Stuvia 1206402 Chapter 07 Control of Gene Expression Molecular Biology of The Cell Sixth Edition Bruce Alberts Test Bank Questions With Answer Key

CHAPTER 07 CONTROL OF GENE EXPRESSION
MOLECULAR BIOLOGY OF THE CELL, SIXTH EDITION

BRUCE ALBERTS TEST BANK QUESTIONS WITH
ANSWER KEY
written by
Laudabletasks
www.stuvia.com
Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Distribution of this document is illegal $103 per month?
Stuvia.com - The Marketplace to Buy and Sell your Study Material
MOLECULAR BIOLOGY OF THE CELL, SIXTH EDITION

BRUCE ALBERTS TEST BANK
Chapter 7: CONTROL OF GENE EXPRESSION
1 Indicate true (T) and false (F) statements below regarding gene control. Your answer
would be a four-letter string composed of letters T and F only, e.g. TTFT.
( ) Development of multicellular organisms from a fertilized egg only rarely involves DNA
rearrangements in specialized cells.
( ) A typical human cell expresses less than 1% of its approximately 30,000 genes at any
given time.
( ) Genes that are expressed in all cell types usually vary in their level of expression in
different cell types.
( ) Many differentiated plant cells can be fully de-differentiated and give rise to an entire
plant.
2 In the following schematic graph of a hypothetical set of RNA-seq data, the number of
reads is plotted for a region of chromosome containing two genes, from samples obtained from
two different tissues. Which gene (X or Y) do you think is more likely a “housekeeping” gene?
Which region (1 or 2) within gene Y most likely corresponds to an exon?
Number of reads
1 2
Liver
Brain
Gene X Gene Y
Position on chromosome
A. Gene X; region 1
B. Gene X; region 2
C. Both genes; region 1

D. Gene Y; region 1
E. Gene Y; region 2
3 Studying the expression of a transcription regulatory protein in two cell types, you have
performed experiments showing that the mRNA encoding the protein is present at comparable
levels in the cytosol of both cell types. However, based on the expression of its target genes, you
suspect that the protein activity might be significantly different in the two cell types. Which of the
following steps in expression of the gene encoding this protein is more likely to be differentially
controlled in these cell types?
A. Transcription
B. Translation
C. mRNA transport
D. mRNA degradation
4 In analysis using two-dimensional gel electrophoresis of the proteins expressed in different

cell types, the number of spots that are different in different cells usually exceeds the number of
common spots, and even the common spots can still have different intensities. The spots
representing which of the following proteins would you expect to be among the common spots
when compared across several cell types?
A. RPL10 (a ribosomal protein)
B. HBA1 (a hemoglobin subunit)
C. Insulin (a hormone)
D. Tyrosine aminotransferase (a metabolic enzyme)
E. All of the above
5 What determines the time and place that a certain gene is transcribed in the cell?
A. The type of cis-regulatory sequences associated with it
B. The relative position of cis-regulatory sequences associated with it
C. The arrangement of various cis-regulatory sequences associated with it
D. The specific combination of transcription regulators present in the nucleus
E. All of the above
6 The majority of transcription regulators make sequence-specific contacts with DNA in the
major groove. In the two diagrams below, where are the contact surfaces that are exposed in the
major groove?

A. 1, 3
B. 1, 4
C. 2, 3
D. 2, 4
7 Considering the diagrams below that show hydrogen-bond donors and acceptors as well as
hydrophobic groups in four DNA base pairs, which of the following do you think is the most
difficult to accomplish by DNA-binding proteins?

A. Distinguishing between A-T and T-A in the major groove

B. Distinguishing between A-T and C-G in the major groove
C. Distinguishing between C-G and G-C in the major groove
D. Distinguishing between C-G and G-C in the minor groove
E. Distinguishing between C-G and T-A in the minor groove
8 Protein subunits that interact specifically with DNA sequences …

A. typically recognize sequences of two to three nucleotide pairs in length.
B. do so via hydrogen bonds, ionic bonds, and hydrophobic interactions.
C. typically form about five weak interactions at the protein–DNA interface.
D. often bind loosely to DNA.
E. All of the above.
9 Which of the following DNA-binding motifs uses β sheets to recognize DNA bases?
A. The helix–turn–helix motif
B. The leucine zipper
C. The zinc finger motif
D. The helix–loop–helix motif
E. None of the above

10 The following sequence logo represents the preferred cis-regulatory sequences of an

imaginary transcription regulator that functions as a dimer. Would you expect this sequence to be
recognized by a homodimer (M) or a heterodimer (T)? Write down M or T as your answer.
Information content
2 4 6 8 10 12 14 16
Position
11 A DNA-binding protein recognizes a specific eight-nucelotide sequence in DNA.

Assuming that its binding is perfectly specific, how many binding sites are expected to exist for it
in human genomic DNA, which is composed of about 6 × 109 nucleotide pairs? What about if the
protein forms a homodimer? Note that the target sequence can be oriented either way in the
double-stranded DNA.
A. About 200,000; about 30,000
B. About 2000; about 300
C. About 200; about 30
D. About 200,000; about 300
E. About 200,000; about 3
12 A DNA-binding protein binds cooperatively to DNA by fairly weak homodimerization.

The binding of this protein to DNA …
A. shows a sigmoidal binding curve.

B. occurs in more of an all-or-none manner, compared to a protein that is a constitutive

dimer.
C. occurs despite the fact that the protein molecules are predominantly monomers in
solution.
D. All of the above.
13 Indicate true (T) and false (F) statements below regarding transcription regulators. Your
answer would be a four-letter string composed of letters T and F only, e.g. TTTF.
( ) About 10% of the protein-coding genes in most organisms encode transcription
regulators.
( ) The packaging of eukaryotic DNA into chromatin dampens the effect of cooperative
binding of transcription regulators.
( ) Some DNA-binding proteins can induce bends or kinks in their target DNA.
( ) Dimerization of transcription regulators increases the chance of binding to nonspecific
sequences.
14 The Trp operon in Escherichia coli encodes the components necessary for tryptophan
biosynthesis. In the presence of the amino acid in a bacterium, …
A. the tryptophan operator is bound to the tryptophan repressor.
B. the tryptophan repressor is bound to bacterial RNA polymerase.
C. the expression of the tryptophan repressor is shut off.
D. the operon genes are expressed.
15 Under which of the following conditions is the Lac operon in Escherichia coli fully turned
on?
A. Low glucose and lactose levels
B. Low glucose but high lactose levels
C. High glucose but low lactose levels
D. High glucose and lactose levels
E. Low cAMP and high glucose levels
16 Consider a cis-regulatory enhancer sequence in the Escherichia coli chromosome that is

located thousands of nucleotide pairs upstream of the gene that it regulates. If the regulatory
sequence is mutated to become nonfunctional, the introduction of the wild-type enhancer on a
plasmid fails to regulate the gene. This implies that …

A. the regulatory sequence encodes a regulatory protein that binds near the promoter of
the target gene and controls RNA polymerase binding.
B. the regulation of the target gene involves looping out of the intervening DNA, and the
promoter of the cis-regulatory sequence must be on the same chromosome.
C. the regulatory sequence can bind directly to the RNA polymerase.
D. the regulatory sequence cannot bind to a protein.
17 Transcription regulation has similarities and differences in bacteria and in eukaryotes.

Which of the following is correct in this regard?
A. Most bacterial genes are regulated individually, whereas most eukaryotic genes are
regulated in clusters.
B. The rate of transcription for a eukaryotic gene can vary in a much wider range than for
a bacterial gene (which is, at most, only about 1000-fold).
C. DNA looping for gene regulation is the rule in bacteria but the exception in
eukaryotes.
D. Transcription regulators in both bacteria and eukaryotes usually bind directly to RNA
polymerase.
E. The default state of both bacterial and eukaryotic genomes is transcriptionally active.
18 Which of the following is directed by transcription activators in eukaryotic cells in order to

provide a more accessible DNA for the transcription machinery?
A. Nucleosome remodeling
B. Histone removal
C. Histone replacement
D. Histone modifications
E. All of the above
19 The following schematic drawing represents the activation of transcription for a

eukaryotic gene (gene X). Indicate what component (A to D) in the drawing corresponds to each
of the following. Your answer would be a four-letter string composed of letters A to D only, e.g.
ADBC.

B
D
( ) Mediator
( ) cis-Regulatory sequence
( ) A general transcription factor
( ) “Spacer” DNA that may encode lncRNAs
20 To prevent spurious transcription from a gene, acetylation of histones—which is carried

out by histone acetyl transferases ahead of a moving RNA polymerase II—is quickly reversed by
histone deacetylases and histone methyl transferases in the wake of the polymerase, leaving a trail
of specific methylated histones. Which of the following curves do you think better represents the
distribution of this specific histone methylation mark with respect to a gene?

Degree of methylation
A B
Transcribed region
Promoter
Genomic location
21 Two transcription activators cooperate to recruit a coactivator to a cis-regulatory

sequence and activate transcription of a nearby gene. If each of the activators increases the affinity
of the coactivator for the reaction site (and therefore the rate of transcription) by 100-fold, how
much would you expect the affinity to increase when both activators are bound to DNA compared
to when none is bound?
A. 10-fold
B. 100-fold
C. 200-fold
D. 10,000-fold
22 In the following schematic diagram of a region of a mammalian genome, genes A to D

(triangles) are located in between a number of insulator elements (white squares) and barrier
sequences (black squares). If the cis-regulatory sequence (oval) is bound by an abundant
repressor protein, which gene would you expect to be expressed at a higher rate in this cell?
A B C D Heterochromatin

Reference: Even-skipped Regulatory Module (Questions 23-26)

Expression of the Even-skipped (Eve) gene in early Drosophila embryos is under the control of
several transcription regulators. In one example, one of the Eve stripes is positioned near the
anterior region of the embryo, and its regulatory module contains binding sites for Bicoid and
Hunchback (activators) as well as Giant and Krüppel (inhibitors) such that the gene is expressed
only in the region where concentrations of the two activators are high and the concentrations of
the two inhibitors are low. A reporter gene can be placed under the control of this module, and it
can be shown to form a stripe in the same place in the embryo as the corresponding stripe of Eve.
Answer the following question(s) based on these findings.
23 In the following schematic diagrams of an early Drosophila embryo, in which region

would you expect to find the reporter protein put under the control of the regulatory module
mentioned above?

Bicoid
Hunchback
Giant
Krüppel
A B C D E
24 What would you expect to happen to the pattern of reporter expression in flies that lack
the gene encoding Giant?
A. It would be expressed in all seven stripes.
B. It would be expressed in stripe 5 only.
C. It would expand to cover a broad anterior region of the embryo.
D. It would fail to express efficiently in the stripe 2 region.
E. It would be expressed throughout the whole embryo.
25 What would you expect to happen to the pattern of reporter expression in flies that lack
the gene encoding Bicoid?
A. It would be expressed in all seven stripes.
B. It would be expressed in stripe 5 only.
C. It would expand to cover a broad anterior region of the embryo.
D. It would fail to express efficiently in the stripe 2 region.

E. It would be expressed throughout the whole embryo.
26 In the Eve regulatory modules, the binding sites for Giant and Krüppel are usually close
to, or even overlapping with, those of Bicoid and Hunchback. This implies that Eve expression is
regulated by … between the activators and regulators.
A. Feedback regulation
B. Cooperation
C. Competition
D. Feed-forward regulation
27 In the following schematic drawings showing four different network motifs in gene
transcription circuits, indicate whether each of the motifs 1 to 4 corresponds to a feed-forward
loop (E), flip-flop device (F), negative feedback loop (N), or positive feedback loop (P). Your
answer would be a four-letter string composed of letters E, F, N, or P only, e.g. PNEF.
A A A A
B B B B
C C C C
1 2 3 4
Answer: PENF Difficulty: 2 Section: Molecular Genetic Mechanisms that Create

and Maintain Specialized Cell Types
Feedback: The circuits 1 and 3 include indirect feedback loops (with positive and negative
feedback, respectively). Circuit 4 has two interconnected flip-flop switches.

Reference: Feed-forward Loops (Questions 28-30)

Consider the two feed-forward loops below containing three transcription regulators A, B, and C,
where A receives the input signal and C generates the output. In the so-called coherent loop (left),
A activates C both directly and indirectly, whereas in an incoherent loop (right), A activates C via
one route and inactivates it via the other. Answer the following question(s) based on these
network motifs.
A A
B B
C C
Coherent Incoherent
28 Considering the two particular feed-forward designs shown, would you expect the
coherent (C) or the incoherent (I) loop to have a stable output and respond best to input signals
that are above a certain threshold? Write down C or I as your answer.
29 Considering coherent and incoherent feed-forward loops, eight different designs are
possible using three components and involving activation (positive) and inhibition (negative)
regulation only. In all such loops, A would regulate both B and C, and B would regulate only C.
How many of these designs constitute a coherent loop? Write down your answer as a number, e.g.
7.
30 Would you expect a coherent (C) or an incoherent (I) loop to generate the following
response pattern? In this example, A is stimulated by the input, and the transcription of C is
measured as the output. Write down C or I as your answer.

Signal
Input
Output
0
Time
31 Indicate true (T) and false (F) statements below regarding DNA methylation in humans.
Your answer would be a four-letter string composed of letters T and F only, e.g. TTTF.
( ) Methylation of adenines is the most common DNA methylation in humans.
( ) Methylated cytosine can be accidentally deaminated to produce thymine, leading to a
C-to-T transition.
( ) Cytosine methylation often occurs within a 5′-CG-3′ sequence.
( ) Shortly after fertilization, a genome-wide wave of demethylation takes place.
32 Indicate true (T) and false (F) statements below regarding DNA methylation in humans.
Your answer would be a four-letter string composed of letters T and F only, e.g. TTTF.
( ) DNA methylation makes repression of gene expression “leakier.”
( ) DNA methylation at the promoter region is usually an indication of active
transcription.
( ) CG islands are nonpermissive for RNA polymerase assembly.
( ) The dinucleotide 5′-GC-3′ is much more common than 5′-CG-3′ in the human genome.
33 Indicate which of the following enzymatic activities corresponds to A, B, or C in the

following schematic drawing of DNA methylation events in the human genome. Your answer
would be a three-letter string composed of letters A, B, and C only, e.g. CBA.

Genomic DNA after Methyl group

replication
C B
( ) DNA demethylating enzyme

( ) Maintenance methyl transferase enzyme
( ) De novo methyl transferase enzyme
34 Beckwith-Wiedemann syndrome in humans is characterized by “overgrowth” in childhood,

sometimes leading to unusually large parts of the body. An imprinted gene cluster on chromosome
11 is associated with this disease. The cluster contains several genes including Igf2 and H19. Igf2
encodes an insulin-like growth factor that is maternally imprinted, i.e. the maternal copy is not
expressed. However, the DNA methylation pattern of this locus is not different between the two
homologous chromosomes. On the other hand, H19 is also imprinted and its methylation pattern
does differ between the two parental chromosomes. H19 is transcribed into a noncoding RNA that
appears to silence the transcription of the Igf2 gene in cis. Would you expect the H19 locus to be
hypermethylated in the maternally inherited chromosome (M) or paternally inherited chromosome
(P)? Write down M or P as your answer.
35 In the following pedigree, females and males are indicated by circles and squares,
respectively, and the presence of a rare disease caused by a loss-of-function mutation in an
imprinted autosomal gene is indicated by black color. Is the gene maternally imprinted (M; i.e. not

expressed from the maternally inherited chromosome) or paternally imprinted (P)? Write down M
or P as your answer.
36 Which of the following is true regarding genomic imprinting?

A. It is an epigenetic phenomenon.
B. It occurs in most animals.
C. It always involves inactivation of genes through direct DNA methylation.
D. It can “unmask” recessive alleles but cannot “mask” dominant ones.
37 You have engineered the X chromosomes in female mice such that one X chromosome
expresses green fluorescent protein when active, while the other expresses red fluorescent protein.
You have used these mice to study cancer in females. You know that each tumor is a clonal
cellular proliferation, meaning all of its proliferating cells are descendants of a single original
cancer-causing cell. It follows that, unless X-chromosome inactivation is perturbed in tumors, …
A. all tumor cells in one mouse should express the same fluorescent protein (either red or
green), but tumor cells from different mice can show either red or green fluorescence.
B. the cells in any tumor should all express the same fluorescent protein (either red or
green), but independently derived tumors in the same mouse can show either green or
red fluorescence.
C. different cells within each tumor can express different fluorescent proteins, and the
tumors would therefore show yellow fluorescence, but each cell shows either red or
green fluorescence.
D. each cell can express both fluorescent proteins and would therefore emit yellow
fluorescence, and the tumors would glow in yellow as well.

E. different tumors would show red, yellow, or green fluorescence.

38 Fill in the blank in the following paragraph regarding X-chromosome inactivation. Do not
use abbreviations.
“The presence of two copies of the X chromosome in females but
only one in males poses a potential problem for regulation of gene
expression: everything else being equal, the higher copy number of
the X-linked genes can lead to an imbalanced overproduction of
their products in females compared to males. Organisms have
evolved different … mechanisms to solve this problem. In
mammals, for example, the almost complete inactivation of one of
the X chromosomes provides the solution to the dosage problem.”
39 Two copies of the gene A exist in a diploid mammal. However, only one copy is expressed
in every somatic cell. Different somatic cells in the body of each organism have inactivated one or
the other allele in a seemingly random fashion, but when they divide, the daughter cells inherit the
choice of the inactive allele faithfully. This is an example of …
A. X-inactivation
B. Genomic imprinting
C. Loss of heterozygosity
D. Monoallelic gene expression
E. Alternative gene splicing
40 Indicate true (T) and false (F) statements below regarding riboswitches. Your answer
would be a four-letter string composed of letters T and F only, e.g. TTTF.
( ) A riboswitch permits transcription elongation only when bound to its small-molecule
ligand.
( ) Riboswitches appear to be a modern evolutionary invention.
( ) Riboswitches are often located near the 3′ end of mRNAs, and therefore fold after the
rest of the mRNA.
( ) Riboswitches are exclusively found in prokaryotes.
41 In the following schematic diagram of five pairs of alternative RNA splicing patterns,
which pair depicts exon skipping only? In exon skipping, an exon is spliced out of the RNA
transcript along with its flanking introns. In the diagram, exons are colored dark blue and introns
are colored yellow. Light blue indicates possible exons.

42 Imagine a gene encoding a pre-mRNA with twelve exons, ten of which can be alternatively
spliced in vivo. Assuming that alternative splicing for this RNA only occurs through exon
skipping, how many different proteins can possibly be made from this pre-mRNA as a result of
alternative splicing?
A. About 10
B. About 20
C. About 100
D. About 200
E. About 1000
43 The alternative splicing of a certain transcript can result in the production of two mRNA
isoforms, one predominant in muscle cells and the other in neurons. The gene contains an exon
that is skipped in muscle cells but retained in neurons. You create a mutant version of the gene in
which the 3′ splice site near this exon is deleted. However, when you introduce this into a culture
of neural cells, an even longer pre-mRNA is produced, consistent with the activation of a
secondary splice site located near the deleted one. Is the secondary splice site within the exon (E)
or its neighboring intron (I)? Write down E or I as your answer.

44 Stimulated B lymphocytes switch from the synthesis of membrane-bound to secreted

antibody molecules by increasing the concentration of a subunit of the trimeric CstF complex that
cleaves and polyadenylates mRNAs. How does this up-regulation of CstF bring about the
production of soluble antibodies?
A. It favors a strong polyadenylation site in the immunoglobulin primary transcript,
creating a longer antibody molecule that is secreted.
B. It activates a weak polyadenylation site in the immunoglobulin primary transcript and
prevents splicing, creating a shorter molecule that is secreted.
C. It favors a strong polyadenylation site in the immunoglobulin primary transcript,
creating a shorter antibody molecule that is secreted.
D. It activates a weak polyadenylation site in the immunoglobulin primary transcript,
creating a longer antibody molecule that is secreted.
E. It favors a strong polyadenylation site in the immunoglobulin primary transcript,
aborting translation and creating a shorter antibody molecule that is secreted.
45 Indicate true (T) and false (F) statements below regarding RNA editing. Your answer
would be a four-letter string composed of letters T and F only, e.g. TTTF.
( ) RNA editing in animal cells mainly takes place through adenine or cytosine
deamination.
( ) RNA editing can change the pattern of pre-mRNA splicing.
( ) RNA editing in coding regions can result in changes in the protein sequence.
( ) Retroviruses such as HIV encode RNA-editing components to confront the host
defense mechanisms.
46 You have transfected HeLa cells with a gene encoding the human immunodeficiency virus
(HIV) protein Rev and have induced the expression of the protein. You incubate the cell culture in
the presence or absence of leptomycin B and later measure the localization of Rev inside the cells
by immunofluorescence microscopy. Leptomycin B specifically inhibits the cellular Crm1 protein,
a nuclear transport receptor that is essential for the normal function of Rev in the HIV life cycle.
Your results are tabulated below. Which condition (1 or 2) do you think corresponds to the
presence of leptomycin B?
Condition Cytoplasmic Rev (%) Nuclear Rev (%)

1 30 70

2 3 97
47 When unfolded proteins accumulate in the lumen of the endoplasmic reticulum due to
inefficient folding conditions, a membrane-bound protein kinase is activated and phosphorylates a
subunit of the translation initiation factor eIF2. Indicate which of the following events would (Y)
or would not (N) occur as a result. Your answer would be a four-letter string composed of letters
Y and N only, e.g. YYYY.
( ) eIF2 binds tightly to the ribosome.
( ) Translation initiation is stimulated.
( ) The GDP-bound form of eIF2 accumulates.
( ) eIF2B is activated.
48 A researcher studying the human immunodeficiency virus (HIV) has infected human T
cells with wild-type or Rev-deficient viruses. She extracts cytoplasmic RNA from the cells and
separates each isolated RNA mixture by agarose-gel electrophoresis. She then uses northern
analysis using HIV-specific probes to identify those bands that contain viral RNA. The results are
presented in the following schematic drawing. Which lane (1 or 2) corresponds to cells infected
with the Rev-deficient virus? What is the size of the full-length HIV genome?
1 2
Apparent length
(×1000 nt)
A. Lane 1; about 9000 nucleotides

B. Lane 1; about 4000 nucleotides
C. Lane 1; about 2000 nucleotides
D. Lane 2; about 9000 nucleotides
E. Lane 2; about 2000 nucleotides

49 Some viruses encode a protease that cleaves the translation initiation factor eIF4G,
rendering it unable to bind to eIF4E. What is the consequence of this cleavage?
A. It shuts down most of the cellular translation machinery, which causes the release of
virus particles.
B. It favors viral protein synthesis because IRES-dependent translation initiation is
inhibited.
C. It shuts down most host-cell protein synthesis and diverts the translation machinery to
IRES-dependent initiation, thus favoring viral protein synthesis.
D. It favors viral protein synthesis by shutting down translation from uORFs.
E. It shuts down IRES-dependent translation, forcing the virus into latency.
50 Gcn4 is a protein kinase that can phosphorylate and inactivate the initiation factor eIF2.
The Gcn4 mRNA contains several short upstream open reading frames (uORFs) that negatively
regulate its translation initiation. The phosphorylation of eIF2 by Gcn4, therefore, can control
Gcn4 expression …
A. in a negative feedback loop.
B. in a positive feedback loop.
C. in a feed-forward loop.
51 Indicate true (T) and false (F) statements below regarding mRNA stability and
degradation. Your answer would be a four-letter string composed of letters T and F only, e.g.
TTFT.
( ) Any factor that affects the translation efficiency of an mRNA tends to have the
opposite effect on its degradation.
( ) Decapping of mRNA normally occurs after poly-A tail shortening removes the poly-A
tail and starts chewing into the 3′-UTR.
( ) Most mRNA decay in the cells generally proceeds via endonucleolytic cleavage.
( ) As a general rule, eukaryotic mRNAs have a shorter half-life compared to bacterial
mRNAs.
52 Under iron-starvation conditions in the cell,

A. cytosolic aconitase binds to the 3′ UTR of the mRNA encoding the transferrin
receptor.
B. cytosolic aconitase binds to the 3′ UTR of the mRNA encoding ferritin.
C. cytosolic aconitase blocks translation of the mRNA encoding the transferrin receptor.
D. the mRNA encoding the transferrin receptor is cleaved by an endonuclease.

53 Indicate true (T) and false (F) statements below regarding P-bodies. Your answer would
be a four-letter string composed of letters T and F only, e.g. TTFT.
( ) P-bodies are membrane-enclosed organelles scattered throughout the cytoplasm.
( ) mRNAs that are to be degraded are transferred from P-bodies to stress granules
containing decapping and exonuclease enzymes.
( ) When translation initiation is blocked, stress granules typically shrink.
( ) mRNAs associated with stress granules are primed for translation.
54 Which of the following classes of noncoding RNAs is NOT directly involved in RNA
interference?
A. miRNA
B. snoRNA
C. piRNA
D. siRNA
55 Indicate whether each of the following descriptions better matches miRNAs (M) or
siRNAs (S) in animal cells. Your answer would be a four-letter string composed of letters M and
S only, e.g. MMMM.
( ) They usually cleave their target RNAs using the slicing activity of the Argonautes.
( ) They typically show perfect complementarity with their target RNA.
( ) They can bind to the RITS as well as the RISC complex.
( ) They seem to be the more ancient form of small noncoding RNAs.
56 Which strand in an miRNA precursor will serve as the guide strand in the RNA-induced
silencing complex (RISC)? Analysis of miRNA sequences has revealed an asymmetry in the
stability of the double-stranded RNA precursor. The strand showing lower thermodynamic
stability near its 5′ end (nucleotides 2 to 6 in the mature guide strand) is normally selected as the
guide strand, and the other strand is usually degraded. In the following miRNA precursor, which
strand (1 or 2) do you think will be incorporated into the active RISC? Write down 1 or 2 as your
answer.

1 5′ CAAAGUGCUUACAGCGCAGGUAG 3′
2 3′ GAUGUUCACGGAAGUGGCGUC-A 5′
57 The schematic diagram below shows the processing of a class of small RNAs that are
involved in RNA interference (RNAi). Which of the following is true regarding these RNAs?
58 What is the function of RNA-dependent RNA polymerases in RNAi?

A. They prevent the spread of the RNAi pathway by replicating the target RNAs.
B. They help amplify the RNAi response by replicating the target RNAs.
C. They produce additional copies of the siRNAs to ensure that the RNAi response is
sustained and spread.
D. They are viral proteins that prevent the spread of RNAi by preferentially replicating
siRNA sponges.
59 A certain region of a mammalian genome is transcribed at low but sustained levels using
two flanking promoters. The RNA products are annealed together, processed, and used to recruit
the RITS complex to this region, as well as chromatin modifying enzymes, RNA-dependent RNA
polymerase, and a Dicer enzyme. Indicate whether this pathway is more closely related to that
seen in miRNA (M), piRNA (P), or siRNA (S) interference pathways. Write down M, P, or S as
your answer.

60 In many animals, siRNAs can only function within the cell in which the siRNA is
introduced. In contrast, the worm Caenorhabditis elegans can be fed with bacteria that synthesize
double-stranded RNAs, and the RNAi spreads throughout the animal. A genetic screen to identify
genes involved in systemic RNAi led to the discovery of Sid-1, a transmembrane protein
expressed in most tissues in the adult worm. Loss-of-function mutations in the gene encoding Sid-
1 restrict the RNAi activity to the cells surrounding the digestive tract after siRNA feeding.
Ectopic expression of Sid-1 in Drosophila melanogaster cells that normally lack systemic RNAi
and are unable to take up siRNAs from the medium, enables these cells to passively take up
siRNA . These findings suggest that …
A. Sid-1 is necessary and sufficient for systemic RNAi and siRNA uptake, respectively.
B. Sid-1 is necessary but not sufficient for systemic RNAi and siRNA uptake,
respectively.
C. Sid-1 is not necessary but is sufficient for systemic RNAi and siRNA uptake,
respectively.
D. Sid-1 is not necessary and not sufficient for systemic RNAi and siRNA uptake,
respectively.
61 Comparing the bacterial CRISPR system and the eukaryotic RNAi mediated by siRNAs,
indicate whether each of the following CRISPR components is most analogous to Argonaute (A),
siRNA (S), or target mRNA (T) in the RNAi pathway. Your answer would be a three-letter string
composed of letter A, S, and T only.
( ) Cas
( ) Viral DNA
( ) crRNA
62 Consider the descriptions below for three different lncRNAs, and determine whether they
function in cis (C) or in trans (T). Your answer would be a three-letter string composed of letters
C and T only, e.g. CCT.
( ) The tsiX RNA is transcribed from the X-inactivation center in the X chromosome that
will not be inactivated. It is antisense with respect to Xist, repressing its transcription
and function.
( ) The ANRIL lncRNA is an antisense transcript in a gene cluster expressing inhibitors of
cell-cycle proteins. It silences the entire cluster by recruiting heterochromatin proteins
of the Polycomb group.

( ) The PTENP1 lncRNA is similar to an mRNA that encodes the protein PTEN, and
contains many of the miRNA response elements present in PTEN mRNA; it therefore
protects the PTEN mRNA from miRNA-mediated silencing by acting as a decoy.

Answers:
1. Answer: TFTT
Difficulty: 1
Section: An Overview of Gene Control
Feedback: The changes in gene expression that underlie the development of multicellular
organisms do not generally involve changes in the DNA sequence of the genome. At any
one time, a typical human cell expresses 30–60% of its approximately 30,000 genes at
some level. But even those genes that are expressed in all cell types usually vary in their
level of expression from one cell type to the next. Under the right conditions,
differentiated plant cells can regenerate an entire adult plant.
2. Answer: D
Difficulty: 3
Feedback: A housekeeping gene is expected to be expressed in nearly all cells, including
brain and liver cells. This is the case for gene Y, for which the mRNA levels are significant
in both cell types, according to the RNA-seq data. The regions with higher numbers of
reads in the RNA-seq results correspond to exons.
3. Answer: B
Difficulty: 2
Feedback: Since the mRNA levels are similar in both cell types, difference in protein
activity can be attributed to differences in translation or in post-translational control.
4. Answer: A
Difficulty: 2
Feedback: Ubiquitously expressed gene products include ribosomal proteins, DNA and
RNA polymerases, and DNA repair enzymes, among others.
5. Answer: E
Difficulty: 2
Section: Control of Transcription by Sequence-specific DNA-binding Proteins
Feedback: The expression of a gene can be determined by its cis-regulatory sequences and
transcription regulators that function in trans.
6. Answer: B
Difficulty: 2
Feedback: Nearly all transcription regulators make the majority of their contacts with the
major groove (1 and 4 in the drawings) because the major groove is wider and displays
more molecular features than does the minor groove (2 and 3).
7. Answer: D
Difficulty: 2
Feedback: In the minor groove, precise recognition of A-T versus T-A (or C-G versus G-
C) is not readily feasible. However, an A-T can still be distinguished from C-G, for
example.
8. Answer: B

Difficulty: 1
Feedback: DNA-binding proteins typically recognize specific sequences that are 5 to 10
nucleotide pairs in length. This involves forming 20 or so weak interactions at the
interface, including hydrogen-bonding, ionic bonding, and hydrophobic interactions. The
sum of all protein–DNA interactions can result in high affinity and specificity.
9. Answer: E
Difficulty: 1
Feedback: All of the examples presented in A to D use α helices to interact with DNA. A
limited number of DNA-binding motifs use β sheets to recognize DNA bases.
10. Answer: T
Difficulty: 3
Feedback: Homodimeric transcription regulators typically have a symmetrical arrangement
which is reflected in their target DNA sequence in the form of an inverted repeat. The
sequence logo shown is not in agreement with an inverted repeat, or even a direct repeat;
the DNA is therefore expected to be recognized by a heterodimer.
11. Answer: E
Difficulty: 3
Feedback: The expected number of target 8-mer sequences is calculated as:
(6 × 109 8-mer/genome) × (2 orientations per double strand) / (48 8-mers/target sequence)
= ~200,000 target sequences/genome.
Similarly, the expected number of target 16-mer sequences is calculated as:
(6 × 109 16-mer/genome) × (2 orientations per double strand) / (416 16-mers/target
sequence)
= ~3 target sequences/genome.
12. Answer: D
Difficulty: 1
Feedback: Cooperative binding creates a sigmoidal binding curve with two main states: at
low protein concentrations, the protein is mostly a monomer and the binding site on DNA
is mostly unoccupied; at high protein concentrations, the great majority of the DNA sites
are occupied by the protein dimer.
13. Answer: TFTF
Difficulty: 1
Feedback: Nucleosome packaging of DNA and dimerization of transcription regulators
promote cooperative DNA binding by these proteins. Some proteins that bind to DNA can
significantly bend the DNA molecule. About 10% of protein-coding genes in most cells
encode transcription regulators, making them one of the largest classes of proteins in the
cell.
14. Answer: A
Difficulty: 1
Section: Transcription Regulators Switch Genes On and Off

Feedback: When tryptophan is present, it binds to the repressor which then binds to the
operator to turn off the operon.
15. Answer: B
Difficulty: 1
Feedback: The Lac operon is fully turned on when glucose is absent AND lactose is
present.
16. Answer: B
Difficulty: 2
Feedback: DNA looping can occur during bacterial gene regulation, where the intervening
DNA acts as a tether to enormously increase the probability that the proteins bound near
the promoter and those bound to the cis-regulatory sequences will collide with each other.
This effect requires that both sequences be on the same DNA molecule, or be somehow
linked physically.
17. Answer: B
Difficulty: 2
Feedback: Variation in transcription rates across the genome is much greater in eukaryotic
cells (about one million-fold) compared to prokaryotic cells (about one thousand-fold). In
eukaryotes, genes are often transcribed and regulated individually, and DNA looping
occurs in the regulation of nearly every gene. In these cells, transcription regulators often
assemble in groups and do not directly contact RNA polymerases. The default state of
most eukaryotic DNA packaged into nucleosomes is off.
18. Answer: E
Difficulty: 1
Feedback: Eukaryotic transcription activator proteins can direct local alterations in
chromatin structure. This can be achieved through covalent histone modifications,
nucleosome remodeling or removal, and histone replacement.
19. Answer: DBAC
Difficulty: 2
Feedback: Please refer to Figure 7–17.
20. Answer: B
Difficulty: 3
Feedback: The methylation mark would be found in the body of actively transcribed genes
(but not near their promoter, which requires a more open nucleosome packaging).
21. Answer: D
Difficulty: 2
Feedback: The combined effect of two transcription activators binding to the same
regulatory sequence in DNA is synergistic, not simply additive.
22. Answer: C

Difficulty: 3
Feedback: Gene D is not protected from heterochromatin expansion by any barrier
sequence, while genes A and B are repressed by the cis-regulatory element bound to a
repressor. Gene C, however, is not under these repressive effects, thanks to its flanking
insulator elements and barrier sequences.
23. Answer: B
Difficulty: 1
Refer to: Even-skipped Regulatory Module
Section: Molecular Genetic Mechanisms that Create and Maintain Specialized Cell Types
Feedback: This module is normally activated in the second stripe, where inhibition is weak
and activation is strong.
24. Answer: C
Difficulty: 2
Feedback: As expected, lack of Giant or Krüppel results in a broad expression pattern for
the second stripe.
25. Answer: D
Difficulty: 2
Feedback: As expected, lack of Bicoid or Hunchback results in an inefficient expression of
the second stripe.
26. Answer: C
Difficulty: 2
Feedback: This helps sharpen the boundaries flanking the Eve stripes.
27. Answer: PENF
Difficulty: 2
Feedback: The circuits 1 and 3 include indirect feedback loops (with positive and negative
feedback, respectively). Circuit 4 has two interconnected flip-flop switches.
28. Answer: C
Difficulty: 3
Feedback: This also depends on the particular parameters of the system. However,
coherent feed-forward motifs are generally more stable and more robust to perturbations.
29. Answer: 4
Difficulty: 2
Feedback: Half of the possible designs yield coherent loops.
30. Answer: I
Difficulty: 3
Feedback: The two-phase response reflects the incoherent nature of this feed-forward
motif.
31. Answer: FTTT

Difficulty: 1
Section: Mechanisms that Reinforce Cell Memory in Plants and Animals
Feedback: The most common DNA methylation in vertebrate DNA occurs on cytosine (C)
nucleotides largely in the sequence 5′-CG-3′. The accidental deamination of the methylated
cytosine can then potentially lead to a mutation. Shortly after fertilization in mammals, a
genome-wide wave of cytosine demethylation takes place and the vast majority of methyl
groups are lost from the DNA.
32. Answer: FFFT
Difficulty: 2
Feedback: DNA methylation helps to make repression of gene expression less leaky. RNA
polymerase is often found bound to promoters within unmethylated CG islands, even when
the associated gene is not being actively transcribed. Except in CG islands, 5′-CG-3′
dinucleotides are rare in vertebrate genomes.
33. Answer: CAB
Difficulty: 2
Feedback: Arrow A represents the maintenance of DNA methylation after DNA
replication, while arrows B and C represent de novo DNA methylation and DNA
demethylation, respectively.
34. Answer: P
Difficulty: 3
Feedback: On the maternally inherited chromosome, H19 is transcribed and silences Igf2.
This does not occur on the paternal chromosome. As a result, Igf2 is maternally imprinted
with no maternal-specific methylation.
35. Answer: M
Difficulty: 3
Feedback: If a disease-causing gene is maternally imprinted, carrier females silently pass it
to the next generation; their sons may have affected children, but their daughters would
not.
36. Answer: A
Difficulty: 2
Feedback: Genomic imprinting, observed in placental mammals and some flowering plants,
is an epigenetic form of inheritance. It is mediated through DNA methylation in mammals,
but it does not always involve gene inactivation by direct methylation. It can unmask
recessive alleles or mask dominant alleles.
37. Answer: B
Difficulty: 2
Feedback: Since different cells in the female body have randomly inactivated one or the
other X chromosome, tumors derived from them will inherit the inactivation pattern and

can therefore express one or the other fluorescent protein. However, all cells within each
tumor are expected to express the same fluorescent protein.
38. Answer: dosage compensation
Difficulty: 2
Feedback: Dosage compensation allows mammals to equalize the dosage of X-
chromosome gene products between males and females.
39. Answer: D
Difficulty: 1
Feedback: Monoallelic expression can result from genomic imprinting, but not all
examples of monoallelic expression are due to imprinting.
40. Answer: FFFF
Difficulty: 2
Section: Post-transcriptional Controls
Feedback: Riboswitches are short RNA sequences that can change conformation upon
ligand binding and regulate transcription. These ancient regulators are common in bacteria
as well as in eukaryotes. They are often found near the 5′ end of mRNAs and fold co-
transcriptionally.
41. Answer: A
Difficulty: 2
Feedback: The alternative splicing event shown in A is exon skipping: the third exon is
missing (together with its flanking introns) in one of the two mRNA variants. Shown in B
is the retention of a single intron (together with its flanking exons) in one of the mRNA
variants.
42. Answer: E
Difficulty: 2
Feedback: Each alternative exon is either skipped or retained, possibly creating 210 (=
~1000) different mature mRNAs.
43. Answer: I
Difficulty: 2
Feedback: The cryptic splice site resides within the upstream intron, resulting in the
production of a longer mRNA when this splice site is chosen.
44. Answer: B
Difficulty: 1
Feedback: The suboptimal cleavage/poly-A addition site in the transcript is encountered
first but is usually skipped in unstimulated B lymphocytes, leading to production of a
longer antibody molecule that is anchored in the plasma membrane. When activated to
produce antibodies, the B lymphocyte increases its CstF concentration; as a result,
cleavage now occurs at the suboptimal site, and the shorter transcript is produced.
45. Answer: TTTF

Difficulty: 1
Feedback: Two principal types of mRNA editing in animals are the deamination of adenine
to produce inosine and, less frequently, the deamination of cytosine to produce uracil.
Both types can have profound effects on the meaning of the RNA message, including
changing the pattern of pre-mRNA splicing or changing the amino acid sequence of the
protein coded by the mRNA. RNA from some retroviruses, including the human
immunodeficiency virus (HIV), is extensively edited by the host cell, presumably as part of
a defense mechanism to hold the virus in check.
46. Answer: 2
Difficulty: 2
Feedback: By inhibiting Crm1, leptomycin B inhibits the nuclear export of Rev, resulting in
its nuclear accumulation.
47. Answer: NNYN
Difficulty: 1
Feedback: Under stress conditions, eIF2 phosphorylation prevents its release from the
guanine nucleotide exchange factor eIF2B, sequestering the latter in a nonfunctional form,
and consequently preventing further eIF2 guanine nucleotide exchange and activation. As
a result, translation initiation is largely inhibited.
48. Answer: D
Difficulty: 1
Feedback: In the absence of a functional Rev protein (lane 2), only the fully spliced viral
RNAs are exported from the nucleus to the cytosol. Rev is required for the export of the
full-length viral RNA.
49. Answer: C
Difficulty: 1
Feedback: Translation of internal ribosome entry site (IRES)-containing mRNAs does not
rely on the common cap-dependent initiation mechanism.
50. Answer: B
Difficulty: 1
Feedback: Since phosphorylated eIF2 promotes the skipping of the uORFs in favor of the
translation of the main Gcn4 ORF, the kinase activity of Gcn4 provides a possible positive
feedback control mechanism.
51. Answer: TFFF
Difficulty: 1
Feedback: Eukaryotic mRNAs are generally more stable than bacterial mRNA. Eukaryotic
mRNA decay is mediated by 5′ exonucleases (after decapping) or 3′ exonucleases, usually
after poly-A tail shortening leaves only about 25 nucleotides of the tail. Since the poly-A
shortening and the translation machinery compete for the same components, factors that

affect one of them also affect the other one in an opposite direction. Some mRNAs are
destroyed by specific endonucleases.
52. Answer: A
Difficulty: 1
Feedback: The iron-sensitive RNA-binding protein aconitase can bind to the 3′
untranslated region (UTR) of the transferrin receptor mRNA and increase production of
the receptor by blocking endonucleolytic cleavage of the mRNA. The addition of iron to
cells results in the release of aconitase from the mRNA and thus decreases the stability of
the mRNA.
53. Answer: FFFT
Difficulty: 1
Feedback: Even though they somehow function as “organelles,” P-bodies are not
membrane-enclosed. Many mRNAs are degraded in P-bodies, but some mRNAs move
from P-bodies to stress granules, which contain mRNA-binding proteins that prime the
mRNAs for translation. Translation itself, however, does not occur in stress granules.
When translation initiation is blocked, stress granules enlarge as more and more
nontranslated mRNAs are stored in them.
54. Answer: B
Difficulty: 1
Section: Regulation of Gene Expression by Noncoding RNAs
Feedback: The small nucleolar RNAs do not function in RNA interference.
55. Answer: SSSS
Difficulty: 2
Feedback: The small interfering RNAs (siRNAs) appear to be the most ancient form of
RNA interference. Having an exact match to their target RNA molecules, they direct the
cleavage of the target. siRNAs can also control transcription of target genes by binding to
the RNA-induced transcriptional silencing (RITS) complex.
56. Answer: 1
Difficulty: 2
Feedback: Note the presence of mismatches and even a bulge along the duplex. Strand 1
contains mostly A-U base pairs, as well as a mismatch, near its 5′ end (left). Strand 2
contains mostly C-G pairs near its 5′ end (right).
57. Answer: C
Difficulty: 2
Feedback: These are miRNAs
58. Answer: C
Difficulty: 1
Feedback: The RNA interference (RNAi) response can be amplified in some organisms
using RNA-dependent RNA polymerases. In these cases, RNA-dependent RNA

polymerases use siRNAs as primers to produce additional copies of double-stranded

RNAs that are then cleaved into siRNAs.
59. Answer: S
Difficulty: 1
Feedback: RNA interference can direct heterochromatin formation, altering the packaging
of nuclear chromatin and expression of genes.
60. Answer: A
Difficulty: 2
Feedback: According to these results, Sid-1 is both necessary for systemic RNAi in the
nematode and sufficient for siRNA uptake in fly cells: without it, systemic RNAi in C.
elegans is lost; additionally, when ectopically expressed, it confers the ability to take up
siRNA in D. melanogaster cells.
61. Answer: ATS
Difficulty: 1
Feedback: Despite lacking homology, these two pathways share similarities: Cas can be
guided by crRNAs to target invading viral DNA; similarly, an Argonaute or Piwi protein
uses siRNAs to seek and cleave target mRNAs.
62. Answer: CCT
Difficulty: 2
Feedback: The first two lncRNAs act in cis; i.e. they affect only the chromosome from
which they are transcribed. The third example, however, acts in trans and regulates the
function of other genes after it diffuses from its site of synthesis.

Powered by TCPDF (www.tcpdf.org)

Stuvia 1206402 Chapter 07 Control of Gene Expression Molecular Biology of The Cell Sixth Edition Bruce Alberts Test Bank Questions With Answer Key

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Stuvia 1206402 Chapter 07 Control of Gene Expression Molecular Biology of The Cell Sixth Edition Bruce Alberts Test Bank Questions With Answer Key

Uploaded by

Copyright:

Available Formats

CHAPTER 07 CONTROL OF GENE EXPRESSION

MOLECULAR BIOLOGY OF THE CELL, SIXTH EDITION

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

MOLECULAR BIOLOGY OF THE CELL, SIXTH EDITION

Chapter 7: CONTROL OF GENE EXPRESSION

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

4 In analysis using two-dimensional gel electrophoresis of the proteins expressed in different

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

A. Distinguishing between A-T and T-A in the major groove

8 Protein subunits that interact specifically with DNA sequences …

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

10 The following sequence logo represents the preferred cis-regulatory sequences of an

11 A DNA-binding protein recognizes a specific eight-nucelotide sequence in DNA.

12 A DNA-binding protein binds cooperatively to DNA by fairly weak homodimerization.

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

B. occurs in more of an all-or-none manner, compared to a protein that is a constitutive

16 Consider a cis-regulatory enhancer sequence in the Escherichia coli chromosome that is

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

17 Transcription regulation has similarities and differences in bacteria and in eukaryotes.

18 Which of the following is directed by transcription activators in eukaryotic cells in order to

19 The following schematic drawing represents the activation of transcription for a

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

20 To prevent spurious transcription from a gene, acetylation of histones—which is carried

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

21 Two transcription activators cooperate to recruit a coactivator to a cis-regulatory

22 In the following schematic diagram of a region of a mammalian genome, genes A to D

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Reference: Even-skipped Regulatory Module (Questions 23-26)

23 In the following schematic diagrams of an early Drosophila embryo, in which region

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

E. It would be expressed throughout the whole embryo.

Answer: PENF Difficulty: 2 Section: Molecular Genetic Mechanisms that Create

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Reference: Feed-forward Loops (Questions 28-30)

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

33 Indicate which of the following enzymatic activities corresponds to A, B, or C in the

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Genomic DNA after Methyl group

( ) DNA demethylating enzyme

34 Beckwith-Wiedemann syndrome in humans is characterized by “overgrowth” in childhood,

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

36 Which of the following is true regarding genomic imprinting?

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

E. different tumors would show red, yellow, or green fluorescence.

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

44 Stimulated B lymphocytes switch from the synthesis of membrane-bound to secreted

Condition Cytoplasmic Rev (%) Nuclear Rev (%)

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

A. Lane 1; about 9000 nucleotides

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

52 Under iron-starvation conditions in the cell,

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

E. All of the above.

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

58 What is the function of RNA-dependent RNA polymerases in RNAi?

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn

Downloaded by: rumeysaoz07 | rumeysaoz07@gmail.com Want to earn