Biology - Term 1 - Subjective Test

Maximum marks: 70 Time: 3 hours

General Instructions:
Read the following instructions carefully.
1. There are 33 questions in this question paper with internal choice.
2. SECTION A consists of 16 multiple-choice questions carrying 1 mark each.
3. SECTION B consists of 5 short answer questions carrying 2 marks each.
4. SECTION C consists of 7 short answer questions carrying 3 marks each.
5. SECTION D consists of 2 case - based questions carrying 4 marks each.
6. SECTION E consists of 3 long answer questions carrying 5 marks each.
7. All questions are compulsory.

Section A
1. Embryo sac is to ovule as _______ is to an anther.
a. Stamen c. Pollen grain
b. Filament d. Androecium
2. The term used for the embryo entering into the state of inactivity as the seed mature is–
a. Quiescent c. Parthenocarpy
b. Parthenogenesis d. Doremancy
3. In a fertilised embryo sac, the haploid, diploid and triploid structures are:
a. Synergid, zygote and primary endosperm nucleus
b. Synergid, antipodal and polar nuclei
c. Antipodal, synergid and primary endosperm nucleus
d. Synergid, polar nuclei and zygote.
4. Spermiation is the process of the release of sperms from:
a. Seminiferous tubules c. Epididymis
b. Vas deferens d. Prostate gland
5. Which among the following has 23 chromosomes?
a. Spermatogonia c. Secondary oöcyte
b. Zygote d. Oögonia
6. The source of gonadotropin LH and its corresponding function is
a. Anterior pituitary, ovulation
b. Anterior pituitary, Graafian follicle formation
c. Hypothalamus, Ovulation
d. Hypothalamus, Graafian follicle formation
7. The method of directly injecting a sperm into ovum in assisted by reproductive technology is called:
a. GIFT c. CSI
b. ZIFT d. ET
8. From the sexually transmitted diseases mentioned below, identify the one which does not specifically affect the sex
organs:
a. Syphilis c. Gonorrhea
b. AIDS d. Genital warts
9. Conditions of a karyotype 2n ± 1 and 2n ± 2 are called:
a. Aneuploidy c. Allopolyploidy
b. Polyploidy d. Monosomy
10. A child with blood group A has father with blood group B and mother with blood group AB. What would be the
possible genotypes of parents and the child? Choose the correct option:
Father Mother Child

a IAi IBi IAi

b IAIB IAi IAIA

c IBi IAIB IAi

d IBIB IAIB IAIA

11. The first genetic material could be:
a. Protein c. DNA
b. carbohydrates d. RNA
12. Choose the correct pair of codon with its corresponding amino acid from the following list:
a. UAG : Glycine c. UUU : Phenylalanine
b. AUG : Arginine d. UGA : Methionine
13. A template strand in a bacterial DNA has the following base sequence:
5' – TTTAACGAGG – 3'
What would be the RNA sequence transcribed from this template DNA?
a. 5' – AAATTGCTCC – 3' c. 3' – AAAUUGCUCC – 3'
b. 3' – AAATTGCTCC – 5' d. 5' – CCUCGUUAAA – 3'
14. Which of the following is used as an atmospheric pollution indicator? (1)
a. Lepidoptera c. Lycopersicon
b. Lichens d. Lycopodium
15. (p + q)2 = p2 + 2pq + q2 = 1 represents an equation used in:
a. population genetics c. biometrics
b. mendelian genetics d. molecular genetics
16. For the MN-blood group system, the frequenciesof M and N alleles are 0.7 and 0.3, respectively. The expected
frequency of MN-blood group bearing organisms is likely to be
a. 42% c. 9%
b. 49% d. 58%
Section B
17. Name the organic materials of which the exine and intine of an angiosperm pollen grains are made up of. Explain
the role of exine.
18.
a. Name the human embryonic stage shown below. Identify ‘A’ and ‘B’ in it.

b. Mention the part of the above embryonic stage that forms the foetus.
19. State any four methods to overcome infertility in human couples.
20. A woman with blood group ‘O’ married a man with AB group. Show the possible blood group of the progeny. List the
alleles involved in this inheritance.
21.
a.

Look at the above sequence and mention the events A, B and C.

b. What does central dogma state in molecular biology? How does it differ in some viruses?
Section C
22. Given below is an enlarged view of one microsporangium of a mature anther.

a. Name ‘A’, ‘B’ and ‘C’ wall layers.

b. Mention the characteristics and function of the cells forming wall layer ‘C’.
23. Differentiate between the location and function of Sertoli cells and Leydig’s cells.
24. A pregnant human female was advised to undergo MTP. It was diagnosed by her doctor that the foetus she is
carrying has developed from a zygote formed by an XX-egg fertilised by Y-carrying sperm. Why was she advised to
undergo MTP?
25. Haemophilia is a sex-linked recessive disorder of humans. The pedigree chart given below shows the inheritance of
haemophilia in one family. Study the pattern of inheritance and answer the questions given.
 a. Give all the possible genotypes of the members 4, 5 and 6 in the pedigree chart.
b. ‘A blood test shows that the individual 14 is a carrier of haemophilia. The member numbered 15 has
recently married the member numbered 14. What is the probability that their first child will be a
haemophilic male?
26.
a. Identify the polarity at A and B respectively in the figure given below. (132)

b. Explain the mechanism the figure represents.

27. A template strand is given below. Write down the corresponding coding strand and the mRNA strand that can be
formed, along with their polarity. 3' ATGCATGCATGCATGCATGCATGC5'
28.
a. Differentiate between analogous and homologous structures.
b. Select and write analogous structures from the list given below:
i. Wings of butterfly and birds
ii. Vertebrate hearts
iii. Tendrils of bougainvillea and cucurbita
iv. Tubers of sweet potato and potato
Section D
29. The first menstruation is called menarche, that usually occurs between 12 and 15 years. In human females,
menstruation is repeated at an average interval of about 28129 days and is called menstrual cycle. It is regulated
by certain hormones, as pituitary gland is stimulated by releasing factors produced in the hypothalamus. The
hormones produced by pituitary gland influence the ovaries. The hormones secreted by the ovaries affect the walls
of the uterus.
a. The breakdown of endometrium is characteristic of
i. proliferative phase iii. ovulatory phase
ii. luteal phase iv. menstrual phase
b. Which days of the menstrual cycle marks the proliferative phase?
i. 1-5 iii. 6-13
ii. 15-28 iv. 10-14
c. Which of the following occurs during secretory phase?
i. Empty Graafian follicle changes into corpus luteum.
ii. Primary follicle changes into Graafian follicle.
iii. Endometrium rebuilds and estrogen secretion increases
iv. LH surge inducing release of an ovum.
d. Identify the hormones that attain peak level during ovulatory phase.
i. FSH iii. LH
ii. Progesterone iv. Both (a) and (c)
e. Withdrawal of which hormone causes degeneration of corpus luteum?
i. FSH iii. Progesterone
ii. LH iv. Estrogen
30. Turner’s Syndrome is an example of monosomy. It is formed by the union of an allosome free egg and a normal ‘X’
containing sperm or a normal egg and an allosome free sperm. The individual has 2n = 45 chromosomes (44 + XO)
instead of 46. Such individuals are sterile females who have rudimentary ovaries, under developed breasts, small
uterus, short stature, webbed neck and abnormal intelligence. They may not menstruate or ovulate. This disorder
can be treated by giving female sex hormone to the women from the age of puberty to make them develop breasts
and have menstruation. This makes them feel more normal.
a. Number of Barr body present in a female withTurner’s syndrome is
i. 0 iii. 2
ii. 1 iv. <2
b. Turner’s syndrome is an example of
i. aneuploidy iii. polyploidy
ii. euploidy iv. autosomal abnormality
c. Turner’s syndrome is a/an
i. autosomal recessive Mendelian disorder
ii. autosomal dominant Mendelian disorder
iii. sex linked Mendelian disorder
iv. chromosomal disorder
d. Which of the following statements regarding Turner’s syndrome is incorrect?
i. It is a case of monosomy of chromosomes.
ii. The suffering individual is a sterile female having one ‘X’ chromosome missing in the cells
iii. The problem is due to an extra chromosome
iv. The individual are of short stature.
e. Assertion: Turner’s syndrome is caused due to absence of anyone of the X and Y sex chromosome.
Reason: Individuals suffering from Turner’s syndrome show masculine as well as feminine development.
i. Both assertion and reason are true and reason is the correct explanation of
ii. assertion.
iii. Both assertion and reason are true but reason is not the correct explanation of assertion.
iv. Assertion is true but reason is false.
v. Both assertion and reason are false.
Section E
31.
a. Draw a diagram of an angiospermic embryo sac, where fertilisation is just completed.
Label the following parts
i. Micropylar end of embryo sac
ii. The part that develops into an embryo
iii. The part that develops into an endosperm
iv. The degenerating cells at the chalazal end
b. Draw a labelled diagram of globular embryonic stage of an angiosperm.
32. Study the following flow chart. Name the hormones involved at each stage.

33.
a. State the arrangement of different genes that in bacteria is referred to as 'operon'.
b. Draw a schematic labelled illustration of lac operon in 'switched on' state.
c. Describe the role of lactose in lac-operon.

End of the test