2020 Midterm 1 exam questions

1. How many covalent bonds can a carbon atom make?

A. 1
B. 2
C. 3
D. 4
E. 5

2. Leucine and isoleucine (shown) are structural isomers of one another.

This means:

A. They are identical molecules with identical properties

B. Isoleucine is the mirror image of leucine
C. Isoleucine and leucine have the same chemical formula but different
connectivity between atoms
D. Both leucine and isoleucine have a carbon-carbon double bond, with
a different arrangement of atoms around this bond

3. Which of these will have the lowest pH

A. Pure water
B. A 1 molar (1 M) solution of the strong base sodium hydroxide
C. A 1 molar (1 M) solution of the weak base sodium citrate
D. A 1 molar (1 M) solution of the strong acid hydrochloric acid
E. A 1 molar (1 M) solution of the weak acid acetic acid

4. Which statement about disaccharides is not true

A. All disaccharides contain fructose
B. Disaccharides are made by a dehydration reaction that joins two
monosaccharides
C. There are many different disaccharides
D. Monosaccharides in a disaccharide are joined via a glycosidic
bond/linkage

5. Which statement about amino acids is not true

A. Amino acids have an amino group and a carboxyl group, both of
which are charged at neutral pH
B. Amino acids are the building blocks of proteins
 C. Amino acids have different sidechains, which give them different
properties
D. Amino acids are the building blocks of nucleic acids

6. Which statement about unsaturated lipids is true?

A. Unsaturated lipids are hydrophilic (polar) molecules
B. Unsaturated lipids are not found in nature
C. Unsaturated lipids pack together less tightly than saturated lipids,
so have a lower melting point
D. Unsaturated lipids are only found in prokaryotes
E. Unsaturated lipids are chemically impossible and cannot form
7. You are looking at a eukaryotic cell under a microscope: you have
added DAPI to stain the DNA blue. Which part of the cell is the
brightest blue?
A. The cytoplasm
B. The nucleus
C. The chloroplasts
D. The mitochondria
E. The lysosomes

8. Which of the following are found in all prokaryotic and eukaryotic

cells?
A. A nucleus
B. Mitochondria
C. Chloroplasts
D. Ribosomes
E. A cell wall

9. Which of the following is not a cytoskeletal element found in animal

cells?
A. The cell wall
B. Intermediate filaments
C. Microtubules
D. Actin microfilaments

10. The free energy change of a forward chemical reaction is +8.7

kcal/mol. What is the free energy change of the reverse reaction?
A. +8.7 kcal/mol
B. +17.4 kcal/mol
C. -8.7 kcal/mol
D. -17.4 kcal/mol
E. Impossible to determine given the information

11. Which statement about ATP is not true

 A. ATP is a nucleotide
B. ATP is used for RNA synthesis in cells
C. The hydrolysis of ATP is exergonic
D. ATP synthesis only occurs in the chloroplasts of plant cells
E. ATP is used as an energy source to power endergonic reactions in
cells

12. The free energy change of a chemical reaction occurring without

enzyme-mediated catalysis is -6.1 kcal/mol. Which of the following is
the most likely free energy change of the same reaction, when
catalyzed by an enzyme?
A. +6.1 kcal/mol
B. +3 kcal/mol
C. 0 kcal/mol
D. -6.1 kcal/mol
E. Impossible to determine

13. Which of these is not synthesized during glycolysis?

A. ATP
B. Glucose
C. Pyruvate
D. NADH

14. In what form does carbon enter the citric acid cycle (TCA cycle)?
A. Pyruvate
B. Glucose
C. Carbon dioxide
D. Acetyl CoA
E. Phosphoenolpyruvate

15. Which of the following can be used as a terminal electron

acceptor for the electron transport chain in mitochondria during
cellular respiration?
A. Water
B. Hydrogen
C. Oxygen
D. Glucose
E. NADH

16. Which of the following can be transferred between immediately

adjacent chlorophyll molecules after one of them absorbs a photon of
light, and contributes to light-harvesting during photosynthesis?
A. Energy
B. Electrons
 C. CH3 (methyl) groups
D. Protons (H+ ions)
E. ATP molecules

17. The reaction of Ribulose 1,5 bisphosphate with which molecule,

catalyzed by Rubisco, fixes carbon from the atmosphere during the
Calvin cycle
A. Oxygen
B. Glucose
C. Pyruvate
D. Acetyl CoA
E. Carbon dioxide (CO2)

18. Which statement about C4 and CAM plants is not true?

A. C4 and CAM plants are adapted to live in hot, dry climates
B. C4 and CAM plants fix CO2 separately from the Calvin cycle
C. C4 and CAM plants both use PEP carboxylase to fix CO2
D. C4 and CAM plants keep their stomata closed 24h per day, 7 days
per week
E. C4 and CAM plants fix CO2 in the Calvin cycle

19. A lysate of virulent Streptococcus pneumoniae is treated with

various combinations of enzymes. Which combination would leave the
lysate unable to transform non-virulent cells of Streptococcus
pneumoniae?
A. RNase + Sucrase
B. RNase + Protease
C. Protease + Sucrase
D. DNase + Sucrase
E. Sucrase + Protease

20. Which best describes the structure of a DNA molecule?

A. Right-handed double helix, antiparallel strands, bases paired by
hydrogen bonding
B. Right-handed triple helix, antiparallel strands, bases paired by
hydrogen bonding
C. Right-handed triple helix, parallel strands, bases paired by hydrogen
bonding
D. Right-handed double helix, parallel strands, bases paired by
hydrogen bonding
 E. Right-handed triple helix, antiparallel strands, bases paired by
covalent bonds

21. Which of these enzymes is not directly required for DNA

replication in an E. coli cell
A. DNA ligase
B. Helicase
C. Pyruvate kinase
D. DNA polymerase I
E. DNA polymerase III

22. Which of the following is not required for PCR?

A. dNTPs
B. ddNTPs
C. A DNA polymerase that remains stably folded at high temperatures
D. Template DNA
E. Forward and reverse primers

23. Which of the following molecules is/are chemically possible

structures?
A. A
B. B
C. C
D. All of them are chemically
possible
E. None of them are chemically possible

24. What best describes the relationship between these two

molecules?
A. Structural isomers
B. cis-trans isomers
C. enantiomers
D. Both of these are the same molecule

25. The synthesis of DNA

A. Proceeds from 5’-3’ via a dehydration reaction
B. Proceeds from 5’-3’ via a hydrolysis reaction
C. Proceeds from 3’-5’ via a dehydration reaction
D. Proceeds from 3’-5’ via a hydrolysis reaction
E. Can proceed either 3’-5’ or 5’-3’ via a hydrolysis reaction
 26. The concentration of Calcium ions (Ca2+) outside a eukaryotic
cell is ~1000 times higher than the concentration inside the cell. Given
this, which of the following statements is most accurate?
A. Calcium will spontaneously diffuse across the membrane unaided,
exiting the cell
B. Calcium will spontaneously diffuse across the membrane unaided,
entering the cell
C. Calcium can spontaneously enter the cell by facilitated diffusion
D. Calcium can spontaneously exit the cell by facilitated diffusion

27. Which of the following could be used to visualize where in a

cell/organism a specific RNA molecule was located?
A. An antibody raised against an unrelated protein from the same
organism?
B. A labeled RNA or DNA molecule with the same sequence as the RNA
in question
C. A labeled RNA or DNA molecule with the reverse complementary
sequence to the RNA strand we want to visualize
D. An unlabeled RNA or DNA molecule with the same sequence as the
RNA in question

28. Which of the following is not a property of a human telomere?

A. Becomes shorter when a linear chromosome is replicated?
B. Protects the ends of linear chromosomes from being recognized as
damage
C. Can be extended by telomerase
D. Is located in the exact center of a chromosome
E. Is present on every chromosome in a normal cell

29. Which of these is increased by a catalyst?

A. The free energy of the transition state
B. The free energy change of the reaction
C. The rate of the forward reaction ONLY
D. The rate of the reverse reaction ONLY
E. The rates of both the forward and reverse reactions

30. Hydrolysis of ATP to ADP + Pi has a free energy change of -7.3

kcal/mol. What is the most likely free energy change of the hydrolysis
of xanthine triphosphate (XTP) to XDP + Pi? XTP is a nucleotide but is
not used in RNA synthesis
A. +7.3 kcal/mol
B. -7.3 kcal/mol
C. +14.6 kcal/mol
D. -14.6 kcal/mol
 E. Zero

31. If the investment phase of glycolysis is run in reverse,

synthesizing glucose from glyceraldehyde-3-phosphate (G3P), how
many ATP molecules can be synthesized per molecule of G3P?
A.0
B.1
C.2
D.3
E.4

32. During fermentation, NADH can react with pyruvate, converting

the pyruvate to lactate. Which statement is true about this reaction?
A. NADH gets oxidized, pyruvate gets reduced during this reaction
B. NADH gets reduced, pyruvate gets oxidized during this reaction
C. NADH and pyruvate are both oxidized during this reaction
D. NADH and pyruvate are both reduced during this reaction

33. Which of the following is the reverse complement of the

sequence below? All sequences here are written from 5’-3’
GGCATTGCATGCAGTGCGTTGAA
A. GGCATTGCATGCAGTGCGTTGAA
B. AAGTTGCGTGACGTACGTTACGG
C. TTCAACGCACTGCATGCAATGCC
D. CCGTAACGTACGTCACGCAACTT
E. AAAAAAAAAAAAAAAAAAAAAAAA

34. Which enzyme do C4 plants use to bring CO2 into the Calvin cycle
in bundle sheath cells?
A. Pyruvate kinase
B. Rubisco
C. Catalase
D. Lactate dehydrogenase
E. Photorespirationase

35. You inhibit DNA ligase in an E. coli cell. Which of the following
will accumulate?
A. Unextended primers on the leading strand
B. Unextended primers on the lagging strand
C. Okazaki fragments on the lagging strand (fully processed but not
joined together)
 D. Supercoiled DNA molecules
E. E. coli cells with telomeres in the middle of their circular
chromosomes

36. You completely inhibit the helicase used in DNA replication in E.

coli. What is the effect on DNA replication?
A. DNA replication can be initiated without a problem; ongoing
replication at replication forks continues
B. DNA replication cannot be initiated; ongoing replication at
replication forks continues
C. DNA replication can be initiated without a problem; ongoing
replication at replication forks stops
D. DNA replication cannot be initiated; ongoing replication at
replication forks stops

37. Why do we need a gel when separating DNA fragments by

electrophoresis?
A. To make sure all the DNA molecules are charged
B. To make sure none of the DNA molecules are charged
C. Because all DNA molecules have the same mass:charge ratio and
would otherwise migrate at the same speed in an electric field
D. Because every DNA molecule has a different mass:charge ratio and
the gel makes sure that they all migrate at the same speed as each
other in an electric field
E. Because we like to eat the agarose as a snack afterwards

38. You perform qPCR to detect a DNA virus in human cells. You
start with equal numbers of cells and treat all samples identically. Cell
sample A shows fluorescent signal above threshold following 15 cycles
of amplification; sample B reaches this threshold at 20 cycles, and
sample C at 25 cycles. Which sample contained more virus?
A. A
B. B
C. C
D. All the samples contained the same amount of virus per cell

39. The structures of several amino acids are shown: which amino
acid is not chiral?
 A. Alanine
B. Glycine
C. Leucine
D. Isoleucine
E. All of these molecules are chiral

40. You fuse two cells, each with a different fluorescently labeled
molecule in is plasma membrane. Assuming cells are completely viable
at both temperatures tested, which will give the fastest mixing of the
two colors in the membrane of the fused cell?
A. Low temperature, lots of unsaturated lipids in the membranes
B. Low temperature, few unsaturated lipids in the membranes
C. High temperature, lots of unsaturated lipids in the membranes
D. High temperature, few unsaturated lipids in the membranes

41. Below is an image of a cell treated with either Ethanol (EtOH) or

Dihydrotestosterone (DHT). The cell is expressing a fluorescently
labeled version of a protein called AR. Which statement best reflects
the outcome of treating cells with EtOH vs DHT

A. AR moves to the nucleus in cells treated with EtOH but not DHT
B. AR moves to the nucleus in cells treated with DHT but not EtOH
C. AR is in the nucleus whether cells are treated with DHT or EtOH
D. AR is never found in the nucleus, regardless of whether cells are
treated with DHT or EtOH

42. If an enzyme cannot release the products of the reaction it

catalyses, what would happen to the overall rate of the (forward)
reaction in a cell where the concentration of substrates and products
is much lower than the concentration of enzyme at all times?
A. The reaction will be much faster if products cannot be released
B. The reaction will be much slower if products cannot be released
C. The reaction will proceed at much the same speed whether or not
products are released
 D. Enzymes don’t bind to the products of their reaction, so this is a
trick question
43. Some organisms use Sulfur, rather than oxygen, as a terminal
electron acceptor during respiration. Assuming that the electron
transport chain is the same in these organisms (with the exception of
the final electron acceptor), what would be the effect on ATP synthesis
of preventing the flow of electrons from Complex III to Complex IV
A. ATP synthesis would speed up
B. ATP synthesis would be unaffected
C. ATP synthesis would slow down a little but carry on
D. ATP synthesis would stop completely

44. What will happen to the synthesis of ATP and NADPH in

chloroplasts if a C4 plant (in light conditions) is treated with FCCP – a
molecule that uncouples proton gradients across biological
membranes?
A. ATP synthesis and NADPH synthesis will be unaffected
B. Both ATP synthesis and NADPH synthesis will stop
C. Both ATP synthesis and NADPH synthesis will increase
D. ATP synthesis will stop, NADPH synthesis will be unaffected
E. ATP synthesis will be unaffected, NADPH synthesis will stop

45. Normally, DNA polymerase incorporates an incorrect base

approximately once per thousand base pairs. Proofreading catches 999
errors per thousand, and mismatch repair catches 999 per thousand of
the errors that remain – so the error rate is one per billion (10 -9). What
would be the most likely error rate in a cell with a mutant DNA
polymerase that incorporates the incorrect base once every ten base
pairs?
A. 10-11
B. 10-10
C. 10-9
D. 10-8
E. 10-7

46. You add a molecule that causes the shelterin complex to be

degraded in a post-replicative cell (i.e. a cell that is not replicating its
DNA or dividing). Which of the following will not happen?
A. Telomeres will become shorter
B. Telomeres will be recognized as damaged DNA
C. Telomeres will fuse together
D. Shelterin will be absent and therefore unable to associate with
telomeres
 47. Consider the five amino acids below. Which two of these would
you expect to find buried in the core of a soluble protein found in the
cytoplasm [1 pt]? Explain your answer [1 pt] (280 character strict
limit). Which of these amino acids would you expect to make a direct
ionic/electrostatic interaction with the backbone of a DNA or RNA
molecule [1 pt]? Explain your answer [1 pt] (280 character strict limit)

• Leucine and valine (0.5pt each)

• They are non-polar so will be buried to
minimize the interaction between nonpolar sidechains and the polar solvent
• Arginine
• It’s positively charged, and the DNA backbone is negatively charged
48. Beta lactam antibiotics such as ampicillin inhibit cell wall
synthesis in bacteria. You treat E. coli cells with ampicillin under two
different conditions – with the concentration of solutes lower outside
the cell than in (hypotonic), or the same outside and inside the cell
(isotonic). Which of these conditions will cause the bacteria to lyse [1
pt], and why [1 pt] (strict 280 character limit)? You suspect that a
specific RNA virus that infects E. coli might make them more or less
sensitive to lysis during ampicillin treatment. Starting with purified
RNA from sensitive and insensitive strains, how could you detect viral
RNA using a PCR-based assay and compare the levels of viral RNA
between the two samples [2 pt] (280 character maximum)?

• Hypotonic
• Water enters the cell by osmosis and, without a cell wall to prevent lysis
(due to ampicillin treatment), the bacteria lyse
• [Possibility 1] Do RT-PCR using primers specific for the viral RNA (1pt).
Compare the PCR products on a gel; the fatter the band, the more RNA
present in the initial sample (1pt)
[Possibility 2] Do RT-qPCR using primers specific for the viral RNA (1).
Fluorescence will increase more rapidly in the sample with more viral RNA
OR it will have a lower Ct (1pt).

49. Consider the free energy diagram below, for a reaction in which
reactants (R) are converted to products (P). What is the activation
energy of the uncatalyzed forward reaction (RP) [1pt]? What is the
activation energy of the catalyzed reverse reaction [1pt]? Is the
reaction RP endergonic or exergonic [1 pt]? How could this reaction
proceed in a cell (140 character strict limit)?
• 10 kcal/mol
• 3 kcal/mol
• Endergonic
• Couple it to an exergonic reaction such as ATP hydrolysis

50. If you treat an E. coli cell with an allosteric inhibitor that

completely inhibits primase, what do you expect to happen to the
following processes (Maximum 10 words per answer – 1 word is fine):
A. Initiation of new leading strands
B. Ongoing synthesis of leading strands currently being extended
C. Initiation of new Okazaki fragments on the lagging strand
D. Removal of pre-existing RNA primers by DNA polymerase I

[1 pt each]
A. Stops
B. Continues
C. Stops
D. Continues

51. A typical cancer cell exhibits a high level of aerobic glycolysis

(i.e. converts most glucose to lactate regardless of whether oxygen is
present). How would treating this cell with the mitochondrial uncoupler
DNP affect its ATP production [1 pt]? Explain why (strict 280 character
limit) [1 pt]. This cell also has active telomerase: predict the net
change in length of its linear chromosomes over the course of many
rounds of DNA replication and cell division [1 pt]; explain your answer,
making explicit reference to the contributions of lagging-strand
synthesis and telomerase [1 pts: strict 400 character limit].

• DNP will not affect ATP production (also give a point for saying it will be
slightly reduced, assuming the answer to the next part makes it clear that
they understand)
• Because DNP uncouples the mitochondrial electron transport chain, which
is not used for ATP production in this cell
• Overall chromosomes do not shorten over successive divisions (can also
give a point for saying they get longer, or saying that they shorten only very
slightly)
• Chromosomes will tend to shorten due to fact that lagging-strand synthesis
cannot proceed all the way to the end of the linear chromosome (0.5pt), but
this will be offset by telomerase extending the telomeres (0.5pt)

52. A student is running gels to sequence a DNA fragment as below.

In addition to running four sequencing reactions with the requisite
ddNTPs, they also include four ‘mystery’ reactions representing
variants of the first sequencing lane (intended to use ddTTP to
sequence T in the template) in which one or more components of the
reaction have been omitted, substituted, or inappropriately added. Give
a possible explanation for the what was inappropriately
added/omitted/substituted in each mystery lane.

Note two important things: firstly, even if everything works perfectly there is
still always some unextended primer in a reaction. Secondly, there may be
more than one possible explanation for some lanes; just give one.
4 pts – 1 per answer

Mystery 1. ‘No DNA polymerase’ OR ‘no template’ OR ‘no dNTPs’ OR no buffer

Mystery 2. Added ddATP instead of ddTTP
Mystery 3. Added all four ddNTPs
Mystery 4. No dTTP (also give the point for ‘too much dTTP’)