ARTICLE IN PRESS

WAT E R R E S E A R C H 41 (2007) 4204– 4210

Available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/watres

Homoacetogenesis as the alternative pathway for H2 sink

during thermophilic anaerobic degradation of butyrate
under suppressed methanogenesis

Vilailuck Siriwongrungson, Raymond J. Zeng1, Irini Angelidaki

Institute of Environment & Resources DTU, Technical University of Denmark, DK-2800 Lyngby, Denmark

ar t ic l e i n f o abs tra ct

Article history: Butyrate degradation for hydrogen production under conditions suppressing methanogen-
Received 26 November 2006 esis was evaluated in continuously fed-tank reactors operated at 55 1C and started up with
Received in revised form digested manure as inoculum. This study shows that the reaction of butyrate degradation
16 May 2007 to acetate and hydrogen could happen when gas sparging was applied. Gas sparging was
Accepted 16 May 2007 very important for reducing hydrogen partial pressure and made the reaction thermo-
Available online 25 May 2007 dynamically possible. Almost no hydrogen or methane (methane production was
prevented by the addition of 2-bromoethane-sulfonic acid) was detected, indicating that
Keywords:
the H2 produced from butyrate oxidation was consumed in a subsequent step. It was found
Butyrate degradation
by isotope experiments that hydrogen produced from butyrate degradation reacted
Homoacetogenesis
immediately with CO2 to form acetate via homoacetogenesis. When CO2/HCO
3 was not
Hydrogen
14 provided in the system, butyrate degradation was no longer possible and butyrate-
C isotope
degrading cultures were washed out. It was furthermore found that the microorganisms
Suppressed methanogenesis
responsible for homoacetogenesis were likely present in normal anaerobic environments,
Mixed cultures
such as biogas reactors.
& 2007 Elsevier Ltd. All rights reserved.

1. Introduction hydrogen and carbon dioxide. Then acetogenic bacteria

Hydrogen has been widely recognized as an ideal alternative
energy source for fossil fuels. Among the hydrogen production
methods, the most promising and environmentally friendly
method seems to be anaerobic digestion from organic wastes
(Benemann, 1996). Anaerobic digestion is an effective biologi-
cal process to convert complex organic molecules to carbon
dioxide and methane (Reith et al., 2003). It consists of three
major steps with entirely different groups of microorganisms
involved: hydrolysis/acidogenesis, acetogenesis and methano-
genesis. At first, the fermentative bacteria hydrolyze the
polymers to monomers and oligomers, which afterward are
turned to products such as short-chain fatty acids, alcohols,
oxidize propionate, butyrate, and other fatty acids and also
alcohols to acetate, hydrogen and carbon dioxide. Finally,
methanogens (Archaea) utilize acetate and hydrogen to form
methane, which is termed as aceticlastic methanogenesis and
hydrogenotrophic methanogenesis, respectively.
Most of the biohydrogen studies focus on hydrolysis/
acidogenesis, but not on acetogenesis. The reason is that
acetogenesis requires very low hydrogen partial pressure to
favor the thermodynamics of the reactions. For example:
butyrate is a very common end product in acidogenesis. The
reaction of its degradation to acetate is
CH3 CH2 CH2 COO þ 2H2 O22CH3 COO þ Hþ þ 2H2 : (1)

Corresponding author. Tel.: +45 4525 1429; fax: +45 4593 2850.
E-mail addresses: r.zeng@awmc.uq.edu.au (R.J. Zeng), ria@er.dtu.dk (I. Angelidaki).
1
Present address: Advanced Wastewater Management Centre, The University of Queensland, St Lucia 4072, Australia.
0043-1354/$ - see front matter & 2007 Elsevier Ltd. All rights reserved.
doi:10.1016/j.watres.2007.05.037
 ARTICLE IN PRESS
WAT E R R E S E A R C H
The standard Gibbs free energy at pH 7 (DG10 ) of Eq. (1) is
48.3 kJ/mol. In order to make Eq. (1) exergonic, hydrogen
partial pressure should be lower than 5.82  105 atm under
standard conditions (1 M acetate and butyrate). In the
anaerobic digestion process, this is normally achieved by
combination with hydrogenotrophic methanogenesis in
which methane becomes the sink for hydrogen. However,
for biohydrogen production, it is inevitable to eliminate the
utilization of hydrogen by methanogenesis. Nevertheless,
there is another potential hydrogen sink in acetogenesis:
acetate. This reaction is termed homoacetogenesis in which
hydrogen is used to reduce carbon dioxide to acetate as
follows (Lovley and Klug, 1983):
HCO3  þ 2H2 þ 0:5Hþ 20:5CH3 COO þ 2H2 O:
Even though the metabolism of homoacetogenesis has
been known for years, not many studies have been dedicated
to it. Homoacetogenesis was usually observed under psy-
chrophilic conditions as homoacetogens have better ability to
adapt to low temperatures than hydrogenotrophic methano-
gens (Kotsyurbenko et al., 2001; Nozhevnikova et al., 2003).
Under mesophilic or thermophilic conditions, it was taken for
granted that homoacetogenesis cannot compete with hydro-
genotrophic methanogenesis because the latter one gener-
ates more energy (Ahring and Westermann, 1987; Conrad
and Klose, 1999; Fang and Jia, 1999). However, Chen et al.
(2003) reported that when H2 and CO2 were supplied as
substrate to a municipal solid waste landfill, significant
acetate accumulation and relatively low methane production
were observed, which indicated that homoacetogens out-
competed the hydrogentrophic methanogens in the landfill
samples. In a study of hydrogen production from wheat
starch, Hussy et al. (2003) found that hydrogen yield
decreased when acetate levels rose, indicating that metabo-
lism shifted toward homoacetogenesis. For biohydrogen
production, actually homoacetogenesis is a very important
pathway as it consumes hydrogen and decreases the hydro-
gen yield. However, not much work has been done on it.
Therefore, better understanding of homoacetogenesis is
Sparging
Feeding
Gas bottle
HBu Media
Heating (55°C)
Fig. 1 – Schematic diagram of butyrate degradation experimental reactor.
4 1 (200 7) 420 4 – 421 0 4205
necessary for unveiling the discussion of production of
biohydrogen through acetogenesis.
In this study, we aimed to investigate anaerobic butyrate
degradation with mixed cultures at thermophilic conditions
under conditions suppressing methanogenesis.
2. Materials and methods
2.1. Reactor setup and operation
The schematic diagram of continuously stirred tank reactor
used in this study is shown in Fig. 1. The reactor volume was
(2) 1 L, with a working volume of 0.7 L. The temperature was
controlled at 55 1C by circulating hot water inside the water
jacket of the reactors. Mixing was provided by a magnetic
stirrer located underneath the reactor. The reactors were
operated at 6-day HRT. The experiments were carried out in
two identical CSTR reactors (R1 and R2). They were operated
in exactly the same way, except for application of sparging by
anaerobic gas, which was different in the two reactors. R1
was sparged with 20%CO2/80%N2, while the sparging gas in R2
was 100%N2. A low gas-sparging flowrate at 3 mL/min was
used to prevent high turbulence inside the reactor. Gas flow
and pH were monitored and liquid samples were sampled
daily for analyses.
The inoculum was taken from a lab-scale CSTR reactor
producing methane by digestion of dairy manure at 55 1C. No
pre-treatment was applied to the inoculum. The feed was
composed of solutions A and B. Solution A contained basic
anaerobic media described previously (Angelidaki and San-
ders, 2004). Solution B contained 32.64 mM butyric acid. The
mixed influent (from solution A and B with 1:1 volume ratio)
contained 2.6 g/L butyrate-COD. It should be noted that
buffering chemicals in solution A for R1 and R2 were 0.2 M
sodium bicarbonate and 0.25 M sodium phosphate, respec-
tively. 2-Bromoethane-sulfonic acid (BES) (10 mM), a metha-
nogenic inhibitor, was added once at the beginning of the
reactor operation.
pH meter
Effluent
pH Gas
sampling
Heating
CSTR Gas meter
Effluent bottle
Mixer
Mixer
 ARTICLE IN PRESS
4206 WAT E R R E S E A R C H
14
2.2. C isotope batch experiment
The isotope tests were conducted in quadruplicate incuba-
tions and were kept without agitation at 55 1C. One of the
quadruplicate incubations was intermittently sampled for
methane using a gas-tight pressure lock syringe at least once
every day. Incubations were performed in 118 mL bottles with
a working volume of 46 mL. R1 effluent at day 14 (44 mL ) was
taken and flushed with 20%CO2/80%N2 to ensure anaerobic
conditions. After flushing, they were capped with air-tight
butyl rubber stoppers and sealed with aluminum seal. Then
butyric acid and radioactive H14CO3 (Amersham Pharmacia
Biotech, Buckinghamshire, England) were added.
2.3. Radioisotope sampling and analysis
The liquid and headspace of the incubation bottles were
sparged with approximately 2 L of O2 through a 5 M NaOH trap
to extract 14CH4 and 14CO2 from the incubation bottles. CO2
was trapped in the 5 M NaOH trap, while the sparging gas and
14
CH4 were collected in 300 mL vials. For the sparging and
collection of the gas phase the following procedure was
followed: the incubation bottles were connected through a
thin aluminum tube that was inserted through the butyl
rubber stopper to a 26 mL anaerobic tube filled with 20 mL 2 M
sodium hydroxide solution to trap the CO2, closed with
butyl stopper. The headspace of this anaerobic tube was
connected through a similar aluminum tube to a 300 mL vial.
HCl (1.2 mL, 7.2 M) was then injected in the incubation bottle,
decreasing the pH of the liquid inside up to 1.570.2. After 1 h
of equilibration time the dissolved carbon dioxide from
the acidified liquid was recovered in the CO2 trap. Then the
incubation bottles were flushed with oxygen for 5 min and
the outlet gas was collected in a 300 mL vial in order to secure
recovery of all 14CH4 and 14CO2 to the 300 mL vial (trap for
methane) and anaerobic tube (trap for carbon dioxide),
respectively.
The gas collected in the 300 mL vial was combusted (oxygen
inside the vial was used for oxidation) to carbon dioxide in a
tube furnace at 800 1C. The generated carbon dioxide was
then trapped in two plastic vessels (traps) each containing
10 mL Carbosorb-E (carbon dioxide absorber for liquid scin-
tillation counting, Packard Bioscience Company, USA). After
addition of 10 mL Perma Fluor-E+ (Packard Bioscience Com-
pany, USA) scintillation liquid to each vessel, the radioactivity
due to 14CO2 produced from 14CH4 was analyzed in a liquid
scintillation counter (Tri-Carb 1600, Perkin-Elmer, England).
The radioactivity originally due to carbon dioxide produced
was measured by sampling 1 mL of sodium hydroxide
solution from the tubes. After addition of 15 mL Opti Phase
‘Hi Safe’ 3 (Perkin-Elmer, England) scintillation liquid, the
radioactivity was measured in the liquid scintillation counter.
The liquid radioactivity after the sparging was measured in
the same way and acetate was determined by GC.
2.4. Test of full scale biogas reactor for homoacetogenesis
In order to evaluate if homoacetogenesis was occurring in
biogas reactors, two 118 mL bottles were used as batch
reactors with working volumes of 60 mL. They contained
41 (2007) 4204– 4210
15 mL digested manure from a full-scale biogas plant
(Snertinge, Denmark) and 45 mL of solution A. The bottles
were flushed with 20%CO2/80%N2 and then capped with air-
tight butyl rubber stoppers and sealed with aluminum seal.
Butyric acid (1 mL, 1.4 M) was added in one bottle. The other
one without butyric acid addition worked as the control.
2.5. Analysis
Volatile fatty acids, ethanol and butanol were determined by a
gas chromatograph (HP 5890 series II) equipped with a flame
ionization detector and HP FFAP column (dimensions
30 m  0.53 mm  1.0 mm). Lactate and formic acids were
determined by suppressed ion chromatography (Kotsopoulos
et al., 2006). Methane, carbon dioxide and nitrogen in the gas
phase were quantified by GC (MicroLab Arhus) equipped with
a packed column Porapak Q (50/80 mesh) and a thermal
conductivity detector. Helium was the carrier gas. Since the
concentration of hydrogen under sparging conditions was
very low, hydrogen analysis at trace levels was applied.
Hydrogen was determined by GC equipped with a reduction
gas detector. Nitrogen was the carrier gas.
2.6. Fluorescence in situ hybridization (FISH)
The liquid samples were taken from R1 at days 11, 23 and 35.
Fluorescence in situ hybridization was performed as de-
scribed in Karakashev et al. (2005). The probes used and their
target orders or families are listed in Table 1. A combination of
EUB338 and EUB338+ targeted all bacteria, while ARC915 was
for methane-producing Archaea. Samples were visualized by
a Zeiss LSM 510 confocal laser-scanning microscope.
3. Results and discussion
3.1. R1-butyrate degradation under CO2 20%–N2 80%
sparging conditions
Fig. 2 shows the profiles of butyrate (HBu), acetate (HAc),
hydrogen, methane and pH in R1. Ethanol and butanol were
not detected. The reactor was operated continuously from
day 3, with a butyrate feeding rate of 1.91 mmol/d (16.37 mM).
Butyrate in the reactor was below 2 mM at day 17 and then
increased to 9.34 mM at day 35. Acetate increased quickly to
27.23 mM at day 11 and decreased to 11.5 mM at day 35. When
gas sparging stopped after day 35, both butyrate and acetate
decreased to 5 mM. Hydrogen was very low (or 105–106
hydrogen partial pressure) all the time. Methane was detected
at day 14. BES, the methanogenic inhibitor, was added once. It
appeared again at day 25. This time, BES addition only slightly
inhibited methane production as its production increased
from day 30. pH dropped from 7.07 to 5.65.
Fig. 2 clearly demonstrates that butyrate was degraded to
acetate, but with almost no hydrogen production. Where did
hydrogen go? Hydrogen could have been utilized by hydro-
genotrophic methanogenesis to form methane when
methane was detected. But when methane was not found,
like before day 9, hydrogen should have been used to form
acetate via homoacetogenesis (Eq. (2)). Similar results were
 ARTICLE IN PRESS
WAT E R R E S E A R C H 4 1 (200 7) 420 4 – 421 0 4207

Table 1 – Oligonucleotide probes used for FISH analyses

Probe Phylogenetic Functional groupa Probe sequence (50 –30 )b Reference

group

EUB338 Bacteria (most) GCTGCCTCCCGTAGGAGT Stahl and Amann

Non-meth (1991)
EUB338+ Bacteria (remaining) GCWGCCACCCGTAGGTGT Daims et al. (1999)
ARC915 Archaea Mainly meth GTGCTCCCCCGCCAATTCCT Stahl and Amann
(1991)
MX825 Methanosaetaceae Aceticlastic meth TCGCACCGTGGCCACACCTAGC Raskin et al. (1994)
MS1414 Methanosarcinaceae Aceticlastic meth (also CTCACCCATACCTCACTCGGG Sekiguchi et al. (1999)
hydrogenotrophic)
MG1200 Methanomicrobiales Hydrogenotrophic meth CGGATAATTCGGGGCATGCTG Sekiguchi et al. (1999)
MC1109 Methanococcales Hydrogenotrophic meth GCAACATAGGGCACGGGTCT Sekiguchi et al. (1999)
MB1174 Methanobacteriales Hydrogenotrophic meth TACCGTCGTCCACTCCTTCCTC Raskin et al. (1994)

a
Meth, methanogenic.
b
W, A+T mixed base.

no feed Feeding with N2/CO2 sparging without sparging

40 8

35 7

30 6
VFA & CH4 (mM)

25 BES 5
BES

pH
20 4

15 3

10 2

5 1

0 0
0 3 6 9 12 15 18 21 24 27 30 33 36 39 42
Day

HAc HBu CH4 pH

Fig. 2 – Profiles of acetate (HAc), butyrate (HBu), methane (mmol per volume of liquid phase) and pH under CO2 20%–N2 80%
sparging in R1.

Table 2 – [2-14C]-Acetate activity analysis results

reported by Bernalier et al. (1996), who found that inhibition
of methanogenesis by BES addition in a biogas reactor Amount of Labeled C-14/std. dev (DPM/mL)
treating pig hindgut content, induced a large increase in
14 14
acetate from CO2 reduction. The observed acetate decrease Beginning Labeled CO2 CH4
HCO3 Acetate
and butyrate increase from days 13 to 35 could be explained
by acetate inhibition. Ahring and Westermann (1988) found 262,105 88,711/9010 154,008/ 1077/
that butyrate degradation could be inhibited when acetate 52,498 136
concentration was higher than 16.4 mM. 100% 33.8/3.4 58.8/20.0 0.4/0.1

14
3.2. C isotope batch experiment

In order to prove the homoacetogenic pathway in R1, an

isotope experiment was performed. As shown in Table 2,
33.873.4% of labeled 14C bicarbonate was converted to
acetate, only 0.470.1% went to 14CH4 and 58.8720.0%
was unused as 14CO2. The recovery of [14C] with the
combination of [2-14C]-acetate, 14CO2, and 14CH4 was above
90% of the radioactivity initially applied. Homoacetogenesis
was the main pathway in the batch experiment. In other
words, homoacetogenic bacteria were playing an important
role in R1.
 ARTICLE IN PRESS
4208 WAT E R R E S E A R C H 41 (2007) 4204– 4210
In addition, thermodynamic calculations also supported, to
some extent, the fact that homoacetogenesis was occurring
in R1. From Eq. (3), which is derived by combining Eqs. (1) and
(2), we can see that 1 mol of butyrate generates 2.5 mol of
acetate.
CH3 CH2 CH2 COO þ HCO3  22:5CH3 COO þ 0:5 Hþ : (3)
The standard Gibbs free energies at pH 7 (DG10 ) of Eqs. (1)–(3)
are 48.3, 52.3 and 4 kJ/mol, respectively. According
to Nernst’s equation (DG ¼ DG1+RT ln K), DG values of
Eqs. (1)–(3) were calculated as 2.17, 1.04 and 3.21 kJ/mol,
respectively, using the actual measured concentrations of
acetate (27.23 mM), butyrate (1.46 mM), bicarbonate (0.1 M)
and H2 (7.16  105) at day 14 (Fig. 2). These DG values indicate
that Eqs. (1)–(3) were thermodynamically possible. In this
study, homoacetogenesis instead of methanogenesis likely
became the sink of hydrogen to make the reaction of butyrate
degradation to acetate thermodynamically possible. However,
the energy yields in Eqs. (1)–(3) were marginally negative. This
would explain the hardness of obtaining stable steady state
conditions in R1. It should be noted that the calculations did
not consider the energy requirement for microbial growth,
which is about 20 kJ/mol. Using this consideration, reactions
1–3 will be thermodynamically unfavorable. However, Jackson
and McInerney (2002) found that anaerobic microbial meta-
bolism by syntrophic associations (like reactions 1 and 2)
could occur at values close to thermodynamic equilibrium
(DG0 E0 kJ/mol). Under thermophilic conditions, Zinder and
Koch (1984) revealed that aceticlastic methanogenesis was
performed via acetate oxidation (opposite to homoaceotogen-
esis), indicating acetate oxidation was favorable under
thermophilic conditions. Our results prove that that homo-
acetogenesis can take place under thermophilic conditions.
This might suggest that acetate oxidation and homoaceto-
genesis are both possible under thermophilic conditions.
No feed Feeding with N2 sparging
40
35
30
VFA & CH4 mM
25
20
15
10
5 1
0 0
0 3 6 9 12 15
Day
HAc HBu
Fig. 3 – Profiles of acetate (HAc), butyrate (HBu), methane (mmol per volume of liquid phase) and pH under N2 sparging in R2.
Homoacetogenesis (Eq. (2)) requires CO2 or bicarbonate,
which must come from the influent as butyrate degradation
(Eq. (1)) does not produce CO2. According to this hypothesis, if
neither CO2 nor HCO 3 would be provided to the system,
butyrate would not be degraded.
3.3. R2-butyrate degradation under N2 sparging
conditions
The operation conditions of R2 were the same as R1 except
that phosphate instead of bicarbonate was the buffer and the
sparging gas was only N2. Fig. 3 illustrates that acetate started
to increase and reached the maximum on day 13 at 22.23 mM,
while butyrate decreased to 2.77 mM. After 14 days, the
degradation of butyrate declined. The amount of butyrate
started to accumulate steadily before the degradation
stopped. On the contrary, the acetate began to drop con-
tinuously to 0.56 mM. Methane was encountered on days 23
and 24. After BES was applied on day 23, no more methane
was detected. The average hydrogen partial pressure before
day 14 was in the order of 105 atm. pH decreased gradually
from 7.46 to 4.43. Ethanol and butanol were not detected
Compared with R1, R2 was much harder to maintain
butyrate degradation. The increase of butyrate from day 14
indicates that butyrate-degrading microorganisms were
slowly washed out. This was likely caused by non-favorable
conditions for the hydrogen sink as both homoacetogenesis
and hydrogenotropic methanogenesis require CO2/HCO 3.
Furthermore, the maximum acetate yield in R2 was 1.45 mol
acetate per mol butyrate degraded, which was lower than the
one in R1 (1.64/mol). All these results again support the fact
that homoacetogenesis was occurring in R1. As the inoculum
was cultivated directly from manure digester without pre-
treatment, homoacetogenic bacteria exist in full-scale biogas
systems.
9
8
7
6
5
BES
pH
4
3
2
18 21 24 27 30 33 36
CH4 pH
 ARTICLE IN PRESS
WAT E R R E S E A R C H 4 1 (200 7) 420 4 – 421 0 4209

60 4

VFA (mM)/methane (%)

HAcchanged/HBuchanged
PI PII

30 2

0 0
0 2 4 6 8 10 12 14 16
Day

HAc HBu methane ΔHAc/ΔHBu

Fig. 4 – Profiles of acetate, butyrate, methane and ratios of HAc increase to HBu decrease from days 4 to 8 in the batch
experiment. These values have deducted the values in the control experiment without butyrate addition.

Table 3 – Microorganism variability via FISH results in R1

Day Acetate (mM) Methane (mM) Dominatea Non-dominateb

11 27.23 EUB ARC, MB

23 15.47 0.03 EUB ARC, MB
35 11.50 12.65 EUB, ARC MB, MC

EUB: bacteria; ARC: Archaea; MC: Methanococcales; MB: Methanobacteriales.

a
Dominate, found more than 40%.
b
Non-dominate, found less than 20%.

3.4. Homoacetogenesis in full-scale reactors
The results of batch tests with inoculum from a full-scale
biogas plant are shown in Fig. 4. The butyrate degradation
course can be described as follows: after an initial lag phase of
half a day, butyrate degradation started. Butyrate degradation
seems to follow two different phases: phase I (0.5–4 days) and
phase II (4–8 days), with different butyrate degradation rates.
After 8 days, butyrate was completely depleted. The acetate
profile was opposite to the butyrate profile in PI and PII. It
reached peak concentration (32 mM) at day 8 and dropped
dramatically after day 12. Methane concentration rose
gradually to 14.1% at day 4 and jumped to 25.5% at day 6,
then increased slightly to 31.9% at day 13, and finally reached
60% when acetate was zero which was a typical aceticlastic
methanogenesis. The hydrogen concentration was very low
(o 0.1%) in this test. It is noted that the background values in
Fig. 4 have been deducted in the control batch.
When compared with the values at day 4, the ratios of
increased acetate (DHAc) to decreased butyrate (DHBu) in PII
(Fig. 4) were always higher than 2 (mol/mol), which was the
theoretical acetate yield in Eq. (1). This strongly indicates that
homoacetogenesis was occurring during phase PII, otherwise
the ratio should be lower than 2. To achieve hydrogen
production from mixed culture fermentations, loss of hydrogen
through interspecies hydrogen transfer, such as during metha-
nogenesis or homoacetogenesis, must be prevented. HRT is a
well-known operating parameter to separate hydrogen and
methane production (Liu et al., 2006; Reith et al., 2003) as the
growth rates of hydrogen producing bacteria (o2 days) are
much faster than methane-producing Archaea (b2 days).
However, it is hard to avoid hydrogen loss via homoacetogen-
esis by HRT only. Oh et al. (2003) reported obvious hydrogen loss
via homoacetogenesis after 1 day in a batch study.
3.5. Diversity of microorganisms in R1
The diversity of microorganisms via FISH in R1 is shown in
Table 3. Bacteria dominated the samples at days 11 and 23,
while hydrogenotrophic methanogenic Archaea were non-
dominated. At day 35, Archaea shared the domination with
bacteria. These microbiological results were consistent with
the process data in Fig. 2. When methane was low, bacteria
were the dominating microorganisms in the reactor. When
methane was detected high amount at day 35, Archaea
started to dominate. This observation, although obvious,
underlines that methanogens were not the H2 scavengers
during butyrate degradation and definitely supports the fact
that in the absence of competition from methanogens,
homoacetogenesis starts to dominate. It is also important to
 ARTICLE IN PRESS
4210 WAT E R R E S E A R C H
remark that absence of methanogenesis would not permit
production of H2 as an alternative, as homoacetogenesis
would consume the hydrogen. Attempts to produce biohy-
drogen from organic acids, even in systems with lowered
hydrogen partial pressure, seem to face homoacetogenesis as
an alternative competitor to biohydrogen production.
4. Conclusions
This study demonstrates that butyrate could be degraded to
acetate at 55 1C by mixed cultures in CSTR under gas sparging
conditions. However, almost no hydrogen or methane
(inhibited by BES addition) was detected. It was found later
in the isotope experiment that the hydrogen produced
reacted immediately with CO2 to generate acetate via homo-
acetogenesis. If CO2/HCO 3 was not provided in the system,
butyrate-degrading cultures were washed out. Gas sparging
was important as it kept the hydrogen partial pressure low
enough to make the reaction between butyrate and acetate
thermodynamically possible. Furthermore, it was also found
in the batch tests that homoacetogenic bacteria were likely
present in full-scale biogas systems with digested manure.
Acknowledgment
The authors wish to acknowledge the financial support of the
Danish Research Agency STVF Project No. 2058-03-0020 and
DTU Ph.D. scholarship for the first author.
R E F E R E N C E
Ahring, B.K., Westermann, P., 1987. Thermophilic anaerobic
degradation of butyrate by a butyrate-utilizing bacterium in
coculture and triculture with methanogenic bacteria. Appl.
Environ. Microbiol. 53 (2), 429–433.
Ahring, B.K., Westermann, P., 1988. Product inhibition of butyrate
metabolism by acetate and hydrogen in a thermophilic
coculture. Appl. Environ. Microbiol. 54 (10), 2393–2397.
Angelidaki, I., Sanders, W., 2004. Assessment of the anaerobic
biodegradability of macropollutants. Rev. Environ. Sci. Bio-
technol. 3, 117–129.
Benemann, J., 1996. Hydrogen biotechnology: progress and
prospects. Nat. Biotechnol. 14 (9), 1101–1103.
Bernalier, A., Lelait, M., Rochet, V., Grivet, J.P., Gibson, G.R.,
Durand, M., 1996. Acetogenesis from H2 and CO2 by
methane- and non-methane-producing human colonic bac-
terial communities. FEMS Microbiol. Ecol. 19 (3), 193–202.
Chen, A.C., Ohashi, A., Harada, H., 2003. Acetate synthesis from
H2/CO2 in simulated and actual landfill samples. Environ.
Technol. 24 (4), 435–443.
Conrad, R., Klose, M., 1999. Anaerobic conversion of carbon
dioxide to methane, acetate and propionate on washed rice
roots. FEMS Microbiol. Ecol. 30 (2), 147–155.
Daims, H., Bruhl, A., Amann, R., Schleifer, K.H., Wagner, M., 1999.
The domain-specific probe EUB338 is insufficient for the
41 (2007) 4204– 4210
detection of all bacteria: development and evaluation of a
more comprehensive probe set. Syst. Appl. Microbiol. 22 (3),
434–444.
Fang, H.H.P., Jia, X.S., 1999. Formation of interim by-products in
methanogenic degradation of butyrate. Water Res. 33 (8),
1791–1798.
Hussy, I., Hawkes, F.R., Dinsdale, R., Hawkes, D.L., 2003. Contin-
uous fermentative hydrogen production from a wheat starch
co-product by mixed microflora. Biotechnol. Bioeng. 84 (6),
619–626.
Jackson, B.E., McInerney, M.J., 2002. Anaerobic microbial metabo-
lism can proceed close to thermodynamic limits. Nature 415
(6870), 454–456.
Karakashev, D., Batstone, D.J., Angelidaki, I., 2005. Influence of
environmental conditions on methanogenic compositions in
anaerobic biogas reactors. Appl. Environ. Microbiol. 71 (1),
331–338.
Kotsopoulos, T.A., Zeng, R.J., Angelidaki, I., 2006. Biohydrogen
production in granular up-flow anaerobic sludge blanket
(UASB) reactors with mixed cultures under hyper-thermophi-
lic temperature (701 C). Biotechnol. Bioeng. 94 (2),
296–302.
Kotsyurbenko, O.R., Glagolev, M.V., Nozhevnikova, A.N., Conrad, R.,
2001. Competition between homoacetogenic bacteria and
methanogenic archaea for hydrogen at low temperature. FEMS
Microbiol. Ecol. 38 (2–3), 153–159.
Liu, D.W., Liu, D.P., Zeng, R.J., Angelidaki, I., 2006. Hydrogen and
methane production from household solid waste in the two-
stage fermentation process. Water Res. 40 (11), 2230–2236.
Lovley, D.R., Klug, M.J., 1983. Methanogenesis from methanol and
methylamines and acetogenesis from hydrogen and carbon-
dioxide in the sediments of a eutrophic lake. Appl. Environ.
Microbiol. 45 (4), 1310–1315.
Nozhevnikova, A.N., Zepp, K., Vazquez, F., Zehnder, A.J.B.,
Holliger, C., 2003. Evidence for the existence of psychrophilic
methanogenic communities in anoxic sediments of deep
lakes. Appl. Environ. Microbiol. 69 (3), 1832–1835.
Oh, S.E., Van Ginkel, S., Logan, B.E., 2003. The relative effective-
ness of pH control and heat treatment for enhancing
biohydrogen gas production. Environ. Sci. Technol. 37 (22),
5186–5190.
Raskin, L., Stromley, J.M., Rittmann, B.E., Stahl, D.A., 1994. Group-
specific 16s ribosomal-RNA hybridization probes to describe
natural communities of methanogens. Appl. Environ. Micro-
biol. 60 (4), 1232–1240.
Reith, J.H., Wijffels, R.H., Barten, H. 2003. Bio-methane & bio-
hydrogen status and perspectives of biological methane and
hydrogen production. /www.novem.nl/default.asp?documentId=
115509S.
Sekiguchi, Y., Kamagata, Y., Nakamura, K., Ohashi, A., Harada, H.,
1999. Fluorescence in situ hybridization using 16S rRNA-
targeted oligonucleotides reveals localization of methanogens
and selected uncultured bacteria in mesophilic and thermo-
philic sludge granules. Appl. Environ. Microbiol. 65 (3),
1280–1288.
Stahl, D.A., Amann, R., 1991. Development and application of
nucleic acid probe. In: Stackebrandt, E., Goodfellow, M. (Eds.),
Nucleic acid techniques in bacterial systematics. Wiley, New
York, NY, pp. 205–248.
Zinder, S.H., Koch, M., 1984. Non-aceticlastic methanogenesis
from acetate-acetate oxidation by a thermophilic syntrophic
coculture. Arch. Microbiol. 138 (3), 263–272.