from the
life animals via juguler vena puncture and bone samples from the same animals in accordance with
approved techniques, after slaughtering (1, 6, 15, 16). In total 400 samples each of blood serum
and bone were collected. The Ca and Mg levels in dry bone samples were determined with the
aid of a Shimadzu atomic absorption spectrometer, model AA-680, while the concentration of dry
bone P was measured spectrophotometrically with the molybdenum blue method (1, 8, 10, 12, 15,
16). The minerals in the blood serum samples were determined with a Ciba Corning autoanalyser,
model Express Plus. When statistically evaluating the results obtained, the mean values and standard
deviations were calculated for every province with t test, the various provinces were compared, and
the statistically significant differences with respect to mineral concentrations in bones and blood
serum examined with one-way Anova using KyPlot package program.
Results
The concentrations of minerals in blood serum and bone samples taken from cattle in Northwest
of Turkey are given in Tables 1 and 2.
Table 1. Mean value, standard deviation and statistical significance of mineral concentrations in dry bone
samples of cattle in Northwest Turkey.
Province N=100 P (mg/g) Ca (mg/g) Mg (mg/g)

Istanbul X ± Sx 130.26 ± 20.17 310.8 ± 140.7c 2.6 ± 0.15c
Tekirdağ X ± Sx 140.21 ± 20.12 330.64 ± 170.4 bc
2.27 ± 0.52c
Kırklareli X ± Sx 130.28 ± 10.92 420.86 ± 220.46 b
2.28 ± 0.29b
Edirne X ± Sx 130.3 ± 20.18 270.63 ± 120.52 a
2.38 ± 0.32a
Mean X ± Sx 132.76 ± 17.84 333.23 ± 163.02 2.38 ± 0.32
In each group significant statistical differences were established between provinces designated with different
letters (for Ca and Mg: p<0,001).
Table 2: Mean value, standard deviation and statistical significance of mineral concentrations in blood serum
samples of cattle in Northwest Turkey.
Province N=100 P (mg/dL) Ca (mg/dL) Mg (mg/dL)

Istanbul X±S 7.95 ± 1.16 11.75 ± 0.5a 2.54 ± 0.71d
Tekirdağ X ± Sx 7.9 ± 1 9.17 ± 0.5 b
1.97 ± 0.8c
Kırklareli X ± Sx 7.7 ± 1.05 10.25 ± 1.32 ab
2.2 ± 0.4b
Edirne X ± Sx 8±1 12.05 ± 0.52 a
2.79 ± 0.83a
Mean X ± Sx 7.88 ± 1.05 10.80 ± 0.71 2.37 ± 0.68
In each group significant statistical differences were established between provinces designated with different
letters (for Ca and Mg: p<0,001).
Mineral concentrations in the examined bone samples were found to be higher for calcium
and phosphorus (333.23 ± 163.02 and 132.76 ± 17.84 mg/g respectively), while the values for
magnesium, 2.38 ± 0.32 mg/g, were lower. Comparison between provinces showed statistically
significant differences in the levels for Ca and Mg in particular in the regions of Kırklareli and Edirne
(p<0.001). For phosphorus between provinces, however, no statistically significant difference could
be established.
Examination of mineral concentrations in blood revealed calcium concentrations in all regions
were in the normal reference value. Istanbul and Edirne provinces were statistically significantly
higher (p<0.001) than Tekirdağ province. The Mg concentrations were established to be higher in
İstanbul, Kırklareli and Edirne provinces than in Tekirdağ province with the levels in İstanbul and
Edirne higher than the reference values, and those in Tekirdağ and Kırklareli provinces within the
reference range. Differences between all regions were found to be statistically significant (p<0.001).
P levels, though higher than the reference value range showed no statistically significant difference.
Discussion
The bones impart mechanical strength to the muscle-skeleton system and provide functional
capabilities, they also serve as mineral storage and are of vital importance for a range of metabolic
activities such as growth, reproduction and livestock productivity (6, 12, 13, 14). The blood serum
data are insufficient for the determination of the mineral concentrations in animal bodies. It has
been reported that for a correct determination of the mineral concentrations in the body, bone
samples from the ribs, the hip or the feet could be used (1, 7, 10, 12; 16). In this study, the minerals
concentrations in cattle were investigated by measuring both blood serum and bone samples with the
objective of determining reference values in Northwest of Turkey. The study thus served the purpose
of establishing the criteria necessary to identify metabolic diseases at an early stage and to permit
continuous control of the level of livestock productivity of the animals.
The application of bone biopsy techniques has become very simple and samples can be taken
swiftly without causing any discomfort to the animals (1, 6, 7, 10, 12, 16). If this method would be
used routinely in veterinary medicine, a number of metabolic diseases seen frequently in animals
during pregnancy, lactation and growth could be detected early and the significant economic losses
they cause could be prevented while their productivity could be increased at the same time (1).
Researchers in this field also stress the necessity of a more extensive publication of reference values,
in order to permit a routine usage of the method, which has not yet been achieved despite the fact
that reference values for mineral concentrations in bones do exist in literature (1, 6). In this study, the
level of minerals in the blood and bones of animals have been determined and compared, and at the
same time reference values for mineral concentrations in bones established. This is the first time this
has been done in Turkey for cattle. A correlation of those levels with livestock productivity will then
permit the calculation of the economic loss suffered from mineral deficiency.
It is known that the phosphorus content in the animal ration effects bone development to a
large extent (15). It is also known, however, that besides chemical and physical properties, bone
development is influenced by range of other factors such as age, ration, hormones and diseases
(12, 15). Beighle et al. (1) reported important differences in the values of P, Ca and Mg of ashed
bone samples taken from bones of animals of different age, sex and breed. In the dry bone samples
analysed in this study an important influence of those factors was found in particular for Mg and P.
Gerloff and Swenson. (6) had stressed in their study that for the determination of body phosphorus
depots from bone phosphorus measurements, dry or defatted dry samples should be used; and they
had advised against the use of ashed samples. For this reason, in this study dry bone samples taken
from over 2-year-old female animals of culture breed were analysed. With this approach it was
attempted to reduce the above-mentioned variations and to obtain more reliable information about
metabolic diseases observed in Turkey. This restriction in terms of age, sex and breed was motivated
by the fact that economically important metabolic diseases usually appear in over 2-year-old animals
of high-yielding culture breeds (1, 14). Comparison of the results of this study with those reported
by Beighle et al.(1), who worked on animals of similar characteristics. Mineral concentrations in the
examined bone samples were found to be higher for calcium and phosphorus than those reported in
literature (203.68 ± 1.0 and 108.25 ± 0.41 mg/g respectively), while the values for magnesium were
lower than previously reported values (5.51 ± 0.05 mg/g) (2).
Examination of mineral concentrations in blood revealed calcium concentrations in all regions
were in the normal reference value of 9.7-12.4 mg/dL (3). The Mg concentrations in İstanbul and
Edirne were established higher than the reference values, and those in Tekirdağ and Kırklareli
provinces within the reference range of 1.8-2.3 mg/dL (3). P levels, though higher than the reference
value range (5.5-6.5 mg/dL) (3) showed no statistically significant differences.
With respect to the mineral concentrations in blood serum samples, it was found that the P
level was rather high while the Ca and Mg concentration were within the normal limits in cattle in
Northwestern Turkey. This was interpreted as a sign for ossification related to high P level in the
blood serum resulting in high Ca and P levels in the bones. This in turn points to a mineral rich
region or to high-dose mineral additives in the animal feed and a lower probability of the emergence
of metabolic diseases.
As has been pointed out by Beighle et al (1), bone mineral concentrations may serve as a powerful
tool for prognosis of the development of metabolic diseases. The ease with which bone samples can
be taken and the availability of serial sample collection techniques make it possible to keep animals
under observation during certain phases of their development (pregnancy, lactation, growth), and
help to avoid unnecessary culling.
Conclusions
As a result of this study on the level of minerals in bones of healthy cattle in Northwestern
Turkey, reference values were determined which may, however, exhibit certain regional differences.
On the basis of those reference values, the animals may be monitored for metabolic diseases in
various phases of their lives with serial measurements of bone samples. An approach that will help to
reduce economic losses to a minimum.
The difference between the results found in this investigation and those reported by other
researchers as well as the dearth of publications on this subject require more extensive research
including other regions in order to be able to establish reliable reference parameters for mineral
concentrations in bone samples.
References
Beighle, D.E., Boyazoğlu, P.A., Hemken, R.W., Serumaga-Zake, P.A.: Determination of calcium, phosphorus,
and magnesium values in rib bones from clinically normal cattle. Am. J. Vet. Res., 1994; 55: 85-89.
Bjorkman, C.: Concentrations of sodium, potassium, calcium, magnesium and chlorine in the muscle cells of
downer cows and cows with parturient paresis. Res. Vet. Sci., 1994; 57: 53-57.
Smith, B.P.: Large animal internal medicine. Third ed., Mosby, St. Louis, Missouri, USA, 2002.
Dakka, A.A., Abdel-All, T.H.S.: Studies on minerals picture in the blood sera of egyptien Sheep. Assiut. Vet.
Med. J, 1992;. 28: 242-249.
Fleming, S.A., Hunt, E.L., Brownie, C., Rakes, A., Mcdaniel, B.: Fractional excretion of electrolytes in lactating
dairy cows. Am. J. Vet. Res., 1992; 53: 222-224.
Gerloff, B.J., Swenson, E.P.: Acute recumbency nd marginal phosphorus deficiency in dairy cattle. J. Am. Vet.
Med. Assoc., 1996; 208:716-719.
Jones, H.C., Fontenot, J.P., Veit, H.P.: Physiological and pathological effects of feeding high levels of magnesium
to steers. J. Anim. Sci., 1990; 68: 4400-4413.
Mosel, M.V., Klooster, A.T.H., Malestein, A.: Effects of an inadequate dietary intake of magnesium on
osteogenesis in dairy cows during the dry period. Res. Vet. Sci., 1990; 48: 280-287.
Mosel, M.V., Klooster, A.T.H., Mosel, F.V., Kuilen, J.V.: Effects of reducing diaetary ((Na+K)-(Cl+SO4)) on the
rate of calcium mobilisation by dairy cows at parturition. Res. Vet. Sci., 1993; 54: 1-9.
Mosel, M.V, Wouterse, H.S., Vant Klooster, A.T.H.: Effects of reducing dietary ((Na + K)-(Cl+SO4)) on bone ‘n
da’ry cows at parturition. Res. Vet. Sci., 1994; 56: 270-276.
Sezer, K., Ozdemir, H.: Elazığ ve çevresindeki ineklerde osteomalasinin epizootiylojisinin araştırılması. F.Ü.
Sağlık Bil. Dergisi., 2002: 16: 95-105.
Shupe, J.L., Butcher, J.E., Call, J.W., Olson, A.E., Blake, J.T.: Clinical signs and bone changes associated with
phosphorus deficiency in beef cattle. Am.J.Vet.Res., 1988; 49: 1629-1636.
Uysal, A.:. Metabolizma ve Karans Hastalıkları, Veteriner İç Hastalıklar Ders Notu, 1998; No:79.
Van De Braak, A.E:, Vant Klooster, A. T.H., Goedegebuure, S.A., Faber, J.A.J.: Effects of calcium and magnesium
intakes and feeding level during the dry period on bone resorption in dairy cows at parturition. Res. Vet.
Sci., 1987; 43: 7-12.
Williams, S.N., Lawrence, L.A., Mcdowell, L.R., Wilkinson, N.S., Ferguson, P.W., Warnick, A.C.: Criteria to
evaluate bone minerilization in cattle: I. Effect of dietery phosphorus on chemical, physical, and mechanical
properties. J. Anim. Sci., 1991; 69: 1232-1242.
Williams, S.N., Mcdowell, L.R., Lawrence, L.A., Wilkinson, N.S., Ferguson, P.W., Warnick, A.C.: Criteria to
evaluate bone minerilization in cattle: II. noninvasive techniques. J. Anim. Sci., 1991; 69: 1243-1254.
Forensic observation on the use of auricular marks on
the Sardinian purebred sheep
Osservazioni cliniche, medico-legali, legislative e di

benessere animale sull’applicazione delle marche
auricolari in ovini di razza sarda
MEDICINSKO-PRAVNI OSVRT NA PRIMJENU UŠNIH MARKICA KOD

SARDINIJSKIH PASMINA OVACA
Cubeddu G.M., Coluccio P.*, Lai M.G.**, Pintori G.*,Vacca E.***
Istituto di Clinica Medica Veterinaria-Università di Sassari

*Dottorato di ricerca in “Normative dei paesi UE relative al benessere e protezione animale-Università di
Messina
** Veterinario libero professionista
***Direttore Servizio Sanità Animale ASL 6 Sanluri
Summary
The numberless complaints of the flock owners, the deforming lesions caused by the application of the
auricular marks, the loss of them, as well as the death of the animals in consequence of the possible clinic
complications in the various Sardinian provinces, have lead the authors to:
1) to weigh up the difficulties met owing to the application of the auricular marks with regard a new
group of lambs in Sardinia, in compliance with the EC Regulation 21/2004;
2) to make a set of forensic observations with regard to both the rising of pathologies resulting from the
application of the auricular marks, through a constant clinic monitoring of the concerned animals, and to the
request of compensation for damages, proposing some suggestions. It is also emphasized, in the light of the
increasing of the rules in the subject of animal wellbeing and protection, that the animal identification systems
of sheep and goats could be considerably improved employing electronic identifiers, on account that some
conditions pertinent to the measures of accompanying are satisfied.
In Italy it has been confirmed the feasibility of cattle, sheep and goats electronic identification, and
therefore, it is hoped for that the EU can issue a course of action to oblige the member States to adopt the
electronic identification system.
Sažetak
Mnogobrojna negodovanja vlasnika stada ovaca u Sardiniji, zbog povreda prouzrokovanih primjenom
ušnih markica, zbog njihovog gubljenjea te zbog mogućih kliničkih komplikacija koje mogu rezultirati i
smrću životinja, navela su autore na: 1) procijenjivanje nastalih komplikacija prilikom primjene ušnih markica
proporcionalno remontu stada ovaca na Sardiniji, prema Pravilniku CE n. 21/2004; 2) izvršiti promatranje niza
medicinsko –pravnih segmenata s obzirom na pojave patologija izazvane primjenom ušnih markica, putem
konstantnog kliničkog monitoringa istih životinja, kao i s obzirom na zatražene odštete, s predlaganjem mjera.
U vrijeme donašenja mnogih normativnih akata vezanih uz dobrobit i zaštitu životinja, naglašava se, da bi
za identifikaciju ovaca i koza bilo bolje korištenje elektronskih čipova. U Italiji je već potvrđena izvedivost
elektronske identifikacije goveda, ovaca i koza, te je moguće da će EU obvezati zemlje članice na primjenu
istoga.
Riassunto
Le numerose lamentele da parte dei proprietari delle greggi, le lesioni deformanti provocate
dall’apposizione delle marche auricolari, la perdita delle stesse, nonché la morte degli animali a
seguito di possibili complicanze cliniche nelle diverse province della Sardegna, hanno indotto gli
Autori a: 1) valutare le difficoltà incontrate dopo l’applicazione delle marche auricolari relativamente
alla quota di rimonta negli ovini in Sardegna, in ottemperanza al Regolamento CE n. 21/2004; 2)
effettuare una serie di osservazioni medico-legali relativamente sia all’insorgenza di patologie
conseguenti all’applicazione delle marche auricolari, attraverso un costante monitoraggio clinico
degli animali interessati, sia alla richiesta di risarcimento per danni, proponendo dei suggerimenti.
Viene sottolineato, altresì, alla luce del proliferare delle normative in materia di benessere e
protezione animale, che i sistemi di identificazione degli animali delle specie ovina e caprina in
Sardegna potrebbero essere sensibilmente migliorati con l’impiego di identificatori elettronici, a
condizione che siano soddisfatte talune condizioni relative alle misure di accompagnamento. In Italia,
è stata confermata la fattibilità dell’identificazione elettronica di bovini, ovini e caprini e, pertanto,
è auspicabile che l’U.E possa emanare una direttiva per obbligare gli stati membri ad adottare il
sistema elettronico di identificazione.
Introduzione: l’allevamento ovino rappresenta un cardine per l’economia della Sardegna, con
circa tre milioni e mezzo di capi, ubicati in oltre 14.000 aziende; il benessere degli animali ha assunto
al giorno d’oggi connotazioni fino a poco tempo fa impensabili. Le difficoltà incontrate con l’avvento
delle nuove normative, vengono oggi superate anche da quelle categorie, tra le quali gli allevatori
sardi, i quali si dimostrano sempre più propensi a tutelare la protezione ed il benessere dei loro animali,
sia in un’ottica di maggiori economie di scala, sia soprattutto per una mutata coscienza zoofila, oltre
all’incentivo dei premi comunitari. Nell’allevamento attuale si pongono numerosi problemi, non
solo di ordine sanitario e mesologico, ma anche in riferimento al benessere animale ( sofferenza ).
Inizialmente il tema del benessere e della protezione animale è stato affrontato principalmente sotto
le spinte di sensibilità nei confronti degli animali. Successivamente tale problematica è stata anche
valutata come fattore di produzione in grado di incidere sul prodotto zootecnico. Il legislatore ha
emanato una vasta ed articolata normativa sulla questione “benessere” per gli stretti rapporti esistenti
fra questa condizione degli animali e produttività quanti-qualitativa dell’allevamento. L’aspetto
giuridico del benessere animale, inteso semplicemente come assenza di maltrattamenti, è stato per
molti anni legato alle disposizioni dettate dall’ex Art. 727 del Codice Penale, che sanciva le pene per
atti di crudeltà o maltrattamenti verso animali. Nel 1985 è stata emanata la Legge n. 623, a ratifica
della Convenzione di Strasburgo del 10.3.1976 riguardo la protezione degli animali negli allevamenti
e nei macelli. Sono state, inoltre, promulgate numerose disposizioni normative, a recepimento anche
di Regolamenti o Direttive Comunitarie, concernenti il benessere e la protezione animale. Tra i fattori
di interesse sanitario relativi al Benessere Animale si annovera anche la prevenzione delle patologie
d’allevamento. Inoltre c’è grande attenzione dell’UE al raggiungimento e mantenimento del benessere
animale nelle produzioni zootecniche. Il benessere animale passa attraverso tre buone ragioni: a-
l’articolo 9 della Costituzione italiana è in fase di revisione con l’inserimento della “tutela delle
esigenze in materia di benessere degli animali in quanto esseri senzienti” da parte della Repubblica;
b-la nuova PAC ( Politica Agraria Comunitaria ) pone “il benessere animale” fra le 4 condizioni per
l’accesso al regime di aiuti da parte dell’UE; c-il Consiglio dell’UE ha stabilito che “i proprietari o
i custodi adottino le misure adeguate per garantire il benessere dei propri animali e per far sì che a
detti animali non venga provocato dolore, sofferenze o lesioni inutili” (dir. 98/58, art. 3); ancora la
Legislazione italiana, all’art. 9 della Costituzione recita: “La Repubblica riconosce l’ambiente, i suoi
ecosistemi, le sue biodiversità, omissis…..; tutela le esigenze in materia di benessere degli animali
in quanto esseri senzienti.
Materiale e metodi
A partire dal 9 luglio 2005, come è noto, in forza del regolamento (CE) N. 21/2004, tutti gli ovini
e i caprini nati dopo tale data devono essere identificati, entro sei mesi a decorrere dalla nascita e
in ogni caso prima che l’animale lasci l’azienda, attraverso due distinti mezzi di identificazione. Il
primo di questi è rappresentato da un marchio auricolare in materiale plastico applicato all’orecchio
sinistro. In aggiunta alla marca auricolare di cui sopra, l’Autorità competente dovrà approvare un
secondo mezzo di identificazione tra i seguenti: un altro marchio auricolare ( orecchio destro ) con
le medesime caratteristiche del marchio costituente il primo mezzo di identificazione; un tatuaggio
(tranne per gli animali destinati agli scambi intracomunitari e all’esportazione verso paesi terzi); un
transponder elettronico (obbligatorio a partire dal 1° gennaio 2008) o anche un marchio al pastorale
unicamente per la specie caprina. Le marche auricolari, in plastica rigida con un’anima in metallo,
vengono pinzate a pressione sulle orecchie delle nuove leve ( quota di rimonta ). Nel corso degli
ultimi due anni sono stati effettuati numerosi sopralluoghi nelle aziende ovine di tutte le province
della Sardegna, con la stretta collaborazione dei colleghi delle A.S.L., oltre che dei veterinari
dell’Associazione regionale allevatori. Nel corso dell’indagine abbiamo sottoposto gli animali
identificati a visita clinica, nell’ottica di valutare gli effetti negativi provocati dall’applicazione delle
targhette, oltre a verificare se, in un contesto legislativo moderno sulla tutela del benessere animale,
le condizioni di benessere fossero realmente rispettate.
Risultati: in un’alta percentuale di ovini ( 30-40% ) sottoposti a visita clinica, erano presenti
dei sintomi come ipertermia, ottundimento del sensorio, linfoadenomegalia a carico dei linfonodi
regionali, facile affaticabilità e, in alcuni casi difficoltà alla masticazione; inoltre, già ad una prima
osservazione a distanza, erano facilmente evidenziabili a carico delle orecchie lesioni deformanti.
L’esame obiettivo particolare dell’orecchio confermava i sospetti a distanza e in particolare,
soprattutto nella parte interna del padiglione auricolare si evidenziavano: tumefazione, soluzioni
di continuo, presenza di essudato purulento-emorragico; nel periodo primavera-estate, le lesioni
erano complicate dalla presenza di parassiti esterni , larve di mosca e necrosi dei tessuti. In tutti
i casi veniva intrapresa la terapia del caso, a base di antibiotici, antisettici, oltre alla toelettatura
delle parti compromesse. Alcuni animali, nonostante la terapia, venivano a morte; nei restanti si
evidenziavano ritardi nello sviluppo morfologico e funzionale. In questo periodo numerose nel
frattempo erano state le sollecitazioni agli assessorati competenti delle anomalie, nel tentativo di
richiesta di risarcimento danni, a tutt’oggi non ancora presa in considerazione. Stante tale situazione,
i costi per l’allevatore subivano un incremento che andava a gravare sul bilancio aziendale già
compromesso dalla sfavorevole congiuntura del mercato delle carni, del latte e dei derivati; inoltre
la patologia suddetta, compromettendo sensibilmente le condizioni di salute e di benessere degli
animali, interferiva col prosieguo della catena alimentare con possibili conseguenze. Un esempio per
tutti è che nel corso degli anni 2006 e 2007 il Servizio di Sanità Animale della sola A.S.L di Sanluri
ha rilevato ufficialmente lesioni da marche auricolari in forma grave in 57 allevamenti ovini.
Osservazioni personali
Non è difficile immaginare le lamentele degli allevatori sardi allorché si trattava di applicare detto
regolamento, dal momento che la marca auricolare poteva comportare, oltre che aggravio dei costi,
un’importante causa di lesioni al padiglione auricolare; si ha la sensazione, a quest’ultimo riguardo,
che si sia sottovalutata la sensibilità degli allevatori per il benessere dei propri animali. La resistenza
degli allevatori si faceva sentire, inevitabilmente, anche sul grado di efficacia dell’identificazione
basata sulla “marca” la cui applicazione in passato aveva dimostrato risultati non soddisfacenti e
comunque inferiori rispetto agli interventi di tatuaggio. Si riteneva oramai, vista la non poca esperienza
accumulata, che il marchio auricolare facesse parte del passato; invece ci si ritrova nuovamente
alle prese con la ben nota “targhetta” con l’aggravante, stavolta, dell’obbligatorietà (per il DPR
317/1996, per lo meno, il marchio auricolare era un’opzione, ovvero un’alternativa al tatuaggio per
contrassegnare il numero progressivo individuale). Il paradosso di tutta la vicenda è che le norme
sul benessere animale impongono, tra le altre cose, anche l’utilizzo delle marche, pena la perdita dei
premi erogati dalla Comunità europea, oltre a quelli della misura F sul benessere. In virtù di questo
ci si attendeva dalla Regione Sardegna, forte della propria esperienza su questo specifico argomento,
una partecipazione più attiva e determinata alle decisioni dirette alla formazione di atti normativi
comunitari così importanti per il comparto ovi-caprino; in questo senso, non sarebbe stato velleitario
proporre a suo tempo un coinvolgimento della sanità pubblica veterinaria e del settore zootecnico nel
definire orientamenti tecnici e procedure specifiche in materia di identificazione e registrazione dei
piccoli ruminanti da sottoporre all’attenzione in sede Statale e Comunitaria. La suddetta esperienza
isolana e le eventuali proposte di nuovi orientamenti e procedure in tema di anagrafe degli animali,
sarebbero state probabilmente sufficienti a dissuadere il Legislatore europeo dal rendere obbligatorio
il marchio auricolare. Ma nel frattempo l’ansia da marche auricolari dilagava negli allevamenti,
sino al punto che molti allevatori pretendevano che le targhette fossero messe solo prima della
macellazione. E’ agevole ipotizzare il pericolo anche per le carni, ove un’infezione latente potesse
determinare alterazioni a carico dello stato di salute degli animali. Ma inoltre la problematica in
oggetto suscita notevole perplessità; infatti, proprio da chi è preposto a ricercare le migliori soluzioni
per la tutela del benessere animale, si aspettavano metodi rispettosi delle norme in vigore, anziché
applicazioni perentorie di tecniche che si erano già in precedenza dimostrate non del tutto consone
all’identificazione degli ovini.
Conclusioni
Le argomentazioni sin qui addotte impongono alcuni suggerimenti utili alla soluzione del
problema. In primis un’immediata azione politica deve essere attivata al fine di far valere le ragioni
di un doppio sistema di identificazione più accettabile per la nostra importante realtà zootecnica.
Già nell’anno 2006 la Commissione europea ha presentato al Consiglio della UE una relazione con
proposte appropriate sul sistema di identificazione elettronica e sull’eventuale aggiornamento degli
aspetti tecnici relativi alla sua attuazione. Gli allevatori svizzeri stanno portando avanti la richiesta di
modifica del succitato regolamento proponendo come primo mezzo di identificazione il transponder
elettronico e come secondo mezzo il marchio-collare. Considerando il sistema di identificazione
fin qui adottato in Sardegna, basato quasi esclusivamente sul tatuaggio auricolare, dimostratosi più
rigoroso e meno traumatico delle “marche”, si ritiene opportuno sollecitare le Autorità competenti
affinché sia riconosciuto il transponder quale primo mezzo di identificazione e il tatuaggio come
secondo sistema identificativo. Infine sembra improcrastinabile garantire un giusto ristoro economico
per i danni subiti dagli allevatori, sulla base dei dettami dell’art.1223 del Codice Civile, anche e
soprattutto per continuare con l’opera di sensibilizzazione nei riguardi del benessere animale in
queste categorie sotto certi aspetti “difficili”. Solo così potremo porre in essere le normative sul
moderno benessere animale. Se così non fosse, potremo tranquillamente considerare gli organismi
competenti responsabili del reato di maltrattamento di animali.
Bibliografia:
1) Benazzi P.: Il regolamento di Polizia Veterinaria-Ed. Esculapio-31/08/2002; 2) Cinotti S., Peccolo.G.:
Protezione animale-Utet-1997; 3) Codice Civile – Libro IV delle obbligazioni; 4) Codice Penale: articoli
638 e 727, legge 189/2004; 5) Cubeddu G.M., Pintori G., Bassu G., Maninchedda G.-Differenti valutazioni
sul danno e risarcimento in ovini di razza sarda. Atti del VIII Congresso SIPAOC., Sezione Patologia, pag.
397, 1988; 6) Gasparini U.: Appunti di Medicina Legale Veterinaria, Legislazione Veterinaria e Deontologia-
Ed. Esculapio 1983; 7) Ghisleni P., Ghisleni G.: Trattato di Medicina Veterinaria Legale. UTET, Torino
1925; Mainardi, D., Papalia, S., Etologia e protezione animale, Editoriale grasso (1991); 8) Nisini: Comp.
Infort. La tribuna 1978 tratato di diritto privato; 9) Pezza F.: Diritto e Legislazione Veterinaria-Utet-1997;
10) Pilla: Ricerca e miglioramento dell’allevamento ovino; 11) Ruffo G.: Legislazione Veterinaria-Poletto
Editore-luglio 2003; 12) Torrente A.: Manuale di Diritto Privato. Giuffrè, Milano 1981.
Biometry and histomorphometry of ovary in Lori local
sheep
Biometrija i histomorfometrija ovarija ovce pasmine

Lori
GHARZI , A 1and ABBASI , M 2

1
Department of Biology , Faculty of Basic Sciences, University of Lorestan, Khorram-Abad, Iran. 2 School of
Veterinary Medicine, University of Lorestan,Khorram-Abad, Iran.
The purpose of this study was to investigate morphometry and histological structure of the ovary in lori
sheep. The lori sheep ovaries were collected from apparently healthy cyclic sheep in khorramabad abattoir. After
removing the non-ovarian tissues the specimens were underwent for biometrical measurements of parameters
and then processed for histological studies. The result of the biometrical studies has shown that the mean
length,width and diameter of ovaries were 1.71± 0.31,1.26 ± 0.24, 0.98 ± 0.23 cm respectively. The ovarian
mean weight was 1.23 ± 0.85 g. The histological study revealed that the majority of primordial follicles was
distributed in close contact to the tunica albuginea, but with the initiation of follicular growth at first, the distance
between follicles and surface epithelium was increased whereas with continuation of the growth this distance
were reduced. Our study revealed that zona pellucida formation in more pronounced in in secondary follicle.
Key words; Sheep, Ovary, Histology, Biometry
Sažetak
Namjera ovog istraživanja je bilo utvrditi histomorfometrijsku i histološku građu jajnika ovce pasmine
Lori. Jajnici su prikupljeni od klinički zdravih ovaca obrađeni u Khorramabadskoj klaonici. Nakon odvajanja od
ne-jajničkog tkiva uzorci su podvrgnuti biometričkim mjerenjima i proslijeđeni na histološku obradu. Rezultati
biometričkog istraživanja pokazuju da su prosječna duljina, širina i promjer jajnika bili1.71+/-0.31 cm, 1.26+/-
0.24 i 0.98+/-0.23 cm. Prosječna težina jajnika bila je 1.23+/-0.85 grama.Histološkim istraživanjem ustanovili
smo da je većina primordijalnih folikula bila raspoređena u neposrednom dodiru s tunikom albugineom, ali
s početkom folikularnog rasta isprva razlika između folikula i površine epitela raste dok se nastavak rasta
smanjivao. Naše istraživanje je pokazalo da je zona pellucida više izražena u sekundarnom folikulu.
Ključne riječi: ovca, jajnik, histologija
Biochemical and hematological parameters in cows
with TRP
Biokemijski i hematološki pokazatelji u goveda sa TRP
Hassanpour, A.1, Amougli Tabrizi, B. 1
1- clinical science department- faculty of veterinary scince- Islamic azad university of Tabriz -Iran
TRP is one the of pervalent diseases in cows that most common in dairy cows feed by prepared foods but
cases occur infrequently in yearlings , beef cattle, dairy bulls , sheep and goats. In this disease cardiac arrythmias
are probably due to electrolyte imbalances .In this research 20 cows with TRP were studied. Firstly affected
cows were diagnosed based on clinical signs. The two blood samples were obtained from the related cows.
The first sample with anticoagulant for haematological tests and determining PCV, RBC, WBC and differential
count ofwhite blood cells, and the second sample was whole blood, in which after separation blood serum by
centrifuging, the biochemical tests, such as sodium , potassium , Glucose , phosphorus, Albumin and calcium
levels in serum were measured. The mean level PCV in these animals was 37.4±4.6 percent. The mean of RBC
and WBC numbers were 7.8×103 and 13.2×106 respectively. The mean concentrations of sodium, potassium,
glucose, phosphorus, albumin and calcium in serum were 117.7± 13.3 meq/l, 3.11±0.96 meq/l, 42.29±5.63 mg/
dl, 3.84±1.02 mg/dl, 544.60± 87.64 mg/dl and 8.60±2.06 mg/dl respectively.According to this study electrolyte
imbalance there was in the cows with TRP and balancing of electrolytes will need.
Sažetak:
TRP je učestala bolest u goveda ,a najčešće se javlja u mliječnih krava koje su hranjene gotovom hranom
ali su zapaženi rijetki slučajevi te bolesti u jednogodišnjih tovljenika, ovaca i koza. Kod ove bolesti srčane
aritmije su vjerojatno povezane pomanjkanjem elektrolita. U ovom istraživanju koristili smo 20 krava. Prva
zapažanja kod oboljelih krava temeljili smo na kliničkim znacima. Od svake oboljele životinje uzeli smo 2
uzorka krvi. Prvi uzorak sa antikoagulansom uzeli smo za hematološku pretragu i određivanje PCV, RBC,
WBC i diferencijalnu krvnu sliku. Drugi uzorak krvi koristili smo za biokemijsku pretragu te odredili količinu
natrija, kalija, glukoze, fosfora, albumina i kalcija u serumu. Srednja vrijednost PCV-a u testiranih životinja bila
je 37.4+/-4.6%. Srednje vrijednosti RBC-a i WBC-a bile su 7.8*10 i 13.2 *10 6. Prosječna koncentracija natrija,
kalija, glukoze, fosfora, albumina i kalcija u serumu bila je 117.7+/-13.3 meq/l, 3.11+/-0.96 meq/l, 42.29+/-5.63
mg/dl, 3.84+/-1.02 mg/dl, 544.60+/-87.64 mg/dl i 8.60+/-2.06 mg/dl. Naše istraživanje je pokazalo da kod
goveda sa TRP-om postoji pomanjkanje elektrolita.
The survey on prevalence of E.coli O157:H7 using VT1, 2
and eae genes from sheep in Shiraz-Iran
Pregled pojavnosti E.coli O157:H7 upotrebom VT 1,2 i eae

gena iz pokrajine Shiraz u Iranu
Yahya Tahamtan*a, Seyyed Shahram Shekarforooshb, Seyyed Ali Pourbakhshc

a
Department of Microbiology, Razi Vaccine and Serum Research Institute, Shiraz, 71955-367, Iran.
b
Department of Food Hygiene, School of Veterinary Medicine, Shiraz University, 71345-1731 Shiraz, Iran.
c
Department of Avian Disease, Research & Diagnosis, Razi Vaccine and Serum Research Institute, Tehran,
31975/148, Iran. •Corresponding author. Tel.: +98 711 6240 331; fax: +98 711 6240 201. E-mail address
yahyatahamtan@yahoo.com (Yahya Tahamtan). Y.Tahamtan@rvsri.ir
Abstract
From September 2004 to August 2005, swab surfaces samples from sheep were collected at the major
slaughterhouses of Shiraz-Iran. The samples were revealed the occurrence and characterization of E. coli O157
strains in Iranian domestic sheep. Escherichia coli O157:H7 is a highly virulent food-borne pathogen and threat
to public health. Sheep faces may be an important source of Verotoxin-producing Escherichia coli. Verotoxins
(VT) 1, 2 and eae genes were tested for this propose. The monthly prevalence of E. coli O157 in sheep was
obtained 3.92-0.2% and was at its highest in spring and late summer. Six (3.92%) of sheep carcasses were
contaminated by E. coli O157:H7. Five (3.34%) of 115 and 1(2.63%) of 38 samples were from ewes and
lambs carcasses respectively. Only six samples were positive to PCR specific for the VT2 gene and produced
verocytotoxin VT2, whereas all isolates were negative for the presence of VT1 and eae virulence genes
considered. The detection limit of the PCR protocol for VT2 in E. coli O157:H7 without prior enrichment was
103 CFU ml-1, and with over night prior enrichment in mTSB was 102 CFUml-1. Geographical variations and
season may be influenced in prevalence. The distribution of VTEC in sheep and lamb in subject area is widely.
The composition of the gastrointestinal flora may be changed by different diet and, therefore O157 VTEC rate
in sheep and lamb was different. Iranian sheep indicated as a natural host of E. coli O157 strains therefore, may
be potentially pathogenic for humans. This is the first report of E. coli O157 detection from sheep in Iran.
Keywords: Escherichia coli O157:H7; Sheep; PCR ; Iran
Sažetak:
U ovom radu prikupljani su uzorci briseva ovaca u većim klaonicama u jednoj iranskoj pokrajni. Uzorci su
ukazali na učestalost i karakteristike sojeva E. coli O157 u iranskih domaćih ovaca. Escherichia coli O157:H7
je vrlo virulentan pathogen koji se prenosi hranom te kao takav ima značajan utjecaj na javno zdravstvo.Ovčji
izmet može biti važan izvor verotoksina kojeg stvara Escherichia coli.U ovom radu istraživali smo verotoksine
1 i 2. Mjesečno pojavljivanje E.coli O157 u ovaca je uočeno u 3.92+/-0.2 % i bilo je najviše u proljeće i kasno
ljeto.Šest (3.92 %) ovčjih lešina je bilo zaraženo E. coli O157:H7. Pet (3.34%) od ukupnog broja od 115 i jedna
( 2.63%) od 38 uzoraka uzeto je od ovaca i janjadi. Samo 6 uzoraka je bilo PCR specifično i pozitivno za VT2
gen, te su proizvodili VT2 verotoksin dok su svi ostali uzorci bili negativni na VT1. Zemljopisne raznolikosti
i doba godine mogli su utjecati na pojavnost stanja. Očigledna je široka rasprostranjenost VTEC u ovaca i
janjadi promatranog područja. Sastav gastrointestinalne flore se mijenjao ovisno o režimu prehrane, pa je stoga
i različita rtazina O157 VTEC u probavilu ovaca i janjadi. Iranske ovce su uočene kao prirodni domaćini E.coli
O157 koja je potencijalno patogena i za ljude. Ovo je prvi izolat E.coli O157 u iranskih ovaca.
Ključne riječi: Escherichia coli O157:H7; Ovca; PCR ; Iran
First Identification of Escherichia coli O157:H7 by
Improved Trypticase Soy Broth and Sorbitol MacConkey
Agar containing cefixime and tellurite and comparison
with PCRs from cattle carcasses in Shiraz-Iran
Prva identifikacija E.coli O157:H7 na poboljšanoj podlozi
bujona sojine triptikaze i sorbitol McConkey agaru koji
sadrže cefexim i telurit u usporedbi s PCR od goveđih
lešina u iranskoj pokrajini Shiraz
Yahya Tahamtana•, Ali Pourbakhsh c, Shahram Shekarforoosh b
a
Razi Vaccine and Serum Research Institute,Shiraz-Iran
b
Razi Vaccine and Serum Research Institute, Tehran-Iran
c
School of Veterinary Medicine, Shiraz University, Shiraz, Iran
Background: E. coli O157:H7 as food-borne pathogens and implicated in HC, HUS and may be lead
to death. Cattle are the major reservoir. Sorbitol-MacConkey (SMAC) agar is developed as the first selective
medium for isolation of E. coli O157:H7 through form colorless colonies. We investigated the efficiency of
modified CT-SMAC medium and PCRs to detection of E. coli O157:H7 in Shiraz-Iran abattoirs. Material
and methods: The Trypticase Soy Broth (TSB) and SMAC agar was supplemented with cefixime (0.25 mg
L-1) and potassium tellurite (12.5 mg L-1) (5 times more than general use) to create improved CT-SMAC. 153
slaughtered cattle were tested from December 2005 to August 2006. Results, Discussion: E. coli O157:H7 were
isolated from 24 (15.58%) of 154 cattle carcasses (by CT-SMAC), while 17(11.03%) of this was positive by
O157 antiserum and finally 14(9.09%) of them were significantly positive by PCR and then Nested PCR. The
sequencing result was shown 80% homology with some O157 isolated. The bacteria were isolated 12(10.52%)
of 114 cattle two or below two and 3(7.5%) of 40 cattle over two years old (P<0.05). We have improved TSB
and SMAC agar, which largely inhibits the physiological intestinal flora. This method has allowed the detection
of bacteria among coliform grown by using specific primers to detect a fragment of 779 bp and combined with
a nested PCR which have 372 bp stx2 fragments. Composition of the gastrointestinal flora may be result in high
frequency for younger animals.This is the first report of E.coli O157:H7 isolated from cattle in Iran.
Keyword: Escherichia coli O157:H7; Cattle; PCR
Sažetak: E. coli O157:H/ je patogena bakterija koja se prenosi hranom a posljedice trovanja tim patogenom
mogu dovesti do smrti.Glavni rezervoar te bakterije su goveda. Sorbitol-MacConkey (SMAC) agar je prvi
selektiva hranjiva podloga razvijena za uzgoj E. Coli O157:H7 pri čemu ona na njemu raste u vidu obojenih
kolonija.U ovom radu istraživana je učinkovitost modificirane CT-SMAC hranjive podloge i otkrivanja E.coli
O157:H/ pomoću PCR metode.Materijal i metode: U triptikaza bujon (TSB) I SMAC agar dodan je cefixim
(0.25mg L-1) I natrijev telurit (12.5 mg L-1) u pet puta većoj koncentraciji od uobičajene . Tako smo dobili
poboljšani CT-SMAC . Od listopada 2005. godine pa do kolovoza 2006 godine obrađeno je 153 uzorka od
zaklanih goveda.Rezultati i rasprava:E.coli O157:H7 je izolirana iz 24 uzorka ( 15.58%) od ukupno 154 uzorka (
pomoću CT-SMAC), dočim je 17 uzoraka ( 11.03%) bilo pozitivno na antiserum od O157 i konačno 14 uzoraka
(9.09%) od njih bilo je pozitivno detektirano uz pomoć PCR-a.??Bakterija je bila izolirana u 10.52% u krava
ispod dvije godine starosti i u 7.5% krava iznad dvije godine starosti (P<0.05). Koristili smo poboljšani TSB i
SMAC agar koji značajno usporava rasžmnožavanje fiziološke crijevne flore.Ovo je prvi slučaj izolacije E.coli
O157:H7 iz goveda u Iranu.
Ključne riječi: Escherichia coli O157:H7; krava; PCR

Induction of parturition in ewes (local breeds) and
subsequent survival of neonates
Saif A.Balios*, Muaffq S.Kassim* *and Rabea A.S.Al-Oramary**.
* Dept. of Surgery and Medicine. College of Veterinary Medicine. University of Dohuk.Kurdistan Region. Iraq
**Dept.of Animal Production .College of Agriculture. University of Dohuk.Kurdistan Region. Iraq.
Abstract
Twenty –four pregnant ewes of local breeds were used in two equal groups ina study of induction of
parturition and subsequent survival of neonates. Ewes were treated with either 15mg dexamethasone or saline
(CONTROL) intramuscularly on day 145 of gestation .There were significant differences between the 2
treatments in the mean of the interval from treatment to lambing ( p < 0.05 ) (162 and 59.7h for control and
dexamethasone respectively) and in the proportion of that lambed by 48 hr after treatment ( p < 0.01) .Injection
of 15mg dexamethasone resulted in the short and less variable interval from treatment to lambing. There were
no significant differencesbetween the two treatment in groups in birth weight (3.8 and 4.2 kg for control and
dexamethasone, respectively) andin the mean of the live weightat one month of age (9.4 and 10.2 kg for control
and dexamethasone, respectively).There were no significant differences between the two treatment groups in the
survival rate of lambs at birth(92.8 and 93.3% for controland dexamethasone, respectively )and at one month
of age (71.4 and 66.6% for control and dexamethasone, respectively ). This study confirms the effectiveness
of the dexamethasone to induce the parturition in ewes oflocal breeds with no adverse effect on the survival
ofsubsequent neonates.
Key Words: Ewe, Parturition, Dexamethasone
Effects of untreated gastrointestinal nematode
infections on performances and development of
effective immune response in lambs of Valle del Belice
breed
Brianti E., Abbene S., Gaglio G., Risitano A.L., Ferlazzo M., Chiofalo B*., Cavallaro
M*., Giannetto S.
Dipartimento di Sanità Pubblica Veterinaria, *Dipartimento MOBIFIPA – Università di Messina, Italy
Gastrointestinal nematode infections in sheep are typified by suboptimal animal performance caused by
reductions in both feed intake and nutrient utilization. On the other hand the maintenance of host-parasite
relationship is believed to be of importance for the development of an effective immune response. This immune
response is crucial for the control of pathogenic consequences of parasites infections (resilience) and for the
control of new parasite infections (resistance). However, the importance of these topics little information
is available for sheep in this field and most of the studies are carried out under controlled conditions with
experimental infections in wool breeds. Therefore, aims of this study were to evaluate the effects of untreated
gastrointestinal nematode infections, naturally acquired from pastures in dairy lambs of Valle del Belice breed,
on: i) animal health and performances and ii) capability to develop effective immune response such as resistance
and resilience. To achieve these goals 26 female lambs of Valle del Belice breed, 2-month-old, were enrolled
in the study and randomly dived into treated (13) and untreated (13) groups. Lambs were from the same flock
and were kept from the start to the end of the study in the same management and alimentary regimes. For one
year lambs weights, faeces for Faecal Egg Count (FEC) and blood for Cell Blood Count (CBC) were collected
monthly. Lambs from treated group received monthly anthelmintic treatment (Moxidectin®, Fort Dodge) for
four months from the beginning of the study to the next spring (march) when lambs started a new season of
grazing. During the middle of the study, only one animal from the treated group was excluded for a suspected
cerebral coenurosis; however no symptom of gastrointestinal helminthiasis was observed in all the study
animals. FEC in untreated lambs showed increasing trend the first four months of the study reaching the higher
mean values in April (325 e.p.g.) to after gradually decrease till the end of the study. In the treated group FEC
rapidly peaked when anthelmintic treatment was suspended reaching similar values to those of untreated group
from May to the end of the study. Study results did not show any significant difference in lambs growth rates and
in CBC values between treated and untreated groups from the beginning to the end of the study. Nevertheless,
significant difference were observed in the count of eosinophilic cells in the first four months of the study
been these higher in untreated than in treated group. This study provide the evidence that a moderate burden
of gastrointestinal nematodes is well tolerated by lambs of Valle del Belice breed and anthelmintic treatment
have not evident benefits on both animal health and performance when parasitic burden is in “equilibrium”
with the host. However, in our study we were not able to demonstrate that the maintenance of host-parasite
relationship especially during the first months is of crucial importance for the development of efficient resilience
and resistance to gastrointestinal nematode infections. This failure could be the result of numerous events such
as the low parasite burden of infected animals and the consequently low pastures contamination, the parasites
genera and the well-balanced alimentary regime. Nonetheless, this study represents a first experience and we
hope to achieve more useful information in future studies.
Serological survey on bovine viral diarrhea virus
infection of cattle in Hamadan area-Iran
Aliasghar Bahari1, Mohammadreza Sadeghi1, Shamsedin Ghaemmaghami2, Ali

Sadeghi-nasab1
1
Junior School of Veterinary Medicine, Bu-Ali Sina University, Hamadan-Iran
2
Razi Vaccine & Serum Research Institute- Arak branch, Arak- Iran
Abstract
Infection with bovine viral diarrhea virus (BVDV) is endemic in cattle populations in most part of the
world. The high prevalence in combination with the negative effects on reproduction and the general health
condition in affected herds result in significant economic losses to the cattle industry globally. In this study,
serological investigation was performed to determine the prevalence of bovine viral diarrhea virus infection of
cattle in Hamadan area. A total of 399 blood samples were collected by jugular puncture. The sera were tested
by enzyme linked immunoabsorbent assay (ELISA) for BVDV antibodies. The results were analysed by chi-
square statistical test. The prevalence rate was 77.6%. A total of 182 cases (76.8%) and 127 cases (78.4%) of
industrial and rural non-industrial farms were positive respectively. Statistical analysis of data were not shown
any significant differences between age groups and methods of husbandry (P<0.05).
Key words: Bovine viral diarrhea virus, Seroprevalence, ELISA.
Seroepidemiology of Bovine Leukemia Virus (BLV)
infection in the north eastern provinces of Iran
Alireza Haghparast1, Gholamreza Mohammadi2, Shalaleh Mousavi1

1
Immunology Section, Department of Pathobiology and 2Department of Clinical Siences, Faculty of Veterinary
Medicine, Ferdowsi University of Mashhad, Iran.
Bovine leukemia virus (BLV) is an exogenous c-type oncovirus in the retroviridae family that causes a
chronic infection in cattle, which develops in three possible pathological forms: asymptomatic course, persistent
lymphocytosis and lymphosarcoma. Once infected, cattle remain virus carriers for life and start to show a
serological reaction within a few weeks after infection. This disease causes significant economic losses associated
with the costs of control and eradication, loss in milk production and difficulties in exports.
The Agar gel immuno diffusion (AGID) and ELISA tests have been the serological choice assays for routine
diagnosis of serum samples. However, due to the higher sensitivity of ELISA, in recent years this method has
replaced the AGID in seroepidemiological studies for control and eradication programe.
Prevalence studies on BLV infection has not been conducted in the eastern part of Iran. This study was
designed to determine the prevalence of BLV in Khorasan Razavi and Khorasan Shomali provinces which are
the main provinces located in the north east of Iran.
During summer 2007, 429 blood samples were randomly taken from industrial dairy herds of these two
provinces and subjected to ELISA test (indirect sandwich ELISA).25.41% of these samples showed positive
reaction. The positive results in khorasane razavi and khorasan shomali provinces were 29.83% and 1.5% ,
respectively. Moreover, 64.7% of the herds tested, had at least one positive cow. The overall true prevalence
was 24.63%.
Statistical analysis revealed a direct correlation between age and occurence of BLV. Significant correlation
was also found between herd size and BLV infection. In another words, the large herds had the most BLV
positive cases. Moreover, number of parity was also shown to have a direct correlation with BLV seropositivity.
Results of Odd ratios analysis which is an indication of possible risk factors, confirmed the above findings.
Taken together, the results presented in this study along with simillar studies in recent years in Iran confirm
an alarming increase in prevalence of BLV infection among dairy herds. Therefore, control strategies based
on test and implementation of corrective management should be taken in order to downgrade and possibly
eliminate this economically hardship disease.
GENETIC CARACTERIZATION OF SARDINIAN MOUFLON
POPULATION USING MICROSATELLITES AND mtDNA MARKERS.
Leoni G.G, °Bebbere D., Satta V., °Berlinguer F., Mereu P., Pirastru M., Manca L.,
°Naitana S.
Department ofPhysiological, Biochemical and Cellular Sciences and °Department of Animal Biology, Univer-
sity of Sassari, Italy.
A recent molecular genetic assessment of the genus Ovis based on mitochondrial genotypes has affirmed
the distinctiveness among ovine species and has suggested that European Mouflon (Ovis gmelini musimon) is an
ancestral line of modern sheep breeds (Hiendleder et al., 2002). Actually, European Mouflon is found in large
number and interbred with domestic sheep in several European countries (Cugnasse, 1994), but lives in natural
state only in Sardinia and Corsica, were is fragmented in a few distinct isolated areas.
This study aimed to investigate the genetic structure of mouflons living in three different areas of Sardiniausing
both microsatellites and mitochondrial DNA as markers.Thirty two mouflons living in Montelerno (n=15),
Orgosolo (n=8) and Lanusei (n=9) areashave been trapped and blood sampled. We analysed 16 microsatellite
loci polymorphism length and sequence polymorphisms of the mitochondrial D-Loop region to characterize the
structure of each group and to clarify the genetic relationshipsamong them.
To genotype microsatellites, Polymerase chain reaction (PCR) of the DNA fragments containing the
polymorphisms was carried out according to standard protocols using primers . Microsatellite products were
loaded on ABI PRISM 3100 DNA Analyser (Applied Biosystems) and data were processed by GENESCAN v3.1
and GENOTYPER v2.5 softwares. Standard intra-population indices, such as allele frequency, gene diversity
and deviation from Hardy-Weinberg Equilibrium (HWE), were tested with the software package Arlequin 1.1
(http://lgb.unige.ch/arlequin/). Genetic differentiation (Fst) and the test of genotype assignment have been
chosen as inter-population indices to assess the relationships among the three samples.
The total length of D-loop region of the mouflon mitochondrial D samples was amplified using described
primers according to Wood & Phua, (1996). The amplified products were sequenced using the dideoxi-terminator
method and loaded on ABI PRISM 3100 DNA Analyser (Applied Biosystems). Clustal X software was used for
the sequence multi-alignment. Phylogenetic molecular analyses were conducted using MEGA software.
All the primers pairs successfully amplified the microsatellites sequences in the mouflon genome. Of the
sixteen genotyped loci, fourteen are polymorphic in at least one of the three analysed groups, with a number of
alleles ranging from two to seven, with a mean of four alleles per locus. Eight microsatellites are polymorphic in
all the three populations, and twelve have private alleles.The observed heterozigosity shows, for every marker,
high variability among the three populations.Five microsatellite loci deviated from HWE in at least one group of
mouflons due to heterozygote deficit. The exact test for population differentiation (Fst) revealed strong genetic
differentiation among the three populations, since almost all the relative P values are significant (P<0.05). The
high Fst values are largely due to private alleles. The test of Genotype Assignment determines the effective
belonging of every individual to the population to which it was initially assigned. It does so by taking the three
sampled population as potential source.
We were able to sequence the mitochondrialD-Loop regions of all the 32sampled mouflons. After sequence
alignment 3 aplotipes were evidenced showing variations in 11 different nucleotides. These data allowed us to
make a neighbour joining-tree of individuals where it was possible to separate three distinct clades each contain
the samples deriving from only one populations.
All these results indicate strong genetic differentiation among the three studied groups, probably due to long
term isolation.Despite the low number of individuals sampled, each population showed considerable genetic
variation. This could be due to the fact that originally the founder of each group carried high genetic variability
and the populations have not been isolated for a period of time long enough to show the disadvantages of
inbreeding. (Supported by Fondazione Banco di Sardegna)
Investigation of Bovine Viral Diarrhea Virus (BVDV)
Infection in Relation to Fertility in Dairy Cows with
Repeat Breeding
Mesih KOCAMÜFTÜOĞLU 1,Ayhan ATA2, Mehmet KALE3, Sibel HASIRCIOĞLU 3, *

1
Dept. of Gynecology and Reproduction, Faculty of Veterinary Medecine, Mehmet Akif Ersoy University,
15100, Burdur, TURKEY.
2
Dept. of Artificial Inseminatiom, Faculty of Veterinary Medecine, Mehmet Akif Ersoy University, 15100,
Burdur, TURKEY.
3
Dept. of Virology, Faculty of Veterinary Medecine, Mehmet Akif Ersoy University, 15100, Burdur, TURKEY.
*
Corresponding author. Fax: +90 248 234 45 00, E-mail address:sibel_has04@hotmail.com (S.
HASIRCIOĞLU)
Abstract
In this study, the blood serum and leucocyte samples were collected from 250 cows with repeat
breeding and tested by ELISA. 250 cows were screened for the presence of BVDV (Ab). Out of 250
cows, 106 cows were found BVDV (Ab-). Out of 106 BVDV (Ab-) animals, 48 were BVDV (Ag+)
and 58 were BVDV (Ag-).
The differences for calving to service interval (CSI) (days) and age between BVDV (Ag+/Ab-)
and BVDV (Ag-/Ab-) cows found statistically important (p<0.01). Also, the differences between
pregnant BVDV (Ag+/Ab-) and BVDV (Ag-/Ab-) cows for CSI (days) (p<0.05) and age (p<0.001)
was found statistically important. Conception rate (CR) between these groups was statistically found
insignificant (P=0.37).
No significant difference for age between animals in this group were detected whereas the
difference for CSI (days) between non-pregnant BVDV (Ag+/Ab-) and BVDV (Ag-/Ab-) cows
found statistically important (p<0.05).
In conclusion, the results of this study showed that there was a close relation between BVDV
infections and fertility in dairy cows being repeat breeding problems and BVDV in these animals
affected the fertility of herds negatively.
Keywords: Dairy cattle, BVDV, repeat breeding, fertility, ELISA
Influence of impropriate milking on udder health of
dairy cows
N. Prvanović, M. Cergolj, A. Tomašković, N. Maćešić, J. Grizelj, M. Samardžija, T.

Dobranić, N. Filipović, G. Bačić, M. Lipar
Clinic for obstetric and reproduction, Faculty of veterinary medicine, University Zagreb, Croatia
Department for physiology and radiobiology,Faculty of veterinary medicine, University Zagreb, Croatia
The aim of the study was to compare and analyse influence of different milking failures on udder health of
dairy cows. Two dairy farms in southwestern Croatia were observed and followed during five years. At the first
farm there were 430 cows and at the second farm there were 320 monitored cows. Cows of both breeds were
uniform according to breed, age and milk production; they all were holstein-frisian cows, approximatly 8 years
old, used in milk production for 5-6 years with everage milk production of 7 000 l per year. Cows from the first
farm were milked on the milking parlour 3 times daily using „BOU-MATIC“ system. Unfortunately, due to
some technical problems, part of the system didn’t work properly and it was necessary to replace it with manual
milking during the last two years of research. Due to high hygienic standards of milking preparation, they didn’t
notice any change of milk hygiene and quality. On the second farm cows were milked 2-3 times daily according
to lactation status using milking machines on the lair but presanitation and hygienic standards were very poor
and absolutely unsufficient. On both farms mastitis test was performed regularly and milk samples from all
positive cows were collected for bacteriological tests. During five years we analysed 1292 samples from the
first and 2504 samples from the second farm. After bacteriological test of 1292 samples from the first farm only
18,60% samples were positive versus 16,6% positive results from 2504 samples from the second farm.
Monitoring and analysis of results from the first farm has shown statistically significant influence of
mentioned technical problem on positive results of bacteriological tests. From the 9,10% positive results at the
first year it decreased on 25,26% at the last year of study. The most common isolate was Staphylococcus aureus
(66,99%), Streptococcus agalactiae (12,95%), Streptococcus dysgalactiae (4,88%), Streptoccocus faecalis
(8,06%) and Lactobacillus spp. (7,09%). Furthermore, number of positive Staphylococcus aureus isolates
increased predominatly year after year and caused already mentioned dramatic increase of positive samples.
Analysis of results from the second farm has shown that number of positive results decreased slowly from
18,74% to 16,66% during five years. There was no predominance of particular bacteria species. The most
common isolates were: Streptococcus faecalis (20,41%), Micoplasma spp. (19,16%), Streptococcus agalactiae
(17,92%), Staphylococcus aureus (17,92%), Lactobacillus spp. (9,58%) and Coliform spp. (8,75%). Comparation
of all positive samples from the front quarters versus rear quarters has shown predominance of the front quarters
(55,41% versus 44,59%). It could be explained with high incidence of S. aureus who predominantly attacks
front quarters. According to our results we concluded that poor sanitation and milking hygiene enables different
bacteria and also Micoplasma species to survive at the farm and cause mastitis and dairy losses but in the mean
time cows develop sort of resistence wich causes decrease of subclinical infections after a few years. In the mean
time, milking of cows using high hygienic standards but changing routine and type of milking ( machine milking
replaced with manual milking) causses decrease of immunity and slowly increases subclinical infections. It also
enables significant increase of very resistent bacteria like S. aureus to intrude and stay in the farm causing more
and more problems and dairy losses.
Key words: cow, mastitis, impropriate milking, sanitation, bacteriological test, S. aureus
ANTIMICROBIAL EFFECT OF EDTA_TRIS AND ANTIBIOTICS ON
SALMONELLA TYPHIMURIUM INVITRO AND ON BROILER CARCASE
Mohagheghzadeh Ali
Faculity member of islamic azad university, kahnooj branch_kerman_iran.
The effect of six antibacterial agents (ampicilin, chloramphenicol, oxytetracyclin, streptomycine, nalidixic
asid and sulfacetamid) on salmonella typhimurium phage type 49, invitro and on broiler carcase and combined
with edta_tris were investigated.
In vitro solutions of edta_tris markly potentiated the effect of oxytetracycline and ampicillin and lesser
potentiated the effect of chloramphenicol, nalidixic acid and sulfanamid. But no potential effect was abserved
with streptomycine.
Enumeration of salmonella typhimurium from the broiler carcase of short term (2 min) and long term (60
min), were investigated.
The mixture of edta-tris with nalidixic acid, chloramphenicol, sulfanamid and oxytetracycline at long term
gave the most significant reduction in the number of organism.
Ampicillin and streptomycine without edta-tris at long term also gave reduction in the number of
organism.
Effects of Bluetongue live modified vaccine on early
and mid pregnancy in sheep
Nicolussi P, Bonelli P, Pau S, Canalis M, Soru A, Sarria A, Patta C, Marongiu E, Di

Gennaro A*, Bonfini B*, Savini G*.
Istituto Zooprofilattico Sperimentale della Sardegna, Sassari, Italy

*Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise, Teramo, Italy
Fifty six pregnant Sarda ewes were arranged into 4 groups according to their different stages of gestation.
The first group included 27 ewes from 15 to 30 days of gestation, the second 13 ewes from 31 and 45 days, the
third 9 ewes from 45 to 55 days and the fourth included 7 ewes from 56 and 75 days of gestation. Twenty seven
ewes, 13 from the first group, 6 from the second, 4 from the third and 4 from the fourth were vaccinated with
the combination of the monovalent bluetongue virus (BTV) serotypes 2, 4, 16 modified live vaccines.Following
vaccination, BT related symptoms were recorded in 6 (18.7%) vaccinated animals. The percentage of vaccinated
animals (66.7%) showing lambing failures was higher (P<0.05) than that ofthe unvaccinated controls (17.2).
Abortion, stillbirth and agalactia were observed in10 ewes(76.9%) of the first group, 5 (83.3%) of the second, 2
(50%) of the third and 1 of the fourth (25%). To assess the presence of bluetongue viraemia and determine the
BTV serotype implicated, blood samples were also collected the day of vaccination and three times a week for
the following 30 days. BTV-16 was the only serotype isolated in the viraemic animals. It is concluded that BTV-
2, BTV-4 and BTV-16 monovalent vaccine combination caused reproductive failures in ewes vaccinated in the
first period of pregnancy and that the BTV-16 wasprobably the serotype responsible for them.
Epidemiological survey of infectious causes of
diarrhea in young small ruminants in Sicily.
Vicari D., Mancuso R., Cicero A., Randazzo V., Martorana C., Chetta M., Ferrantelli V.,
Castiglione F.
Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri”, via G. Marinuzzi 3, Palermo, Italy,
dvicari@pa.izs.it
Diarrhea is the most common and costly disease affecting neonatal small ruminants and is the major
cause of lamb mortality. It is a complex, multi-factorial disease involving the animal, the environment,
nutrition, and infectious agents. The four major causes of diarrhea in lambs and kids during the first
month of life are E. coli, rotavirus, Cryptosporidum sp. and Salmonella spp.E. coli scours are most
common. The aim of this study is the description of causes of diarrhea in young small ruminants in
120 flocks in occidental lands of Sicily. Data reported here were collected from rectal swabs and
from animals died for diarrhea submitted at our laboratory facilities during a two-years time extent.
The most common microorganism isolated are E. coli, Clostridium spp. and Campylobacter spp.
confirming their rule in this disease.
Development of “potency test” for evaluation of farm
vaccines against contagious agalactia in a natural
outbreak
RAZVOJ “TESTA UČINKOVITOSTI” ZA OCJENU FARMSKE VAKCINE

PROTIV KONTAGIOZNE AGALAKCIJE
Castiglione F., Tamburello A., Macrì D., Emanuele M.C., Alaimo C., Monteverde V.,
Puleio R., Manno C., Ferrantelli V., Nicholas R.A.J. *, Loria G.R.
Istituto Zooprofilattico Sperimentale of Sicily, Italy; *) VLA (Weybridge), UK
Introduction:
Contagious agalactia is the cause of more than 30% of sheep and goats mastitis in Sicily (data
from yearly reports of Istituto Zooprofilattico Sperimentale della Sicilia-IZSS ). Because of the
loss of farm production, severe sanitary restrictions and difficulties in treatment and control of the
infection in the farm, this infection represents a veterinary priority among problems of sheep farming
in Southern Italy. The aim of this long-term on-going study is to add a practical contribution to the
knowledge and evaluation of an inactivated (autogenous) vaccine as control tool against contagious
agalactia. The authors report clinical and laboratory data one year after experimental vaccination of
sheep severely affected by contagious agalactia in the Trapani district of Sicily.
Sažetak:
Kontagiozna agalakcije uzrok je više od 30% mastitisa u ovaca i koza na Siciliji (podatci iz godišnjeg
izviješća sicilijanskog eksperimentalno - zooprofilaktičnog instituta IZSS). Zbog gubitka proizvodnje na
farmana, ozbiljnih sanitarnih ograničenja i poteškoća u liječenju i kontroli infekcije na farmi, ova infekcija
predstavlja veterinarski prioritet među problemima u farmskom ovčarstvu južne Italije. Cilj ove dugotrajne
studije je praktični doprinos dosadašnjim saznanjima i ocjena inaktivirane (autogenske) vakcine kao kontrolne
mjere protiv kontagiozne agalakcije. Autori iznose kliničke i laboratorijske podatke godinu dana nakon što je
provedeno eksperimentalno vakciniranje stada ovaca ozbiljno napadnutog kontagioznom agalakcijom u regiji
Trapani na Siciliji.
Materials and methods:

The flock was selected in November 2006 following clinical and laboratory investigations of a
farm in the Trapani district where the disease is endemic. The flock showed clinical, microbiological
and serological positivity for contagious agalactia with more than 50% of excretion in monitored
milks and even higher antibody levels in sera. The veterinarian of the farm vaccinated all the sheep,
inoculating 2 ml/head with autogenous vaccine produced by the IZS of Sicily, using the local strain
of Mycoplasma agalactiae previously isolated from the farm during aetiological investigations. The
vaccine was obtained from a broth culture, harvested at the peak of growth and the whole cells
inactivated with 0.2% of formalin at 37° C for 15 hours, and adjuvanted with 300 mg/l commercial
saponin (Quil A®) supplied by Brentag Biosector, Denmark (Estrada et al. 2000). The vaccine
preparation contained a median value of 108 CFU/ml. In February, a group of eighteen 3-5 year old
healthy lactating ewes, belonging to the Comisana dairy breed originating from a flock with no history
of contagious agalactia, were introduced into the infected flock. This introduced group comprised
vaccinated animals and some unvaccinated control ewes. The unvaccinated ewes were included to
act as sentinels to enable us to measure the level of infection on the farm. The introduced sheep
were divided into three subgroups of 6 animals each: group 1 vaccinated once; group 2 vaccinated
twice, with the booster dose given after an interval of one month; and group 3 as negative controls
treated only with saponin solution without antigen and same adjuvant concentration. This group were
previously screened by microbiological and serological tests and shown to be free of the causative
agents of contagious agalactia. Over the year since vaccination, the sheep have been monitored daily
by the owner and fortnightly by IZSS vets with, in addition to clinical assessment, samples taken for
laboratory monitoring of M.agalactiae. Each animal of the introduced group showing severe signs or
other pathologies were properly treated with antibiotics and vaccines when necessary or eliminated
from the experiment on welfare grounds. The rest of the flock were under the responsibility of the
owner and he was requested to manage as usual. Periodically every 2 weeks, clinical investigations
were performed on the whole flock and on all 18 sheep of introduced group. Biological samples were
collected from all “introduced” sheep and from a representative sample of the home herd, generally
the youngest ewes. Biological samples taken were blood samples, milk, joint fluid (if there was
detectable arthritis) ocular and nasal swabs. For isolation of the pathogen we utilised selective media
and procedures as described by Nicholas and Baker (1998): milk, ocular and nasal swabs, drops of
joint fluids were cultured in broth and semi-solid media (Mycoplasma Experience, UK; Mycoplasma
broth and agar, Oxoid, USA). After 2-3 days incubation at 37°C 10% CO2, broths were plated onto
agar for colony observation. Sera were tested by ELISA method utilising commercial kit (Check-kit
Agalactiae (Pourquier) to monitor for specific antibodies against M. agalactiae.
The PCR technique (Bashiruddin, 1998; McAuliffe et al., 2003) was also used either to confirm
microbiological results or wherever possible to detect the presence of dead mycoplasmas in field
samples. The home sheep were re-vaccinated with the same dose every 4 months; the introduced
ELISA antibodies
180
160
140
120
2 times v ac c inated
100 1 time v ac c inated
80 Control
Random
60
40
20
0
ly
ay
ne
ril
h
er
y
r
r
r
08
us
Ju
07
be
be
c
be
Ap
ar
M
Ju
group was maintained/ kept with a single or double vaccination in order to monitor the length of
ob
ar
20
g
nu
m
m
em
y
Au
ct
ar
Ja
br
O
ov
ec
pt
u
Fe
br
Se
immunity and protection.

Fe
Results:
Clinical signs: after the severe clinical syndrome detected in winter 2006, no more clear cases
have been observed in the flock. Only some occasional mild conjunctivitis not always correlating to
isolation of the pathogen.
Antibody level (Elisa Kit Pourquier®- France) during the trial (median values):
Antigen excretion during the trial:
December Quarterly reports

2006 2007/2008
Group 3 4
1 2 September- December
March-May June-August
November 2007-
2007 2007
2007 February 2008
2 times vaccinated
1 time vaccinated
●
Controls
● ●▲
■■■■■■■■■■
■■■■■■ ■■■■■ ■ ●▲
Random
●●●●
( *Legenda: ■ milk ● nasal swab ▲ ocular swab)
The vaccinated introduced sheep have not shown clinical signs of contagious agalactia with
the exception of occasional mild conjunctivitis. ELISA testing showed high serological antibody
presence in both vaccinated groups (1 dose and 2 doses), but with prolonged levels of reactivity
detected only in the booster vaccinated group which has lasted over 12 months (see tables below
reported). An increase in antibody levels has been observed in the last sampling in the introduced
unvaccinated controls suggesting that the pathogen is starting to infect again exposed ewes.
No mycoplasma pathogens have been isolated from two times vaccinated sheep whereas one
time vaccinated were found positive on one occasion (nasal swab) and controls for milk, nasal and
ocular swabs in the last six months of the trial. Random sampling from the home herd have shown
lower antibody levels and occasional positive microbiological and/ or PCR results in the last three
months of the experiment.
Discussion:
Even after one year study it is difficult to draw conclusions: at the beginning of the experiment
the disease seemed under control with no clinical cases or excretion of the pathogen. Nevertheless
non-vaccinated animals have not so far shown any sign of disease, which can be attributed, in the
outbreak, to a initial very “low risk” of infection.
Only in the fourth quarterly period, the presence of the pathogen started to be identified in the
random and control groups with some isolation of Mycoplasma agalactiae from nasal, ocular swabs
and from milk samples. This data could theoretically confirm (until now) the efficacy of the inactivated
vaccine in prevention of clinical disease and limiting the excretion of the pathogen but it is possible
that after the acute syndrome the infection survives at more chronic, subclinical levels with milder
clinical behaviour and rare bacterial excretion. Even if it is too early for final answer, this field trial
gave an interesting and practical data on the efficacy of the autogenous saponin vaccine. It is our aim
to continue to monitor the outbreak for more complete data. The proven safety and low costs of these
products make them the “chosen tool” of prophylactic measures against contagious agalactia.
References:
Bashiruddin, J.B. (1998) Extraction of DNA from mycoplasmas. In: Miles R.J. and Nicholas R.A.J. (Editors)
Mycoplasma protocols, Methods in molecular biology, vol. 104, Humana Books Press, Totowa, New Jersey,
USA, pp. 141-144.
Estrada, A., Katselis, G.S., Laarveld, B., Barl, B. (2000) Isolation and evaluation of immunological adjuvant
activities of saponins from Polygala senega L. Comparative Immunology, Microbiology & Infectious
Diseases 23, 27-43.
McAuliffe, L., Ellis, R., Ayling, R.D., Nicholas, R.A.J. (2003) Differentiation of Mycoplasma species by
16S ribosomal DNA PCR and denaturing gradient gel electrophoresis fingerprint. Journal of Clinical
Microbiology. 41, 4844-4847.
Nicholas, R.A.J., Baker, S. (1998) Recovery of Mycoplasma from animals. In: Miles R.J. and Nicholas R.A.J.
(Editors) Mycoplasma protocols, Methods in molecular biology, vol. 104, Humana Books Press, Totowa,
New Jersey, USA, pp. 37-43.
CLINICAL AND HISTOPATHOLOGICAL FINDINGS IN A CASE OF
OVINE OCULAR SQUAMOUS CELL CARCINOMA (OSCC)
Galia S., Pugliese M., De Majo M., Mazzullo G.
Dipartimento di Sanità Pubblica Veterinaria – Facoltà di Medicina Veterinaria – Università di Messina

– Polo Universitario SS. Annunziata, 98168, Messina
Abstract – Ocular squamous cell carcinoma (OSCC) is one of the most important primary neoplasms of the
eye. [1] It occurs more frequently in cattle and horses than in cats and dogs [2-4] and has been reported, although
uncommonly, in buffaloes, sheep, pigs and humans beings [1,5,6]. The tumour arises and develops at the level
of the epithelial surfaces of the conjunctiva (more frequently in the nictitans) and/or cornea (more frequently at
the level of the limbus). Invasive and highly malignant tumours can progressively involve the entire ocular globe
and metastases in regional lymph nodes and in lungs can occur. [7] Aim of this paper is to report the clinical
and histopathological examinations of a case of OSCC in a sheep, observed in a Sicilian farm. Clinically, in the
right eye a voluminous mass involving the entire ocular globe was detected. Lesion showed ulcerations on the
periorbital region, eyelids’ involvement, and mucopurulent discharge. The subject underwent to necropsy and
histological examination of tissue samples showed neoplastic transformation whose appearance were consistent
with well-differentiated squamous cell carcinoma, characterized by “horn-pearls” and cords/islands of squamous
epithelial cells. The observed findings underlines the possible relationships between the poorly pigmented ocular
skin, the extensive farming system employed and the exposure of the animals to ultraviolet radiations.
Introduzione – Il carcinoma oculare a cellule squamose (OSCC), meglio conosciuto con il

termine corrente di “cancro dell’occhio”, rappresenta una delle neoplasie più comuni e più importanti
degli animali da reddito, in quanto oltremodo incide sotto il profilo economico. [8] E’ il tumore
oculare di più frequente riscontro nella specie bovina [9] e, anche se con incidenza inferiore rispetto
al bovino, nella specie ovina [10]. Recente è la segnalazione e la descrizione di due casi di OSCC in
due capre [11].
Negli ovi-caprini l’incidenza della neoplasia, i fattori predisponenti che ne influenzano
l’insorgenza e l’evoluzione eziopatogenetica del processo carcinomatoso sono identici a quelli
descritti per il bovino. [10,11]
Dal punto di vista eziologico, le cause di OSCC restano ancora da definire; tuttavia è indubbia,
almeno nella specie bovina, l’influenza svolta da alcuni fattori predisponenti (razza, pigmentazione
cutanea, predisposizione genetica, età, raggi UVA, virus, stato di nutrizione, ecc.) nell’insorgenza di
tale neoplasia. [12,13]
L’incidenza dell’OSCC è significativamente più elevata nelle razze che presentano aree di
depigmentazione intorno agli occhi, ai margini palpebrali o sulla mucosa congiuntivale si presentano
depigmentate. [14] E’ opportuno ricordare che la pigmentazione delle palpebre e del bulbo oculare
(processo che normalmente comincia subito dopo la nascita e che si completa entro il quinto anno
d’età) costituisce un fattore altamente ereditabile e strettamente correlato a particolari meccanismi
genetici. [12,13]
Nella comparsa della lesione neoplastica l’età gioca un ruolo predisponente non trascurabile; la
neoplasia, infatti, si osserva con una certa frequenza nei soggetti anziani, raramente in soggetti d’età
inferiore ai tre anni. [15]
Altri fattori predisponenti spesso chiamati in causa sono riferibili soprattutto a particolari
condizioni ambientali e d’allevamento, quali prolungata esposizione ai raggi ultravioletti solari,
aumento dell’altitudine e diminuzione della latitudine. [16,17]
Per quanto riguarda la sede d’insorgenza, circa il 75% delle forme neoplastiche origina a livello
della congiuntiva bulbare e/o della cornea, e di queste il 90% interessa il limbo e il 10% la cornea.
Nel rimanente 25% dei casi la proliferazione neoplastica coinvolge la congiuntiva palpebrale, la
membrana nittitante e la cute delle palpebre. Le lesioni limbari si localizzano elettivamente nella
porzione mediale e/o laterale, probabilmente perché queste aree risultano essere le più esposte
all’azione dei raggi ultravioletti e/o all’azione irritante svolta da eventuali corpi estranei. [2]
Per quanto concerne l’aspetto clinico, l’OSCC evolve generalmente attraverso quattro stadi:
placca, papilloma, carcinoma non invasivo e carcinoma invasivo. [7,18,19]
Dal punto di vista microscopico, utilizzando i criteri istopatologici riportati nella classificazione
dei tumori del World Health Organization (WHO), il carcinoma invasivo può essere distinto in:
- OSCC ben differenziato: il tumore assume spesso un aspetto vorticoso, con intensa eosinofilia,
presenza di perle cornee e numerosi ponti intercellulari;
- OSCC moderatamente differenziato: le cellule sono spesso raccolte in cordoni o nidi, l’aspetto
vorticoso è poco rappresentato e solo in alcuni casi è possibile riscontrare piccole quantità di materiale
eosinofilico corneificato, raro è il rilevamento di ponti intercellulari;
- OSCC scarsamente differenziato: solo poche cellule mostrano segni di cheratinizzazione e le
formazioni cordoniformi sono frequenti; le cellule sono più piccole rispetto a quelle presenti nelle
altre forme di carcinoma squamoso e il tumore tende ad invadere i tessuti connettivi dell’occhio.
[20]
La diagnosi di OSCC si basa sulla valutazione dei riferimenti anamnestici e degli aspetti clinici
e istologici sopra menzionati. [14]
Materiali e Metodi – Il nostro studio è stato condotto su una pecora di razza Valle del Belice,
di sette anni, femmina. Nella primavera del 2006 l’animale presentava, a livello della commessura
mediale dell’occhio destro, una lesione delle dimensioni di un cece, umida ed iperemica.
Fino alla successiva stagione primaverile, e nonostante l’effettuazione di tre cicli di antibiotico-
terapia con tilosina ad alto dosaggio, la lesione aveva mantenuto dimensioni ed aspetto costante, ed
il soggetto si manteneva in buone condizioni di salute.
All’inizio dell’estate 2007 la lesione cominciava a presentarsi ulcerata, infestata da larve di ditteri
e aumentava rapidamente di volume fino a raggiungere, nell’arco di quaranta giorni, un volume pari
a dieci volte quello iniziale.
A questo punto, eseguita un’accurata visita clinico-oftalmologica del soggetto ed accertata,
mediante esame citologico del materiale prelevato, la natura neoplastica della lesione, si decideva
di abbattere l’animale, ormai, tra l’altro, in avanzato stato cachettico. In sede autoptica si procedeva
all’asportazione delle strutture oculari orbitali e periorbitali interessate dal processo neoplastico e al
prelievo dei relativi linfonodi.
I campioni tissutali prelevati venivano fissati in formalina tamponata al 10%, inclusi in paraffina,
sezionati in modo da ottenere preparati di 4 µm di spessore e infine colorati con Ematossilina-Eosina
(EE).
Risultati – Alla visita clinica si evidenziava un’estesa tumefazione a livello della commessura
mediale dell’occhio destro, costituita da un’ampia area centrale crateriforme d’aspetto sarcomatoso,
di consistenza fibrosa e ricoperta da lesioni di tipo ulcerativo-crostoso, talora sanguinolente. La
proliferazione neoplastica interessava gran parte della superficie cutanea della regione periorbitale
destra, le palpebre, gli strati cutanei più profondi e le strutture muscolo-scheletriche sottostanti.
(Figura 1,2).
Per quanto concerne i risultati dell’esame istologico, l’osservazione microscopica a piccolo
ingrandimento mostrava la presenza di una proliferazione neoplastica più o meno uniforme sia
nell’aspetto che nella distribuzione. A più forte ingrandimento si apprezzava la presenza di piccole
cellule non cheratinizzate, ipercromatiche e con scarsi ponti intercellulari, tra le quali s’interponevano
rare cellule fusiformi. Le figure mitotiche erano numerose, ben evidenti e uniformemente distribuite
in tutti i campi osservati. (Figura 3).
Per l’aspetto spiccatamente anaplastico che la neoplasia mostrava all’esame istologico si emetteva
la diagnosi istologica di carcinoma squamocellulare invasivo scarsamente differenziato.

Figura 1 Figura2 Figura 3
Discussione – Il caso da noi descritto rientrerebbe, sia dal punto di vista clinico (localizzazione
e morfologia della lesione) che patologico (aspetti anatomo-istopatologici della neoformazione) tra
quelli recentemente riportati in letteratura. [10]
Il reperto neoplastico descritto risulta essere particolarmente interessante soprattutto se si tiene
conto della razza ovina coinvolta, la Valle del Belice, mai segnalata nei dati bibliografici consultati.
Tale razza rappresenta un biotipo di pecora allevato in Sicilia e riprodotto per meticciamento
selettivo in consanguineità, impiegata per l’elevata attitudine alla produzione di latte e lana, per la
conformazione dell’apparato mammario, per l’elevata prolificità, per la resistenza alla siccità estiva e
ad altri fattori climatici avversi tipicamente presenti del territorio siciliano. [21] E’ proprio la notevole
resistenza mostrata dagli esemplari appartenenti a questa razza che ne ha incoraggiato l’allevamento
allo stato brado.
Pertanto, è lecito ipotizzare che il particolare tipo di allevamento, che permetterebbe agli animali
di rimanere esposti all’azione dei raggi ultravioletti solari per tempi prolungati, unitamente alle
particolari condizioni climatiche e ambientali presenti nel territorio siciliano, conforterebbero l’ipotesi
secondo cui la prolungata esposizione ai raggi UVA rappresenta uno dei principali fattori predisponenti
chiamati in causa nell’insorgenza e nello sviluppo dell’OSCC. [16,17] Inoltre, la colorazione sbiadita
del mantello e l’ipotricosi congenita che affligge tale razza, tra l’altro recentemente descritta [22],
potrebbero rappresentare fattori patogenetici determinanti nell’insorgenza dell’OSCC.
Dal punto di vista diagnostico, una delle maggiori difficoltà che si riscontrano nella pratica
clinica è rappresentata dalla diagnosi differenziale tra la lesione iniziale, a carattere benigno, e la
forma carcinomatosa maligna. [19]
Per questo motivo è opportuno sottolineare come soltanto un’attenta e dettagliata valutazione
clinica della lesione unitamente ad un accurato esame anatomo-istopatologico della stessa, consentano
di pervenire ad un’esatta diagnosi e di valutare così quale sia il reale potenziale di sviluppo e diffusione
di tale patologia neoplastica nella specie ovina.
Bibliografia
1. Wilcock BP, 1993: The eye and ear, pp. 512-522. In: Jubb KVF, Kennedy PC, Palmer N (Eds), 1993,
Pathology of Domestic Animals, 4th Ed, San Diego, Academic Press.
2. Russel WO, Wynne ES, Loquvam GS. Studies on ocular squamous cell carcinoma (“cancer eye”). I.
Pathological Anatomy and Historical Review. Cancer 1956; 9: 1-52.
3. Fischer CA, Lindley DM, Carlton WC, Hecke HV, 2002: Tumors of the cornea and sclera, pp. 149-202. In:
Pfeiffer RL, Simons KB (Eds), 2002, Ocular Tumours in Animals and Humans, Ames, Iowa State Press.
4. Wilcock B, Rosenbraum PS, Boniuk J, 2002: Tumors of the conjunctiva, pp. 87-125. In: Pfeiffer RL,
Simons KB (Eds), 2002, Ocular Tumours in Animals and Humans, Ames, Iowa State Press.
5. Steiner PE, Bengston JS: Research and economic aspects of tumors in food-producing animals. Cancer, 4:
pp. 1113-1124, 1951.
6. Nakamura Y, Mashima Y, Kameyama K, Mukai M, et al: Detection of human papillomavirus infection in
squamous tumours of the conjunctiva and lacrimal sac by immunohistochemistry, in situ hybridisation, and
polymerase chain reaction. British Journal of Ophthalmology, 81: pp. 308-313, 1997.
7. Taylor RL, Hanks MA. Developmental changes in precursor lesions of bovine ocular carcinoma. Vet Med
Small Anim Clin 1972; 67: 669-671.
8. Heeney JL, Valli VEO: Bovine ocular squamous cell carcinoma: an epidemiological perspective. Canadian
Journal of Comparative Medicine, 49: p. 21, 1985.
9. Rebhun WC, 1995: Ocular diseases, pp. 443-468. In: Rebhun WC, 1995, Diseases of Dairy Cattle,
Philadelphia, Lippincott Williams & Wilkins.
10. Mendez A, Perez J, Ruiz-Villamor E, Garcia R, Martin MP, Mozos E: Clinicopathological study of an
outbreak of squamous cell carcinoma in sheep. Veterinary Record, 141 (23): pp. 597-600, 1997.
11. Marà M, Di Guardo G, Venuti A, Marruchella G, et al: Spontaneous ocular squamous cell carcinoma in
twin goats: pathological and biomolecular studies. Journal of Comparative Pathology, 132: pp. 96-100,
2005.
12. Anderson DE: Genetic aspects of cancer with special reference to cancer of the eye in the bovine. Ann N Y
Acad Sci, 108: pp. 948-962, 1963.
13. Anderson DE, Chambers D: Genetic aspects of cancer eye in cattle. Misc Publ Okla Agric Exp Sta No MP,
48: p. 28, 1957.
14. Moore CP, 1990: Diseases of the Eye, pp. 1197-1257. In: Smith BP, 1990, Large Animal Internal Medicine,
St. Louis, C.V. Mosby Company.
15. Blackwell RL, Anderson DE, Knox JH: Age incidence and heritability of cancer eye in Hereford cattle.
Journal of Animal Science, 15: pp. 943-951, 1956.
16. Anderson DE, Skinner PE: Studies on bovine ocular squamous carcinoma (cancer eye). XI. Effects of
sunlights. Journal of Animal Science, 20: pp. 474-477, 1961.
17. Anderson DE, Badzioch M: Association between solar radiation and ocular squamous cell carcinoma in
cattle. American Journal of Veterinary Research, 52: pp. 784-788, 1991.
18. Pulley LT, Stannard AA, 1990: Tumors of the Skin and Soft Tissue, pp.23-87. In: Moulton JE (Ed), 1990,
Tumors in Domestic Animals, 3rd Ed, Berkeley, University of California Press.
19. Monlux AW, Anderson WA, Davis CL: The diagnosis of squamous cell carcinoma of the eye (“cancer eye”)
in cattle. American Journal of Veterinary Research, 18: pp. 5-34, 1957.
20. Kircher CH, Garner FM, Robinson FR: X: tumours of the eye and adnexa. Bulletin of the World Health
Organisation, 50: p. 135, 1974.
21. Giaccone P, Portolano B, Todaro M: La pecora “Valle del Belice”. Arti Grafiche Provideo, pp. 15-20,
1988.
22. Mazzullo G, Fasciana G, Marotta S, Marino F, Macrì B: Congenital hypotrichosis in Valle del Belice sheep:
gross and histopathological study of skin lesions. Abstracts 24th ESVP Meeting, Munich, Germany, p. 145,
2007.
Sheep of the Island of Pag: lambing frequency and lamb
birth weight during winter-spring season
Paška ovca: učestalost janjenja i porodna masa janjadi

tijekom zimsko-proljetne sezone
V. Sušić1, A. Ekert Kabalin1, I. Štoković1, Ž. Pavičić2, B. Mioč3, V. Pavić3, Z. Barać4

1
Zavod za stočarstvo, Veterinarski fakultet, Sveučilište u Zagrebu, Hrvatska
2
Zavod za animalnu higijenu, okoliš i etologiju, Veterinarski fakultet, Sveučilište u Zagrebu, Hrvatska
3
Zavod za specijalno stočarstvo, Agronomski fakultet, Sveučilište u Zagrebu, Hrvatska
4
Hrvatski stočarski centar, Zagreb, Hrvatska
Sažetak
Paška ovca je hrvatska autohtona pasmina. Glavni proizvodni cilj uzgoja paške ovce je mlijeko koje se
prerađuje u cijenjeni tvrdi sir. Meso janjadi je visoke kvalitete i kulinarski specijalitet. Kao u slučaju većine ovaca
u Hrvatskoj, paška ovca se janji sezonski, tijekom zimskih i proljetnih mjeseci. U istraživanju je analizirano
4005 janjenja tijekom četverogodišnjeg razdoblja. U svim godinama janjenja su započela tijekom studenog
i završila slijedeće godinje u svibnju. Najveća dnevna učestalost janjenja bila je tijekom prosinca i siječnja.
Prosječna porodna masa janjadi iznosila je 3,28 ± 0,58 uz statistički značajne (p<0,01) varijacije ovisne o spolu
(muška janjad 3,32 ± 0,58 i ženska janjad 3,25 ± 0,57). Općenito, janjad ojanjena tijekom rane zime imala je
veću porodnu masu u usporedbi s janjadi ojanjenom tijekom kasne zime ili proljeća. Utvrđeni rezultati koristiti
će se za karakterizaciju reprodukcijskih obilježja Paške ovce.
Abstract
Sheep of the Island of Pag is Croatian autochthonous breed. It’s main production goal is milk which is
processed into the well known hard cheese. Lamb meat is, because of high quality, culinary speciality. Like
majority of sheep in Croatia, Sheep of the Island of Pag has seasonal lambing during winter and spring months.
In this investigation we analyzed 4005 lambings during 4 years period. In all years lambings started in November
and finished next year in May. The maximal daily frequency of lambings was in December and January. Average
lamb birth weight was 3.28 ± 0.58, but it varied depending of lamb gender (3.32 ± 0.58 for males and 3.25 ± 0.57
for females, statistically significant difference at level P<0.01). In general, lambs born during early winter days
had higher birth weight in comparison to lambs born in late winter and spring months. The results will used for
the characterisation of reproduction traits of Sheep of the Island Pag.
Uvod
Paška ovca je hrvatska autohtona pasmina. Procijenjena brojnost ove pasmine je oko 30.000
grla, što je čini najbrojnijom otočkom populacijom ovaca u Hrvatskoj. Broj uzgojno valjanih ovaca,
obuhvaćenih uzgojno-selekcijskim radom, tijekom vremenskog razdoblja od 2004. do 2006. godine
prikazan je na tablici 1.
Tablica 1 – Pasminska struktura uzgojno valjanih paških ovaca od 2004 do 2006. g (Izvor: HSC, 2007)
Table 1 - Breed structure of Sheep of the Island of Pag under selection control from 2004 to 2006 (Source:
HSC, 2007)
Broj šilježica
Godina / Broj ovaca / Broj ovnova / Ukupno /
/ Number of
Year Number of ewes Number of rams Total number
yearlings
2004. 1207 170 41 1418
2005. 1466 186 43 1695
2006. 1944 411 88 2443
Na otoku Pagu uzgajao se otočni tip pramenke koja je bila osnova za stvaranje izvorne paške
ovce. Mijenjanjem proizvodnih ciljeva u prošlosti mijenjale su se i pasmine kojima se pokušavala
oplemeniti paška ovca. Pretpostavlja se da je uz oplemenjivanje pramenke ovnovima pasmine
Negretti i Bergamo, na formiranje paške ovce znatno utjecala i talijanska pasmina Pentile de Puglia
(Pavić i sur., 2005).
Osnovni proizvodni cilj uzgajivača paške ovce je mlijeko koje otkupljuju tri veće sirane na otoku
Pagu, ili se mlijeko unutar gospodarstava prerađuje u poznati i cijenjeni punomasni tvrdi paški sir.
Posebno mjesto u ponudi mesa na hrvatskom tržištu predstavlja i paška janjetina.
Janjenje paških ovaca, kao i većine ovaca drugih pasmina, događa se sezonski tijekom zimskih
i proljetnih mjeseci. Cilj rada je utvrditi dnevnu učestalost janjenja paških ovaca tijekom sezone, te
postoje li razlike u porodnoj masi janjadi ovisno o razdoblju unutar sezone.
Materijal i metode
Podaci o janjenju uzgojno valjanih paških ovaca sustavno su praćeni u razdoblju od 20. 10. 2004.
do 9.6.2007., te analizirani statističkim računalnim programom Statistica 7.1 (StatSoft Inc., 2005).
Prikupljeni podaci obrađeni su uobičajenim postupcima deskriptivne statistike. Analiza varijance
(uz Unequal n HSD test za post hoc analizu) korištena je da bismo usporedili porodnu masu janjadi
ojanjene tijekom pojedinog mjeseca i godine. Značajnost razlika u tjelesnoj masi pri porodu s
obzirom na spol utvrđena je Studentovim T-testom.
Sezonalnost janjenja tijekom promatranog razdoblja prikazana je na grafu 1. U tablici 2 navedene
su prosječne porodne mase janjadi u pojedinoj godini, kao i prosječna porodna masa muške i ženske
janjadi dok je na tablici 3 i grafu 2 prikazano kretanje porodne mase ovisno o mjesecu janjenja.
240
220
200
180
160
140
120
100
80
60
40
Number of lambed ewes
20
0
Jul-2005
Jul-2006
Apr-2005
Apr-2006
Apr-2007
Oct-2004
Jan-2005
Jun-2005
Oct-2005
Jan-2006
Jun-2006
Oct-2006
Jan-2007
Feb-2005
Mar-2005
Aug-2005
Sep-2005
Feb-2006
Mar-2006
Aug-2006
Sep-2006
Feb-2007
Mar-2007
Nov-2004
Dec-2004
Nov-2005
Dec-2005
Nov-2006
Dec-2006
May-2005
May-2006
May-2007
M o n th a n d ye a r o f la m b in g
Graf 1 – Učestalost janjenja u razdoblju od 20. 10. 2004. do 9.6.2007.

Graph 1 - Lambing frequency in period from 20. October 2004. till 9. June 2007.
Tablica 2 - Prosječna porodna masa janjadi uzgojno valjanih paških ovaca

Table 2 - Average lamb birth mass of Sheep of the Island of Pag under selection control
Prosječna porodna masa, kg (arit. sred. ± std. dev.)

Broj janjadi Average birth mass, kg (Mean ± SD)
/ Number of
lambs Sva janjad / All lambs Muški / Male Ženski / Female
3918 3,28 ± 0,58 3,32 ± 0,58 3,25a ± 0,57

a
statistički značajna razlika (p<0,01) u odnosu na porodnu masu muške janjadi / statistically significant difference
(P<0.01) according to the birth mass of male lambs
Tablica 3 – Kretanje prosječne mase janjadi ovisno o mjesecu janjenja
Table 3 - Kinetics of average lamb birth weight depending on month of lambing
Godina / Year
2004 2005 2006 2007
arit. std. arit. std. arit. std. arit. std.
Mjesec sred. dev. sred. dev. sred. dev. sred. dev.
/ Month n* Mean ± SD n* Mean ± SD n* Mean ± SD n* Mean ± SD
I ± 220 3,40 ± 0,52 308 3,33 ± 0,59 420 3,19 ± 0,51
II ± 51 3,18 ± 0,45 63 2,86 ± 0,48 54 2,92 ± 0,55
III ± 45 2,86 ± 0,56 50 2,95 ± 0,51 16 2,50 ± 0,67
IV ± 33 2,62 ± 0,39 78 2,82 ± 0,41 5 2,70 ± 0,51
V ± 7 2,31 ± 0,27 28 2,48 ± 0,37 24 2,52 ± 0,32
VI ± 1 2,40 ± 2 2,15 ± 0,07 3 2,43 ± 0,42
VII ± ± ± ±
VIII ± ± ± ±
IX ± ± 1 3,50 ± ±
X 1 3,50 ± 2 3,30 ± 0,28 2 3,60 ± 0,57 ±
XI 117 3,59 ± 0,65 60 3,86 ± 0,46 40 3,23 ± 0,64 ±
XII 455 3,49 ± 0,52 726 3,34 ± 0,56 1104 3,28 ± 0,54 ±
* broj janjadi ojanjene po pojedinom mjesecu manji je od broja janjenja – iz statističke obrade porodne mase
izuzeta je ona janjad kod koje nije zabilježena porodna masa / number of lambs born in every month is smaller
than number of lambing - lambs without noted birth mass are excluded from statistical analysis
5,0
4,5
4,0
3,5
3,0
2,5
2,0
1,5
Lamb birth weight (Kg)
1,0
Porodna masa janjadi (kg) /
0,5
0,0
Apr-2005
Apr-2006
Apr-2007
Oct-2004
Jan-2005
Jun-2005
Oct-2005
Jan-2006
Jun-2006
Oct-2006
Jan-2007
Jun-2007
Feb-2005
Mar-2005
Feb-2006
Mar-2006
Sep-2006
Feb-2007
Mar-2007
Nov-2004
Dec-2004
Nov-2005
Dec-2005
Nov-2006
Dec-2006
May-2005
May-2006
May-2007
M je se c - g o d in a / M o n th - ye a r
V ertic al bars denote 0,95 c onf idenc e interv als
Graph 2 - Kinetics of average lamb birth weight depending on month of lambing (during period from 20.
October 2004. till 9. July 2007.)
Graf 2 – Kretanje prosječne porodne mase zavisno o mjesecu janjenja (u razdoblju od 20. 10. 2004. do
9.6.2007.)
Tijekom promatranih godina prva janjenja na početku sezone bila su zabilježena krajem listopada,
izuzev u 2006. godini krajem rujna. Pri tome početkom i završetkom sezone janjenja smatrali smo
mjesece u kojima je učestalost janjenja bila veća od pet. Iz grafa 1 i tablice 3 uočljivo je da se najveći
broj ovaca (80% i više) ojanjio tijekom prosinca i siječnja.
Prosječna porodna masa janjadi iznosila je 3,28± 0,58 uz statistički značajne (p<0,01) varijacije
ovisne o spolu (muška janjad 3, 32 ± 0,58 i ženska janjad 3,25 ± 0,57). Općenito, janjad ojanjena
tijekom rane zime imala je veću porodnu masu u usporedbi s janjadi ojanjenom tijekom kasne zime
ili proljeća.
Utvrđeni rezultati koristiti će se za karakterizaciju reprodukcijskih obilježja Paške ovce.
Literatura
1. Ekert Kabalin, Anamaria, I. Štoković (2007): Očuvanje hrvatskih izvornih pasmina. Zbornik 2. kongresa
studenata veterinarske medicine, 13.-16. lipanj 2007, Zagreb.
2. FAO (2007): The State of the World’s Animal Genetic Resources for Food and Agriculture, edited by
Barbara Rischkowsky & Dafydd Pilling. Rome.
3. HSC – HRVATSKI STOČARSKI CENTAR (2007): Godišnje izvješće za 2006. godinu, Zagreb.
4. MZOPU (Ministarstvo zaštite okoliša, prostornog uređenja i graditeljstva) (2007): Internet stranica (http://
www.mzopu.hr/doc/06Poljoprivreda.pdf).
5. Pavić, Vesna, B. Mioč, Z. Barać, I. Vnučec, V. Sušić, N. Antunac, Dubravka Samardžija (2005): Vanjština
paške ovce. Stočarstvo 59 (2): 83-90.
6. Sušić, V. (2006): Utjecaj sezone pripusta na plodnost ovaca. Ovčarsko kozarski list 3, 14 - 16.
7. Sušić, V., A. Ekert Kabalin, I. Štoković, I. Karadjole, T. Balenović (2006): Hrvatske izvorne pasmine
domaćih životinja. IV. simpozij poljoprivrede, veterinarstva, šumarstva i biotehnologije. Zenica, Bosna i
Hercegovina. (pozvano predavanje).
8. Sušić, V., A. Ekert Kabalin, I. Karadjole, T. Balenović, I. Štoković, Igor (2006): Paška ovca. IV. simpozij
poljoprivrede, veterinarstva, šumarstva i biotehnologije. Zenica, Bosna i Hercegovina. (poster).
9. Sušić, V., V. Pavić, B. Mioč, I. Štoković, A. Ekert Kabalin (2005): Seasonal variations in lamb birth weight
and mortality. Veterinarski arhiv 75 (5), 375-381.
10. Sušić, V., T. Balenović, I. Martinić, D. Katica, I. Štoković, A. Ekert Kabalin (2001): Hrvatske autohtone
pasmine domaćih životinja. Zbornik - Proceedings “Veterinarski dani 2001.”, Zagreb, 177-186.
11. Sušić, V., K. Mikulec, I. Karadjole, A. Tomašković, D. Križanović, I. Štoković (2000): Effect of milk yield
on seasonal oestrual activity in sheep. Veterinarski arhiv 70 (Suppl.), S231-S237.
Prevalence and aethiology of cow mastitis in small
dairy holdings in Croatia
Prevalencija i etiologija mastitisa krava u malim

obiteljskim gospodarstvima
Benić, M1.; Ž. Cvetnić1, M. Lojkić1, B. Habrun1; G. Kompes1; M. Cergolj2, N. Maćešić2
1Hrvatski veterinarski institut, Savska c. 143, 10 000 Zagreb

Veterinarski fakultet, Klinika za porodništvo i reprodukciju, Heinzelova 55
2
SUMMARY
In spite of improved milking practices and widely applicated preventive measures against intramammary
infections, mastitis is still one of the most commonly observed problems in dairy practice. The aim of the
research was to obtain the data concerning the spread of intramammary infections at herd level at point of time
and to compare it with similar investigations in order to improve preventive measures against new intramammary
infections. Therefore during a cross-sectional field investigation 304 cows from 47 holdings were examined.
Average number of lactating cows per holding at the time of visitation was six (from three to 12). Samples were
taken from individual quarters, tested by California mastitis test and microbiologicaly examined in laboratory.
Microbiological examination was performed on esculin blood agar. Isolated bacteria were subcultivated on
differential and selective media. Ststistical analysis was performed using Stata 6.0 statistical package (STATA
Corp.). At least one CMT positive quarter was found in 174 (57%) of cows. Percent of CMT positive quarters
varied from 0 to 60% per holding while 26% of all examined quarters expressed elevated somatic cells.
Percent of CMT positive quarters was not associated with herd size (p›0.05). However rear quarters were more
frequently affected by elevated cell content than front quarters (p‹0,001). Mastitis pathogens were isolated from
264 quarter sample (23.2%). Contagious pathogens dominated among isolated bacteria, especially S. aureus
which was isolated from 138 (11.3%) of all examined quarter samples. Streptococcus agalactiae was isolated
from 21 (1.7%) samples. Environmental bacteria were isolated from 105 (8.6%) of examined quarter samples.
Agreement between CMT and microbiological examination was moderate (Kappa = 0.6).Since the contagious
pathogens dominated among isolated bacteria, results suggest that improvement in udder health status can be
made by proper hygienic treatment of udder at milking time. Zero percent prevalence of elevated SCC and
negative microbiological findings indicate that small dairy holdings are able to maintain low level prevalence
of intramammary infections.
SAŽETAK
Usprkos napretku u tehnologiji mužnje i široko primjenjivanim preventivnim mjerama za sprečavanje
intramamrnih infekcija, mastitis još uvijek predstavlja jedan od najčešćih problema s kojim se susreće primarna
proizvodnja mlijeka. Cilj ovog istraživanja bio je prikupiti podatke o proširenosti intramamarnih infekcija u
malim stadima muznih krava i usporediti ih s rezultatima sličnih istraživanja kako bi se unaprijedile preventivne
mjere protiv novih infekcija mliječne žlijezde.Provedeno terensko istraživanje presjeka populacije obuhvatilo je
304 muzne krave kod 47 vlasnika. Prosječni broj krava u laktaciji u stadu kretao se od tri do 12 (prosječno šest).
Uzorci su uzeti iz svih četvrti krava u laktaciji, testirani mastitis testom i mikrobiološki pretraženi u laboratoriju.
Mikrobiološka pretraga provedena je na krvnom agaru s dodatkom eskulina, a izolirane bakterije subkultivirane
su na selektivnim i diferencijalnim podlogama. Statistička obrada provedena je korištenjem statističkog
programa Stata 6.0 (STATA Corp.).Barem jedna četvrt s povišenim brojem somatskih stanica utvrđena je u 174
krave (57%). Postotak četvrti s povećanim brojem somatskih stanica u stadima se kretao u rasponu od 0 do
60%, odnosno 26% svih pretraženih četvrti imalo je u manjem ili većem stupnju izraženu pozitivnu reakciju.
Prevalencija mastitis test pozitivnih četvrti nije statistički povezana s veličinom stada (p›0.05). Međutim, stražnje
četvrti češće su zahvaćene povećanjem broja somatskih stanica nego prednje, a razlika je statistički značajna
(p<0.001). Uzročnici mastitisa izdvojeni su iz 264 uzorka pojedinačnih četvrti vimena (23.2%). U zastupljenosti
prednjačili su kontagiozni uzročnici, pogotovo Staphylococcus aureus koji je izdvojen iz 138 uzoraka (11.3%).
Streptococcus agalactiae izdvojen je iz 21 (1.7%) uzorka. Uvjetno patogeni uzročnici iz okoliša izdvojeni su
iz 105 (8.6%) uzoraka pojedinačnih četvrti. odudarnost rezultata mastitis testa i mikrobiološke pretrage bila je
umjerena (Kappa =0.6).Budući da među izdvojenim uzročnicima prevladavaju kontagiozni uzročnici, rezultati
nagovješćuju da je smanjenje učestalosti infekcija mliječne žlijezde moguće poboljšanjem higijene mužnje.
Činjenica da u nekim stadima nije bilo ni citološki ni mikrobiološki pozitivnih četvrti upućuje na zaključak da
je mala stada moguće držati u stanju slobodnom od mastitisa.
UVOD
Usprkos brojnim profilaktičkim mjerama u suzbijanju mastitisa, infekcije vimena i dalje su jedan
od glavnih uzroka izravnih i neizravnih šteta u mliječnom govedarstvu. U nastanku i održavanju
infekcija vimena ulogu igraju životinja, okoliš i mikrorganizmi kao neposredni uzročnici infekcija.
Činjenica da se promjene u bilo kojem od ova tri segmenta mogu odraziti na pojavnost mastitisa
razlog je potrebi za opsežnim i redovitim praćenjem sastavnica spomenutih elemenata, od nutritivnog
i fiziološkog stanja same životinje, higijene muzača i muzačke opreme do provjere učestalosti i
zastupljenosti pojedinih uzročnika mastitisa na farmi i njihovoj osjetljivosti prema antibioticima.
Proizvodnja mlijeka u Hrvatskoj doživjela je nekoliko značajnih novosti u posljednjih desetak
godina. Te promjene uvelike su oblikovale i još uvijek utječu na pravac razvoja mliječnog govedarstva.
Treba spomenuti stupanje na snagu Pravilnika o kakvoći svježeg sirovog mlijeka koji je obvezao
cjelokupnu mljekarsku industriju na uvođenje i poštivanje higijenskih standarda kroz formiranje
otkupne cijene mlijeka. Pored ovog i drugi zakonski akti uvjetuju preobrazbu mliječnog govedarstva
od malih držatelja prema tržišno orijentiranim proizvođačima mlijeka s većim brojem krava. Usprkos
tome još uvijek veliki udio proizvodnje mlijeka otpada na držatelje s manjim brojem krava.
Neizravne dijagnostičke metode za otkrivanje infekcija vimena temelje se na brojenju
somatskih stanica, mjerenju električne provodljivosti mlijeka ili aktivnosti nekih enzima u sekretu
mliječne žlijezde. Određivanje broja somatskih stanica obavlja se pomoću uređaja za brojenje ili
polukvantitativno mastitis testom. Pouzdana dijagnoza mastitisa postavlja se mikrobiološkom
pretragom uzoraka sekreta sumnjivih četvrti.
MATERIJAL I METODE
U istraživanje je bilo uključeno 47 proizvođača mlijeka s područja Karlovačke i Zagrebačke
županije. Prema dizajnu istraživanje je cross-sectional tipa pri čemu su ukupno pretražene 304 muzne
krave u laktaciji u jednokratnom obilasku. Uzorci su uzeti prije redovite mužnje na sljedeći način:
prvih nekoliko mlazova mlijeka izmuzli smo u posebnu posudu. U pliticu za testiranje namuzli smo
oko 2 ml mlijeka iz svake četvrti. U pliticu smo potom dodali oko 2 ml mastitis reagensa. Kružnim
pokretima izmiješali smo smjesu mlijeka i reagensa i prosudili reakciju. Nakon toga vrhovi sisa
temeljito su izbrisani vatom namočenom u 70%-tni alkohol. S jednim do dva mlaza iz svake četvrti
napunili smo prethodno označene sterilne epruvete. Uzorci su pohranjeni na led i transportirani u
laboratorij. U laboratoriju su do početka pretrage čuvani na +4 ºC, a pretraga je započeta najkasnije
12 sati nakon uzimanja uzoraka. Uzorci su zagrijani na sobnu temperaturu i nacijepljeni na podlogu
eskulin-krvni agar. Nacijepljene podloge inkubirane pri 37 ºC tijekom 18-24 sata. Porasle kolonije
precijepljene su na diferencijalne i selektivne podloge: Baird-Parker agar, podlogu s trostrukim
šećerom (TSI), TKT agar, MacConkey agar radi pouzdanije identifikacije. Izdvojeni stafilokoki
podvrgnuti su koagulaza testu.
Dobivene podatke statistički smo obradili u programu Stata 6. 0 (Stata Corp., USA).
REZULTATI
Opis populacije. Broj krava u laktaciji u trenutku posjete iznosio je prosješno šest (od tri do 12).
Pasminski sastav čine uglavnom simentalac i crnošaro govedo. Životinje se drže na vezu u objektima
zatvorenog tipa s ili bez ispusta. Mužnja se obavlja u staji.
Tablica 1. Razdioba populacije i udio četvrti s povećanim brojem somatskih stanica
Broj krava Broj držatelja Ukupno krava CMT pozitivnih četvrti (%)
Prosjek Prednje stražnje
3 3 9 11.1 0 11.1
4 6 24 29.2 11.5 17.7
5 10 50 27.0 12.5 14.5
6 5 30 17.5 6.7 10.8
7 11 77 23.7 8.8 14.9
8 5 40 33.8 14.4 19.4
9 2 18 22.2 8.3 13.9
10 1 10 45 20 25
11 2 22 45.5 22.7 22.7
12 2 24 22.9 7.3 15.6
Ukupno 47 304 26 10.5 15.5
Tablica 2. Rezultati mikrobioloških pretraga
Mikrobiološki nalaz Broj četvrti %
Negativan 933 76.7
S. aureus 138 11.3
Streptococcus agalactiae 21 1.7
Streptococcus dysgalactiae 8 0.7
Ostali streptokoki i enterokoki 69 5.7
E. coli 11 0.9
Pseudomonas spp 7 0.6
Kvasci 10 0.8
Bakteriostatik 7 0.6
Atrofija četvrti 12 1
UKUPNO 1216 100
Tablica 3. Podudarnost mastitis testa s rezultatima mikrobiološke pretrage
Rezultat mikrobiološke pretrage

UKUPNO
Pozitivan Negativan
Mastitis test Pozitivan 206 123 329
Negativan 58 810 868
UKUPNO 264 933 1197*
*atrofične četvrti i uzorci s antibioticima nisu uzeti u obzir; Kappa = 0.6
RASPRAVA
Proizvodnju mlijeka u Republici Hrvatskoj u zadnjih petnaestak godina zahvatilo je niz promjena
koje su imale za posljedicu nestanak velikih farmi u državnom vlasništvu, smanjenje broja malih
držatelja krava, ali u isto vrijeme i pojavu novih farmi s većim brojem muznih krava u privatnom
vlasništvu. Osim toga tijekom procesa prilagodbe smjernicama Europske unije donesen je veći
broj pravnih akata koji izravno ili neizravno reguliraju proizvodnju i stavljanje u promet mlijeka
i mliječnih proizvoda. Svakako treba spomenuti Pravilnik o kakvoći svježeg sirovog mlijeka (NN
102/00) koji omogućuje razvrstavanje mlijeka u razrede kakvoće uzimajući u obzir osim kemijskog
sastava i broj somatskih stanica i broj mikroorganizama. Dok je broj mikroorganizama često
posljedica sekundarne kontaminacije mlijeka, broj somatskih stanica najčešće je odraz zdravstvenog
stanja mliječne žlijezde.
Udio četvrti s povećanim brojem somatskih stanica u odnosu na veličinu stada prikazan je u
tablici 1. Premda postotak četvrti zahvaćenih povećanjem broja somatskih stanica četvrti varira (11-
45%) razlike nisu statistički značajne (Kruskall-Wallis p= 0.3). U usporedbi s ranijim istraživanjima
postotak mastitis test pozitivnih četvrti je smanjen što je očekivano s obzirom na stupanje na snagu
Pravilnika o kakvoći svježeg sirovog mlijeka.
Stražnje četvrti u većem su postotku reagirale pozitivno mastitis testom nego prednje, vjerojatno
zbog veće izloženosti podražajima. Uočena razlika statistički je značajna (p<0.001).
Iz tablice 2 razvidno je da među uzročnicima mastitisa krava u malim uzgojima dominiraju
kontagiozni uzročnici, poglavito S.aureus, slično kao u drugim istraživanjima u svijetu. U usporedbi
s ranijim istraživanjima u Hrvatskoj, učestalost kontagioznih uzročnika je smanjena, ali je povećana
učestalost uvjetno patogenih uzročnika iz okoliša. No s obzirom na smanjen udio četvrti pozitivnih
mastitis testom, čini se da se inficirane četvrti ranije otkrivaju i liječe.
Vrijednost mastitis testa kao dijagnostičke metode u otkrivanju upala mliječne žlijezde dokazana
je u brojnim radovima. Budući da je razina detekcije somatskih stanica niža od vršnih vrijednosti
broja somatskih stanica propisanih Pravilnikom o kakvoći svježeg sirovog mlijeka preporučljivo je
izvoditi ga u redovitim vremenskim intervalima i za svaku muznu životinju voditi evidenciju. Na taj
način moguće je uočiti pojavu infekcije prije nego li ista ugrozi kakvoću proizvedenog mlijeka.
LITERATURA
Topolko, S., M. Benić (1997): Aktualni problemi i epizootiološko stanje subkliničkih mastitisa u minifarmskoj
proizvodnji mlijeka. Praxis veterinaria, 45 (1-2), 69-77
Pravilnik o kakvoći svježeg sirovog mlijeka (Narodne novine: 102/2000)
Radostits, O.M., D.C. Blood, C.C. Gay: Veterinary Medicine, Eight edition, London, Bailliere Tindal, 1994
Schalm, O.W., E.J. Carrol, N.C. Jain (1971): Bovine mastitis. Lea & Febiger, Philadelphia
National Mastitis Council: Laboratory Handbook on Bovine Mastitis. National Mastitis Council, Inc. 2820
Madison. USA, 1999
Case Report of anaplasmosis on a sheep farm in the
Nebrodi Mountain range (Sicily – Italy - Europe)
Di Marco Vincenzo, Russo Miriam, Aronica Vincenzo, Fiasconaro Michele, Scimeca

Salvatore, Alongi Angelina, Torina Alessandra
Istituto Zooprofilattico Sperimentale della Sicilia
Species of the genus Anaplasma (Rickettsiales: Anaplasmataceae), are obligate intracellular

aetiological agents of tick-borne diseases of mammalian hosts (Dumler et al., 2001) and includes
the causative agents of anaplasmosis of ruminants. The disease in sheep and goats is generally
symptom free and the etiological agent in most cases is Anaplasma ovis. This genus also includes A.
phagocytophilum (previously recognized as E. equi, E. phagocytophila and the human granulocytic
ehrlichiosis (HGE) agent), which infects a wide range of hosts including humans and wild and
domesticated animals, and causes human, canine and equine granulocytic anaplasmosis and tick
fever of ruminants (TBF) (Dumler et al., 2001). A.ovis is transmitted by Rhipicephalus bursa and
most likely other ticks (Friedhoff, 1997). Mammalian or tick hosts with persistent infection serve
as reservoirs of the pathogen in nature (Kocan et al., 2004). Often clinical findings are absent or
scarce. Although anaplasmosis is more frequently associated with haemolytic anaemia in goats, A.
ovis can also cause disease in sheep, particularly in animals exposed to stress or other predisposing
factors (Splitter et al,1956 and Friedhoff, 1997). TBF is rarely fatal, unless there are complications
from other infections. In November 2006, on a sheep and goat farm (300 goats and 220 sheep) in
the province of Messina (Sicily – Italy), 20 sheep deaths were reported. A further 19 animals were
found to be weak, with oedema under the lower jaw and top of the chest, reduced sensory perception,
anorexia, fever and extensive cutaneous tick infestation. The pathological findings were liver damage,
a slightly increased and “soft” spleen (which contained serous and haemorrhagic effusions). There
was evidence of multiple parasitism: tapeworm, roundworm, Lancet liver fluke and Echinococcosis.
All the animals in the flock were poorly nourished. The purpose of this document is to describe this
epidemic focus of sheep anaplasmosis.

Samples were taken from the livestock farm as follows: whole blood and serum samples were
taken from 155 sheep and 46 goats and 71 ticks were collected. The blood was collected in test tubes
without anticoagulant and in test tubes with EDTA kept at a temperature of 4° C until they reached
the laboratory. The ticks were kept in 70% ethanol at room temperature. Tests were carried out on
the samples according to the following protocols:1) Identification of the ticks according to Manilla’s
morphological keys; 2) Whole blood: DNA extraction and subsequent specific PCR; full blood count
with the Heco-vet SE device. The 95% confidence intervals for preponderance were calculated using
the WinEpiscope 2.0 programme; 3) Serum samples: serologic tests: (cELISA, VMRD, Pullman, WA
99163). An antibody examination for A. phagocytophilum was carried out by slide for IFI (Fuller
Laboratories, Fullerton, CA, USA ) and FITC-conjugated Anti goat IgG (Sigma, St. Louis, MO,
USA) and FITC-conjugated Anti Sheep IgG (Sigma, St. Louis, MO, USA).
Results
The blood tests on all sheep samples showed an average level of GR of 6.19 (DS=2.4), GB of
12.97(DS=4.0) haemoglobin 7.9(DS=2.44), hematocrit 21.3(DS=8.4). On the other hand, in the 19
animals with symptoms the average GR was 4.18(ds=1.71), the GB 12.37(ds=2.25),the haemoglobin
4.91(ds=1.86), hematocrit 14.80(ds=5.57). The prevalence of Anaplasma in sheep serum was 98%
(CI 95%= 96.80-99.20%), whilst for Anaplasma phagocytophilum the prevalence was 16.7% (CI
95%=13.51-19.89). In goats the prevalence of Anaplasma was 87% (CI 95%= 78.06-95.94), whilst
for Anaplasma phagocytophilum the prevalence was 78.2%(CI95%=67.22-89.18) On the same
livestock farm, the prevalence of a positive PCR test for Anaplasma sp was for sheep 38%(CI
95%= 33.85-42.15), for Anaplasma ovis it was 20%(CI 95%=16.58-23.42), and for Anaplasma
phagocytophilum 12.9%CI 95% = 10.03-15.77). For the goats on the other hand we found the
following PCRs prevalences: Anaplasma sp. 58.6%(CI 95%= 45.5-71.7), Anaplasma ovis 52.1%(CI
95%=38.82-65.38), Anaplasma phagocytophilum. =0%. 17 ticks belonged to Riphicephalus spp, 32
to Hemaphisalis spp and 22 to Dermacentor spp.
Conclusions
Analysis of the observed haematological parameters, serum prevalence and PCR positivity
confirm the clinical diagnosis of an anaplasmosis focus. The blood tests confirm that all the animals
tested had severe anaemia and it was more severe in the animals showing symptoms when samples
were taken. The interpretation of diagnostic tests leads us to think that the range of disease symptoms
in this livestock farm supports the theory of Anaplasma sp. infection. The high preponderance of
serum abnormality indicates that sheep anaplasmosis is endemic on the livestock farm and rife
infection is supported by the high positivity found with the PCR. Unlike the situation in cattle
infected with A.marginale (who stay lifetime carriers of the infection in a latent form, with fresh
clinical outbreaks whenever the animal is stressed or sick), there is not similar latent state for A. ovis
or for A. phagocytophilum. Finding parasites in the blood of sheep and goats, therefore, indicates
active infection. The severe manifestation of disease in these animals may have been caused by
multiple parasitism and by their generally poor state of health. All the ticks examined belong to the
species which, according to numerous bibliographical references, are considered to be Anaplasma sp.
vectors. Last but not least, it is interesting to look at the differences between sheep and goats. Goats
have always been thought to be more resistant to infection than sheep – this is not only linked to
their genetic make-up, but also due to the fact that goats are rarely treated for parasites and therefore
they undergo natural selection. During the epidemic the goats examined, although they were less in
number than the sheep, gave an interesting outcome. More than 50% were PCR positive for A. ovis
and this result would lead us to believe that the goats are asymptomatic reservoirs for the pathogen
in the area.
Theileria equi in ovine: a cases report
Caracappa Santo, Torina Alessandra, Nicosia Silviane, D’Agostino Rosalia, Russo

Miriam, Alongi Angelina, Di Marco Vincenzo
Istituto Zooprofilattico Sperimentale della Sicilia, via G. Marinuzzi 3, 90129 Palermo.
Abstract
Sicilian kind of breeding, especially for small ruminant is characterized by mixed animal species. Ticks
can bite in their life cycle different host that can became asinthomatic reservoir of the TBD pathogens. In
the present work we describe the accidental discovery of Theileria spp different from to most common ovine
Theileria (B.ovis, T.hirci, T.motasi) in sheep and we intend to demonstrate that piroplasmid infections may
reveal unexpected (but probably not infrequent) in unusual hosts.
Introduction
Piroplasms are tick-transmitted parasitic protozoa divided into the genera Theileria and Babesia.
They are the causative agents of theileriosis and babesiosis, respectively. Piroplasms of both genera
are highly pathogenic for domestic animals. The agents of tick borne disease in ovine are B. ovis, B.
motasi and Theileria hirci. Previous works from other authors (Habela et al, 1990) pointing out that
B. ovis is the most frequent piroplasmid present in sheep and goats in Mediterranean regions. B. ovis
is transmitted by Rhipicephalus bursa, R. turanicus, Hyalomma anatolicum excavatum (Friedhoff
et al, 1997). The acute form has characteristic clinical signs, as jaundice and haemoglobinuria; sub-
acute or chronic form can only be diagnosed by demonstration of the parasite in the blood (smear,
PCR, RLB). Indigenous sheep in enzootic areas usually acquire a mild infection and are immune
thereafter. Sicilian kind of breeding, especially for small ruminant is characterised by mixed animal
species. Ticks can bite in their life cycle different host that can became asinthomatic reservoir of the
TBD pathogens. Molecular diagnosis methods has led to the discovery of some new piroplasmids in
the lapse of just a few years (H. americanum, described by Vincent-Johnson et al., 1997; Theileria
annae by Zahler et al., 2000a).
In the present work we describe the accidental discovery of Theileria spp different from to most
common ovine Theileria (B.ovis, B.motasi, T.hirci,) in sheep and we intend to demonstrate that
piroplasmid infections may reveal unexpected (but probably not infrequent) in unusual hosts.

Sampled were collected in Sicilian sheep breeding in Messina province. DNA extracted (N=100)
positive by Reverse Line Blot hybridization for probe Theileria/Babesia catch all, Theileria sp1 china,
Theileria sp2 china and negative for T. buffely, T. annulata, T. velifera, T. taurotragi, T. mutans, T.
lestoquardi, T. ovis, B. bovis, B. bigemina, B. crassa, B. motasi, B. ovis, B. major, B. divergens, T. hirci,
B.sp1 (Turchey),B.sp2 (Lintan). (Gubbels et al. 1999) were tested by T. equi specific PCR (Badgar
Battsetseg et al, 2002). For sequencing purposes, amplified products were separated in agarose gels
and visualized with ethidium bromide. Bands of interest were isolated with the Wizard SV Gel and
PCR Clean-up purification System (Promega Corporation, Madison, WI, USA). Fragments obtained
by PCR Theileria equi were sequenced using primers EMA5 (5’-TCGACTTCCAGTTGGAGTCC-
3’) and EMA6 (5’-AGCTCGACCCACTTATCACC -3’) for identification of isolates through the
sequence of merozoite antigen (published by Kakuda T, Sugimoto C and Onuma M). Sequencing
was carried out by Macrogen.Inc automated sequencer.
Results
Thirty sheep were infected with T.equi as demonstrated by PCR and two samples were select
for sequencing to ascertain if the infection was present in the samples. The obtained sequences were
compared with those in GeneBank using Blast software and then analyzed in silico using Bioedit
v.7.0.9.0. The results showed a high degree of identity (99.5%) with the Merozoite antigen of T. equi
isolate D-31 (GeneBank accession number AB015220).
Discussions
The degree of identity between the sequences obtained and the GeneBank data shows that there
is a high probability that in the ovine samples tested was present the T. equi DNA.
Our study would show the existence, among the sheep population tested, of a piroplasm not
common for small ruminants. T.equi has never been described before as a parasite of sheep. Animals
positive for T.equi PCR analyses were clinically asymptomatic, which might be indicative of a no-
pathogenicity in that host. Theileria equi is a common protozoan disease of horses in Sicily and
infected horses become carriers of T. equi and potential disseminators of the parasite. Trans-ovarian
transmission in ticks for Theileria spp has been never described in previous reports, only trans-stadial
transmission can occur. Due to this reason the interspecies transmission between equine and ovine
is possible throughout the bite of the same tick in its different biological stages; ticks that acquire T.
equi from infected horses could successfully transmit the parasite to naive sheep. In fact there are in
Sicily many farms where cohabit different animal species, ovine, equine, bovine, dogs; we suppose
that domestic animal species may play a role as asymptomatic reservoir for Tick Borne pathogens.
References
Badgar Battsetseg, Susana Lucero, Xuenan Xuan, Florencia G. Claveria, Noboru Inoue, Andy Alhassan,
Tsutomo Kanno, Ikuo Igarashi, Hideyuki Nagasawa, Takeshi Mikami, Kosa Fujisaki, 2002. Detection
of natural infection of Boophilus microplus with Babesia equi and Babesia caballi in Brazilian horses using
nested polymerase chain reaction. Veterinary Parasitology 107: 351-357.
Friedhoff KT, 1997. Tick-borne diseases of sheep and goats caused by Babesia, Theileria or Anaplasma spp.
Parassitologia; 39(2):99-109.
J.M. Gubbels, A.P.de Vos, M.van der Weide, J. Viseras, L.M.Schouls, E.de Vries, F.Jongejan, 1999.
Simultaneos detection of bovine Theileria and Babesia species by Reverse Line Blot Hybridization. Journal
of Clinical Microbiology, 1782-1789.
Habela M, Reina D, Nieto C, Navarrete I. 1990Isolation and identification of Babesia ovis in Extremadura
(Spain). Vet Parasitol; 35 (3): 233-8.
Vincent-Johnson, N.A., Macintire, D.K., Lindsay, D.S., Lenz, S.D., Baneth, G., Shkap, V. and Blagburn,
B.L., 1997. A new Hepatozoon species from dogs: description of the causative agent of canine hepatozoonosis
in North America. J. Parasitol. 83, pp. 1165–1172.
Zahler, M., Rinder, H., Schein, E. and Gothe, R., 2000. Detection of a new pathogenic Babesia microti-like
species in dogs. Vet. Parasitol. 89, pp. 241–248.
ANIMAL IDENTIFICATION: CONDITIONS OF THE INDIVIDUAL
IDENTIFICATION OF BOVINE ANIMALES IN ASTURIAS (SPAIN)
Barriada Alvarez M.1, Martínez López L. M.2

1
Dirección General de Ganadería y Agroalimentación. Consejería de Medio Ambiente y Desarrollo Rural.
Principado de Asturias. Asturias. Spain
2
Dirección General de Informática. Consejería de Administsraciones Públicas y Portavoz del Gobierno. Prin-
cipado de Asturias. Asturias. Spain
SUMMARY
This paper aims to present some data on the status of the identification of cattle in Asturias, a small
autonomous community placed in the north of Spain. The Identification of cattle is based on several elements
including the ear tags, that every bovine animals should keep throughout its life, with the same identification
code. Another element is simogan, the database containing the identification and movement of bovine animals
and that, on the one hand, must be able to control the information that is provided in order to maintain their
reliability, and, on the other hand, has to provide data that allow ensure the traceability of production, such as
information relating to the ear tags replacement in the animals.In this paper we have checked the data pertaining
to the replacement of the ear tags in the animals of our holdings, as one of the parameters to assess the quality of
information stored in terms of traceability. We have controlled cattle censuses, births, and requests for duplicate
ear tags, in the period of time between the years 2004 2007. The results show that while from 2004 to 2007 in
the region there has been a decline of close to 14%, of the census and the number of births of bovine animals,
the number of duplicates of ear tags that were requested has experienced a sharp increase, about 78%. This
significant, and not expected, increase in the number of requested duplicates of ear tags, leads us to analyze
data in search of some factor that allows explain it, and if possible, seek solutions. So we have analysed the
relationship with the type of holding, age of the animals, and the provenance of ear tags.
RESUMEN
Este trabajo pretende presentar algunos datos sobre la situación de la identificación del ganado bovino
en Asturias, una pequeña Comunidad Autónoma situada al norte de España. La identificación del bovino está
basada en varios elementos entre los que se encuentran las marcas auriculares o crotales, que todas las reses han
de mantener puestas a lo largo de toda su vida y con el mismo código de identificación. Otro de los elementos
es simogan, la base de datos que recoge la identificación y los movimientos de los bovinos y que, por una
parte, ha de ser capaz de controlar la información que se le facilita a fin de mantener su fiabilidad, y que, por
otra parte, ha de suministrar datos que permitan garantizar la trazabilidad de la producción, como es el caso
de la información referida a las recrotalizaciones de los animales. En este trabajo se han revisado los datos
referidos a las recrotalizaciones de los animales de nuestras explotaciones, como uno de los parámetros para
valorar la calidad de la información almacenada, en cuanto a la trazabilidad. Para ello se han controlado los
censos de ganado bovino, los nacimientos, y las solicitudes de duplicados de marcas auriculares, en el período
de tiempo comprendido entre los años 2004 a 2007. Los resultados obtenidos muestran que si bien desde el año
2004 a 2007 en la región se ha producido una disminución, próxima al 14%, del censo y del nº de nacimientos
de bovinos, el nº de duplicados de crotales solicitados experimentó un fuerte incremento, del 78,37%. Este
considerable, y no esperado, incremento del número de duplicados solicitados, nos lleva a analizar los datos en
busca de algún factor que permita explicarlo y, si es posible, buscar soluciones. Así, se buscó la relación con el
tipo de explotación, la edad de los animales, y la procedencia de los crotales.
INTRODUCCCIÓN
Los consumidores valoran cada vez más la calidad y la seguridad de los alimentos que
consumen.
En el campo de la producción animal, y de modo especial en la producción de bovino, este hecho
unido a las diferentes crisis alimentarias y de sanidad animal que hemos presenciado en los últimos
años, han llevado a una revisión de la normativa relacionada con el control de los alimentos. Así, la
nueva normativa que se elaboró, nació bajo la máxima de buscar la seguridad alimentaria desde la
granja hasta la mesa.
En este contexto, la identificación de los animales constituye uno de los puntos de partida para
que sea viable mantener la trazabilidad de la producción, a fin de asegurar la calidad alimentaria.
Particularizando para el ganado bovino, su identificación está basada en varios elementos entre
los que se encuentran las marcas auriculares que se les colocan a los animales después de nacer y
que han de mantener durante toda su vida, y las bases de datos, que gestionadas por las autoridades
competentes, recogen esa información referida a la identificación de las reses.
Con este sistema de identificación del bovino mediante marcas auriculares, las sustituciones de
dichas marcas, en casos de pérdida, es uno de los puntos que se han de controlar de manera efectiva,
para poder cumplir los requisitos relativos a garantizar la trazabilidad de los alimentos.
OBJETIVO
Este trabajo presenta datos referidos a la identificación del ganado bovino en Asturias, una
pequeña Comunidad Autónoma situada al norte de España.
El fin es valorar la información que existe, en nuestra base de datos de identificación y registro
de ganado bovino simogan, sobre las sustituciones que se hacen de las marcas auriculares cuando se
pierden. Las nuevas marcas han de ser duplicados de las originales, manteniendo el mismo código
de identificación.
Por una parte, se pretende estimar qué nivel de reposición de marcas auriculares tenemos
anualmente (nº de crotales duplicados solicitados un año respecto al censo de ganado bovino ese
año). Y por otra parte, se valora la evolución de ese nivel de reposición a lo largo de varios años y su
relación con factores como la edad de los animales y el tipo de animal de producción.
DATOS
Se analizan los datos de simogan, relativos a número de bovinos, número de nacimientos y
número de crotales solicitados duplicados para esos bovinos, localizados en las explotaciones
asturianas durante los años 2004, 2005, 2006 y 2007.
En el cálculo de la cantidad de crotales duplicados solicitados, además de considerar el nº total
de peticiones, se diferenciaron las solicitudes en que se pedía un único ejemplar de la marca auricular
(duplicados simples) de aquellas en las que se pedían los dos ejemplares de la marca (duplicados
dobles), por las repercusiones que este hecho tiene en el control de esos animales.
También se realizan cálculos para determinar la distribución del número de duplicados solicitados
según
- la edad de los animales, considerando 4 grupos: animales de 1 año de edad o menos, animales
con edad comprendida entre 1 y 3 años, animales con edad comprendida entre 3 y 6 años, y animales
con edad superior a 6 años.
- el tipo de animal de producción, considerando a este efecto la raza del animal y obteniéndose
datos para las cuatro razas que representan aproximadamente el 99 % del censo: frisona, asturiana de
los valles (AV), asturiana de la montaña (AM) y animales mestizos.
RESULTADOS
En la tabla 1 se presentan los datos referidos al número de bovinos localizados en las explotaciones
asturianas, número de nacimientos y número de duplicados solicitados.
TABLA 1. Número de reses, nacimientos y crotales duplicados solicitados para ganado bovino en las explota-
ciones asturianas, correspondientes a los años 2004 a 2007
2004 2005 2006 2007

Censo bovino 452.556 424.392 386.913 386.954
Nº Nacimientos 215.545 203.438 192.546 186.405
Nº duplicados simples (DS) 25.216 30.684 35.876 44.979
Nº duplicados dobles (DD) 2.264 2.342 2.190 2.145
Ratio DS / Censo bovino 0,055 0,072 0,093 0,116
Ratio DD / Censo bovino 0,005 0,005 0,006 0,005
Ratio Nº total D / Censo bovino 0,060 0,078 0,098 0,121
Se observa que, desde el año 2004, si bien ha ido disminuyendo el censo de ganado bovino
en nuestras explotaciones, llegando a ser en el año 2007 un 14% menor que en el 2004, ha ido
aumentado el número de las solicitudes de crotales duplicados simples, llegando a ser en el año 2007
un 78,73 % mayor que en 2004. No se ha observado una tendencia clara en el caso de las solicitudes
de duplicados dobles, con incrementos y descensos que oscilaron del 3 al 8 %.
Así con estos datos, se ve que el porcentaje de reposición de las marcas auriculares ha ido en
aumento todos los años, pasando de valores de 6,07 % en el año 2004 a 12,18 % en el 2007 (Gráfico
1), lo que supuso un aumento del 71,48 % en el nº total de crotales solicitados.
GRAFICO 1. Evolución desde el año 2004 a 2007 en la reposición de

las marcas auriculares del bovino en la comunidad de Asturias
0,14
0,12
duplicados/ censo
0,1
Ratio nº de
bovino
0,08
0,06 Ratio DS /
0,04 Censo bo vino
0,02 Ratio DD /
Censo bo vino
0
Ratio N□to tal D
2004 2005 2006 2007
/Censo bo vino
Años
En la tabla 2 se presentan los datos del número de crotales duplicados que se solicitaron en esos
años, teniendo en cuenta la edad de los animales.
TABLA 2. Crotales duplicados solicitados, durante los años 2004 a 2007, teniendo en cuenta la edad.
2004 2005 2006 2007

Simples Dobles Simples Dobles Simples Dobles Simples Dobles
menos de 1 año 4.307 610 4.050 441 4.823 353 5.934 333
de 1 a 3 años 4.526 284 4.456 226 4.093 133 5.159 158
de 3 a 6 años 9.886 791 9.771 610 10.228 480 10.667 381
más de 6 6.497 579 12.407 1.065 16.732 1.224 23.219 1.282
Se puede ver que para el grupo de animales con edad superior a 6 años se ha producido un
incremento continuado e importante del número de solicitudes registradas. Este aumento se detecta
tanto para las peticiones de duplicados simples como de duplicados dobles. Al comparar los datos
de los años 2005, 2006 y 2007, respecto a los de 2004, las peticiones aumentaron más del doble,
llegando a ser 3,5 veces superiores las peticiones de duplicados simples, en el año 2007 (Gráfico 2).
GRAFICO 2. Evolucion desde el año 2004 a 2007 del número de

solicitudes de crotales duplicados simples en función de la edad de
los animales
25000
2004
Nª de crotales
20000
duplicados
15000 2005
10000
2006
5000
2007
0
menos de 1a□o de 1a 3 a□os de 3 a 6 a□os m sde 6 a□os
Edad de los animale s
Cuando analizamos la información del número de crotales duplicados pedidos, en función de la

raza, el resultado constata que el incremento continuado, desde el año 2004 al 2007, en la cantidad
de solicitudes registradas para los animales de más de 6 años de edad, se produce para todas las razas
(Gráfico 3).
GRAFICO 3. Evolución desde el año 2004 al 2007 del nº de solicitudes de

duplicados simples en función de la raza para animales mayores de 6 años de edad
10000
8000
2004
6000
4000 2005
2000 2006
0
MESTIZO AM FRISONA AV
2007
R az a
Al revisar los datos que tenemos de los otros 3 grupos de edad, no se aprecia en ninguna de las
razas, variaciones interanuales importantes en la cantidad de duplicados pedidos. Paralelamente,
durante los cuatro años, se ve que el rango de edad para el que se registra el mayor y el menor
número de solicitudes no varía dentro de cada una de las razas, de modo que parece que pueda existir
una referencia para determinar en qué edades puede ser más necesario, en cada raza, el control de la
reposición de marcas auriculares (Gráfico 4).
GRAFICO 4. Evolución desde el año 2004 al 2007 del numero de solicitudes de crotales
duplicados en función de la raza y la edad
10000
9000
8000
7000
6000
5000 N □C R O T A L E S
4000
3000
2000
1000
0
2004 2005 2006 2007
ED A D
Así, en los animales de conjunto mestizo ese mayor nº de solicitudes se centra en animales
de menos de 1 año y de más de 6 años de edad; en los bovinos de raza asturiana de la montaña se
realizan más peticiones de duplicados para los animales de más de 6 años; en la raza frisona destaca
el bajo nº de solicitudes para animales de menos de 1 año y, en comparación con las otras razas, un
alto número para los animales de 1 a 3 y de 3 a 6 años; finalmente en la raza asturiana de valles la
mayor cantidad de solicitudes corresponden a los animales de los grupos de menos de 1 y de más de
6 años de edad.
DISCUSIÓN
De acuerdo con los resultados expuestos, en el año 2004 la reposición de las marcas auriculares
en la cabaña bovina de nuestra comunidad fue del 6%, cifra que coincide con los porcentajes de
pérdidas anuales que se citan en la bibliografía (Ghirardi et al., 2004; Caja et. al, 2005) para este tipo
de crotales convencionales de poliuretano.
En cuanto a los porcentajes de reposición que se obtienen para los siguientes años, resultan muy
superiores a esa cifra del 6%. Aquí se ha de tener en cuenta que entre los resultados de este trabajo
se señala un incremento muy importante del número de crotales duplicados solicitados al aumentar
la edad de los animales, especialmente para animales de más de 6 años de edad, y por tanto cabe
suponer que se trata de animales que portan esas marcas de identificación durante un período de
tiempo superior a los 7 años que Ghirardi et al., citan que duro la experiencia de su trabajo.
Si a su vez consideramos que esa relación entre el incremento en el nº de solicitudes de crotales
duplicados y la mayor edad de los animales, se mantiene independientemente de la raza de bovino
que consideremos, y por extensión del sistema de producción, nos lleva a pensar en que el factor que
está influyendo es la duración o vida media de la marca auricular.
En relación con la duración y resistencia de los crotales únicamente se han encontrado
referencias de los fabricantes a la duración del marcado de los caracteres que llevan inscritos, citando
10 años como mínimo, y a la resistencia a que las dos piezas que componen el crotal sean separadas,
soportando fuerzas de más de 40 kg.
Respecto a los rangos de edad en los que el número de solicitudes de duplicados es mayor para
cada raza, se podrían relacionar, con un mayor censo de animales de esas edades y a la vez con los
sistemas de producción en que se les mantiene:
 orientaciones productivas de carne, en sistemas semiextensivos e intensivos, para los bovinos
de raza asturiana de valles y conjunto mestizo (con reproductoras y cebo de reses jóvenes), y
en sistemas más extensivos, para los bovinos de raza asturiana de montaña (reproductoras y
producción de carne de buey)
 y orientaciones productivas de leche para los bovinos de raza frisona, con reproductoras
jóvenes.
Como comentario final, señalar que no se pudo disponer del censo de animales de cada año
desglosado por raza y edad para poder hacer una valoración objetiva de esa relación censo- sistema
de producción - nº de solicitudes.
AGRADECIMIENTOS
Al personal de la empresa “Atos Origin” y del Servicio de Producción y Bienestar Animal
(Consejería de Medio Ambiente y Desarrollo Rural) por su colaboración.
REFERENCIAS
Ghirardi J.J., Caja G., Conill C., Hernández-Jover M. & Garín D. 2004. J. Anim. Sci.
82 (Supl. 1):351 (Abstr.).
C. Saa, M.J. Milán, G. Caja, J.J. Ghirardi, O. San Miguel, A. Ruiz y M.J. Lueso. 2005. ITEA Prod. Animal,
(volumen extra) 26: 318-320
Información técnica de fabricantes de crotales.

Investigation of Bovine Herpesvirus 1 BH

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Investigation of Bovine Herpesvirus 1 BH

Uploaded by

Copyright:

Available Formats

Izdavač Publisher

Veterinarski fakultet Sveučilišta u Zagrebu Faculty of Veterinary medicine Zagreb

Prof. Dr. Ivica Harapin Prof. Dr. Josip Kos

Grafički urednik Graphic Editor

Radovi tiskani u Zborniku su recenzirani

REPUBLIKA HRVATSKA REPUBLIC OF CROATIA

MINISTARSTVO POLJOPRIVREDE MINISTRY OF AGRICULTURE, Fisheries

VETERINARSKi FAKULTET FACULTY OF VETERINARY MEDICINE

Hrvatska veterinarska komora Croatian Veterinary Chamber

POSEBNO ZAHVALJUJEMO GREAT GRATITUDE TO THE MINISTRY

MEĐUNARODNI ORGANIZACIJSKI ODBOR

INTERNATIONAL ORGANIZING COMMITTEE

Prof. Dr. Sc. J. Kos, Croatia

Prof. Dr. Arcangelo Gentile, Italy

Prof. Dr. Antonio Pugliese, Italy

Dr. Sc. B. Fatur, Slovenia

Prof. Dr. M. Erman Or, Turkey

Prof. Dr. Paulino Garcia Partida, Spain

Prof. Dr. Pablo Diez-Banos, Spain

Prof. Dr. Hossein Hamali, Iran

ZNANSTVENO STRUČNI SCIENTICIC PROFESSIONAL

INTERVET GLAVNI SPONZOR

Infectious Diseases - Zarazne bolesti

Analiza PrPsc kod pojave svrbeža u ovaca na siciliji

Metabolic Diseases - Metaboličke bolesti

Reproduction, Obstretics and Udder Health - Reprodukcija, porodništvo i zdravlje vimena

Surgery, Miscellaneous - Kirurgija, ostalo

Autohtone pasmine preživača u Hrvatskoj

V. Sušić1, A. Ekert Kabalin1, I. Štoković1, Ž. Pavičić2, B. Mioč3, V. Pavić3, Z. Barać4, S.

Status of autochthonous ruminant breeds in Croatia

Number of animals Effective

Primary characteristics of Croatian autochthonous cattle, sheep and goat breeds

Sheep of the Island of Cres Sheep of the Island of Rab

Istrian Sheep Sheep of the Island of Pag

Number of Sum Total ≈ Euros per

Situación actual de las técnicas de reproducción

Aktualni status postupaka asistirane reprodukcije

Antonio Gonzalez-Bulnes, Claudia A. Letelier, Ignacio Contreras-Solís, Juraj Grizelj

Inducción y sincronización de celos y ovulaciones

Superovulación y transferencia de embriones

Aktualni status postupaka asistirane reprodukcije malih preživača

Indukcija i sinkronizacija estrusa i ovulacije

Superovulacija i trensfer zametaka

Nove mogućnosti kontrole zaraznog goveđeg

Juan Muñoz Bielsa

International Marketing, International Product Manager Ruminant Biologicals, Intervet International bv

MAIN RESPIRATORY PATHOGENS

Bovine Herpesvirus Type 1 (BHV-1)

Bovine Virus Diarrhea Virus (BVDV)

Bovine Adenovirus (BAV)

Bovine Respiratory Syncytial Virus (BRSV)

CONTROL OF BOVINE RESPIRATORY COMPLEX

Recommended vaccination programme

Table 3. Challenge with M haemolytica A1

Number of animals Dead % Mortality

Table 4. Challenge with M haemolytica A6

Number of animals Dead % Mortality

GENETSKA KARAKTERIZACIJA LENTIVIRUSA GENOTIPA E U

Reina, R., Grego, E., Lacerenza, D., Profiti, M., Rosati, S.

Dipartimento di Produzioni Animali Epidemiologia ed Ecologia, Universita di Torino, Torino.Italy.

MATERIAL AND METHODS

ENTOMOLOŠKO ISTRAŽIVANJE BLUETONGUE VEKTORA U TIRANI

Material and Methods