CHAPTERWISE BOARD QUESTION BANK OF PREVIOUS YEARS

SEXUAL REPRODUCTION IN PLANTS

1. Banana crop is cultivated by farmers without sowing of seeds. Explain how the plant is propagated.
Vegetative propagation, rhizome (1x2=2)
2. If the meiocyte of a maize plant contains 20 chromosomes, write the number of chromosomes in the endosperm and
embryo of the maize grain and give reasons in support of your answer.
Ans. Endosperm = 30 , Embryo = 20 = ½ × 2 Diploid meiocyte (20 chromosomes) form haploid gametes (10
chromosomes) Two haploid gametes fuse to form diploid (20) zygote which develops into a (diploid = 20) embryo / syngamy
of two haploid gametes to form a diploid zygote = 1 One haploid gamete (chromosome 10) fuses with two polar nuclei
(chromosome 10 + 10) to form (triploid - 30) endosperm nuclei (which divides to form endosperm) / Triple fusion of three
haploid nuclei (1 gamete + 2 polar nuclei) to form a triploid endosperm = 1[1 + 1 + 1 = 3 marks]
3. Do you think apomixis can be compared with asexual reproduction? Support your answer, giving one reason. How
is apomixis beneficial to farmers? Explain.
Ans. Yes, seeds are produced without fertilisation = ½ × 2
Production of hybrid seeds is costly, if hybrids with desirable characteristics can be made into apomicts , there is no
segregation of characters in the hybrid progeny , farmer can continue using hybrid seeds year after year and not buy new seeds
= ½ × 4[1 + 2 = 3 marks]
4. Write one advantage and one disadvantage of cleistogamy to flowering plants.
Ans. Advantage - Assured seed set / maintain purelines = ½
Disadvantage - No variation / only parental characters are preserved / it can lead to inbreeding depression = ½
5. Draw a diagram of Pistil showing pollen tube growth in angiosperm and label (i) Stigma; (ii) male gametes; (iii)
micropyle and (iv) Ovule. Write the function of micropyle.
Ans.

(b) the pollen tube enters the ovule through micropyle , it facilitates the entry of oxygen and water for seed
germination. = ½ + ½
6. (a) Mature seeds of legumes are non-albuminous. Then, can it be assumed that double fertilization does not occur in
legumes? Explain your answer.
(b) List the differences between the embryos of dicot (pea) and monocot(grass family).
Ans. (a) No, as double fertilization does takes place, endosperm is consumed during development. (1/2+1/2=1)
(b)

(1+1)
7. Angiosperm flowers may be monoecious, cleistogamous or show self-incompatibility. Describe the characteristic
features of each one of them and state which one of these flowers promotes inbreeding and out-breeding respectively.
Ans. Monoecious-male and female flowers are present on the same plant, Cleistogamous-flowers do not open
Self-incompatibility-genetic mechanism by which self- pollination does not take place (1x3=3) Inbreeding is promoted by
monoecious and cleistogamous flowers (1/2+1/2=1) Outbreeding is promoted by flower showing self-incompatibility(1)
8. Differentiate between (a)Xenogamy and Geitonogamy (b) Oviparous and Viviparous organisms (c)Pathogenesis and
Parthenocarpy
Ans. a) Xenogamy- transfer of pollen grains from anther to stigma of a different plant-brings genetically different pollen
grains Geitonogamy- Transfer of pollen grains from the anther to the stigma of another flower of same plant ½+½=1
b) oviparous- Anmials that lay eggs, viviparous- Animals giving birth to young ones ½+½=1
c) Parthenogenesis- female gamete undergoes development to form new organism without fertilization. Parthenocarpy- fruits
which develop without fertilization ½+½=1
9. (a) Draw a longitudinal section of a pistil of an angiosperm showing the growth of the pollen tube up to the
micropyle of the ovule.Label (i) stigma (ii) embryo sac (iii) pollen tube (iv) micropyle.
(b) Explain the events that occur up to fertilization, when the compatible pollen grain lands on the stigma.

(b) Pistil accepts the pollen and pollen grain germinates on the stigma to produce a pollen tube which passes through one of
the germ pores, content of the pollen grain move into the pollen tube and pollen tube grows through the tissues of the stigma
and style to reach to ovary, the generative cell in the pollen grain divides and form two male gametes, pollen tube enters the
ovule through micropyle and then enters one of the
synergids through filliform apparatus, two male gametes from pollen tube released in to the cytoplasm of synergids, one of the
male gametes moves towards the egg cell and fuses with its nucleus (½x6=3)
10. (a) Draw a diagrammatic sketch of a transverse section of an anther of an angiosperm. Label its different walls and
the tissue forming microspore mother cells.
(b) Describe the process of microsporogenesis upto the formation of a microspore.
(c) Write the function of ‘germ pore’ in a pollen grain of an angiosperm.
Ans. (a)
11. Differentiate between Parthenocarpy and Parthenogenesis. Give one example of each.

12. List the post-fertilization events in angiosperms.

Ans. – Development of endosperm Embryogeny / development of embryo Seed formation Fruit formation = ½ × 4
13. Explain any three advantages the seeds offer to angiosperms.
Ans. - Since reproductive process such as pollination and fertilisation are independent of water, seed formation is more
dependable. Seeds have better adaptive strategies for dispersal to new habitats and help the species to colonise in other areas.
As they have sufficient food reserves young seedlings are nourished until they are capable of photosynthesis on their own. The
hard seed coat provides protection to the young embryo.
Being products of sexual reproduction, they generate new genetic combinations / variations. Dehydration and dormancy of
mature seeds are crucial for survival under adverse conditions. (Any three points) = 1 + 1 + 1 [3 marks]
14. (a) Explain the phenomenon of double fertilization.
(b) Draw a labelled diagram of a typical anatropous ovule.
Ans. (a) It includes syngamy where one of the male gametes fuses with egg cell to form zygote , triple fusion which includes
fusion of second male gamete with two polar nuclei to form primary endospermic nucleus = 1 + 1
15. State the function of filiform apparatus found in mature embryo sac of an angiosperm.
Ans. Filiform apparatus helps to guide pollen tubes into synergid
16. Name any two organisms and the phenomenon involved where the female gamete undergoes development to form
new organisms without fertilization.
Ans. Rotifers / honeybees / some lizards / turkey (Any two) = ½ + ½ Parthenogenesis = 1
17. Write the differences between wind – pollinated and insect – pollinated flowers. Give an example of each type.
Ans.

18. Give an example of a plant which came into India as a contaminant and is a cause of pollen allergy.
Ans. Parthenium / Carrot grass.
19. Make a list of any three out breeding devices that flowering plants have developed and explain how they help to
encourage cross-pollination.
Ans. Time of pollen release and stigma receptivity are different (not synchronized), self-pollination prevented. Anther &
stigma are placed at different positions, so the pollen cannot come in contact with the stigma of the same flower. Self
incompatibility, genetic mechanism (prevent the pollen germination on the stigma of the same flower) Production of unisexual
flowers / dioecious plants, cross pollination ensured.
(any three) = (½ x 6) [3 marks]
20. Apomixis resembles asexual reproduction, as well as mimics sexual reproduction in plants. Explain with the help
of a suitable example.
Ans. Since there is no fertilisation in apomixis it resemble asexual reproduction , and development of embryo / seed / fruit
formation is mimicing sexual reproduction , ½ + ½ = 1 In Citrus/ Mango some of the nucellar cells surrounding the embryo
sac , act as diploid egg cell , which are formed without reduction division , and develop into embryo, without fertilization ½ ×
4 = 2 [1 + 2 = 3 Marks]
21. Why are angiosperm anthers called dithecous? Describe the structure of its microsporangium.
Ans. • Anther bilobed, each lobe of anther has two theca. = ½+½
Microsporangium surrounded by four wall layers / epidermis, endothecium, middle layer and tapetum. = 1
In young anther a group of compactly arranged homogenous cells called sporogenous tissue occupies the centre of each
microsporangium which produce microspores / pollen grains. = 1 [3 marks]
22. (a) Explain the different ways apomictic seeds can develop. Give an example of each. (b) Mention one advantage of
apomictic seeds to farmers.(c) Draw a labeled mature stage of a dicotyledonous embryo.
Ans. (a) (i) Diploid egg cell is formed without reduction division and develops into embryo without fertilisation, eg.
Asteraceae / grasses. = ½+½
(ii) In citrus / mango, some of the diploid nucellar cells surrounding the embryo sac start dividing, protrude into embryo sac &
develop into a embryo = ½+½.
(b) No segregation of character in hybrid seeds, economically beneficial / desired varieties are cultivated. =1

23. These pictures show the gynoecium of (A) Papaver and (B) Michellia flowers. Write the difference in the structure
of their ovaries.

Ans. a. ( multicarpellary) ovary showing fused/ syncarpous pistil ½ b. (multicarpellary) ovary showing free/ apocarpous pistil
½
24. Banana fruit is said to be parthenocarpic where as turkey is said to be parthenogenetic. Why?
Ans. Banana –the fruit develops without fertilisation from an unfertilised ovary. 1 Turkey- the ovum/ Female gamete develop
into a new chick without fertilisation. 1
25. (a) Draw a labelled diagram of the sectional view of microsporangium of an angiosperm.
(b) Explain the development of male gametophyte in the microsporangium.
26. Mention the relationship between concentration of luteinising hormone and maintenance of endometrium in the
human uterus.

27. Write the difference between the tender coconut water and the thick, white kernel of a mature coconut and their
ploidy.
Ans. Coconut water from the tender coconut has free nuclear endosperm, kernel has the cellular endosperm Ploidy of the
endosperms- 3n/ Triploid ½ + ½ + 1=2
28. (a) Describe in sequence the process of microsporogenesis in angiosperms.
(b) Draw a labelled diagram of a two celled final structure formed.
Ans. (a) Microsporogenesis-Each microspore mother cell divides meiotically, to form 4 haploid cells or tetrad, each
microspore divides into two unequal cells- large vegetative cell and smaller generative cell; at this 2- celled stage the pollen
grains are shed. Sometimes the generative cell divides mitotically to give rise to two haploid male gametes , that are shed at 3
- celled stage ½ x6=3

29. Describe the development of endosperm after double fertilization in an angiosperm. Why does endosperm
development precedes that of zygote?
Ans. Following fertilisation the PEN (primary endosperm nucleus) divides repeatedly to give rise to free nuclei, subsequent
cell wall formation leading to formation of endosperm = 1 + 1 Cells of endosperm are filled with reserved food materials to be
used for nutrition of the developing embryo / for providing food to the developing embryo = 1
30. Read the following statement and answer the questions that follow : “A guava fruit has 200 viable seeds.” What are
viable seeds ? Write the total number of: Gametes in producing 200 viable guava seeds. Prepare a flow-chart to depict
the post-pollination events leading to viable-seed production in a flowering plant.
Ans. (a) Seeds that remain alive / gives rise to new plant / ability to germinate (Any one) = 1 (b) (i) 200 = ½
(ii) 600 gametes / 400 male gametes / 200 female gametes = ½
(c) Pollen grain germinates on stigma , pollen tube carrying the male gametes reach the ovule , discharge male gametes near
the egg , syngamy / fusion of male gamete with egg occurs to form zygote , triple fusion / fusion of male gamete with two
polar nuclei to form PEN (Primary Endosperm Nucleus) , ovule develops into seed = ½ × 6 [1 + 1 + 3 = 5 marks]
31. A flower of tomato plant following the process of sexual reproduction produces 200 viable seeds.
Answer the following questions giving reasons:
(a) What would have been the minimum number of ovules present in pre-pollinated pistil?
(b) How many microspore mother cells would minimally be required to produce requisite number of pollen grains?
(c) How many pollen grains must have minimally pollinated the carpel?
(d) How many male gametes would have used to produce these 200 viable seeds?
(e) How many megaspore mother cells were required in this process?
Ans. (a) 200, one ovule after fertilisation forms one seed = ½ + ½
(b) 50, each microspore mother cell meiotically divides to form four pollen grains (200 /4 = 50) = ½ + ½
(c) 200, one pollen grain participates in fertilisation of one ovule = ½ + ½
(d) 400, each pollen grain carries two male gametes which (participate in double fertilisation) (200 × 2 = 400) =½+½
(e) 200, each MMC forms four megaspores out of which only one remains functional = ½ + ½ [1 × 5 = 5 Marks]
32. (a) Do all pollen grains remain viable for the same length of time? Support your answer with two suitable
examples.
(b) How are pollen grains stored in pollen banks? State the purpose of storing pollen grains in these banks.
Ans. (a) No = 1 Examples : Cereals / rice / wheat - pollen grains / loose viability with in thirty minutes of their release = ½ In
some members of Rosaceae / leguminoseae / Solanacease maintain viability for months = ½
(b) Using cryopreservation techniques / in liquid nitrogen (-196° C) = ½ Maintaining viability / preserving threatened species /
preserving commercially important plants / to be used for crop breeding programmes = ½
33. (a) Explain the events after pollination leading to the formation of a seed in angiosperms.
(b) Mention the ploidy levels of the cells of different parts of an albuminous seed.
Ans. (a) (i) Pistil accepts right type pollen , pollen grain germinates to produce pollen tube that grows and reaches the ovary ,
male gametes enter the ovule through micropyle , one male gamete fuses with nucleus of egg cell to form diploid zygote ,
other male gamete fuses with two polar nuclei forming primary endosperm cell which develops into endosperm , diploid
zygote develops into embryo , followed by development of ovule into seed = ½ × 8
(b) Embryo - 2n / diploid = ½ Endosperm - 3n / triploid = ½ [5 Marks]
34. Suggest two advantages to a farmer for using apomictic seeds of hybrid varieties.
Ans. (i) No segregation of characters in hybrid progeny = 1 Apomictic hybrid seeds can be used to grow crop year after year
/economical as ordinary hybrid seeds are not used to grow crop year after year = 1[2 Marks]
35. Why are some seeds referred to as apomictic seeds? Mention one advantage and one disadvantage to a farmer who
uses them.
Ans. Seeds produced without fertilisation are referred to as apomictic = 1
Advantage: Desired characters retained in offspring (progeny) / no segregation of characters in offspring (progeny) / assured
seed production in absence of pollinators =1 (Any other relevant advantage) Disadvantage: Cannot control accumulation of
deleterious genetic mutation / usually restricted to narrow ecological niches / lack ability to adapt to changing environment =
1(Any other relevant disadvantage)
36. (a) Plan an experiment and prepare a flow chart of the steps that you would follow to ensure that the seeds are
formed only from the desired sets of pollen grains. Name the experiment that you carried out.
(b) Write the importance of such experiments.
Ans. (a) Selection of flowers from desired plants, emasculation, bagging, dusting of the pollens on the stigma of the flowers
that were bagged, flower rebagged, fruit formed = ½ × 6 Artificial Hybridisation =1 (b) Production of superior/ improved
varieties of plants = 1[5 Marks]
37. Angiosperms bearing unisexual flowers are said to be either monoecious or dioecious. Explain with the help of one
example each.
Ans. Monoecious angiosperms plants bear both male and female unisexual flowers on the same plant = ½
e.g. Cucurbits /coconut / maize (any one) = ½ Dioecious angiosperms - plants bear either male or female unisexual flowers on
different plants = ½ e.g. Papaya /date palms (any one) = ½
38. (a) Describe any two devices in a flowering plant which prevent both autogamy and geitonogamy.
(b) Explain the events upto double fertilisation after the pollen tube enters one of the synergids in an ovule of an
angiosperm.

Ans. (a) - Dioecy / production of unisexual flowers (in different plants)

- Self incompatibility = 1 + 1
- Pollen tube releases 2 male gametes in the cytoplasm of synergid
One male gamete fuses with egg cell / syngamy , resulting in diploid zygote Other male gamete fuses with polar nuclei / triple
fusion, to form triploid PEN (Primary Endosperm Nucleus) / PEC (Primary Endosperm Cell) = 1 × 3 [2 + 3 = 5 marks]
39. A mature embryo-sac in a flowering plant may possess 7-cells, but 8-nuclei. Explain with the help of a diagram
only.
40. Name the type of asexual reproduction where the parent cell ceases to exist.
Ans. Fission / Binary fission / Longitudinal fission / Multiple fission
41. Differentiate between pericarp and perisperm.
Ans. Pericarp – wall of the fruit (which develops from the wall of ovary) = 1 Perisperm – persistent residual nucellus = 1
42. With labelled diagrams, depict stages in embryo development in a dicotyledenous plant.
(b) Endosperm development precedes embryo development. Why?

43. (a) Explain the post-pollination events leading to seed production in angiosperms.
(b) List the different types of pollination depending upon the source of pollen grain.
Ans. (a) Pollen pistil interaction , germination of pollen tube that carries two male gametes , double fertilization / syngamy
and triple fusion , development of endosperm , development of embryo , maturation of ovule into seed.= ½ × 6
(b) Autogamy / self pollination / Geitonogamy = 1 Xenogamy / cross pollination = 1 [3 + 2 = 5 marks]
44. (a) Draw a labelled sketch of a mature 7-celled, 8-nucleate embryo-sac.
(b) Which one of the cell in an embryo-sac produces endosperm after double fertilization?
Ans. (a)

(b) Central cell = ½

45. Explain the events upto fertilization that occur in a flower after the pollen grain has landed on its compatible
stigma.
Ans. The pollen grain germinates , on the stigma to produce a pollen tube through one of the germ pores , the content of the
pollen grain move into the pollen tube , pollen tube grows through the tissues of the stigma and style and reaches the ovary ,
the generative cell divides and forms two male gametes during the growth of pollen tube (in the stigma) , the pollen tube
enters the ovule through micropyle, and then enters one of the synergids (through filiform apparatus) , the pollen tube releases
the two male gametes (in the cytoplasm of synergids) , one of the male gamete fuses with egg cell to form zygote (2n)
(syngamy) , the other male gamete fuses with two polar nuclei (in central cell) to form primary endosperm nucleus (PEN-
3n)/PEC = ½ × 10 [5 Marks]
46. (a) When a seed of an orange is squeezed, many embryos, instead of one are observed. Explain how it is possible.
(b) Are these embryos genetically similar or different ? Comment.
Ans: (a) Polyembryony , nucellar cells surrounding embryosac start dividing , protrude into the embryo sac and develop into
many embryos = 1+ 1+ 1
(b) These embryos are genetically similar, as produced from nucellar cells by mitotic division / formed without fertilisation
(but different from the embryo formed by fertilization) = 1 + 1

47. Out of many papaya plants growing in your garden, only a few bear fruits Give reason.
Ans. Unisexual / Dioecious // male and female flowers are borne on separate plants , only plants bearing female flowers will
bear fruits = 1 + 1
48. How are Parthenocarpic fruits produced by some plants and apomictic seeds by some others? Explain.
(b) When do farmers prefer using apomictic seeds?
Ans (a) Ovary develops into fruit without fertilisation =1 Formation of seeds without fertilisation / form without reductional
divison / develop into embryo without fertilisation =1
(b) To maintain hybrid characters (year after year in a desired plant ) , to avoid buying hybrid seeds every year ( expensive
seeds) = ½ + ½
49. (a) As a senior biology student you have been asked to demonstrate to the students of secondary level in your
school, the procedure(s) that shall ensure cross-pollination in a hermaphrodite flower. List the different steps that you
would suggest and provide reasons for each one of them.
(b) Draw a diagram of a section of a megasporangium of an angiosperm and label funiculus, micropyle, embryosac and
nucellus.
Ans. (a) Emasculation, removal of anthers from the flower bud before the anther dehisce to avoid self-pollination = ½ + ½
Bagging , to prevent contamination of its stigma with unwanted pollen grains = ½ + ½
Rebagging, the stigma of the mature ovary are dusted with desired pollen grains and rebagged to allow the fruit to develop =
½+½
(b)

50. A pollen grain in angiosperm at the time of dehiscence from an anther could be 2-celled or 3-celled. Explain. How
are the cells placed within the pollen grain when shed at a 2-celled stage?
Ans. In 2-celled stage the mature pollen grain contains a generative and vegetative cell, whereas in 3- celled stage one
vegetative cell and two male gametes are present = ½ + ½ The generative cell floats in the cytoplasm of vegetative cell =1
51. Mention any two conditions that enhance the chances of syngamy in organisms exhibiting external fertilization.
Ans. Organisms exhibiting external fertilisation show great synchrony between the sexes , release a large number of gametes
into the surrounding medium = ½ + ½
52. (a) Can a plant flowering in Mumbai be pollinated by pollen grains of the same species growing in New Delhi ?
Provide explanations to your answer.
(b) Draw the diagram of a pistil where pollination has successfully occurred. Label the parts involved in reaching the
male gametes to its desired destination.
(a) Yes, By artificial means (any relevant explanation) = ½ + ½
(b) Diagram with following labellings Stigma, Pollen tube, Synergid / Filiform Apparatus, Micropyle = ½ × 4

53.

54. (a) State one difference and one similarity between geitonogamy and xenogamy.
(b) Explain any three devices developed in flowering plants to discourage self-pollination and encourage cross
pollination.
Ans (a) Difference- In geitonogamy pollen grains from one flower are transferred to the stigma of another flower on the same
plant whereas in xenogamy the pollen grains are transferred to the stigma of a flower on another plant(of the same species)
genetically similar, genetically different Similarity -In both types of pollination pollen grains from the anther are transferred to
the stigma of another flower of the same species =1 (b) - Pollen release & stigma receptivity not synchronised / hence the
maturity of stigma and pollen are different /Protandry / Protogyny - Anther and Stigma are placed at different positions so that
pollen cannot come in contact with stigma of the same flower.
- Self incompatibility/ Self sterility.
- Production of unisexual flowers (Any three) = 1 × 3 [5Marks]

HUMAN REPRODUCTION
1. Explain the events that occur during fertilization of an ovum in humans. How is it that only one sperm enters the
ovum?
Ans. Completion of meiotic division of secondary oocyte, haploid ovum and polar body is formed, fusion of the two nuclei.
(any 2)(1/2+1/2) Sperm induces the changes in zona pellucida and doesn’t allow the other sperms to enter (1)
2. Schematically represent and explain the events of spermatogenesis in humans.

(1/2x10=5)
3. Draw and label the parts of the head region only, of human sperm.
Ans. Plasma membrane, Acrosome; Nucleus;

(½ x 3 labels+½ diagram=2)
4. Draw a transverse section of a human ovary showing the sequential development of different follicles up to the
corpus luteum. Comment on the corresponding ovarian and pituitary hormone levels during these events
Ans.

(b)The secretion of gonadotropins increases gradually during the follicular phase ,stimulates follicular development as well as
secretion of estrogens by the growing follicles. Both LH and FSH attain a peak level in the middle of cycle. Rapid secretion of
LH, induces rupture of Graffian follicle ,and there by the release of ovum.// explained with diagram. ½x6=3.
5. What happens to corpus luteum in human female if the ovum is (i) fertilized, (ii) not fertilized’?
Ans. i) Corpus luteum continues to secrete progesterone to maintain pregnancy/ it persists and produces progesterone ii) it
disintegrates/ changes into corpus albicans 1+1
6. Name and explain the role of inner and middle walls of the human uterus.
Ans. Inner - Endometrium = ½, supports foetal growth , helps in placenta formation after implantation = ½ + ½, Middle -
Myometrium = ½, Exhibits strong contraction during delivery of baby = 1 [3 marks]
7. Arrange the following hormones in sequence of their secretion in a pregnant woman.
Mention their source and the function they perform : hCG ; LH ; FSH ; Relaxin

8. Draw a labelled diagrammatic view of human male reproductive system. Differentiate between:
(i)Vas deferens and vasa efferentia (ii) Spermatogenesis and spermeogenesis
 (Label any six) = ½ × 6 = 3
9. (a) Draw a diagram of the adult human female reproductive system and label the different:
parts of fallopian tube, layers of uterus wall
(b) Explain the events during fertilization of an ovum in humans.

(b) When a sperm comes in contact with Zona pellucida of ovum this induces changes in the membrane that blocks entry of
additional sperm , secretions of acrosome helps sperm enter into the cytoplasm of ovum through zona pellucida and plasma
membrane , this induces completion of meiotic division of secondary oocyte and formation of a haploid ootid / ovum (and a
second polar body) , haploid nucleus of ovum fuses with sperm nucleus to form diploid zygote (fertilization occurs) = ½ × 4
[3 + 2 = 5 marks]
10. Draw a diagram of a human sperm. Label only those parts along with their functions that assist the sperm to reach
and gain entry into the female gamete.
Ans.
Functions:
Acrosome : filled with enzymes that help enter the ovum = ½
Mitochondria (middle piece) : energy source for movement of tail to reach ovum = ½
Tail : for motility = ½
11. Write the effect of the high concentration of L.H. on a mature Graafian follicle.
Ans. Rupture of graffian follicle, release of ovum / secondary oocyte / ovulation = 1+1[2 marks]
12.

(a) Identify the parts labelled 1, 2 and 3 in the diagram given.

(b) Draw a labelled diagram of a human blastocyst.
(c) What is parturition and how is it induced at the end of pregnancy in a human female ?
Ans. (a) 1 - Placental Villi = ½ 2 - Umbilical cord (with its vessels) = ½ 3 - Embryo = ½

(c) Process of delivery of the foetus (at the end of pregnancy) = 1

The signals for parturition originate from the fully developed foetus and placenta which induce mild uterine contractions /
called foetal ejection reflex , this triggers release of oxytocin from the maternal pituitary which acts on uterine muscle and
causes stronger uterine contraction which stimulates further secretion of oxytocin , the stimulatory reflex between uterine
contraction and oxytocin secretion continues resulting in stronger and stronger contractions leading to parturition = ½ × 3[1½
+ 1 + 1 + 1½ = 5 marks]
13. Draw a labelled diagrammatic sectional view of a human seminiferous tubule.
Ans.

14. (a) Explain the hormonal regulation of spermatogenesis in humans.

(b) Draw the diagram of a human sperm. Label and write the functions of the components of its head.
Ans. (a) - Initiation by GnRH from hypothalamus which acts on Anterior Pituitary to release FSH & LH
(Gonadotropins) = 1 -LH acts on cells of Leydig / Interstitial cells to secrete androgens = ½ -Androgens in turn
stimulate the process of spermatogenesis = ½ -FSH acts on Sertoli cells and stimulates the secretions of some factors
that stimulate spermio genesis = 1
(b)

Function of plasma membrane: Envelopes the whole body of sperm. Acrosome- contains enzymes for fertilization
Nucleus: Contains haploid chromosomal material (Any two =½ + ½ = 1)
15. Describe the embryonic development of a zygote upto its implantation in humans.
Ans. Zygote moves through isthmus and undergoes cleavage ( forming morula) , morula continues to divide and transform
into blastocyst (as it moves further into uterus) , Blastomeres in the blastocyst are arranged into an outer layer trophoblast ,
and inner cell mass , the trophoblast layer gets attached to endometrium , uterine cells divide and cover the blastocyst = ½ ×
6[3 Marks]
16. (a) Where does fertilization occur in humans? Explain the events that occur during this process.
(b) A couple where both husband and wife are producing functional gametes, but the wife is still unable to conceive, is
seeking medical aid. Describe any one method that you can suggest to this couple to become happy parents.
Ans. a) i. Ampullary Isthmic junction in fallopian tube / fallopian tube = ½ The sperms come in contact with zona pellucida =
½ Induces change in the membrane = ½ Blocks entry of other sperms / ensures only one sperm fertilizes the ovum / prevents
polyspermy. = ½ The secretion of acrosome helps the sperm to enter the cytoplasm = ½ Entry of sperm induces completion of
second meiotic division forming ovum and 2nd polar body = ½ The haploid nucleus of Sperm and that of ovum fuses = ½
Formation of diploid Zygote, fertilisation completed. = ½ (½×8=4)
b) Methods IVF / ZIFT / AI = ½ IVF: Ova from wife and sperm from the husband is collected It is induced to formed zygote
under laboratory conditions = ½
// ZIFT: Zygote or early embryo are then transferred to the fallopian tube (ZIFT) or into uterus (IUT) to complete further
development = ½ // AI: Semen collected from the husband is artificially introduced either into the vagina or into the uterus
(IUI) of the wife = ½
17.
The above diagram shows human male reproductive system (one side only). Identify ‘X’ and write its location in the
body. Name the accessory gland ‘Y’ and its secretion. Name and state the function of ‘Z’.
Ans. (a) X=Testicular lobules, location – Testis// Testis , location outside the abdominal cavity/ scrotum ½+ ½ Y= Seminal
vesicle, seminal plasma ½+ ½ Z= epididymis, function: storage of sperms ½+ ½
18. Explain the events in a normal woman during her menstrual cycle on the following days.
(a) Ovarian event from 13-15 days (b) Ovarian hormones level from 16 to 23 days (c) Uterine events from 24 to 29 days
Ans. (a) Rupture of Graafian follicle leads to ovulation / release of ovum (b) Estrogen level is low
(c). Disintegration of endometrium and menstrual cycle begins 1+1+1 =3
19. Draw a diagram of a mature human sperm. Label any three parts and write their functions.
Ans.

(Any three labelling) = ½ × 3

Plasma membrane - Envelope of the sperm Acrosome - Filled with enzyme that help fertilization of ovum Mitochondria -
Energy source for swimming Middle Piece - Possess mitochondria which is the energy source for swimming Tail - For
movement of sperm Nucleus - Containing chromosomal material
(Functions of the parts labelled) = ½ × 3 [1½ + 1½ = 3 marks]
20. (a) Name the hormone that initiates spermatogenesis in humans. Describe the process of spermatogenesis in
sequence mentioning the ploidy of the cells at each step.
(b) Draw the diagram of a mature human sperm and label the parts that
(i) helps it reaching to the ovum.
(ii) providing energy for it to reach the ovum.
(iii) helping it to gain entry into the ovum.
Ans. Gonadotropin releasing hormone/ GnRH 1
Process of spermatogenesis - The Spermatogonia (present on inside wall of seminiferous tubules) are diploid (2 N) (Some of
the spermatogonia) primary spermatocytes which undergo Ist meiosis leading to formation of two equal haploid cells(N)
called secondary spermatocyte. The secondary spermatocytes undergo the second meiotic division to form 4 equal haploid(N)
Spermatids. Now spermatids transform into spermatozoa (N)// Correct flow chart of spermatogenesis 4x ½ = 2
(b) Tail -½ Middle piece/ mitochoridria-½ Acrosome ½
21. Name the male accessory glands in humans and write their functions.
Ans. (Paired) seminal vesicles, prostate, bulbourethral glands (paired) = ½ × 3 Functions - Secretions constitute the Seminal
plasma, which is rich in fructose / calcium and certain enzymes , lubrication of penis = ½ × 3
22. Describe the process of Parturition in humans.
Ans. - Signals originate from the fully developed foetus and placenta, Induce mild uterine contractions (foetal ejection
reflex), Triggers release of oxytocin (from maternal pituitary), Oxytocin acts on uterine muscles and cause stronger uterine
contractions, Stimulatory reflex between the uterine contraction and oxytocin secretion continues resulting in stronger and
stronger contraction Expel the baby from the uterus = ½ × 6
23. Explain the events in a normal woman during her menstrual cycle on the following days:
(a) Pituitary hormone levels from 8 to 12 days. (b) Uterine events from 13 to 15 days. (c) Ovarian events from 16 to 23
days.
Ans. a) FSH and LH levels–low-1 (b) Endometrium is highly vascularised / proliferative phase of uterine lining-1 (c)
Formation of corpus luteum / secretion of progesterone 1
24.

Ans. (a) X= Primary oocytes – 1 (b) Y= Fimbriae, collection of ovum - ½+ ½ (c) Z=ampullary- isthumic junction/fallopian
tube, the ovum encounters the sperm/fertilisation takes place - ½ + ½
25. (a) Explain menstrual cycle in human females. (b) How can the scientific understanding of the menstrual cycle of
human females help as a contraceptive measure?
Ans. (a) - Menstrual Phase - Menstrual flow occurs / due to breakdown of endometrial lining of uterus, when fertilization does
not occur Follicular Phase - Primary follicles grow into mature graafian follicles and endometrium regenerates through
proliferation , changes induced by pituitary and ovarian hormones
Ovulatory Phase - LH surge, induces rupture of Graafian follicle and release of secondary oocyte / ovum during middle of
cycle (i.e. 14th day) Luteal phase - Ruptured Graafian follicle transforms into corpus luteum which secrete large amount of
progesterone, essential for maintaining endometrium = 1 × 4
(b) Because ovulation occurs during mid cycle chances of fertilisation are very high so, couples should abstain from coitus
between day 10 - 17 = ½ + ½
26. Draw a sectional view of a seminiferous tubule of human. Label sertoli cell, spermatagonia and leydig cell on it and
write their functions. Explain the role of pituitary and sex hormones in the process of spermatogenesis.
Pituitary hormones– LH/luteinising hormone- acts on Leydig cells and stimulates synthesis and secretion of androgens,
FSH/follicle stimulating hormone- acts on sertoli cells and simulates secration of some factor that help in spermiogenesis ½ +
½ Sex hormone –(Androgen/testosterone) stimulate process of spermatogenesis
27. Explain the development of a secondary oocyte (ovum) in a human female from the embryonic stage upto its
ovulation. Name the hormones involved in this process.
Ans.

28. Meiosis is an essential event in the sexual life cycle of any organism. Give two reasons.
Ans. (i) Meiosis helps in formation of gametes by reductional division & maintains number of chromosomes constant /
maintains ploidy = ½ Recombination of genes in offsprings / brings variation = ½
29. Draw a diagrammatic, labelled sketch of a sectional view of human ovary.
30. Explain the process of fertilization and implantation in humans.
Ans. Fertilisation : Sperm comes in contact with zona pellucida layer of ovum , and induces changes in the membrane that
blocks the entry of additional sperms , this induces completion of second meiotic division to form second polar body and
haploid ovum (ootid) , nucleus of sperm fuses with that of ovum to form diploid zygote = ½ × 4
Implantation : Repeated cleavage in zygote results in formation of blastocyst , whose outer layer is called trophoblast , and an
inner group of cells called inner cell mass , trophoblast layer gets attached to endometrium , inner cell mass gets differentiated
as embryo , uterine cells divide rapidly and covers the blastocyst that becomes embedded in the endometrium= ½ × 6 [5
Marks]
31. Our government has intentionally imposed strict conditions for M.T.P. in our country. Justify giving a reason.
Ans. To prevent female foeticide / to maintain sex ratio / to avoid any danger for (young) mother (and foetus)
32. Describe the roles of pituitary and ovarian hormones during the menstrual cycle in a human female.
Ans. Pituitary hormones:
(When levels of FSH is high) FSH, induces follicular growth, secretion of estrogen by follicles, (when LH surge is there in the
mid of the cycle) lutinising hormones/LH, along with FSH leads to ovulation , and then formation of corpus luteum = ½ ×6
Ovarian hormone: Estrogen, repair/proliferation of endometrium, Progesterone, maintains endometrium for implantation = ½
×4 ( Low level of progesterone leads to menstrual flow) [5 Marks]
33. Explain the events that follow up to fertilization when the sperms come in contact with the ovum in the fallopian
tube of a human female.
Ans. The secretion of the acrosome help the sperm enter into the cytoplasm of ovum through zona pellucida and the plasma
membrane, this induces the completion of second meiotic division of the secondary oocyte , forming second polar body and a
haploid ovum , soon the haploid nucleus of the sperm and that of the ovum fuse together to form a diploid zygote = ½ × 4 =
2[2 Marks]
34. (a) Explain the menstrual phase in a human female. State the levels of ovarian and pituitary hormones during this
phase.
(b) Why is follicular phase in the menstrual cycle also referred as proliferative phase? Explain.
(c) Explain the events that occur in a graafian follicle at the time of ovulation and there- after.
(d) Draw a graafian follicle and label antrum and secondary oocyte.
Ans. (a) Menstrual phase occurs when released ovum not fertilised , break down of endometrial lining (of the uterus) and its
blood vessel form the liquid that comes out through the vagina , lasts for 3 to 5 days = ½ × 3 Level of ovarian and pituitary
hormones fall = ½ // graphically represented
(b) Primary follicle grows into Graafian follicle under the influence of LH & FSH, regeneration of endometrium (under the
influence of estrogen) = ½ × 2
(c) Graafian follicle ruptures to release the ovum (secondary oocyte) , remaining parts of the Graafian follicle transform into
corpus luteum = ½ × 2
(d)

35. (a) Draw a diagram of a sectional view of human ovary and label (i) Primary follicle; (ii) Tertiary follicle;
(iii) Graafian follicle and (iv) Corpus luteum.
(b) Write the function of corpus luteum. = ½ × 4
Ans. (a)
(b) Secretes (large amounts of ) progesterone , which is essential for maintenance of endometrium = ½ × 2
36. Briefly explain the events of fertilization and implantation in an adult human female. Comment on the role of
placenta as an endocrine gland.
Ans. Fertilization- Sperm comes in contact and enters the secondary oocyte activates / induces secondary oocyte to complete
meiosis II leads to formation of ovum / ootid the haploid nucleus of sperm and that of ovum fused to form a diploid zygote
completing the process of fertilization = ½ × 3
Implantation- Trophoblast layer of blastocyst attaches to the endometrium (of the uterus) The uterine cells divide rapidly and
cover the blastocyst, The blastocyst becomes embedded in the endometrium and the implantation is completed = ½ × 3 – hCG
(human chorionic gonadotropin) hPL (human placental lactogen) estrogen progestogens = ½ × 4[3 + 2 = 5]
37. Name two animals that exhibit Oestrus cycle.
Ans. Cow / sheep / rat / deer / dog / tiger / any other (correct example) = ½ × 2
38. Draw a labelled diagram of the embryonic stage that get implanted in the human uterus. State the functions of the
two parts labelled.
Ans.

-Trophoblast - helps in implantation / attachment to endometrium / attachment to uterus = 1 -Inner cell mass - gets
differentiated into an embryo = 1
39. (a) Explain the following phases in the menstrual cycle of a human female:
Menstrual phase, Follicular phase, Luteal phase
(b) A proper understanding of menstrual cycle can help immensely in family planning. Do you agree with the
statement? Provide reasons for your answer.
Ans: (a) (i) Menstrual phase - first 3-5 days of the cycle where menstrual flow occurs due to break down of endometrial lining
of uterus, if the released ovum is not fertilized = ½ +½
Follicular phase - from 5th to 14th day of the cycle where the primary follicles grow to become a fully mature Graafian
follicle , endometrium of uterus regenerates , Graafian follicle ruptures to release ova (ovulation on 14th day) = ½ × 3 Luteal
Phase - During 15th to 28th day remaining parts of graafian follicle transform into corpus luteum , secretion of progesterone
(essential for maintenance of endometrium) = ½ × 2
All these phases are under the influence of varying concentrations of pituitary and ovarian hormone = ½
(b) Yes, can take appropriate precautions between 10th to 17th day of the menstrual cycle when the chances of fertilisation are
high = ½ + ½[5 Marks]
40. (a) Where does spermatogenesis occur in human testes? Describe the process of spermatogenesis up to the
formation of spermatozoa.
(b) Trace the path of spermatozoa from the testes upto the ejaculatory duct only.
Ans. (a) Seminiferous tubules = ½
 REPRODUCTIVE HEALTH
1. Name an IUD that you would recommend to promote the cervix hostility to the sperms.
Ans. LNG-20 /progestasert (Any one)
2. “Intra- cytoplasm sperm injection” and “gamete intrafallopian transfer” are two assisted reproductive technologies.
How is one different form the other?
Ans. ICSI-sperm is directly injected into the ovum1 GIFT-Transfer of ovum collected from a donor into the fallopian tube of
another female who cannot produce but can provide suitable environment for fertilization 1
3. Name and explain the surgical method advised to human males and females as a means of birth control. Mention its
one advantage and one disadvantage.
Ans. Vasectomy & Tubectomy = ½ + ½
Devoid of ill effects of contraceptive (like nausea , abdominal pain , breakthrough bleeding , irregular menstruation or breast
cancer), Reversibility is very poor = 1 + 1 [3 marks]
4. (a) Name two copper releasing IUDs.
(b) Explain how do they act as effective contraceptives in human females.
Ans. (a) Intra Uterine Devices - CuT, Cu7, Multiload 375 (any two) = ½+½
(b) Supress sperm motility, supress fertilizing capacity of sperms, increase phagocytosis of sperms within utreus. (any two) =
1+1 [3 marks]
5. A childless couple has agreed for a test tube baby programme. List only the basic steps, the procedure would involve
to conceive a baby.
Ans. Extraction of gametes from the parents/donors. ½ Invitro / fertilisation (simulated conditions in laboratory) ½
transfer of the zygote / early embryo, (at 8 blastomere stage )into the fallopian tube ½+½
6. An infertile couple is advised to adopt test-tube baby programme. Describe two principle procedures adopted for
such technologies.
Ans. IVF / In vitro fertilisation - Fertilisation outside the body in almost similar conditions as that in the body /ICSI / Intra
cytoplasmic sperm injection- A sperm is directly injected into the ovum, = 1 ET / Embryo transfer - Embryo is transferred into
reproductive tract or uterus / ZIFT / Zygote intra fallopian transfer - Zygote or early embryos (upto eight blastomeres)
transferred into fallopian tube / IUT / Intra uterine insemination - Early embryos (with more than eight blastomeres)
transferred into uterus =1[2 Marks]
7. Reproductive and Child Healthcare (RCH) programmes are currently in operation. One of the major tasks of these
programmes is to create awareness amongst people about the wide range of reproduction related aspects. As this is
important and essential for building a reproductively healthy society.
(a) “Providing sex education in schools is one of the ways to meet this goal.” Give four points in support of your
opinion regarding this statement.
(b) List any two ‘indicators’ that indicate a reproductively healthy society.
Ans. (a) - Provide right information to the young so as to discourage children from believing in myths and misconception
about sex related aspects. Proper information about reproductive organs Proper information about adolescence and related
changes Safe hygienic practices
STDs / AIDS Available birth control options Care of pregnant mothers Post-natal care Importance of breast feeding Equal
opportunities for male and female child awareness of problems due to uncontrolled population growth Sex abuse Sex
related crimes (Any four) = ½ × 4
(b) Better awareness about sex related matters / increase number of assisted deliveries / better post-natal care / decrease in
IMR (Infant Mortality Rate) / decrease MMR (Maternal Mortality Rate) / increase number of couples with small families /
better detection and cure of STDs / overall increased medical facilities for sex related problems / total well-being in all aspects
of reproduction / physical - behavioural - social / physically and functionally normal reproductive organs / normal emotional
and behavioural interaction among all sex related aspects. (Any two) = 1+ 1
8. Name two hormones that are constituents of contraceptive pills. Why do they have high and effective contraceptive
value? Name a commonly prescribed non-steroidal oral pill.
Ans Progestogen-estrogen / Progesterone-estrogen combination , Progestogen / Progesterone = ½ +½ They inhibit ovulation,
inhibit implantation, alter quality of cervical mucus to retard entry of sperm=½ × 3 Saheli = ½
9. (a) Explain the steps involved in in vitro fertilisation popularly known as test tube baby programme.
(b) State the importance of this programme.
Ans (a) i) Ova from wife / donor and sperms from husband / donor are collected
They are induced to form zygote under simulated conditions ( in the labortory )
The zygote or early embryos upto 8 blastomeres could then be transferred to fallopian tube /ZIFT
Embryos more than 8 blastomeres, into the uterus / IUT/ Intra uterin transfer = 1× 4
(b) Allows couples to bear children who were unable to do so naturally = 1[4+1=5]
10. (a) Name a terminal method to prevent pregnancy in humans.
(b) Describe the procedure of the terminal method carried in human male and female.
Ans. (a) Surgical methods / Sterilisation = 1
(b) Males - Vasectomy , a small part of vas deferens is removed or tied up through a small incision on the scrotum = ½ + ½
Females - Tubectomy , a small part of the fallopian tube is removed or tied up through a small incision in abdomen or through
vagina = ½ + ½[1 + 1 + 1 = 3 marks]
11. What is amniocentesis? Justify the statutory ban on it.
Ans. Study of chromosonal pattern in amniotic fluid of foetus,
It is misused to detect the sex of the foetus, ban to check female foeticide (= 1 × 3)
12. A large number of married couples the world over are childless. It is shocking to know that in India the female
partner is often blamed for the couple being childless. Why in your opinion the female partner is often blamed for such
situations in India? Mention any two values that you as a biology student can promote to check this social evil. State
any two reasons responsible for the cause of infertility.
Suggest a technique that can help the couple to have a child where the problem is with the male partner.
Ans. Female partner is blamed due to social mind set / inequality of sexes / lack of awareness / male dominated society / any
other relevent point (Any two) = ½ × 2 Awareness to be created that abnormality can occur in both male and females and
infertility issues with suitable examples
Mutual respect towards both the partners in case of the problem and to find the remedy from medical experts instead of
visiting quacks
Educate them to find the reason and not believe in superstitions (Any two) = ½ × 2
Physical (abnormality in reproductive system) , congenital , immunological or psychological
(Any two) = ½ × 2
Intra cytoplasmic sperm injection (ICSI) / artificial insemination (AI) / Intra uterine insemination (IUI) = 1
13. List any two types of IUDs that are available for human females and state their mode of action.
Ans i) Non medicated IUDs =1 , increase phagocytosis of sperms within the uterus = ½
Copper releasing IUDs = 1 , Cu ions suppress sperm motility and fertilising capacity of sperms=½
Hormone releasing IUDs = 1 , make uterus unsuitable for implantation / makes cervix hostile to sperms = ½
(Any two) (1½ +1 ½)
14. Your school has been selected by the Department of Education to organize and host an interschool seminar on
“Reproductive Health –Problems and Practices”. However, many parents are reluctant to permit their wards to attend
it. Their argument is that the topic is “too embarrassing”.
Put forth four arguments with appropriate reasons and explanation to justify the topic to be very essential and timely.
Ans. 1. The issue of puberty and adolescence need to be addressed effectively with the respective age group because many
changes take place in the body during adolescence of which they are supposed to be aware of = 1
To bring in awareness about their reproductive health and its effect on their physical, emotional and social being = 1
To address the increase in sex abuse and sex crimes in our country = 1
Myths and misconceptions related to reproductive issues =1
Note: (any other related or relevant argument with reasons may be accepted) [4 Marks]

PRINCIPLES OF INHERITANCE AND VARIATION

1. Why did T.H. Morgan select Drosophila melanogaster to study sex Linked genes for his lab experiments?
Ans. Can be grown in simple synthetic medium in the laboratory Complete life cycle in two weeks
Large no. of progeny Differentiation of sexes Many hereditary variations (any four) ½ × 4
2. (a) Hershey and Chase carried their experiment in three steps : infection, blending, centrifugation. Explain each
step.
(b) Write the conclusion and interpretation of the result they obtained.
Ans. (a) Infection - Radioactive phosphorus / phosphorus labelled bacteriophages were allowed to infect E.coli - growing in a
culture medium, simultaneously radioactive sulphur / sulphur labelled bacteriophage was allowed to infect E.coli growing in
another culture medium = 1+1
Blending- As infection proceeds- the viral coats are removed from the bacteria by agitating in a blender =½
Centrifugation - virus particles were seperated from bacteria by spinning them in a centrifuge = ½
(b) Conclusion - DNA is the genetic material = 1
Interpretation - sulphur labelled viral protein did not enter the bacteria during infection, whereas phosphorus labelled viral
DNA entered into the bacteria to cause infection = ½ + ½
3. (a) How are polygenic inheritance and multiple allelism different? Explain with the help of an example each.
(b) List the criteria a chemical molecule must fulfill to be able to act as a genetic material.
Ans.

4. (a) What is polygenic inheritance? Explain with the help of a suitable example.
(b)How are pleiotropy and Mendelian pattern of inheritance different from polygenic pattern of inheritance?
Ans (a) Inheritance in which traits are controlled by three or more genes , eg human skin colour / height , the inheritance
depends upon the additive / cumulative effect of allelles , more the number of dominant allelles the expression of the trait will
be more distinct / prominent , more the number of recessive allelles the trait will be diluted , if member of dominant and
recessive allelles are equal the effect is intermediate = ½ × 6
// same explanation with the help of any suitable example
b) Single gene controls multiple phenotypic expression (Pleiotropy) , one gene controls one phenotypic expression
(Mendelian) = 1+ 1
5. A colour blind boy is born to a couple with a normal colour vision. Write the genotype of the parents.
Ans. Father - XY, Mother -XXC = ½ + ½
6. What is a test cross? How can it decipher the heterozygosity of a plant?
Ans. - A cross to analyse whether genotype of dominant individual is homozygous or heterozygous =1
- On crossing with a recessive parent , if 50% of progeny have dominant trait and 50% have recessive trait then the plant is
said to be heterozygous = 1+1 //
The above value points can be considered with the help of a test cross = 1 + 1
7. How many kinds of phenotypes would you expect in F2 generation in a monohybrid cross exhibiting co-dominance?
Ans. Three
8. Morgan carried out several crosses in Drosophila and found F2-ratios deviated very significantly from the expected
Mendelian ratio. Explain his findings with the help of an example.
Ans. Morgan’s findings differ from Mendel’s because of the phenomena of -
Linkage (genes present on the same chromosome) and recombination; (1/2x2=1)

9. Colour blindness in humans is a sex-linked trait. Explain with the help of a cross.
Ans.
10. In human beings, the sex of the child is determined by the father and not by the mother. Explain.
Ans.

11. Work out a monohybrid cross up to F2 generation between two pea plants and two Antirrhinum plants both
having contrasting traits with respect to colour of flower. Comment on the pattern of inheritance in the crosses carried
above.
Ans.

12. Explain with the help of a suitable example the inheritance of a trait where two different dominant alleles of a trait
express themselves simultaneously in the progeny. Name this kind of inheritance pattern.
Ans. Name- Co-dominance -1 IA IB = Blood group AB- ½ Both alleles dominant

13. How does the gene 'I' control ABO blood groups in humans ? Write the effect the gene has on the structure of red
blood cells.
Ans.
14. (a) Write the scientific name of the organism Thomas Hunt Morgan and his colleagues worked with for their
experiments. Explain the correlation between linkage and recombination with respect to genes as studied by them.
(b) How did Sturtevant explain gene mapping while working with Morgan?
Ans. (a) Drosophila melanogaster = 1 They observed that two genes (located closely on a chromosome) did not segregate
independently of each other (F2 ratio deviated significantly from 9 : 3 : 3 : 1) = ½ Tightly linked genes tend to show fewer
(lesser) recombinant frequency of parental traits / show higher (more) frequency of parental type = ½ Loosely linked genes
show higher percentage (more) of recombinant frequency of parental traits / lower frequency percentage of parental type = ½
Genes present on same chromosome are said to be linked and the recombinant frequency depends on their relative distance on
the chromosome = ½
(b) He used the frequency of recombination between gene pairs on the same chromosome, as a measure of the distance
between genes and mapped their position on the chromosome = 1 + 1 [3 + 2 = 5 marks]
15. Write the three basic facts that are highlighted in Mendel’s Law of Dominance.
Ans. (i) Characters are controlled by discrete units called factors = 1 Factors occur in pairs = 1 In a dissimilar pair of factors
one member of a pair dominates (dominant) the other (recessive) = 1
16. Write the types of sex-determination mechanisms the following crosses show. Give an example of each type. (i)
Female XX with Male XO (ii) Female ZW with Male ZZ
Ans. (i) Male heterogamety, Grasshopper = ½ + ½ (ii) Female heterogamety, Birds = ½ + ½ [2 marks]
17. Women are often blamed for producing female children. Consequently, they are ill-treated and ostracized. How
will you address this issue scientifically if you were to conduct an awareness programme to highlight the values
involved?
Ans. – Male produces two types of sperms ( X & Y type in the ratio 1 : 1) , Female produces only one type of ovum (X type)
, hence the sex of baby is determined by the type of sperm fertilising the ovum therefore women should not be blamed // A
genetic cross showing sex determination in human beings covering above value points can be considered in lieu of the above
explanation = ½ × 3
Sensitivity towards community / Social awareness / Self discipline / Responsible behaviour / Leadership quality / Caring
attitude / Responsible attitude towards society / Concern for others/ Sharing of knowledge or information / Presence of mind
/Being proactive / any other relevant value.
(Any three values) = ½ × 3
18. A colourblind child is born to a normal couple. Work out a cross to show how it is possible. Mention the sex of this
child.
Ans.

19. Mendel published his work on inheritance of characters in 1865, but it remained unrecognized till 1900. Give three
reasons for the delay in accepting his work.
Ans. - The communication was not easy in those days and his work could not be widely publicized.
His concept of genes as stable and discrete units that controlled the expression of traits and of the pair of alleles which did not
‘blend’ with each other was not accepted by contemporaries as an explanation for the apparently continuous variation seen in
nature.
Mendel’s approach of using mathematics to explain biological phenomena was totally new and unacceptable to many of the
biologists of his time.
Though Mendel’s work suggested that factors (genes) were discrete units , he could not provide any physical proof for the
existence of factors and what they were made of. (Any three points) = 1 + 1 + 1 [3 marks]
20. Write the sex of a human having XXY chromosomes with 22 pairs of autosomes. Name the disorder this human
suffers from.
Ans. Male, Klinefelter’s syndrome = ½ + ½
21. A haemophilic father can never pass the gene for haemophilia to his son. Explain.
Ans. It is a sex linked recessive disorder in which X-chromosome has the haemophilic gene = 1
Son inherits a Y chromosome from father and gene for haemophilia is not present on Y chromosome = 1
22. Describe the dihybrid cross carried on Drosophila melanogaster by Morgan and his group. How did they explain
linkage, recombination and gene mapping on the basis of their observations?
Ans. According to Morgan and his group if genes were very tightly linked they showed very low recombination = 1 (shown in
cross A) = 1If genes were loosely linked they showed very high recombination = 1 (shown in cross B) =1The group used the
frequency of recombination between gene pairs on the same chromosome as a measure of distance between genes and
‘mapped’ their position on the chromosome = 1

23. Explain the mechanism of ‘sex determination’ in birds. How does it differ from that of human beings?
Ans. In birds;

Birds : female heterogamety / female produces (Z) type and (W) type of gametes = ½
Humans : male heterogamety / male produces (X) type and (Y) type of gametes = ½ [2 + 1 = 3 marks]
24. Why do normal red blood cells become elongated sickle shaped structures in a person suffering from sickle cell
anaemia?
Ans. The mutant haemoglobin molecule (substitution of Glutamic acid by valine) undergoes polymerization, under low
oxygen tension causing the change. = ½ +½ [1 mark]
Name the type of cross that would help to find the genotype of a pea plant bearing violet flowers.
Ans Test cross =1
25. Study the figures given below and answer the question.

Identify in which of the crosses is the strength of Linkage between the genes higher. Give reasons in support of your
answer.
Ans. Cross A, because they are tightly linked / due to close physical association / they are closely located = 1+1 [2 marks]
26. Write the type and location of the gene causing thalassemia in humans. State the cause and symptoms of the
disease. How is sickle cell anaemia different from this disease?
Ans. i. Autosomal, recessive gene, gene for alpha thalassemia is on chromosome 16, for β thalassemia it is on chromosome 11
=½×4
Cause of symptoms – Mutation or deletion of the gene / genes, resulting in reduced rate of synthesis of one of the globin
chains / alpha or beta chains) = ½ + ½ Thalassemia is a quantitative problem / of too few globin molecules of haemoglobin,
while sickle-cell is a qualitative problem of synthesising an incorrectly functioning globin = 1 + 1
27. Name the stage of cell division where segregation of an independent pair of chromosomes occurs.
Ans. Anaphase-1 of Meiosis -1 / Anaphase -1.
28. In Snapdragon, A cross between true breeding red flower (RR) plants and true breeding white flower (rr) plants
showed a Progeny of plants with all pink flowers. The appearance of pink flowers is not known as blending. Why?
What is the phenomenon known as?
Ans. (a) R (dominant allele red colour) is not completely dominant over r (recessive allele white colour) / r maintains its
originality and reappear in F2 generation. = 1 (b) Incomplete dominance = 1[2 marks]
29. Identify 'a', 'b', 'c, 'd', 'e' and 'f' in the table given below :

Ans. a. short statured / small round head / furrowed tongue / partially open mouth / palm is broad
/ physical development retarded / psychomotor development retarded / mental development retarded .
(any two) = ½

30. Write the scientific name of the fruit-fly. Why did Morgan prefer to work with fruit-flies for his experiments? State
any three reasons.
Ans. Drosophila melanogaster = ½ Grown in simple synthetic medium, complete the life cycle in two weeks / short life cycle,
single mating produce more progeny , dimorphism, many heritable variations / easy to handle.
(any three) = 1½[2 marks]
31. Linkage or crossing-over of genes are alternatives of each other. Justify with the help of an example.
Ans. In Drosophila a yellow bodied white eyed female was crossed with brown bodied red eyed male, F1 progeny produced
and intercrossed the F2 phenotypic ratio of Drosophila deviated significantly from Mendel’s 9:3:3:1, the genes for eye colour
& body colour are closely located on the ‘X’ chromosome showing linkage & therefore inherited together, recombinants were
formed due to crossing over but at low percentage. = ½×4
32. State the chromosomal defect in individuals with Turner’s syndrome.
Ans. (In female) Monosomy of sex chromosome // XO condition // Absence of one X chromosome 1
33. What is chance mutation? Explain this phenomenon using application of DDT as an example.
Ans. DDT is an insecticide- kills most of the insects , but some become resistant varieties, in much less time scale of just
months or years , It is a chance event in nature- so chance Mutation 4x ½ =2
34. Which chromosome carries the mutated gene causing β thalassaemia? What are the problems caused by the
mutation?
Ans. Chromosome number 11 carries the Mutant gene causing β thalassaemia 1
It causes formation of abnormal haemoglobin molecules, resulting into anaemia 1+1
35. State and explain the “law of independent assortment” in a typical Mendelian dihybrid cross.
Ans. Law of Independent Assortment : when two pair of traits are combined in a hybrid , inheritance of one pair of characters
is independent of the other pair of characters / when two pairs of contrasting characters or genes or traits are inherited together
in a dihybrid cross (in a pea plant ) the inheritance of one pair of character is independent of inheritance of the other character
in the progeny = 1 Explanation : Mendel took homozygous pea plant producing yellow and round seeds and crossed them with
homozygous pea plant producing green and wrinkled seeds / shown in a flow chart of a dihybrid cross given
//

(Formation of new phenotypes along with parental phenotypes is possible because inheritance of two pairs of contrasting traits
or genes in the progeny is independent of each other)[4 + 1 = 5 marks]
36. When Morgan conducted dihybrid cross on Drosophila like Mendel did with pea plants, the F2 ratios deviated
significantly from that of Mendel’s F2 ratio. Write the explanation Morgan and his group gave to the observations
they obtained from their experiment.
Ans. - When two genes in a dihybrid cross were located on the same chromosome they did not segregate independently = 1
The proportion of parental gene combinations were much higher than non-parental combinations / recombinants = 1 Physical
association of two genes was termed linkage = 1 [1× 3 = 3 marks]
37. During a medical investigation, an infant was found to possess an extra chromosome 21. Describe the symptoms the
child is likely to develop later in the life.
Ans. Short-statured , small round head , furrowed tongue , partially open mouth , broad palm with characteristic palm crease ,
physical psychomotor & mental development retarded , big and wrinkled tongue, broad flat face, flat back of head , many
‘loops’ on finger tips (Any three) = 1 × 3
38. State the fate of a pair of autosomes during gamete formation.
Ans. Segregate / separate
39. (a) Dihybrid cross between two garden pea plant one homozygous tall with round seeds and the other dwarf with
wrinkled seeds was carried. Write the genotype and phenotype of the F1 progeny obtained from this cross. Give the
different types of gamates of the F1 progeny. Write the phenotypes and its ratios of the F2 generation obtained in this
cross along with the explanation provided by Mendel.
(b) How were the observations of F2 progeny of dihybrid crosses in Drosophila by Morgan different from that of
Mendel carried in pea plants? Explain giving reasons.
(b) Morgan observed the result of linkage of genes on a chromosome, but Mendel did not observe phenomenon of linkage in
pea plants // F2 ratio of Morgan deviated significantly from 9:3:3:1 ratio (Mendelian ratio) 1
40. On what basis is the skin colour in humans considered polygenic?
Ans. Controlled by more than one gene, cumulative/additive effect of every gene ½ + ½
41. Write the chromosomal defect in individuals affected with Klinefelter’s syndrome.
Ans. (Male) additional copy of X chromosome / XXY 1
42. Explain codominance with the help of one example.

43. (a) If there is a history of haemophilia in the family, the chances of male members becoming haemophilic are more
than that of the female.Why is it so?
(b) Write the symptoms of the disease.
Ans. a) Defective gene is on X chromosome, in case the carrier female (mother) passes Xh to the son he suffers, if she passes
Xh to the daughter, she has the other X( from father ) to make it heterozygous so the daughters escape as carriers ½ x 4=2
b) The blood does not clot in the affected person after an injury or a small cut. 1
44. A pea plant producing yellow coloured and round seeds is given with unknown genotypes.
Explain how you would find the correct genotypes of the plants with respect to the two traits mentioned. Work out the
cross and name it.
Ans.
45. A geneticist interested in studying variations and patterns of inheritance in living beings prefers to choose
organisms for experiments with shorter life cycle. Provide a reason.
Ans. Many generations can be obtained (in a short time)// variations can be exhibited / selected faster
46. Differentiate between ‘ZZ’ and ‘XY’ type of sex-determination mechanisms.
Ans. ZZ - males (birds) homogametic (females heterogametic), sex is determined by the type of egg getting fertilised = ½ + ½
XY male (human being) heterogametic (females homogametic), sex is determined by the type of sperm fertilising the ovum =
½+½
47. A teacher wants his/her students to find the genotype of pea plants bearing purple coloured flowers in their school
garden. Name and explain the cross that will make it possible.
Ans. Test cross = 1 Purple flower to be crossed with white (homozygous recessive) flower = 1 If all flowers of F1 are purple
then genotype is homozygous dominant / PP = ½ If 50% are purple and 50% are white then genotype is heterozygous
dominant / Pp = ½ or (same thing can be shown with the help of crosses)[3 Marks]
48. Explain the genetic basis of blood grouping in human population.
Ans. (i) Blood group in human population determined by gene ‘ I ’ , which has three allele IA and IB and i (multiple allelism)
=½ + ½
IA IB are dominant allele (codominance) each forming different type of sugar polymer on the surface of RBC , while allele ‘ i
’ is recessive and does not produce any sugar = ½ + ½
IA IA , IA i –– A group = ½

49. Give an example of an autosomal recessive trait in humans. Explain its pattern of inherit- ance with the help of a
cross.
Ans. Sickle cell anaemia / Phenylketonuria / Thalassemia / O Blood group / Non - rolling of tongue / Fused or attached ear
lobes / Inability to taste PTC (phenyl thiocarbamide) =1
50. How would you find genotype of a tall pea plant bearing white flowers? Explain with the help of a cross. Name the
type of cross you would use.

Test cross = ½ Both crosses = ½

Both interpretations = ½
IB IB , IB i –– B group = ½
IA IB ––– AB group = ½
ii –– O group = ½
Since humans are diploid / each person possesses any two of three ‘ I ’ gene alleles , resulting into six different genotypic
combination and four phenotypic expression = ½ + ½
51. Both Haemophilia and Thalassemia are blood related disorders in humans. Write their causes and the difference
between the two. Name the category of genetic disorder they both come under.

Mendelian disorder = 1
52. (a) Name the kind of diseases/disorders that are likely to occur in humans if mutation in the gene that codes for an
enzyme phenyl alanine hydrolase occurs,
(a) There is an extra copy of chromosome 21,
(b) The karyotype is XXY. Mention any one symptom of the diseases/disorders named above.
Ans. (a & b)
Phenylketonuria , mental retardation = ½ + ½
Down’ s syndrome , short statured / small round head / furrowed tongue / partially open mouth / broad palm with
characteristics palm crease / retarded mental physical and psychomotor development = ½ + ½
Klinefelter’s Syndrome , Overall masculine development with feminine features (enlarged breast / Gynaecomastia) / sterile =
½ + ½ (any one symptom from each category , any other appropriate symptom) [3 Marks]
53. (a) State and explain the law of dominance as proposed by Mendel.
(b) How would Phenotypes of monohybrid F1 and F2 progeny showing incomplete dominance in Snapdragon and co-
dominance in human blood group be different from Mendelian monohybrid F1 and F2 progeny? Explain.
Ans. (a)
Characters are controlled by discrete units called factors = 1
Factors occur in pairs = 1
In a dissimilar pair of factors one member of the pair dominates (dominant) the other (recessive) = 1
(b)

54. List any two characters of Pea plants used by Mendel in his experiments other than height of the plant and the
colour of the seed.
Ans. Flower colour / Flower position / Pod shape / Pod colour / Seed shape (Any two) = ½ + ½
55. Name the disorder caused due to the absence of one of the X-chromosomes in a human female.
Ans. Turner’s syndrome
56. How many chromosomes do drones of honeybee possess? Name the type of cell division involved in the production
of sperm by them.
Ans. 16, Mitosis = ½ + ½ [1 Mark]
57. The F2 progeny of a monohybrid cross showed phenotypic and genotypic ratio as 1:2:1, unlike that of Mendel’s
monohybrid F2 ratio. With the help of suitable example, work out a cross and explain how it is possible.
Ans. Mirabilis jalapa / four O’ clock plant / Antirrhinum (majus)/ Snapdragon flower /dog flower = ½

In heterozygous condition a single dominant gene is not sufficient to produce red colour, therefore it is a case of incomplete
dominance = ½ + ½

58. (a) How are Mendelian inheritance, polygenic inheritance and pleiotropy different from each other ?
(b) Explain polygenic inheritance pattern with help of suitable example.

=1 × 3
(b) Human Height/skin colour are examples of polygenic inheritance, height trait is controlled by at least three gene pairs,
additive effect of each allele contributes to the phenotypic expression of the trait, more the dominant alleles more pronounced
is the phenotypic expression /more the recessive alleles less pronounced is the phenotypic expression = ½ × 4 Note: (skin
colour may be accepted in place of height as an example)
59. Mention two causes of frame- shift Mutation.
Ans. Insertion, deletion of three bases / one codon or multiple of three bases / multiple codon (hence one or more amino acid)
(reading frame remains unaltered from that point onwards) = ½ + ½ [1 Mark]
60. How does a test cross help to determine the genotype of an individual?
Ans. Individual of unknown genotype crossed with recessive parent = 1 All dominant in progeny - Homozygosity, dominant
to recessive ratio 1:1 in progeny – Heterozygosity = ½ + ½
61. Human blood group is a good example of multiple allelism and co-dominance. Justify.
Ans. Multiple allelism : Generally in an individual / population , only two alleles of a trait govern the character, but in case of
ABO blood group , three alleles IA, IB and i are found to govern blood group in human population = ½ × 4 =2 Co-dominance:
Allele IA and IB when present in an individual , both being dominant express their own types of sugars / traits (no marks for
the second step if two alleles are not given correctly)
= ½ × 2 =1
62. Thalassemia and haemophilia are both Mendelian disorders related to blood. Write the symptoms of the diseases.
Explain with the help of crosses the difference in the inheritance pattern of the two diseases.
Ans. Thalassemia - Anaemia = ½ Haemophilia - Non stop bleeding = ½
Haemophilia - Sex linked recessive disorder , is generally passed on from (carrier) mother to some of her sons / from affected
father to daughter (carrier) = ½ + ½
Note : - Any one cross , one mark to be given if the entire diagram (cross) is correct [1 + 1 + 1 + 1 + 1 = 5 marks]
63. A male honeybee has 16 chromosomes whereas its female has 32 chromosomes. Give one reason.
Ans. Male Honey bee develops from unfertilized female gamete / unfertilised egg / Parthenogenesis of female gamete (16
chromosomes), female develops by fertilization / fertilised egg (32 chromosomes) = ½ + ½ [1 mark]
64. What happens when chromatids fail to segregate during cell division cycle? Explain your answer with an example.
Ans. Failure of segregation of chromatids during cell division cycle results in the gain or loss of chromo-some/ called
aneuploidy = 1E.g.Down' syndrome results in the gain of extra copy of chromosome 21 /Turner's syndrome results due
to loss of an X-chromosome in human female = 1
65. ABO blood groups is a good example of co-dominance. Justify.
Ans -ABO blood group in humans is contributed by gene 'I' that has 3 alleles 'IA' 'IB' and 'i.' Because human beings are
diploid each person has two of the three alleles. IA and I B produce two different types of sugar while allele i does not
produce sugar on the plasma membrane of RBC- When IA and I B are present they both express their own type of sugar- this
is codominance = ½ × 4 [2 Marks]
66. Mention the combination(s) of sex chromosomes in a male and a female bird.
Ans. Male-ZZ = ½, Female-ZW = ½
67. Explain the cause of chromosomal disorders in humans. Describe the effect of such disorders with the help of an
example each involving (i) autosomes, and (ii) sex chromosomes.
Ans. Gain or loss of a chromosome (due to non-disjunction) =1 Down Syndrome- Additional copy of 21st chromosome/
trisomy of 21 = ½ + ½
i) Klinefelter’s Syndrome- presence of an additional copy of X chromosome leading to XXY
// Turner’s Syndrome- absence of one of the X chromosome i.e. 45 with XO = ½ + ½[3 Marks]

MOLECULAR BASIS OF INHERITANCE

1. Write the conclusion Griffith arrived at the end of his experiment with Streptococcus pneumoniae.
Ans. He concluded that the R-strain bacteria had somehow been transformed by heat- killed S-strain bacteria, this must be due
to transfer of genetic material = ½ + ½
2. Identify A, B, C, D, E and F in the following table

Ans i) A - Nitrogenous base / A - Pentose sugar . B - Pentose Sugar / B- Nitrogenous base C - N glycosidic linkage.
D - phosphate group.
E - phospho ester linkage
F- (3 -'5') phosphodiester linkage.
3. Why is charging of t-RNA necessary during translation process?
Ans. Formation of peptide bond requires energy which is provided by the charged tRNA
Amino acid can join with cognate t-RNA.
4. (a) Name the stage in the cell cycle where DNA replication occurs.
(b) Explain the mechanism of DNA replication. Highlight the role of enzymes in the process. Why is DNA replication
said to be semiconservative?
Ans (a) S phase / synthetic phase ( of interphase) = ½
(b) The replication begins in definite regions which are called the origin of replication , Replication occurs within a small
opening of the DNA referred to as Y shaped replication fork (uncoiling of DNA is by some enzymes e.g. Helicase and
topoisomerase),
Polymerisation of the nucleotides are catalysed by DNA dependent DNA polymerase in 5' - 3' directions,
Deoxyribonucleotides act as substrates and also provide energy for the process, The new strands formed on 3 '-5' template is
continuous, New strands formed on 5-'3' template is discontinuous, The discontinuously formed fragments are joined
by enzyme DNA ligase = ½ × 7 During DNA replication in the two newly synthesised daughter DNA one strand is parental
(conserved) and the other is newly synthesised =1 (1+1=2)
5. With the help of a schematic diagram, explain the location and the role of the following in a transcription unit:
Ans. Structure

Function-Promotor- RNA polymerase binds to it starter Structural gene- functional genes Terminator- transcription ends here
[ ½ X 6= 3]
6. Following a severe accident, many charred –disfigured bodies are recovered from the site making the identification
of the dead very difficult. Name and explain the technique that would help the authorities to establish the identity of
the dead to be able to hand over the dead to their respective relatives.
Ans. DNA fingerprinting - Isolation of DNA and digestion of DNA by restriction endonucleases, separation of DNA
fragments by electrophoresis, transferring(blotting) of separated DNA fragments to synthetic membranes, such as
nitrocellulose or nylon, hybridization using labeled VNTR probe and, detection of hybridized DNA fragments by
autoradiography. (1/2x6=3)
7. “DNA replication is semi-conservative”. Name the scientists who proposed it and who proved it .How was it proved
experimentally? Explain.
Ans. Meselson & Stahl (1)

(three steps with DNA and centrifugation tubes-(1+1+2))

8. Describe the interaction of t-RNA, m-RNA and ribosomes during the events of translation.
Ans. - for initiation the ribosome binds to the mRNA at the start codon / AUG = 1
charged tRNA binds to the appropriate codon on mRNA forming complementary base pairs on tRNA as anti codon in the
ribosome = 2 Ribosomes moves from codon to codon along mRNA , amino acids are added one by one brought by tRNA,
form the polypeptide chain = 2 [1 + 2 + 2 = 5 Marks]
9. (a) Why does DNA replication occur in small replication forks and not in its entire length?
(b) Why is DNA replication continuous and discontinuous in a replication fork?
(c) State the importance of origin of replication in a replication fork.
Ans. (a) DNA being very long, requires high energy for opening along its entire length = 1 + 1
(b) DNA dependent DNA polymerase catalyse polymerisation only in one direction, i.e. 5’ 3’, =½+½
Two strands of DNA are anti parallel and have opposite polarity = 1
(c) Site where replication originates = 1 [2 + 2 + 1 = 5 marks]
10. What is an operon? Explain the functioning of lac operon when in an open state.
Ans. The arrangement where a (Polycistronic) structural gene is regulated by a common promoter and regulatory genes = 1
Lactose acts as inducer , binds with repressor protein , RNA polymerase freely moves over the structural genes , transcribes
lac mRNA , which in turn produce enzymes - transacetylase, permease , ß-galactosidase (by lac z) , responsible for digestion
of lactose = ½ × 8
// In lieu of above explanation the following diagram can be considered

11. (a) Expand VNTR and describe its role in DNA fingerprinting.
(b) List any two applications of DNA fingerprinting technique.
Ans. (a) VNTR - Variable Number of Tandem Repeat(s) = ½ -used as a probe (because of its high degree of
polymorphism) = ½
(b) Forensic science / criminal investigation (any point related to forensic science) / determine population and genetic
diversities / paternity testing / maternity testing / study of evolutionary biology (Any two) = 1 + 1[1 + 2 = 3 marks]
12. Write the dual purpose served by Deoxyribonucleoside triphosphates in polymerisation.
Ans. Acts as a substrate, provide energy (from the terminal two phosphates) = ½ + ½
13. What will happen if DNA replication is not followed by cell division in a eukaryotic cell?
Ans. Results in polyploidy/ chromosomal abnormality 1
14. How would lac operon operate in E.coli growing in a culture medium where lactose is present as source of sugar?
Ans. Lactose (Inducer) binds to repressor,/repressor does not bind to operator/z,y,a-transcribe (lac mRNA)Translation (□-
galactosidase/permease/transacetylase) (½ x 4=2)
15. a) What are the transcriptional products of RNA polymerase III ? 3
(b) Differentiate between ‘Capping’ and ‘Tailing’. Expand hnRNA.
Ans. a) tRNA,5srRNA,snRNA
(b) Capping-addition of mGppp / mGTP . Tailing-Poly A tail/200-300 adenylate residues Heterogenous nuclear RNA
16. Describe the process of transcription in a bacterium.
17. How is repetitive / satellite DNA separated from bulk genomic DNA for various genetic experiments?
Ans. Density gradient centrifugation = 1
18. i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
ii) Explain the basis on which he arrived at this conclusion.
Ans. (i) George Gamow = ½
(ii) There are four bases and 20 amino acids = ½
(There should be atleast 20 different genetic codes for these 20 amino acids)
Only possible combinations that would meet the requirement is combinations of 3 bases that will give 64 codons = 1 [2
marks]
19. (a) State the ‘Central dogma’ as proposed by Francis Crick. Are there any exceptions to it? Support your answer
with a reason and an example.
(b) Explain how the biochemical characterisation (nature) of ‘Transforming Principle’ was determined, which was not
defined from Griffith’s experiments.

Ans. (a) =1
Yes , in some viruses flow of information is in reverse direction / reverse transcription = ½ + ½
e.g. Any Retrovirus / HIV = ½
(b) Protein and DNA and RNA were purified from heat killed S strain / smooth
Streptococcus / Diplococcus pneumoniae = ½
Protein + Protease transformation occured (R cell to S type) = ½ RNA + RNA ase transformation occured (R cell to S
type) = ½ DNA + DNAase transformation inhibited = ½
Hence DNA alone is the transforming material = ½ [2 + 3 = 5 marks]
20. Describe the experiments that established the identity of ‘transforming principles’ of Griffith.
Ans. - Purification of biochemicals like Proteins, RNA & DNA from S cells (heat killed), = ½
Presence of Protein & RNA in medium did not affect transformation, = ½ + ½
DNA alone from S Bacteria caused R Bacteria to transform, = ½
Digestion with DNAase did inhibit transformation, = ½ Conclusion: DNA is the transforming chemical / biochemical, = ½
21. (a) Explain the process of DNA replication with the help of a schematic diagram.
(b) In which phase of the cell cycle does replication occur in Eukaryotes? What would happen if cell-division is not
followed after DNA replication?
22. One of the salient features of the genetic code is that it is nearly universal from bacteria to humans. Mention two
exceptions to this rule. Why are some codes said to be degenerate?
Ans. (i) Mitochondrial codons, = ½
(ii) Some protozoans = ½
Since some amino acids are coded by more than one codon hence it is called as degenerate = 1[2 marks]
23. A template strand is given below .Write down the corresponding coding strand and the mRNA strand that can be
formed, along with their polarity.
3’ATGCATGCATGCATGCATGCATGC5’
Ans. Coding strand-5’ TACGTACGTACGTACGTACGTACG 3’
mRNA strand- 5’ UACGUACGUACGUACGUACGUACG 3’ = 1+1
24. Draw a labeled diagram of nucleosome. Where is it found in a cell?

Location : chromatin of nucleus = ½[2 marks]

25. Why is DNA molecule considered as a better hereditary material than RNA molecule?
Ans. DNA molecule is a better hereditary material as-
It is more stable (due to presence of thymine and not uracil as in RNA)
Less reactive than RNA (as RNA has 2’ - OH making it more reactive)
Being less reactive, DNA is not easily degradable (RNA being more reactive is easily degradable)
Rate of mutation is slow (Rate of mutation in RNA is faster)
Any three = 1 × 3
26. Name the three RNA polymerases found in eukaryotic cells and mention their functions.
Ans. RNA polymerase - I , transcribes rRNAs (28S -18S and 5.8S ) = ½ × 2
RNA polymerase - II , transcribes precursor of mRNA / hnRNA / heterogeneous RNA = ½ × 2
RNA polymerase - III , transcribes tRNA / 5sr RNA / snRNA = ½ × 2[3 marks]
27. Explain the post transcriptional modifications the hn-RNA undergoes in eukaryotic cell.
Ans. Splicing, Introns are removed and exons are joined = ½ × 2
Capping, Methyl guanosine triphosphate / mGppp is added to the 5’ end of hnRNA = ½ × 2 Tailing, Polyadenylate
residues are added to 3’-end in a template independent manner= ½ × 2[3 marks]
28. (a) Name the scientist who postulated the presence of an adapter molecule that can assist in protein synthesis.
(b) Describe its structure with the help of a diagram. Mention its role in protein synthesis.
Ans. (a) Francis Crick = ½
(b) Clover leaf / inverted L , Anticodon loop (complementary to codon of mRNA) , acceptor end (to bind amino acid) =½ × 3
= 1½
//

It reads the codons on mRNA with the help of anticodon loop , brings the corresponding amino acid for the formation of
polypeptide chain = ½ + ½
29. Name one amino acid, which is coded by only one codon.
Ans. Methionine / Tryptophan
30. Explain the two factors responsible for conferring stability to double helix structure of DNA.
Ans. Presence of H-bonds, the plane of one base pair stacks over the other, complementarity, presence of thymine in place of
uracil. (any two) = 1+ 1
31. Name the negatively charged and positively charged components of a nucleosome.
Ans. Negatively charged component DNA, positively charged component histone octamer ½+½
32. (a) Differentiate between a template strand and coding strand of DNA.
(b)Name the source of energy for the replication of DNA.

33. Explain the process of DNA replication with the help of a replicating fork.
Ans. There is a definite region in DNA where the replication originates called as origin of replication, For long DNA
molecules since the two strands of DNA cannot be separated in its entire length, the replication occurs within a small opening
of the DNA helix , referred to as replication fork.
The DNA dependent DNA polymerase, catalyze polymerization only in one direction, that is 5’-- >3’, on one strand ( the
template with polarity 3’-->5’) the replication is continuous, while on the other( the template with polarity 5’-->3’) it is
discontinuous. The discontinuous synthesized fragments are later joined by the enzyme DNA ligase. (10 x ½ = 5)
34. Explain the structure of t-RNA with the help of a diagram. Describe its role in the process of translation.
Correct diagram-1, correct labelling of anti-codon / anti- codon site ½ , correct labelling of corresponding amino acid / amino
acid binding site- ½
t-RNA has an anticodon loop that has bases complementary to the code ,and it has also an amino acid accepter end to which it
binds to amino acid . 1
Amino acid are activated in the presence of ATP, and linked to their cognate t-RNA,called as charging/ amino-acylation of t-
RNA.1 Initiater t-RNA recognises start codon (AUG)/ t-RNA act as the adapter molecule that reads the genetic code1
Two such charged t-RNA are brought close enough to favour peptide bond formation. ½ x6=3
35. Although a prokaryotic cell has no defined nucleus, yet DNA is not scattered throughout the cell. Explain.
Ans. DNA is negatively charged , positively charged proteins , hold it in places , in large loops (in a region termed as
nucleiod) = ½ × 4
36. Describe the structure of a nucleosome.
Ans. A unit of eight molecules of positively charged histones, negatively charged DNA , wrapped around the histones octamer
, contains 200 bp of DNA helix = ½ × 4
// In lieu of the above explanation the following diagram alongwith the following statement can be considered

DNA is negatively charged, histone is positively charged , 200 bp of DNA helix = ½ × 3, Diagram = ½
37. Name the transcriptionally active region of chromatin in a nucleus.
Ans. Euchromatin / Exon
38. (a) A DNA segment has a total of 2,000 nucleotides, out of which 520 are adenine containing nucleotides. How
many purine bases this DNA segment possesses?
(b) Draw a diagrammatic sketch of a portion of DNA segment to support your answer.
Ans. (a) 1000 purines = ½
 (b)

Diagram showing polarity = ½ N- base = ½ H - bond = ½ Deoxyribose sugar = ½

39. Differentiate between the genetic codes given below:
Unambiguous and Universal
Degenerate and Initiator

40. Following the collision of two trains a large number of passengers are killed. A majority of them are beyond
recognition. Authorities want to hand over the dead to their relatives. Name a modern scientific method and write the
procedure that would help in the identification of kinship.
Ans. DNA fingerprinting (analysis) = ½
Isolation and digestion of DNA by restriction endonuclease
Separation of DNA fragments by electrophoresis and transferring them to synthetic membranes
/ nitrocellulose / nylon Hybridisation using labelled VNTR probe Detection of hybridised DNA fragments by autoradiography
Matching banding pattern of DNA / DNA fingerprints / autoradiograms of the passengers killed and that of relatives = ½ × 5
[3 Marks]
41. How did Hershey and Chase established that DNA is transferred from virus to bacteria?
Ans. • Some bacteriophage were grown in a medium that contained 32P / radioactive phosphorus , while some were grown in
a medium that contained 35S / radioactive sulphur =½×2
the labelled bacteriophage from both media were allowed to infect E. coli = 1
In both the cases viral coats were removed from the bacteria by agitating them in a blender =1
The virus particles were separated from the bacteria by spinning them in a centrifuge = 1
No radioactivity was detected in cells (E. coli) but detected in supernatant in case where bacteriophage were labelled with
radioactive sulphur = ½
Radioactivity detected in cells (E. coli) while no radioactivity detected in supernatant in another case where bacteriophage
were labelled with radioactive phosphorus = ½
(Phosphorus being a constituent of DNA indicates that DNA is the genetic material that is passed from virus to bacteria) [5
Marks]
// The following diagrammatic representation can be considered in lieu of the above explanation.

42. A region of a coding DNA strand has the following nucleotide sequence:
-ATGC- What shall be the nucleotide sequence in (i) sister DNA segment it replicates, and (ii) m-RNA polynucleotide it
transcribes?
Ans. i) -TACG- = ½ , ii) -AUGC - = ½
43. How was a heavy isotope of nitrogen used to provide experimental evidence to semi- conservative mode of DNA-
replication?
Ans. E.coli were allowed to grow on medium containing 15N for many generations so that 15N was incorporated in newly
synthesized DNA making it heavy DNA (Nitrogen is important constituent of DNA) = ½
The heavy DNA can be differentiated from light DNA by Caesium Chloride Density Gradient centrifugation, = ½ The above
E.coli (with 15N) were then transferred in medium containing 14N and, samples were taken out after 20 minutes and after 40
minutes = ½ Extracted DNA was centrifuged and measured to get their density , = ½DNA extracted after 20 minutes (Ist
Generation) showed an intermediate hybrid density / 14N 15N,= ½
DNA extracted after 40 minutes (2nd Generation) showed equal amount of Light DNA / 14N and hybrid DNA / 14N 15N =
½= ½ × 6
 44.(a) Describe the various steps of Griffith's experiment that led to the conclusion of the 'Transforming principle' .
(b) How did the chemical nature of the 'Transforming principle' get established ?
Ans. (a) Streptococcus pneumonia = ½ S - Strain 'inject into mice' mice die = ½ R - strain 'inject into mice' mice alive = ½ S
- strain (heat killed) 'inject into mice' mice alive = ½
R - strain (alive) + S (heat killed) strain 'inject into mice' mice die = ½ R strain transformed into virulent = ½
(b) Purified biochemicals (protein, DNA, RNA) from heat killed S - Strain = ½ Treated with protease - did not affect
transformation = ½ Treated with RNase - did not affect transformation = ½ Treated with DNase - transformation affected = ½
(½×10=5)
45. What is a cistron?
Ans. A segment of DNA, Coding for a polypeptide = ½ + ½
46. Describe how the lac operon operates, both in the presence and absence of an inducer in E.coli.

structural gene zya = ½ operator = ½ i = ½ repressor = ½ binding = ½ Operon shut = ½ inducer = ½ viii inducer + binding =
½ operator free = ½ enzymes / operator = ½ (½×10=5)[5 marks]
47. (a) Describe the structure and function of a t-RNA molecule. Why is it referred to as an adapter molecule?
(b) Explain the process of splicing of hn-RNA in a eukaryotic cell.
Ans: (a) Clover-leaf shaped / inverted L shaped molecules has an anti codon loop with bases complementary to
specific codon , has an amino acid acceptor end = 1+1
As it reads the code on one hand and binds with the specific amino acid on the other hand.=1
(b) Introns are removed, exons are joined in a definite order = 1 + 1 //
Process of splicing shown diagramatically.
48. Write the different components of a lac-operon in E.coli. Explain its expression while in an ‘open’ state.
Ans: It consists of one regulatory gene(i) , promotor gene , operator gene , and three structural genes(z,y,a) = ½× 4
Lactose/ inducer binds to the repressor protein , makes it inactive so it cannot bind with operator, allows RNA Polymerase
access to the promotor and transcription proceeds , -galactosidase , permease , transacetylase formed (by translation process
for Lactose metabolism ) = ½ × 6

49. How does a degenerate code differ from an unambiguous one?

Ans. Degenerate Code : one amino acid coded by more than one codon = ½ Unambiguous code : One codon for one amino
acid = ½ [1 Mark]
50. Write the function of RNA polymerase II.
Ans. RNA polymerase II - transcribes precursor of mRNA / hn RNA
51. Explain the process of transcription in Eukaryotes.
Ans. Transcription in Eukaryotes is catalysed by DNA dependent RNA polymerase (I , II , III) ,
RNA polymerase binds to promoter and initiates transcription ,
It uses nucleoside triphosphates and polymerises to continue elongation ,
Results in termination of transcription ,
RNA polymerase I transcribes rRNAs (28S, 18S and 5.8S) ,
RNA polymerase III is responsible for transcription of tRNA (5s rRNA and snRNAs) ,
RNA polymerase II transcribes precursor of mRNA - the hn RNA,
Splicing removes introns and exons that are joined in a defined order,
hn RNA undergoes capping (methyl guanosine triphosphate added to 5’- end),
and tailing (adenylate residues are added to 3’- end in template) ,(It is the fully processed hnRNA is now called mRNA
transported out of nucleus for translation)= ½ × 10[5 Marks]
52. State the roles of AUG codon at 5' end and UAG at 3' end of a certain m-RNA during translation.
Ans. AUG codon at 5’ end = start codon (for translation) / codes for methionine = 1 UAG codon at 3’ end = stop codon (for
translation) / terminate polypeptide chain= 1
[1 + 1 = 2 marks]
53. ‘Degenerate’ and ‘Universal’ are salient features of a genetic code. Explain.
Ans. Degenerate - Some aminoacids are coded by more than one codon = 1
Universal - one codon shall code for the same amino acid in all organisms (UUU would code for phenylalanine from bacteria
to human beings) = 1[1 + 1= 2 marks]
54. “A very small sample of tissue or even a drop of blood can help to determine paternity”. Provide a scientific
explanation to substantiate the statement.
Ans. (i) DNA from all cells of an individual shows the same degree of polymorphism and therefore becomes a useful
identification tool =1
(ii)Polymorphs are heritable and the child inherits 50% of the chromosome from each parent=1
(iii) With the help of PCR the small amount of DNA from blood can be amplified and be used in DNA finger printing to
identify the paternity =1 Note: (if only DNA finger printing is described or illustrated allot only 1 mark)
55. Rearrange the following in the correct sequence to accomplish an important biotechnological reaction:
(a) In vitro synthesis of copies of DNA of interest
(b) Chemically synthesized oligonucleotide
(c) Enzyme DNA-polymerase
(d) Complementary region of DNA
(e) Genomic DNA template
(f) Nucleotides provided
(g) Primers
(h) Thermostable DNA-ploymerase (from Thermus aquaticus)
(i) Denaturation of ds-DNA [3 Marks]

56. (a) Draw a labelled diagram of a “replicating fork” showing the polarity.Why does DNA replication occur within
such ‘fork’ ?
(b) Name two enzymes involved in the process of DNA replication, along with their properties.
Ans. (a)

(Correct diagram with polarity of parental strands and any other 3 labels) = ½ × 4
Since two strands of DNA cannot be seperated in its entire length due to very high energy requirement
/ high amount of energy is required to break the hydrogen bonds holding the two strands the replication occurs in small
opening of DNA strands called the Replication fork = 1
(b) i) DNA dependent DNA polymerase , adds nucleotides only in 5’ to 3’ directions/are very fast =½ ×2
ii) DNA ligase, joins the discontinuously synthesised DNA fragments during replication=½ ×2[5 Marks]
57. Give an example of a codon having dual function.
Ans. AUG
58. Answer the following questions based on Hershey and Chases’s experiments:
(a) Name the kind of virus they worked with and why?
(b) Why did they use two types of culture media to grow viruses in? Explain.
(c) What was the need for using a blender and later a centrifuge during their experiments?
(d) State the conclusion drawn by them after the experiments.
Ans. (a) Bacteriophage , they infect bacteria = ½ + ½
(b) Two types of culture media were used in order to make protein of viruses (with the help of 35S) radioactive in one case ,
and DNA molecule in virus (with the help of 32P radioactive in other case = ½ × 2
so as to identify which one of the two had entered into the bacteria during viral infection = 1
Blender - to separate the viral protein coats that are still attached to the surface of bacteria =½ Centrifuge - to separate lighter
supernatant (containing viral protein coats) from denser residue (containing bacteria) = ½
DNA is the genetic material i.e. passed from virus to bacteria = 1
59. State a difference between a gene and an allele.
Ans. Gene - contains information that is required to express a particular trait // unit of inheritance // segment of DNA called
cistron //sequence of DNA coding for tRNA / rRNA / polypeptide / enzyme
Allele - Genes which code for a pair of contrasting traits / (slightly) different forms of the same gene / individual gene in a
particular gene pair (for same character)
60. Mention one difference to distinguish an exon from an intron.
Ans. Exon : coded / expressed sequence of nucleotides in mRNA , = ½
Intron : Intervening sequence of nucleotides not appearing in processed mRNA = ½
61. Mention two applications of DNA polymorphism.
Ans. Genetic mapping, DNA finger printing = 1 + 1
62. Where is an ‘operator’ located in a prokaryote DNA? How does an operator regulate gene expression at
transcriptional level in a prokaryote? Explain.
Ans. The operator region is located adjacent to promoter elements / prior to structural gene = ½ In regulation of gene
expression switch off – the repressor binds to the operator region, & prevents transcription = ½ + ½ switch on – In the
presence of inducer the repressor is inactivated , (by the interaction with the inducer) and operator allows RNA polymerase
access to the promoter , & transcription proceeds = ½ × 3[3 marks]
63. A number of passengers were severely burnt beyond recognition” during a train accident. Name and describe a
modern technique that can help hand over the dead to their relatives.
Ans. DNA finger printing = 1
Isolation of DNA and digestion of DNA by restriction endonucleases, separation of DNA fragments by (gel) electrophoresis
and transferring (blotting) of separated DNA fragments to synthetic membrane or nitrocellulose or nylon , hybridization using
VNTR probe and detection of hybridised DNA fragments by autoradiography , matching the banding pattern so obtained with
that of relative = ½ × 4
64. (a) Why did Hershey and Chase use radioactive sulfur and radioactive phosphorus in their experiment?
(b) Write the conclusion they arrived at and how.
Ans. (a) In order to label protein coat of virus with radioactive sulfur, label DNA with radioactive phosphorus = ½ + ½
(b)Bacteria which were infected with viruses having radioactive DNA were found to contain radioactive DNA later on = ½
Bacteria which were infected with viruses having radioactive protein coat were not found to contain radioactivity = ½
Conclusion - DNA is the genetic material = 1 [3 Marks]
65. Following are the features of genetic codes. What does each one indicate? Stop codon; Unambiguous codon;
Degenerate codon; Universal codon.
Ans. Stop codon - does not code for any amino acid / terminates the synthesis of polypeptide chain Unambiguous codon - one
codon codes for one amino acid only
Degenerate codon - some amino acid are coded by more than one codon
Universal codon - genetic code is same for all organisms (bacteria to humans) = ½ ×4 [2 Marks]

EVOLUTION
1. Write in what context did Darwin use the terms ‘fitness’, ‘survival’ and ‘selection’ while elaborating on the
mechanism of evolution.
Ans. Fitness refers to reproductive fitness (will leave more progeny) - more survival and hence selected by nature - natural
selection = 1 × 3[3 marks]
2. Identify the following pairs as Homologous or Analogous organs:
Sweet potato and potato
Eye of octopus and eye of mammals
Thorns of Bougainvillea and tendrils of Cucurbits.
Fore limbs of Bat and Whale.
Ans. (i) & (ii) Analogous
(iii) & (iv) Homologous = ½ × 4
3. What are fossils? How are they an evidence for evolution?
(b) “Anthropogenic action can lead to evolution.” Explain with the help of an example.
Ans. (a) Fossil - remains / impression of hard parts of life-forms existed in past, found in rocks= ½ + ½
study of fossils in different sedimentary layers indicates the geological periods in which they existed, and showed that life
forms varied over time = 1 + 1
(b) Excess use of herbicides & pesticides , in crop production , has resulted in selection of resistant varieties of pests , in a
much lesser time scale // use of antibiotics or drugs , against microbes , leads to resistant organism , in lesser time scale = ½ ×
4[5 Marks]
4. Excessive and continuous use of pesticides has resulted in evolution of some new species of pests. Explain what must
have led to this. What is this type of evolution called5
Ans Excessive use of pesticides has resulted in selection of resistant varieties in a much lesser time scale, as evolution is a
stochastic process based on chance events in nature and chance mutation in organism = 1 +1
Evolution by anthropogenic action = 1
5. Taking an example of white-winged moths and dark-winged moths of England in pre and post industrialised era,
explain evolution by natural selection.
Ans. The number of light winged moths was more during the pre industrialised period in England than dark winged moth
where as it reversed in the post industrialised period = 1
In Pre industrialised period the tree trunks were covered with white coloured thick growth of lichens = 1
hence the light coloured moth were not spotted by the predator and their number increased , whereas the dark coloured moths
were captured and their numbers decreased = 1
During post industrialisation period the tree trunks became dark due to industries smoke and hence the dark coloured moths
were not captured by the predators and their number increased where as the light coloured moths were captured and their
number decreased = 1 In a mixed population those moths that are better adapted camouflaged to the changed environment
survive and increase in population size = 1 [ 5Marks]
6. What role does an individual organism play as per Darwin’s theory of natural selection?
Ans. Individual with reproductive fitness passes on the useful gene to the next generation.
7. Write the names of the following :
(a) A 15 mya primate that was ape-like
(b) A 2 mya primate that lived in East African grasslands
Ans. (a) Dryopithecus = ½
(b) Australopithecines / Australopithecus / Homo habilis = ½

HUMAN HEALTH AND DISEASES

Community Service department of your school plans a visit to a slum area near the school with an objective to educate
the slum dwellers with respect to health and hygiene.
(i) Why is there a need to organize such visits?
(ii) Write the steps you will highlight, as a member of this department, in your interaction with them to enable them to
lead a healthy life.
Ans. (i)To create awareness about disease and their effects on the body / about immunization / health and hygiene. = 1
(ii)Disposal of waste, Control of Vectors, Hygienic food and water / fresh drinking water / Balanced diet / Regular exercise /
Yoga (any four) = ½×4=2 ]
To create awareness about disease and their effects on the body / about immunization / health and hygiene.= 1
A patient showed symptoms of sustained high fever, stomach pain and constipation, but no blood clot in
stools. Name the disease and its pathogen. Write the diagnostic test for the disease. How does the disease
get transmitted?
Bacterial disease typhoid, caused by Salmonella typhi is characterised by sustained high fever (39° - 40°C), stomach pain and
constipation. Typhoid fever is diagnosed by Widal test and is transmitted through contaminated food and water.
A 17-year old boy is suffering from high fever with profuse sweating and chills. Choose the correct option from
the following diseases which explains these symptoms and rule out the rest with adequate reasons.
(a) Typhoid (b) Viral Fever (c) Malaria
(a) If the boy is suffering from Typhoid, then, the he should have sustained high fever (39° to 40°C), weakness, stomach
pain, constipation and headache. So It cannot be typhoid. 1 mark
(b) If the boy is suffering from Viral Fever he will suffer from high fever, joint pain, weakness, and headache, So It
cannot be Viral Fever. 1 mark
(c) If the boy is suffering from Malaria he should have high fever recurring with profuse sweating every three to four
days associated with chills and headache. There is a possibility that he is suffering from Malaria because high fever
associated with chills is possible with malaria. 1 mark
Your classmate complains of headache and cough. On the basis of certain symptoms, the doctor confirms that he is
suffering from Pneumonia and not common cold. List these symptoms. Mention any two precautions to be followed to
prevent the spread of this disease. 3
Doctor confirms pneumonia on the basis of the following symptoms - fever/chills/grey
- blue lips and finger nails (any two); ½+½ and not common cold as the following symptoms are not observed – Nasal
congestion/sore throat/hoarseness (any two) ½+½
Precautions –
1) Cover the nose when near the patient
2) Do not share glasses and utensils / articles used by the infected person½+½
Fill in the blanks in the different columns of the table given below to identify the no’s 1 to 6.
Name of disease Causative organism Symptoms

Pneumonia Streptococcus (1)

Typhoid (2) High fever, weakness, headache, stomach pain.

(3) Rhinoviruses Nasal Congestion, and discharge sore throat cough, headache

Ascariasis Ascaris (4)

Ringworm (5) Dry, Scaly lesions on various body parts, Intense itching, redness.

(6) Entamoeba histolytica Constipation, cramps, abdominal pain, Stools with excess mucous and blood clots.

Ans: The fill-in blanks in the different columns of the table given below to identify the no’s 1 to 6 are:
(1) Alveoli filled with fluid, reduced breathing, fever, chills, cough, and headache. (2) Salmonella typhi (3) Common Cold (4)
Internal bleeding, muscular pain, anemia, fever, and blockage of the intestinal passage. (5) Microsporum
species/Trichophyton species/Epidermophyton Species. (6) Amoebiasis/amoebic dysentery
List the symptoms of Ascariasis. How does a healthy person acquire this infection?
Ans. Internal bleeding, muscular pain, anaemia, blockage of intestinal passage. (any three) = 1½
Intake of water, vegetables / fruits / foods contaminated with eggs of the parasite. = ½
Malaria, typhoid, pneumonia and amoebiasis are some of the human infectious diseases. Which one of
these are transmitted through mechanical carriers?
Mechanical carrier is one that simply carries pathogens to a susceptible individual and is not essential to the development of
the pathogen. The pathogens are simply carried on the mouthparts, legs, body surface of the carrier from an infected to a
susceptible host. Amoebiasis and typhoid are carried through mechanical carriers like housefly.
Mention any two human diseases caused by helminths. Name their causative agents and their mode of
transmission into the human body.
Roundworms are nematodes which are responsible for helminthic diseases in humans. Two human diseases caused by
helminths are : (i) Ascariasis - It is caused by Ascaris lumbricoides and spreads through contaminated fruits, water,
vegetables, etc. (ii) Filariasis - It is caused by Wuchereria bancrofti and W. malayi. It is transmitted through the bite of
female Culex mosquito.
Name the causative organism, two symptoms and mode of transmission of ringworms.
Ringworm is a fungal disease caused by dermatophytes, which include Trichophyton, Microsporum and Epidermophyton.
Symptoms of ringworm are appearance of dry, scaly lesions on skin, nails, scalp. Ringworm infection is acquired by sharing
towels or clothes or comb with infected person.
A person is suffering from ascariasis. Mention the pathogen causing the disease and an organ of the body
affected, three symptoms and one mode of transmission of the disease.
Ascariasis is caused by a roundworm, Ascaris lumbricoides. It is an endoparasite of small intestine of
human beings. Symptoms of ascariasis are abdominal discomfort, fever, anaemia. It is transmitted through contaminated food,
water, vegetables etc.
(a) Name the causative agent of amoebiasis and mention its symptoms.
(b) Write how it spreads.
Ans. (a) Entamoeba histolytica = 1 Symptoms - Constipation / abdominal pain / cramps / stool with excess mucus and blood
clot (Any two) = ½ + ½ (b) Spreads through housefly / drinking water contaminated with faecal matter / eating food
contaminated with faecal matter (Any one) = 1
OR
Name a human disease, its causal organism, symptoms (any three) and vector, spread by intake of water and food
contaminated by human faecal- matter.
Ans. Amoebiasis (Amoebic dysentery) , Entamoeba histolytica , constipation / abdominal pain /cramps / stools with excess
mucus / blood clots (Any three symptoms), Housefly = ½ × 6 // Ascariasis, Ascaris, internal bleeding / muscular pain / fever /
anaemia / blockage of intestinal passage (Any three symptoms), Housefly = ½ × 6 // Typhoid, Salmonella typhi, high fever /
weakness / stomach pain / constipation / headache / loss of appetite (Any three symptoms), Housefly = ½ × 6 [3 Marks]
(a) Name the causative organisms for the following diseases:
(i) Elephantiasis (ii) Ringworm (iii) Amoebiasis
(b) How can public hygiene help control such diseases?
(a) (i)Wuchereria ,(ii) Microsporum / Epidermophyton/ Trichophyton (iii)Entamoeba
Proper disposal of waste/periodic cleaning/disinfection of water reservoirs, etc/standard practices of hygiene in public
catering/eliminate vectors and their breeding placec(any three) (1/2x6=3)
Name the causative organism of the disease amoebiasis. List three symptoms of the disease.
Ans. - Entamoeba histolytica = ½ Constipation, abdominal pain , cramps , stool with excess mucous / blood clots
(Any three) = ½ × 3
Name two diseases whose spread can be controlled by the eradication of Aedes mosquitoes.
Ans. Dengue , Chikunguniya // Yellow Fever / Eastern Equine Encephalitis / West Nile Fever / Zika / Zika Virus Disease
(Any two) = ½ + ½ [1 mark]
Name the form of Plasmodium that gains entry into the human body. Explain the different stages of its life –
cycle in the human body.
Ans. Sporozoites, Sporozoites reach the liver through blood, the parasite reproduces asexually in liver cells , the
parasite reproduces asexually in red blood cells , bursting the RBCs and releasing into the blood, Gametocytes
develop in RBCs = ½ × 6 = 3
(a) State what happens in the human body when malarial parasites infected RBCs burst to release the parasites in the
blood. (b) Mention the specific sites in the host body where production of sporozoites and gametocytes take place in the
life cycle of the malarial parasites.
Ans. Ans. (a) The rupture of RBCs results in releasing toxic substance haemozoin, which is responsible for chill and high
fever (3-4 days) – 1 (b) (i)intestine of mosquito – ½ (ii) RBCs of human – ½
At what stage does Plasmodium gain entry into the human body? Write the different stages of its life cycle in the
human body.
Ans. Anopheles picks up gametocytes from the person with malarial fever, gametocytes develop in the RBCs, fertilisation in
the mosquito, zygote develop in the wall of intestine, sporozoites develop and migrate to the salivary glands, to be injected
into the next victim by the mosquito ½ x6=3
Name the stage of Plasmodium that gains entry into the human when bitten by an infected female Anopheles.
Ans. Sporozoites
Differentiate between active and passive immunity.
Ans. Active immunity- When a host is exposed to antigens, which may be in terms of dead or living microbes/proteins;
antibodies are produced in the host body
Passive Immunity- When ready-made antibodies are directly given to protect the body against foreign agent /antigen/
protein1+1=2
(a) Name the types of lymphoid organs lymph nodes and thymus are. Explain the role played by them in causing
immune response.
(b) Differentiate between innate immunity and acquired immunity.
Ans. a) Thymus- Primary lymphoid organ, immature lymphocytes differentiate here, into antigen-sen- sitive lymphocytes = ½
× 3 = 1½ Lymph nodes- secondary lymphoid organ , they seem to trap the microorganisms or other antigen, which are
responsible for activation of lymphocytes present there (and cause immune response) = ½ × 3 = 1½

[3 + 2 = 5 Marks]
Mention one application for each of the following:
(a) Passive immunization (b) Antihistamine (c) Colostrum (d) Cytokinin-barrier
Ans. (a) Provide preformed antibodies / anti-toxins for quick response in case of infection by deadly microbes (tetanus) or
snake bite = ½ (b) Reduces symptoms of allergy = ½ (c) Provides passive immunity / antibodies / Ig A to new born = ½
(d) Protection of non-infected cells from further viral infection = ½
How do monocytes act as a cellular barrier in humans to provide innate immunity?
Ans. Phagocytosis of microbes / destroy microbes.
Why is the structure of an antibody molecule represented as H 2L2? Name any two types of antibodies produced in a
human body.
Ans. L2 = Two light / small polypeptide chains, H2= two heavy / longer polypeptide chains = ½ × 2 IgA / IgM / IgE / IgG =
Any two = ½ × 2 [2 marks]
How do cytokine barriers provide innate immunity in humans?
Ans. Interferon (proteins), secreted by virus infected cells (protect non - infected cells from further viral infection) =½ + ½
The figure given below represents a molecule present in the body of a mammal –
a) Name the parts labelled ‘a’ and ‘b’ in the molecule shown above.
b) Name the type of cells that produce this molecule.
a–Antigen binding site
b–Light chain ½ + ½ a mark each
b) B-lymphocytes (B-cells). 1mark
Explain the impact of removal of thymus gland on the immune system of a human body. / Thymus of a new born child
was degenerating right from birth due to a genetic disorder. Predict its two impacts on the health of the child.
The thymus provides micro-environments for the development and maturation of T-lymphocytes. The T-cells
themselves do not secrete antibodies but, they help B cells produce them. Therefore, the immunity will be reduced. ½ x 4
=2 marks
Name and explain giving reasons the type of immunity provided to the newborn by colostrum and vaccinations.
Name the type of antibody present in colostrum produced in response to allergens in human body.
Ans. (a) passive immunity, when readymade antibodies are directly given to protect the body against foreign agents = ½ + ½
Active immunity, when a host is exposed to antigens which may be forms of living or dead microbes or other proteins
antibodies are produced in the host body. = ½ + ½
(b)(i)IgA = ½ (ii)IgE = ½
Q4. How do cytokine barriers help in evading viral injections?
Ans. Virus infected cells secrete proteins called interferons, which protect non-infected cells from further infection. 1
Suggest a method to ensure an anamnestic response in humans.
Ans. Vaccination / Immunization (Active / passive) / weakened or inactive microbes or pathogens or proteins or antibodies
introduced into the host body [1 mark]
A farmer while working on his farm was bitten by a poisonous snake. The workers in the farm immediately rushed
him to the nearby health centre. The doctor right away gave him an injection to save his life. What did the doctor
inject and why? Explain.
Ans. - Antitoxin / Antivenoms / Preformed antibodies = 1 Whenever quick immune response is required we need to directly
inject preformed antibodies/ Antitoxins = ½ + ½ To neutralize snake venom quickly, passive immunity is provided = ½ + ½
Name an allergen and write the response of the human body when exposed to it.
Release of serotonin and histamine, from mast cells (½+1/2 =1)
Name and explain any four lymphoid organs present in humans.
Categorize the named lymphoid organs as primary or secondary lymphoid, giving reasons
Ans. Bone marrow - blood cells - lymphocytes are produced and mature.
Thymus- large at the time of birth but keep reducing in size with age. Lymphocytes are produced and mature.
Spleen- Acts as a filter for microorganisms in blood and reservoir for RBCs
Lymph nodes- trap micro-organisms or other antigens and activate lymphocytes and initiate immune system
(Name and explanation together = ½) (Any two) = 4×½ = 2
(b) Primary lymphoid organs - bone marrow and thymus = ½
Immature lymphocytes differentiate into antigen sensitive lymphocytes = 1
Secondary lymphoid organ - spleen and lymph nodes = ½
Provide the site for interaction of lymphocytes with antigen, which proliferate to become effector cell = ½ + ½[2 + 3 = 5
Under polio prevention programme, infants in India were given polio vaccines on a large scale at regular intervals to
eradicate polio from the country.
(a) What is a vaccine? Explain how it imparts immunity to the child against the disease.
(b) With the help of an example each, differentiate between active and passive immunity.
Ans. (a) Vaccine – It is inactivated or weakened pathogen that is inoculated into the body of the child = 1
Vaccines generate memory - B & T - cells that recognize the pathogen quickly on subsequent exposure , produce specific
antibodies against the pathogen / antigen = ½ + ½
(b) Active Immunity – Immunity that an organism develops due to direct exposure of pathogen by producing antibodies in the
body = 1 eg .vaccination / infections / hepatitis etc. = ½
Passive Immunity - readymade antibodies are directly given to protect the body from foreign pathogens = 1 eg. Colostrum /
tetanus / antitoxin for snake bite etc. = ½ [5 Marks]
(a) It is generally observed that the children who had suffered from chicken - pox in their childhood may not contract
the same disease in their adulthood. Explain giving reasons the basis of such an immunity in an individual. Name this
kind of immunity.
(b) What are interferons? Mention their role.
Ans.(a) The first infection of chicken pox produce a primary response and antibodies are generated against chicken pox virus,
subsequent encounter with the same virus elicits a highly intensified secondary response, due to the memory cells formed
during the first encounter , active immunity = ½ × 4
(b) Proteins secreted by viral infected cells, which protect non infected cells from viral infection/ when α - interferon is given
to cancer patient (it activates immune system), destroys tumour = ½ × 2
Name the condition in vertebrates where the body attacks self-cells.
Ans. Auto immune disorder / auto-immune disease.
(a) What is an “allergic reaction”?
(b) Name any two drugs used to quickly reduce the symptoms of allergy.
(c) Why do more and more children in metro cities of India suffer from allergies and asthma?
Ans a) The exaggerated response of the immune system to certain antigens present in the environment (is called allergic
reaction) =1 (b) anti-histamine / adrenalin / steroids ( Any two) = ½ + ½
(c) due to deteriorating air quality / sensitivity to the environment /allergens / lowering of immunity due to modern day life
style ( which could be due to the protected environment provided largely in life) = ½ + ½ [3 Marks]
On a visit to a Hill station, one of your friend suddenly became unwell and felt uneasy.
(a) List two symptoms you would look for to term it to be due to allergy.
(b) Explain the response of the body to an allergen.
(c) Name two drugs that can be recommended for immediate relief.
Ans. (a) sneezing, watery eyes, running nose , difficulty in breathing (any two)= ½ + ½ (b) body releases antibodies , IgE
type = ½ + ½ (c) Antihistamine , adrenalin , steroids (any two) = ½ +½ [3 Marks]
Name the type of immunity a baby is born with. How is it different from the one he gets from the mother’s milk after
birth?
Ans. Innate Immunity, Acquired Immunity that a baby acquires from his mother’s milk after birth is an example of passive
Immunity = 1 + 1
Name any two types of cells which act as 'Cellular barriers' to provide Innate Immunity in humans.
Ans. Polymorpho-nuclear Leukocytes / Neutrophils / Monocyte, Natural Killer (type of lymphocyte), macrophages
(Any two) = ½ + ½
A youth in his twenties met with an accident and succumbed to the injuries. His parents agreed to donate his organs.
List any two essential clinical steps to be undertaken before any organ transplant. Why is the transplant rejected
sometimes? What views would you share with your health club members to promote organ donation?
Ans. Blood group matching, and tissue matching should be done prior to the organ transplant , the body is able to identify the
‘non-self’ graft, triggers the cell mediated immune response , this rejects the graft . 5x ½ =2 ½
Views- Cornea can be transplanted to any one and a blind can see the world . Heart / lung/ Kidney can be transplanted and a
person is gifted with life , the mind set to volunteer to register for organ donation – (particularly eye donation ) ( any other
valid views ) (3x ½ =1 ½).
(a) What precaution(s) would you recommend to a patient requiring repeated blood transfusion?
(b) If the advise is not followed by the patient, there is an apprehension that the patient might contract a disease that
would destroy the immune system of his/her body. Explain with the help of schematic diagram only how the immune
system would get affected and destroyed.
Ans. (a) Ensuring blood (from blood banks) is safe from HIV / screening blood for HIV / AIDS / Hepatitis / ensuring use of
only disposable needles and syringes in (public and private) hospitals/clinic = 1
(b)
 Retroviruses have no DNA. However, The DNA of the infected host cell does possess viral DNA how is it possible?
Ans. Reverse transcription of viral RNA into viral DNA, then integrates/ incorporates with the host DNA = ½ + ½ [1 Mark]
(a) How does a Human Immunodeficiency Virus (HIV) replicate in a host?
(b) How does an HIV-infected patient lose immunity?
(c) List any two symptoms of this disease.
Ans. (a)

(b) Loss of T-lymphocytes = 1

(c) Fever / diarrhoea / susceptibility to other diseases, prone to microbial infection (any two) = ½ + ½ [5 Marks]
Name the cells, HIV (Human Immunodeficiency Virus) gains entry into after infecting the human body. Explain the
events that occur in these cells.
Ans. Macrophages, (Helper) T- lymphocytes, viral RNA forms DNA by reverse transcription (reverse transcriptase) , directs
the infected cells to produce viral particles / increase viral progeny = ½ × 4
Explain the process of replication of a retrovirus after it gains entry into the human body.

Ans.
Virus enters and infect the normal cell, viral RNA forms viral DNA with the enzyme reverse transcriptase, viral DNA
incorporates into host genome, new viral RNA is produced by the infected cell, new viruses are produced which infect other
cells. = 1×5 [5 marks]
How does the HIV breakdown the immune system of the AIDS patient?
Ans. Virus enters in macrophages RNA genome replicates to form viral DNA with help of reverse transcriptase, Viral DNA
gets incorporated into host cells’ DNA to produce virus particles, HIV enters into helper ‘T’ lymphocytes and produces
progeny virus, Which are released in the blood and attack other helper ‘T’ lymphocytes, This leads to progressive decrease
number of helper ’T’ lymphocytes and the persons starts suffering from infections (loss of immunity) ½x6=3
(a) Differentiate between benign and malignant tumours.
(b) Why is colostrum a boon to the newborn baby?
Ans. (a) Benign tumour- remains confined to original location/does not spread to other part of the body/ not cancerous 1
Malignant tumour-mass of proliferating (neoplastic) cells that invade and damage surrounding tissues/cancerous tumour/
tumour showing property of metastasis 1
(b) Colostrum contains antibodies/that provides resistance (immunity) to new born babies 1
Indiscriminate diagnostic practices using X-rays etc., should be avoided. Give one reason.
Ans. (Act as) Carcinogen / (harmful) mutation / chromosomal aberration / damage to DNA / normal cells converted to
neoplastic
(a) Cancer is one of the most dreaded diseases of humans. Explain ‘Contact inhibition’ and ‘Metastasis’ with
respect to the disease. (5×3 = 15)
(b) Name the group of genes which have been identified in normal cells that could lead to cancer and how they do
so ?
(c) Name any two techniques which are useful to detect cancers of internal organs.
(d) Why are cancer patients often given α-interferon as part of the treatment ?
Ans. (a) Conact with other cells inhibits their uncontrolled growth = 1
tumour cells reach distant sites, through blood. = ½ + ½
(b) Proto oncogenes = ½
when activated under certain condition could lead to oncogenic
transformation of the cells. = ½
(c) Biopsy / radiography / CT / MRI
(Any 2) = ½+½
(d) It activates immune system, destroys tumour = ½+½ [5 marks]

Indiscriminate diagnostic practices using X-rays etc., should be avoided. Give one reason.
Ans. (Act as) Carcinogen / (harmful) mutation / chromosomal aberration / damage to DNA / normal cells converted to
neoplastic
Name the drug obtained from Erythroxylum coca and write its effects on the human body.
Cocaine, interferes with transport of neuro- transmitter - dopamine/ stimulates CNS/ produces sense of euphoria/ increased
energy/ hallucinations (Any 3) (½+1½=2)
Q23. Peer pressure plays a negative role in triggering smoking habits in adolescents. As a school captain list any two
activities you would like to organize with the help of senior students of your school and any other two activities you
would like your school authorities to organize for the students to tackle this problem. Explain how these activities will
help in doing so.
Ans. Students‘ activities- Poster making , slogan writing , essay writing , processions , display of banners , highlighting its ill-
effects during assembly, power-point presentation on harmful effects of tobacco (any two= ½ + ½ )
School activities – Seminars, workshops, talks-by doctors, counsellors ,psychologists, government officials, vigilant
supervision, value education through class teachers (any two= ½ + ½)
This will help in bringing about awareness/ prevent diseases associated with smoking /provide alternatives/help the smokers in
doing away with this habit (Any other relevant point to be evaluated) (any two =1+1) [1 Mark]
A team of students are preparing to participate in the interschool sports meet. During a practice session you find some
vials with labels of certain cannabinoids.
(a) Will you report to the authorities? Why?
(b) Name a plant from which such chemicals are obtained.
(c) Write the effect of these chemicals on human body.
Ans. (a) Yes = ½ May be abused by sports person = ½ (b) Cannabis (sativa) /any other relevant plant = 1 (c) Effects
cardiovascular system of the body = 1 [1 Mark]
Do you support ‘Dope’ test being conducted on sportspersons participating in a prestigious athletic meet? Give three
reasons in support of your answer.
Ans. Yes, it helps to diagnose unnatural enhanced performance, unethical (Cheating) or any other appropriate points.
You have attended a birthday party hosted by one of your classmates. You found some guests at the party sitting in a
corner making a lot of noise and consuming ‘something’. After a while one of the boys from the group started
screaming, behaving abnormally and sweating profusely. On enquiry you found that the group members were taking
drugs.
(a) Would you inform your parents/school authorities? Yes/No. Give reasons in support of your answer.
(b) Prepare a note to be circulated amongst the schoolmates about the source and dangers of any two drugs.
(c) Write any two ways that you will suggest to your school principal so as to promote awareness amongst the youth
against the use of these drugs.
Ans. (a) Yes, so that it does not become a habit by repeated use / consumption of drugs may cause harmful effects / any other
reason = 1 (b) Drug : Cocaine - Source is plant Erythroxylum coca = ½ Danger - effects central nervous system / interferes
with transport of neurotransmitter (dopamine) = ½ Drug : Opioids / heroin / smack - source is latex of Papaver somniferum /
poppy plant = ½ Danger - slows down body function = ½ Drug: Cannabinoids source is Cannabis (sativa) = ½ Danger -
effects cardiovascular system = ½ (Any two drugs and their danger ) = 1 + 1
(c) By organising : - Poster competitions / Street play / talk by experts / interviews / any other appropriate awareness
campaign (any two) = ½ + ½
Prior to a sports event blood & urine samples of sportspersons are collected for drug tests.
(a) Why is there a need to conduct such tests?
(b) Name the drugs the authorities usually look for.
(c) Write the generic names of two plants from which these drugs are obtained.
Ans.

[1 × 3 = 3 marks]
You have a friend whose parents are too indulgent in his/her daily affairs. They think him/ her to be still young which makes
him/her sad and is upset all the time. As he/she feels that the parents should give him/her opportunity to take independent
decision on some issues.
(a) Would you support your friend and why?
(b) Write the characteristics of this age group.
(c) List two curative measures.
Ans. (a) Yes, because of peer understanding = ½ + ½ =1
(b) Curious, adventurous , look for excitement , experimentation = ½ × 4 =2
(c) Avoid undue peer pressure / education & counselling / help from parents & peers / identifying the danger signs /
professional and medical help or any other appropriate measures (any two) = ½ + ½ =1
Name and state the effect of a drug that is often medically prescribed, but its overuse leads to drug dependence and
drug abuse.
Ans. Morphine / barbiturates / amphetamines / benzodiazepines / lysergic acid diethyl amides (LSD) = 1
Affects the central nervous system / acts as a pain killer / acts as a sedative / treats depression/ treats insomnia / creates
hallucinogenic effect (Any two) = ½ + ½
Your school’s athletic team along with the athletic teams from different schools reach the venue two days before the
inter district school athletic event was to be held. A day before the competition, a team of officials from an agency
arrive and ask for blood and urine samples from all the participating athletes.
(a) Would you support or object to this sample collection? Provide explanation to your answer.
(b) Write a note that you would like to read out to your team-mates to explain the purpose of this visit of these officials.
Ans. (a) Yes I support = ½ Many times children take drugs to improve their performance in sports out of curiosity / anxiety /
intentionally = ½ + ½ + ½ To test the fact that performance of child in the sports is natural or drug induced, to be fair on
everybody’s part this test is essential = ½ + ½
(b) A team of officials from an agency have asked for blood and urine samples from all participants because these samples
when analysed will show the presence of drugs , if anybody has taken , this is as per the rule all over the world for any sports
Why is there a fear amongst the guardians that their adolescent wards may get trapped in drug/alcohol abuse?
Explain ‘addiction’ and ‘dependence’ in respect of drug/alcohol abuse in youth.
Ans. (a) Adolescents are easily affected by (vulnerable to) peer pressure /adventure /curiosity / excitement / experimentation /
media (Any two) = ½ + ½
(b) Addiction -Psychological attachment to certain effects such as Euphoria / temporary feeling of well-being =l
Dependence-Tendency of the body to show withdrawal syndrome / symptoms if regular doses of drug / alcohol is abruptly
discontinued = 1
Doctor prescribed morphine as a sedative and pain killer to your cousin who had undergone a surgery. Even after
recovery, he indiscriminately took the medicines and later craved for the same. What do you conclude about his
condition? What measures will you suggest to him to overcome this problem? Briefly explain any two.
Drug dependence - is the tendency of the body to manifest a characteristic and unpleasant withdrawal syndrome if regular
dose of drugs is abruptly discontinued /because of perceived benefits, drugs are frequently used repeatedly from which the
person may not be able to get out. 1 mark Measures:
- Education and counseling - to face problems and stresses/ to channelize the energy into healthy pursuits like reading, music,
yoga and other extracurricular activities
- Seeking help from parents - to guide the person appropriately and immediately
- Seeking professional and medical help – to help the person to get rid of the
problem completely with sufficient efforts and will power (any two) 1 mark each
When someone buys packets of cigarettes, cannot miss the statutory warning that is present on the packing which
warns against smoking and says how it is injurious to health. Yet, smoking is very prevalent in our society, both among
young and old. Advise the adolescents about the importance of avoiding smoking. (Mention any six points.) [½x6= 3]
Tobacco in cigarettes contains a large number of chemical substances including nicotine, an alkaloid.
Nicotine stimulates adrenal gland to release adrenaline and nor-adrenaline into blood circulation, both of which raise blood
pressure and increase heart rate.
Smoking is associated with increased incidence of cancers of lung, urinary bladder, throat and oral cavity.
It is responsible for bronchitis and emphysema.
It is associated with increased risk of coronary heart disease, gastric ulcer, etc.
Smoking increases carbon monoxide (CO) content in blood and reduces the concentration of haem-bound oxygen. This
causes oxygen deficiency in the body. (½ X 6 =3)

MICROBES IN HUMAN WELFARE

Why is ‘starter’ added to set the milk into curd? Explain
Acts as an innoculum; contains LAB, at suitable temperature, coagulates milk to curd. (1/2x4=2)
How are lactic acid bacteria beneficial to us other than helping in curdling the milk?
Ans. Inoculum contains lactobacilli which curdles milk into curd with lactic acid
Mention a product of human welfare obtained with the help of each one of the following microbes:
(a) LAB (b) Saccharomyces cerevisiae (c) Propionibacterium sharmanii (d) Aspergillus niger
Ans. a) Milk to curd = ½ (b) Bread / ethanol / alcoholic drinks / whiskey / brandy / beer / rum = ½ (c) Swiss cheese = ½
(d) Citric acid = ½
Give the scientific name of the source organism from which the fist antibiotic was produced.
Ans. Penicillium notatum[1 mark]
Name the first antibiotic discovered and by whom.
Ans. Penicillin, Alexander Flemming = 1 +1 [2 Marks]
Bottled fruit juices are clearer as compared to those made at home. Explain.
Ans. Enzyme Pectinase, protease are added for clearing them = 1 + 1
Identify a, b,c,d ,e and f in the table given below:

Scientific Name of Product Use in human

the organism Produced Welfare
Streptococcus Streptokinase that was later A
modified
B Cyclosporin A C
Monascus purpureus D E
Lactobacillus F Sets milk into curd

Ans. a - clot buster for removing clots from blood vessels b - Trichoderma polysporum
c - Immunosuppressive agent in organ transplant d - Statins
- Blood cholesterol lowering agent
- Lactic acid = ½ × 6
Identify a, b, c, d, e and f in the following table:
Name of Enzyme/ Bioactive Source Function
Molecule

(i) a Streptococcus B
(ii) c D Immuno-suppressive agent in organ
transplant patients

(iii) Statins E F
Ans i) a) Streptokinase b) 'Clot buster' for removing clots from the blood vessels (of patients who have undergone myocardial
infaction leading to heart attack) /clot buster enzyme
ii) c) Cyclosporin A d) Trichoderma polysporum
iii) e ) Monascus purpureus (yeast)
f) Blood cholesterol lowering agent.
(a) A patient who had an organ transplant was given cyclosporin– A. Mention the microbial source and state
the reason for administration of this bioactive molecule.
(b) Bottled fruit juices bought from the market are clearer as compared to those made at home. Give reason.
a) Source – Trichoderma polysporum Reason – Immuno suppressive agent ½ + ½
b) They are clarified by pectinases and proteases ½ + ½
Bottled fruit juices are clearer as compared to those made at home. Explain.
Ans. Enzyme Pectinase, protease are added for clearing them = 1 + 1
a) A patient who is suffering from myocardial infarction is given a clot buster as part of his treatment. Mention the clot
buster administered and its microbial source.
b) A person recuperating from illness is advised to have curd regularly. Why? 1+1
a) Streptokinase, Streptococcus
b) Curd contains Lactic Acid Bacteria, which play beneficial role in checking disease causing microbes. It is a source of
vitamin B12.
Given below is a list of six micro-organisms. State their usefulness to humans.
(a) Nucleopolyhedrovirus (b) Saccharomyces cerevisiae (c) Monascus purpureus (d) Trichoderma polysporum
(e) Penicillium notatum (f) Propionibacterium sharmanii
Ans. (a) As bio control agents / species specific / narrow spectrum insecticidal application / no negative impacts on plants /
mammals / birds / fish / non target insects / Integrated Pest Management
(b) Used in bread making / brewing industry / ethanol / CO2 production
(c) Cholesterol lowering agent / competitively inhibiting the enzyme responsible for synthesis of cholesterol
(d) Produces Cyclosporin - A / immuno suppressive agent
(e) Produces antibiotic penicillin
(f) Produces large holes in Swiss cheese / produces large amount of CO2 in Swiss cheese

Name the microbes that help production of the following products commercially:
(a) Statin (b) Citric acid (c) Penicillin (d) Butyric acid
Ans (a) Monascus purpureus (b) Aspergillus niger (c) Penicillium notatum (d) Clostridium butylicum = ½ × 4 [2Marks]
State the medicinal value and the bioactive molecule produced by Streptococcus, Monascus and Trichoderma.
Ans. Streptococcus; Streptokinase , clot buster / remove clot from the blood vessels = ½ + ½
Monascus; Statin , blood cholesterol lowering agent / it inhibits the enzymes responsible for synthesis of cholesterol = ½ + ½
Trichoderma; cyclosporin A , immunosuppressive agents used in organ transplantation = ½ + ½
Name two groups of organisms which constitute ‘flocs’ .Write their influence on level of BOD during
biological treatment of sewage.
Ans. Aerobic bacteria; fungi; they consume organic matter of effluents; use O2/ reduce BOD
a) Name the category of microbes occurring naturally in sewage and making it less polluted during the treatment.
(b) Explain the different steps involved in the secondary treatment of sewage.
Ans. (a) Aerobic microbes = ½
(b) Primary effluent passed into large aeration tank with air pumped into it allowing useful aerobic microbes to form flocs ,
these microbes consume major part of organic matter , and reduce BOD , once BOD reduced effluent is passed into settling
tank , to allow flocs to sediment and form activated sludge , some of the activated sludge is sent to aeration tank as inoculum ,
and remaining is pumped to anaerobic sludge digesters , where bio gas is produced as a result of anaerobic digestion , the
effluents from secondary treatment are released into natural water bodies. = ½ × 9 [½ + 4½ = 5 marks]
Explain the process of sewage water treatment before it can be discharge into natural water bodies. Why is this
treatment essential?
Ans. Primary treatment - physical removal of particles, filtration / sequential filtration for floating debris, sedmentation for grit
/ soil & small pebbles, settled solids form Primary sludge and Supernatant forms is effluent. = ½×4=2
Secondary treatment / Biological treatment – Effluent passed in aeration tank and agitated mechanically, air is pumped,
vigrous growth of aerobic microbes consuming organic matter, BOD reduced. = ½×4
Essential to control pollution in natural water bodies, to check water borne diseases / pathogenic organism. =½+½ [5
marks]
Explain the changes that can be observed in the characteristics of river water when sewage is discharged into it and a
few weeks after the discharge with respect to: (a) level of dissolved oxygen (b) population of fresh water organisms.
Criteria/Time of Sewage When Sewage is discharged Few weeks after discharge

Discharged

Level of dissolved oxygen Microorganisms involved in Level of dissolved oxygen

biodegradation of organic matter increases as sewage
consume a lot of oxygen decreases

,resulting in sharp decline in ½ +½

dissolved oxygen ½ +½

Population of fresh water decline in dissolved oxygen Reappearance of population

organisms fresh water organisms ½
causes mortality of fresh water
organisms ½

“Determination of Biological Oxygen Demand (BOD) can help in suggesting the quality of a water body.” Explain.
Ans. High BOD of a water body indicates more number of micro-organisms in water , resulting in bad quality of water / death
of aquatic creatures, more polluting potential 1 × 3// Lower BOD of water body indicates less number of micro-organisms in
water , good quality of water / aquatic life flourishes , less polluting potential = 1 × 3
Describe the process of waste- water treatment under the following heads:
(a) Primary treatment (b) Secondary treatment.
Ans. (a) Primary treatment
Physical removal of particles through filtration, sedimentation in stages = ½ +½
Solids settle to form primary sludge, the supernatants form the effluent = ½ +½
(b) Secondary Treatment
Effluent passed into aeration tanks = ½
Vigorous growth of useful aerobic microbes into flocs = ½
Significant reduction of BOD = ½
Effluent passed on to settling tanks where bacterial flocs settle to form activated sludge = ½
Activated sludge is passed on to anaerobic sludge digester, where bacteria and fungi are anaerobically digested = ½ + ½
= ½ × 10 [5 Marks]
How can sewage be used to generate biogas? Explain.
Ans. When BOD of sewage is reduced, effluent is passed into a settling tank for bacterial flocs to settle down (which is
Activated sludge) = ½ + ½ Activated sludge is pumped into anaerobic sludge digesters , Bacteria grow anaerobically and
digest bacteria & fungi in sludge = ½ + ½ During digestion bacteria produce a mixture of gases containing methane, hydrogen
sulphide and CO2 = ½ + ½
Draw a labeled sketch of a typical biogas plant.
Cow dung and water is mixed and this slurry is fed into the biogas plant for digestion by microbes. The person
performing the process shares that there is no need to provide any inoculum for it. Give reason. What is the role of
microbes at the source? Under which condition will they be most active and effective?
Methanogens are present in Cow dung so there is need to add innoculum.1 mark
Breakdown of cellulose1 mark
Anaerobic conditions. 1 mark
Given below is a figure of a biogas plant.

(a) Identify A and justify its floating nature.

(b) Identify the products B and C and discuss their significance. [1+2=3]
a) A is the floating cover which is placed over the slurry, which keeps on rising as the gas is produced in the tank
due to the microbial activity.
b) B is the biogas which is a mixture of gases consisting of methane, hydrogen sulphide and carbon dioxide. It can
be used as a source of energy to nearby houses as it is inflammable.
C is the spent slurry or sludge which is removed through another outlet and may be used as fertiliser. (1+2 =3)
What are Methanogens? Name the animals they are present in and the role they play there.
Ans. –Bacteria which grow anaerobically on cellulosic material = 1
– Present in cattle (rumen) = 1
Breakdown of cellulose , helps in nutrition of animal // digestion of cellulose = 1
What are Methanogens? How do they help to generate biogas?
Ans. Anaerobic, methane producing bacteria = ½ × 2, methanogens generate biogas, when act on cellulose rich biowaste
(anerobically) = 1 + 1
Explain the function of “anaerobic sludge digester” in a sewage treatment plant.
Ans. Anaerobic sludge digester has anerobic bacteria that digests the aerobic bacteria and fungi present in the sludge = 1
during the digestion these bacterias produce mixture of gases such as methane and H2S and CO2 / biogas = 1 [2 Marks]
Distinguish between the roles of flocks and anaerobic sludge digesters in sewage treatments.
Describe how do ‘flocs’ and ‘activated sludge’ help in Sewage Treatment.
Ans. Flocs - Aerobic microbes consume the major part of the organic matter in the effluent, significantly reduces BOD = 1 + 1
Activated sludge - Small part of activated sludge is used as inoculum and pumped back to aeration tank / pumped into
anaerobic sludge digesters where microbes or bacteria grow anaerobically to produce CH4 or H2S or CO2 or biogas = 1
Explain the different steps involved in the secondary treatment of sewage.
Primary effluent is passed into large aeration tanks with constant mechanical agitation and air supply. Useful aerobic
microbes grow rapidly and form flocs. 1mark
Flocs while growing consume organic matter and thus reduce the biochemical oxygen demand (BOD), the effluent is
passed into settling tank. 1 mark
The bacterial flocs settle at the bottom of the tank and it forms activated sludge, a small part this is used as an
inoculum in the aeration tank and the remaining part is passed into large tanks called anaerobic sludge digesters. 1 mark
Secondary treatment of the sewage is also called Biological treatment. Justify this statement and
explain the process.
Involves biological organism such as aerobic and anerobic microbes / bacteria and fungi to digest / consume organic waste
= 1 Primary effluent is passed into aeration tank where vigorous growth of aerobic microbes (flocs) take place, BOD reduced
(microbes consume major part of organic matter), effluent is passed to settling tank where flocs sediment to produce
activated sludge, sludge is pumped to anerobic sludge digester to digest bacteria and fungi = ½ × 4 [3 Marks]
Large quantities of sewage is generated everyday in cities and towns, which is treated in Sewage Treatment Plants
(STPs) to make it less polluted. Given below is the flow diagram of one of the stages of STP. Observe the given flow
diagram and answer the questions accordingly.

a.) Why primary effluent is passed into large aeration tanks?

b.) Write the technical term used for the sediment formed? Mention its significance.
c.) Explain the final step that results in the formation of biogas in the large tank before the treated effluent is released
into water bodies.
a) Vigorous growth of useful aerobic microbes into flocs. 1 Mark
b) Activated sludge – some of it is pumped back into the aeration tank to serve as the inoculum ½ + ½ Mark
c) During this digestion, a mixture of gases such as methane, hyrogensulphide is made and carbon dioxide. These gases form
biogas. 1 Mark

State one reason for adding blue-green algae to the agricultural soil.
Ans. To increase fertility of soil /to fix N2-/enhance N2- content
How are Baculoviruses and Bacillus thuringiensis used as bio-control agents? Why are they preferred over
readily available chemical pesticides?
Ans. Baculovirus-used as species specific/narrow spectrum//insecticidal application.
Bacillus thurengiensis-available in sachets as dried spores which are mixed with water and sprayed ( any one difference)
No negative impacts on plants, mammals/birds/fish/non target insects (1+1+½+½=3)
Name the type of association that the genus Glomus exhibits with higher plants.
Ans. Symbiosis / Mycorrhizae / Mutualism.
Explain the significant role of the genus Nucleopolyhedrovirus in an ecological sensitive area.
Ans. Species specific, narrow spectrum , insecticidal application (IPM), no negative impact on plants / mammals / birds / fish /
even non-target insects. = ½×4
Choose any three microbes, from the following which are suited for organic farming which is in great demand these
days for various reasons. Mention one application of each one chosen. Mycorrhiza; Monascus; Anabaena; Rhizobium;
Methanobacterium; Trichoderma.
Ans. Mycorrhiza: (Fungal symbiont of the association) Absorb phosphorus from soil Anabaena : Fix atmospheric nitrogen /
Adds organic matter to the soil Rhizobium : Fix atmospheric nitrogen (in leguminous plants) Methanobacterium: They digest
cellulosic material and the product / spent slurry can be used as fertilizer Trichoderma: Biocontrol agent for several plant
pathogens (Any 3 microbes = ½ × 3 = 1½) (Any 3 corresponding roles = ½ × 3 = 1½)
What are biofertilizers? Describe their role in agriculture. Why are they preferred to chemical fertilizers?
Ans. Biofertilizers – are organisms that enrich the nutrient quality of the soil = 1
Role – (i) increase nutrient quality (ii) fix atmospheric nitrogen (iii) resistant to root borne pathogens (iv) tolerance to
salinity and drought (v) overall increase in plant growth and development (any four) = ½ × 4 = 2 These are preferred to
chemical fertilizers because - They do not pollute soil / air / water = 1 - do not spoil soil texture or pH of the soil = 1[5 Marks]

Name a free-living and a symbiotic bacterium that serve as bio-fertilizer. Why are they so called?
Ans. Azospirillium / Azotobacter, Rhizobium = ½ + ½ (any other correct example) They enrich soil nutrient / nitrogen
fixation = 1
(a) How do organic farmers control pests? Give two examples.
(b) State the difference in their approach from that of conventional pest control methods.
Ans. (a) Natural predation / biological control = 1
Examples - lady bird used to kill aphids // dragon flies used to kill mosquitoes // Bacillus thuringiensis used to kill cotton
bollworm / caterpillar / butterfly caterpillar (Any two) = ½ + ½

[3 Marks]
What is the pathogenic property of baculovirus, used as a biological agents? Name the genus of these organisms.
Ans Attacks insect, and other arthropods = ½ × 2 Nucleopolyhedrovirus = 1 [2 Marks]
How does the application of the fungal genus, Glomus, to the agricultural farm increase the farm output?
Ans. Glomus forms mycorrhizal association, absorbs phosphorus, provide resistance to root borne pathogens, enhanced to
tolerate salinity / drought = ½ × 4
(a) How does Bacillus thuringiensis act as a biocontrol agent for protecting Brassica and fruit trees? Explain.
(b) List the components of biogas.
(c) What makes methanogens a suitable source for biogas production?
Ans. (a) Bacterium Bacillus thuringiensis (Bt) are available in sachets as dried spores, mixed with water and sprayed onto
vulnerable plants , these are eaten up by the insect larvae , the toxins are released in the gut and larvae gets killed = ½ × 4 = 2
(b) Methane, H2S, CO2 , H2 (any two = ½ , any three = 1)
(c) Methanogens grow anaerobically, on cellulosic material, produce large amount of methane, along with CO2 & H2 = ½ × 4
=2 [2 + 3 = 5 Marks]
Why are microbes like Spirulina being produced on a commercial scale? Mention its two advantages.
Ans. As source of food protein = 1 Reduces environmental pollution / solves problem of hunger and malnutrition / rich source
of protein / low cost production = Any two = 1
The three microbes are listed below. Name the product produced by each one of them and mention their use.
(a) Aspergillus niger (b) Trichoderma polysporum (c) Monascus purpureus.
Ans. (a) Aspergillus niger - Citric Acid, natural preservative / flavouring agent = ½ + ½ Trichoderma polysporum-Cyclosporin
A, immunosuppressive agent = ½ + ½ Monascus purpureus - Statin, blood cholesterol lowering agent = ½ + ½ [1 × 3 = 3]
Baculoviruses are good example of biocontrol agents. Justify giving three reasons.
Ans. i. Species specific / narrow spectrum insecticidal application = 1
They have no negative impact on plants / mammals / birds / fish / non target insects = 1
They are beneficial for IPM (Integrated Pest Management) / Pest Management Programme = 1 [3 marks]
Your advice is sought to improve the nitrogen content of the soil to be used for cultivation of a non-leguminous
terrestrial crop.
(a) Recommend two microbes that can enrich the soil with nitrogen.
(b) Why do leguminous crops not require such enrichment of the soil?
Ans. (a) Azospirillum / Azotobacter / Anabaena / Nostoc / Oscillatoria / Frankia (Any two correct names of microbes) = ½ + ½
(If cyanobacteria mentioned = ½, but if along with cyanobacteria Anabaena / Nostoc/ Oscillatoria mentioned then No mark on
cyanobacteria)
(b) They can fix atmospheric nitrogen, due to presence of Rhizobium / N 2 fixing bacteria in their root nodules = ½ + ½
(a) Organic farmers prefer biological control of diseases and pests to the use of chemicals for the same purpose.
Justify.
(b) Give an example of a bacterium, a fungus and an insect that are used as biocontrol agents.

(b) Bacteria – Bacillus thuringiensis = ½ Fungus – Trichoderma = ½ Insect – Ladybird / Dragonfly / Moth or any other correct
example = ½ [1½+ 1½ = 3 marks]
Microbes can be used to decrease the use of chemical fertilizers. Explain how this can be accomplished. 3
Rhizobium bacteria present in the root nodules of leguminous plants forms a symbiotic association and fixes
atmospheric nitrogen into organic forms, which is used by the plant as nutrient.
Free-living bacteria in the soil Azospirillum and Azotobacter can fix atmospheric nitrogen thus enriching the nitrogen
content of the soil.
Many members of the genus Glomus (Fungi) form mycorrhizal symbiotic associations with higher plants in these, the
fungal symbiont absorbs phosphorus from soil and passes it to the plant.
Cyanobacteria like Anabaena, Nostoc, Oscillatoria are autotrophic microbes widely distributed in aquatic and
terrestrial environments, which can fix atmospheric nitrogen, also add organic matter to the soil and increase its fertility.
(any three 1 mark each 1x3=3)
To reduce the percentage of population suffering from hunger and malnutrition, microbes are grown on a
large scale to act as food supplements. Mention any two microbes used as food supplement and suggest their
role.
Spirulina – Produces large quantities of food rich in protein, minerals, fats, carbohydrates and vitamins. Methylophilus
methylotrophus – 250 gm of this microorganism produces 25 tonnes of protein per day 1 x 2 = 2

BIOTECHNOLOGY PRINCIPLES AND PROCESSES

Write the two components of the first artificial recombinant DNA molecule constructed by Cohen and Boyer.
Ans. Restriction enzyme, Vector = ½ +½ [1 mark]
Explain with the help of a suitable example the naming of a restriction endonuclease.
Ans. EcoRI = ½ Eco stands for the genus and species of the prokaryotic cell from which the enzyme was isolated i.e
E.coli = ½ R stands for strain = ½ ‘I’ follows order in which enzyme was isolated = ½
Explain palindromic nucleotide sequence with the help of a suitable example.
Ans. Palindrome in DNA is a sequence of base pairs that reads the same on two strands when orientation of reading is the
same = 1 example: 5' –––– GAATTC –––– 3' 3' –––– CTTAAG –––– 5' =1
What is EcoRI ? How does EcoRl differ from an exonuclease?
Ans. EcoRI is restriction endonuclease enzyme. 1
Exonuclease removes nucleotides from the ends of DNA while-½ EcoRI makes cuts at specific position within the DNA ½
Name the material used as matrix in gel-electrophoresis and mention its role.
Ans. Agarose gel / seaweed; sieving effect to separate DNA fragments ½+½
Name and describe the technique that helps in separating the DNA fragments formed by the use of restriction
endonuclease.
Ans. Gel electrophoresis = ½, DNA are -vely charged, forced to move towards anode, electric field in agarose gel
matrix, separate according to their size / sieving effect, smaller fragments moves faster and further than the larger. =
½×5 [3 marks]
Name and explain the technique used for separating DNA fragments and making them available for biotechnology
experiments.
Ans. Gel electrophoresis = 1
Negatively charged DNA fragments are forced to move towards the anode under electric field on agarose gel, DNA fragments
get separated according to their size / Small fragments cover large distance & large fragments cover small distances. These
fragments are visualized after staining with ethidium bromide followed by exposure under UV rays. The separated bands of
DNA are cut out from the gel & extracted (elution) = ½ × 4 [3 Marks]
Suggest a technique to a researcher who needs to separate fragments of DNA.
Ans. (Gel) eletrophoresis
Unless the vector and source DNA are cut, fragments separated and joined, the desired recombinant vector molecule
cannot be created.
(a) How are the desirable DNA sequences cut?
(b) Explain the technique used to separate the cut fragments.
(c) How are the resultant fragments joined to the vector DNA molecule?
(b) These cut ends fragments are to be extracted from the culture medium using gel Electrophoresis ½
This has an agarose gel matrix ½
Fragments are fed in the wells ½
They are negatively charged ½
So move towards anode under an electric field through the gel ½
smaller fragments move faster ,thus separated ½
(c) Fragments are now added to the medium containing the vector DNA ½
The sticky ends facilitates the action of the enzyme ligase and joins the source DNA to the Vector ½ (10x ½ ==5)

What are ‘cloning sites’ in a cloning vector? Explain their role. Name any two such sites in pBR322.
Cloning sites are recognition sites.
Role- where restriction enzyme will recognize and cut /ligation of alien DNA takes place here any two examples-
EcoRI,BamHI. (1+1+1/2+1/2=3)
Draw a schematic diagram of the E. coli cloning vector pBR322 and mark the following in it : 3
(a) ori
(b) rop
(c) ampicillin resistance gene
(d) tetracycline resistance gene
(e) restriction site BamHI
(f) restriction site EcoRI
OR

Draw schematic diagrams of segments of a vector and a foreign DNA with the sequence of nucleotides
recognized by EcoRI. Draw the vector DNA segment and foreign DNA segments after the action of EcoRI and
label the sticky ends produced.

Vector DNA, Foreign DNA, Sticky ends, Arrow for joining, Correct sequence, Correct position for cutting ½ X 6=3
Why is it not possible for an alien DNA to become part of a chromosome anywhere along its length and replicate
normally?
Ans. Alien DNA must be linked to ori / origin of replication / site to start replication
State the functions of the following in the cloning vector pBR322:
(i) Ori, (ii) rop, and (iii) Hind III sites
Ans. i) Ori-sequence from where replication starts/ responsible for controlling the copy number of the linked DNA 1
Rop- codes for proteins involved in the replication of the plasmid 1 Hind III - Restriction site on E. coli cloning vector 1

Why is making cells competent essential for biotechnology experiments? List any two ways by which this can
be achieved.
Ans. Enable host cells/bacteria to take up DNA/ r-DNA
- Bacterial cell treated with (divalent cation) Ca ++ + heat (420C) +r-DNA on ice / /microinjection/gene gun/
vector disarmed pathogen 1+1=2
Mention the type of host cells suitable for the gene guns to introduce an alien DNA.
Ans. Plant cells
Name the host cells in which micro –injection technique is used to introduce an alien DNA.
Ans. Animal cell
Write the names of the enzymes that are used for isolation of DNA form bacterial and fungal cells
respectively for Recombinant DNA Technology.
Ans. Lysozyme for bacterial cells, chitinase for fungal cells = ½ + ½ [1 mark]
Why is Taq polymerase preferred in PCR? Mention the source of this enzyme.
Ans. Taq polymerase is used for amplification of DNA /gene, (Usually enzymes also get denatured) Taq polymerase
remains active at high temperature, Thermus aquaticus (If bacteria written give only ½)1+1+1=3
(a) List the three steps involved in Polymerase Chain reaction (PCR).
(b) Name the source organism of Taq polymerase. Explain the specific role of this enzyme in PCR.
Ans. (a) (i) Denaturation (ii) annealing (iii) Extension = ½ × 3
(b) Thermus aquaticus , it remains active during the high temperature , (induced to denature double stranded
DNA) and catalyses polymerisation of DNA = ½ × 3 [1½ + 1½ =3
marks].
Describe the different steps in one complete cycle of PCR. State the purpose of such an amplified DNA sequence.
(Same value points to be awarded in an explanation)
Purpose –used to ligate with a vector for further cloning/ detection of bacteria or virus by amplification of their
DNA/detection of HIV in AIDS patient/to detect mutation in genes in suspected cancer patients.(any two= 1+1)
Many copies of a specific gene of interest are required to study the detailed sequencing of bases in it. Name and explain
the process that can help in developing large number of copies of this gene of interest.
Ans. Polymerase Chain Reaction = 1
Denaturation / Separation of ds DNA (by high temperature) = ½
Annealing - Two sets of primers are added which anneal to 3’ end of each seperated strand as they act as initiator of
replication = ½
Extension - DNA Polymerase / Taq polymerase =½ , extends primer by adding nucleotides using DNA as templates = ½

Draw a labelled sketch of sparged-stirred-tank bioreactor. Write its application.

Ans.

Correct diagram = 1 Any two correct labellings = ½ + ½ Application = Produces larger biomass leading to higher yields of
desired protein / recombinant protein / processing large volume of culture / conversion of raw materials into specific product
biologically = 1 [3 Marks]
Suggest and describe a technique to obtain multiple copies of a gene of interest in vitro.
Ans. PCR / polymerase chain reaction = 1
Separation / denaturation of two strands of two dsDNA , using two sets of primers / small chemically synthesized
oligonucleotides complementary to regions of DNA and (thormostable) DNA polymerase / Taq polymerase, extension of the
primers, by enzyme using nucleotides replicates the DNA and if the process of replication is repeated many times multiple
copies of DNA are produced . = ½ × 4
The following diagram can be considered in lieu of the explanation:

How does a restriction endonuclease help in DNA recombinant technology?

Ans. Restriction endonuclease(EcoRI) inspects length of DNA and recognizes specific palindromic nucleotide sequence,
binds with DNA, cuts each of the two strands of double helix at specific points = 1 × 3 [3 Marks]
Why does the ‘insertional inactivation’ method to detect recombinant DNA is preferred to ‘antibiotic resistance’
procedure?
Ans. The presence of a chromogenic substrate gives blue coloured colonies , in absence of an insert / in non-transformants ,
presence of an insert (in the enzyme site) , results into (insertional inactivation of the -galactosidase) colonies which do not
produce colour = ½ × 4 Antibiotic resistance method requires duplicate plating / cumbersome procedure = 1 [3 Marks]
Draw a labelled sketch of sparged-stirred-tank bioreactor. Write its application.

Correct diagram = 1 Any two correct labellings = ½ + ½ Application = Produces larger biomass leading to higher yields of
desired protein / recombinant protein / processing large volume of culture / conversion of raw materials into specific
product biologically = 1

(a) Name the selectable markers in the cloning vector pBR322? Mention the role they play.
(b) Why is the coding sequence of an enzyme (β-galactosidase) a preferred selectable marker in comparison to the ones
named above?
Ans. (a) ampR / ampicillin resistance genes, tetR/ tetracycline resistance gene = ½ × 2 They help in identifying and eliminating
non-transformants / non recombinants and selectively permitting the growth of the transformants / recombinants = 1
(b) Simpler process / less cumbersome , in the presence of chromogenic substrate recombinants are colourless and non-
recombinants are blue in colour = ½ × 2 [3 Marks]
(a) Why must a cell be made 'competent’ in biotechnology experiments? How does calcium ion help in doing so ?
(b) State the role of ‘biolistic gun’ in biotechnology experiments.
Ans. (a) - To take up the (hydrophilic) DNA from the external medium = 1
- Divalent calcium ions increase the efficiency of DNA entering the cell through pores in the cell wall = 1
(b) To introduce alien DNA into the plant cell by bombarding them with high velocity microparticles (gold or tungsten coated
with DNA) = 1[3 Marks]
Write the function of a Bioreactor.
Ans. Bioreactors are required to produce large volumes ( 100 - 1000 litres) of recombinant proteins/ desired protein / enzymes
Mention the role of (i) selectable marker, (ii) Ori and (iii) rop in E. coli cloning vector pBR322.
Ans i) Selectable marker - helps in identifying and eliminating non-transformants and selectively permitting the growth of
the transformants = 1
(ii) Ori - helps to start replication and any piece of DNA when linked to this sequence can be made to replicate within host
cell, responsible for controlling the copy number of the linked DNA = ½ + ½
(iii) -codes for the proteins involved in the replication of the plasmid = 1 [3 Marks]
Draw a diagram of a typical agarose gel electrophoresis showing migration of undigested and digested sets of DNA
fragments. Label (a) the digested and undigested DNA fragments, (b) Anode and cathode ends of the plate. Mention
the role of electrophoresis in biotechnology.

The cutting of DNA by restriction endonuclease results in fragments of DNA. These fragments can then be separated by (Gel)
electrophoresis = 1
Explain the role(s) of the following in Biotechnology:
(a) Restriction endonuclease (b) Gel – electrophoresis (c) Selectable markers in pBR322.
Ans. (a) Cuts at specific position within the DNA / cuts DNA at specific nucleotide / cuts at palindromic nucleotide sequence
= 1 Separation of DNA fragments (under the influence of electric field ) = 1 Helps in identifying and eliminating non-
transformants from transformants / selection of transformants = 1 [1 + 1+ 1 = 3 marks]
Write the steps you would suggest to be undertaken to obtain a foreign-gene-product.
Ans. Insert a piece of alien or desired or foreign DNA into a cloning vector, transfer it into a bacterial / plant / animal cell , the
alien DNA gets multiplied, optimised condition (temperature pH, substrate, salts, vitamins, O 2 ) provided to the culture /
culture in bioreactor / in continuous culture system to induce the expression of the target product , extracting the desired
product , purifying it by using different separation techniques = ½ × 6 [3 marks]
Why do lepidopterans die when they feed on Bt cotton plant ? Explain how does it happen.
Ans. Bt cotton contains inactive toxin protein / protoxin / insecticidal protein / crystal protein, once the insect ingest it the
inactive protoxins are converted into active form due to alkaline pH in gut , which solubilise the crystals, activated toxins
binds to surface of midgut (epithelial cells) , create pores causes cell swelling ,lysis eventually leading the death of the insect
pest = ½ × 6 [3 marks]
Explain three basic steps to be followed during genetic modification of an organism.
Ans. (i) Identification of DNA with desirable genes , so that the genetically modifed organism has largely desirable genes = ½
+ ½ Introduction of the DNA with desirable genes , into the host using vector = ½ + ½ Maintenance of introduced DNA in the
host , and transfer of the DNA to its progeny through cloning = ½ + ½ [1× 3= 3 Marks]
How can a bioreactor be made to function at optimal state in order to obtain a desired foreign gene product? Explain.
Ans. By providing optimum growth conditions: Temperature, pH, substrate, salts, vitamins, oxygen [½ × 6 = 3 Marks]
How does β -galactosidase coding sequence act as a selectable marker? Explain. Why is it a preferred selectable
marker to antibiotic resistance genes?
Ans. (i) Presence of a chromogenic substrate gives blue colour, if the plasmid in the bacteria does not have an insert (non-
recombinants) = ½ + ½ With the insert do not produce any colour , recombinant colonies = ½ + ½ Selection of recombinants
due to inactivation of antibiotics, requires simultaneous plating on two plates having different antibiotics / process is more
cumbersome = ½ + ½ [1 × 3= 3 Marks]
(a) Explain the significance of ‘palindromic nucleotide sequence’ in the formation of recombinant DNA.
(b) Write the use of restriction endonuclease in the above process.
Ans (a) Palindromic nucleotide sequence is the recognition (specific) sequence present both on the vector and on a desired /
alien DNA for the action of the same(specific) restriction endonuclease to act upon = 1
(b) Same restriction endonuclease binds to both the vector and the foreign DNA , cut each of the two strands of the double
helix at specific points in their sugar phosphate backbone of recognition sequence for restriction endonucleases / palindromic
sequence of vector and foreign DNA , to cut strand a little away from the centre of the palindrome sites, creates overhanging
stretches /sticky ends = ½ × 4 // (b) If depicted diagrammatically showing the above mentioned value points it can be accepted
[3 Marks]
Describe the roles of heat, primers and the bacterium Thermus aquaticus in the process of PCR.
Ans Heat - Denaturation / separation of DNA into two strands =1
Primer- Enzyme DNA Polymerase extend the primers using the nucleotides provided in the reaction and the genomic DNA as
template =1 Thermus aquaticus - source of thermostable DNA polymerase / Taq polymerase = 1
Why do DNA fragments move towards the anode during gel electrophoresis?
Ans. DNA fragments are negatively charged
Explain three steps involved in polymerase chain reaction.
Ans. Denaturation, Two strands of DNA are separated by heating = ½ × 2
Annealing, Two sets of primers are attached / annealed to the separated DNA strands = ½ × 2
Extension, Taq polymerase catalyses the extension of primers using genomic DNA as template and nucleotides provided in
the reaction = ½ × 2 (correctly labelled diagrams with polarity of strands to be accepted in lieu of explanation)
// Diagram given in text book.
(a) How has the development of bioreactor helped in biotechnology?
(b) Name the most commonly used bioreactor and describe it’s working.
Ans. (a) Larger biomass / large volume of culture can be processed leading to higher yields of desired specific products
(protein / enzymes), under controlled condition = ½ +½
(b) Stirring type = ½ Mixing of reactor contents evenly(with agitator system or a stirrer) = ½ Facilitates oxygen availability=
½ Temperature / pH / foam control // under optimum conditions = ½ [1 + 2 = 3 marks]
Explain the roles of the following with the help of an example each in recombinant DNA technology:
(a) Restriction Enzymes (b) Plasmids

[1½ + 1½ = 3 marks]
The prophase I stage of meiosis plays a vital role in r-DNA formation. Justify with reason.
The prophase I stage of meiosis plays vital role in r-DNA formation because crossing over occurs at this stage
which helps in recombination.
a) How do DNA fragments migrate and resolve in a Gel electrophoresis?
b) How lane one is different from lane 2, 3 and 4 in the Gel electrophoresis set up?
c) How pure DNA fragments are made observable in the visible light?

a) The DNA fragments resolve according to their size through sieving effect provided by the agarose gel. Hence, the smaller
the fragment size, the farther it moves. 1 mark
b) The given agarose gel electrophoresis shows migration of undigested DNA fragments in lane 1 and digested set of DNA
fragments in lane 2 to 4. 1 mark
c) The separated DNA fragments can be visualized only after staining the DNA with a compound known as ethidium bromide
followed by exposure to UV radiation. 1 mark
Write the two components of the first artificial recombinant DNA molecule constructed by Cohen and Boyer.
The two components are –antibiotic resistant gene and plasmid vector of Salmonella typhimurium.½+ ½ =1
Given below is the diagram of agarose gel kept under UV light:
(a) Mention the positive and negative terminals.
(b) What is the charge carried by DNA molecule and how does it help in its separation?
(c) How are the separated DNA fragments finally isolated? 1+1+1
a) Positive terminal - ‘B’ Negative terminal - ‘A’ ½x2=1
b) DNA being negatively charged, moves towards the positive ½ x 2 = 1 electrode (anode)
c) By elution - separated bands of DNA are cut out from the agarose gel and extracted from the gel piece ½ x 2 = 1
(a) In pBR322, foreign DNA has to be introduced in tetRregion. From the restriction enzymes given below, which one
should be used and why: PvuI, EcoRI, BamHI
(b) Give reasons, why the other two enzymes cannot be used.
a) Bam HI should be used, as restriction site for this enzyme is present in tetR region 1 mark
b) PvuI will not be used, as restriction site for this enzyme is present in ampR region (not in tetR) 1 mark
EcoRI will not be used, as restriction site for this enzyme is not present in selectable
marker tetR 1 mark
PCR requires very high temperature conditions where most of the enzymes get denatured. How was this problem
resolved in a PCR?
The use of a thermostable DNA polymerase Thermus aquaticus which remain active during the high temperature induced
denaturation of double stranded DNA.
(a) Draw the figure of vector pBR322 and label the following:
Origin of replication
Ampicillin resistance site
Tetracycline resistance site
Bam H1 restriction site
(b) Identify the significance of Origin of replication [½x4+1= 3]
(a)

b) Origin of replication is responsible for controlling the copy number of the DNA sequence inserted. 1
Rajesh was doing gel electrophoresis to purify DNA fragments. Given below is the sketch of the observations of the
experiment performed by him.

(a) At which end he would have loaded the samples and where?
(b) Analyse the reason for different positions taken up by the DNA bands.
(c) Elaborate the step he would have followed to visualize DNA bands.
a) He would have loaded the samples near end A; in the wells.
b) The DNA fragments separate (resolve) according to their size through sieving effect provided by the agarose gel. Hence,
the smaller the fragment size, the farther it moves.
c) After staining the DNA with ethidium bromide followed by exposure to UV radiations the DNA bands appear coloured.
(1x3)
When the gene product is required in large amounts, the transformed bacteria with the plasmid inside the bacteria are
cultured on a large scale in an industrial fermenter which then synthesizes the desired protein. This product is
extracted from the fermenter for commercial use.
a.) Why is the used medium drained out from one side while fresh medium is added from the other? Explain.
b.) List any four optimum conditions for achieving the desired product in a bioreactor.
(a) To maintain the cells in their physiologically most active log/exponential phase. 1 Mark
(b) Temperature, pH, substrate, salts, vitamins, oxygen (Any 4) (½ x4 =2 Mark)

BIOTECHNOLOGY AND ITS APPLICATION

Name the host plant that Meloidogyne incognitia infects. Explain the role of Agrobacterium in the production of
ds-RNA in the host plant tobacco.Roots of tobacco plant.
Using Agrobacterium vectors, nematode specific genes were introduced into the host plant, because of introduction of
DNA both sense & antisense RNA are produced in host cell, the 2 RNAs being complimentary form a ds-RNA (that
initiated RNAi)
Explain how Eli Lilly an American company produced insulin by recombinant DNA technology.
Ans. Prepared two DNA sequences corresponding to A and B chains of human insulin , introduced them in plasmid of
E. coli to produce insulin chains , separately produced chains A and B extracted , combined by creating disulfide bonds
=½×4
Write any two ways how genetically modified plants are found to be useful.
Ans Tolerant to abiotic stresses/reduced reliance on chemical pesticide/reduced post harvest losses/increased efficiency of
mineral usage/enhanced nutritional value (Any two) (1x2=2)
What is gene therapy? Name the first clinical case where it was used.
Ans. – Collection of methods that allows correction of a gene defect that has been diagnosed in a child / embryo = 1
– Adenosine deaminase (ADA) deficiency = 1
Why does the Bt toxin not kill the bacterium that produces it but kills the insect that ingests it?
Ans. Exists as inactive protoxins = 1
Becomes active in the gut of insect due to alkaline pH = 1
14. How did the process of RNA interference help to control the nematode from infecting roots of tobacco plants?
Explain.
Ans. Using Agrobacterium vectors , nematode specific genes introduced into host plant , produced sense - antisense RNA in
host cells , ds RNA - initiated RNAi, silenced specific mRNA of nematode , parasite could not survive in transgenic host =
½×6 [3 marks]
State the role of C peptide in human insulin.
Ans. C-peptide (extra stretch of polypeptide) which makes the insulin inactive / proinsulin is inactive because it contain C-
peptide.
How have transgenic animals proved to be beneficial in:
(a) production of biological products? (b) chemical safety testing?
Ans. a) (Rosie - transgenic cow) produced human protein / alpha lactalbumin enriched milk, alpha- 1 antitrypsin used
to treat emphysema. = ½+½
b) (Toxicity Testing) - more sensitive to toxic substances, results obtained in less time. =½+½
Explain the application of biotechnology in producing Bt cotton.
Bt toxin gene has been cloned from the bacteria, and has been expressed in plants, to provide resistance to insects (without the
need for insecticide), Bt toxin gene forms protein crystals, these crystals contain a toxic insecticidal protein, Bt toxin protein
exists as inactive protoxin in the host, but once the insect ingests the inactive toxin, it is converted in active form of toxin , due
to alkaline pH of the gut which solubilises the crystals, causing death of the insect.(10 x ½ = 5)
What do you understand by (a) cry I ac gene (b) RNA interference (RNAi)?
Ans. (a) It produces inactive pro-toxin in the host cell /produces proteins to control cotton bollworm.
(b) It produces ds RNA which silences host mRNA/cellular defence mechanism/prevent infestation by nematodes 1+1
Explain the application of rDNA technology to produce insulin.

Human insulin is synthesized as a pro- hormone, the pro-hormone contains an extra C- peptide, the C- peptide is not present in
mature insulin, and is removed during maturation, Eli-Lily-an American company prepared two DNA sequences,
corresponding to A and B chains of human insulin, and introduced them in plasmids of E.coli to produce insulin chains, Chain
A and B were produced separately, extracted and combined, by creating disulphide bonds ½ x10=5
What is Biopiracy?
Ans. Illegal / non-authorized / non-compensated use of bioresources by organisations (MNC)
Recombinant DNA-technology is of great importance in the field of medicine. With the help of a flow chart, show how
this technology has been used in preparing genetically engineered human insulins.
Ans. Insulin consists of two (short) polypeptide chains (A and B), linked by disulphide bonds , two DNA sequences
corresponding to chain A and B prepared (by Eli Lily company), introduced them into plasmids of E. coli, chain A and B
produced separately , extracted and combined by creating disulphide bonds = ½ × 6

One of the major contributions of biotechnology is to develop pest-resistant varieties of cotton plants. Explain how it
has been made possible.
Ans. Introducing Bt toxin gene / cry gene from Bacillus thuringiensis , into cotton plant using r-DNA technology = ½ + ½
Cry gene produces insecticidal protein in inactive stage (protoxin) which after ingestion is converted into active form in the
gut of insect , due to alkaline pH there = ½ + ½ This toxin binds to surface of midgut epithelial cells , causes swelling and
lysis leading to death of insect = ½ + ½

Recombinant DNA-technology is of great importance in the field of medicine. With the help of a flow chart, show how
this technology has been used in preparing genetically engineered human insulins.
Ans. Insulin consists of two (short) polypeptide chains (A and B), linked by disulphide bonds , two DNA sequences
corresponding to chain A and B prepared (by Eli Lily company), introduced them into plasmids of E. coli, chain A and B
produced separately , extracted and combined by creating disulphide bonds = ½ × 6 [3 Marks]

Suggest any two possible treatments that can be given to a patient exhibiting adenosine deaminase deficiency.
Ans. (i) Enzymes replacement therapy ( in which functional ADA is injected) (ii) Bone marrow transplantation (iii) Gene
therapy / Culturing the lymphocytes followed by introduction of functional ADA cDNA into it & returning it into the patient’s
body (Any two) = ½ + ½ [1 Mark]
Describe any three potential applications of genetically modified plants.
Ans. More tolerant to abiotic stress, less dependence on chemical pesticides, reduces post harvest losses,increase efficiency of
mineral usage by plants, enhance nutritional value of food. eg. Vitamin A enriched rice (any three) = 1+1+1 [3 Marks]
How did an American company, Eli Lilly use the knowledge of r-DNA technology to produce human insulin?.
Ans. Two chains of DNA sequence corresponding to A& B chains of human insulin prepared, introduced them into plasmids
of E.coli to produce separate A & B chains, A & B chains extracted combined by creating disulphide bonds = 1 × 3 [3 Marks
What is a GMO? List any five possible advantages of a GMO to a farmer.
Ans. - Plants / bacteria / fungi / animals whose genes have been altered by manipulation = ½
- Tolerance to abiotic stresses / like cold / drought / salt / heat , reduced reliance on chemical pesticides / pest resistant crops ,
reduce post-harvest losses, increased efficiency of mineral usage by plants, enhanced nutritional value, to create tailor
made plant. (Any five) = ½ × 5
How has RNAi technique helped to prevent the infestation of roots in tobacco plants by a nematode Meloidegyne
incognitia?
Ans. Using Agrobacterium vectors, nematode specific genes introduced into host plant, produced sense- antisense RNA in
host cells,ds RNA - initiated RNAi, silenced specific mRNA of nematode, parasite could not survive in transgenic host
=½×6 [3 marks]
Suggest a molecular diagnostic procedure that detects HIV in a suspected AIDS patient.
Ans. PCR / ELISA = 1 [3 marks]
(a) What is Gene therapy?
(b) Describe the procedure of such a therapy that could be a permanent cure for a disease. Name the disease.
Ans. (a) (Collection of) methods that allows correction of gene defect that has been diagnosed in a child / embryo // Genes are
inserted into a person’s cells and tissues to treat a disease , this involves delivery of a normal gene into the individual / embryo
to take over the function of and compensate for non-functional / a defective gene = 1
(b) If the desired gene is isolated and introduced into cells at early embryonic stages it can provide a permanent cure = 1
ADA / Adenosine deaminase deficiency = 1
What are transgenic animals? Give an example.
Ans. Animals whose DNA is manipulated to possess and express an extra (foreign) gene e.g. Rosie - transgenic cow
(Any other correct example of animal)
What was the challenge for production of insulin using rDNA techniques? How did Eli Lilly produce insulin using
rDNA technology?
Ans. The challenge for production of insulin using r DNA technique was getting insulin assembled into a mature form = 1
Prepared two DNA sequence corresponding to A and B chains of human insulin, introduced them in plasmids of E.coli to
produce insulin chains, chains A and B were produced separately, extracted and combined by creating disulfide bonds to form
human insulin = ½ × 4
Name the organism from which the ‘cry’ genes are isolated. Mention with the help of suitable example why and how
bio-technologists have made use of ‘cry’ genes.
Ans Bacillus thuringiensis = 1
- Source of insecticidal (crystal) protein that control the cotton bollworms / corn borer = 1
- Specific Bt toxin genes were isolated from Bacillus thuringiensis, incorporated into several crop plants such as cotton
=½×2 [3 Marks]
GM plants are useful in many ways. How would you convince farmers to grow GM plants on their field? Explain
giving three reasons.
Ans. Make crop more tolerant to abiotic stresses / Reduce reliance on chemical pesticides / Help to reduce post harvest loses /
Increase efficiency of mineral usage / Enhance nutritional value of food (Any three) [1× 3 = 3 marks

Expand ‘ELISA’. Why is this method preferred over conventional methods of diagnosis of diseases?
Ans. Enzyme Linked Immunosorbent Assay = 1
Infection by pathogen detected by the presence of antigens (protein, glycoprotein etc.) / antibodies synthesised against the
pathogen = 1 Conventional methods cannot provide early diagnosis which is made possible by ELISA = 1
List the type of cry genes that provide resistance to corn plants and cotton plants respectively against lepidopterans.
Ans. cryIAc/ cryIIAb- cotton = ½ cryIAb -corn = ½
What are Cry genes? In which organism are they present?
Ans. The genes which code for Bt toxin / Cry proteins / toxic proteins , Bacillus thuringiensis = ½ + ½
Explain the various steps involved in the production of artificial insulin.
Ans. Two DNA sequences corresponding to A and B polypeptide chains of human insulin were prepared, these were
introduced into E.coli to produce A and B chains separately, these chains were extracted and combined by creating disulphide
bonds =1+1+1 [3 Marks]
(a) What are transgenic animals?
(b) Name the transgenic animal having the largest number amongst all the existing transgenic animals.
(c) Mention any three purposes for which these animals are produced.
Ans. (a) Animlas that have had their DNA manipulated to possess and express an extra / foreign gene = 1

[1 + ½ + 1½ = 3 marks]
Explain how Eli Lilly, an American company produced insulin by recombinant DNA technology.
Ans. Prepared two DNA sequences, corresponding to A and B chains of (human) insulin, introduced in the plasmids of E.coli,
to produce insulin chains, chains A and B were produced separately and extracted, and combined by creating disulphide bonds
=½×6 [3 marks]
Mention the chemical change that pro-insulin undergoes, to be able to act as mature insulin.
Ans. Removal of C - peptide (from pro-insulin) [1 mark]
How has the use of Agrobacterium as vectors helped in controlling Meloidegyne incognitia infestation in tobacco
plants? Explain in correct sequence.
Ans.

a) While cloning vectors, which of the two will be preferred by biotechnologists - bacteriophages or plasmids. Justify
with reason.
b) Name the first transgenic cow developed and state the improvement in the quality of the product produced by it.
a) Bacteriophages, because they have very high copy numbers of their genome within the bacterial cells whereas
some plasmids may have only one or two copies per cell and others may have 15-100 copies per cell. 1 mark
b) Rosie, it produced human protein-enriched milk (2.4 Gms per litre). 1 mark
The Indian Government refuted the attempt by a multinational company (MNC) to patent the antiseptic
property of curcumin derived from Turmeric. Analyze the unethical practice adopted by the MNC, state its
implications and suggest provisions in the Indian Law to prevent such malpractices. 3
MNC wanted to encash on our rich legacy by bio piracy. 1 mark
It leads to injustice, inadequate compensation and unauthorized exploitation of traditional knowledge of the country. 1 mark
Second amendment of the Indian Patents Bill takes into consideration issues related with patent terms, emergency
provisions, and research &development initiative. 1 mark
State a method of cellular defense which works in all eukaryotic organisms.
RNA interference
CryIAbis introduced in a plant to prevent infestation by corn borer.
(a) What is the resultant plant referred as?
(b) Summarize the action of the gene introduced
a) Bt corn ½
b) Cry I Ab/ Bt toxin gene codes for crystal protein; the Bttoxin protein exists as an inactive protein, but once an insect ingests
it, it gets converted into an active form due to the alkaline pH of the gut which solubilizes the crystal. The activated toxin
binds to the surface of mid gut and creates pores that cause swelling, lysis and eventually death of the insect. ½ x 5 = 2½
Biotechnology has helped farmers to get pest resistant cotton crops. Explain the technique adopted along with its mode
of action. (Mention six points)
The technique involves the use of a popularly known bio pesticide Bt toxin produced by bacteria Bacillus thuriengiensis.
Bt toxin protein when ingested by the insect gets converted to its active form due to alkaline pH of the gut.
The activated toxin binds to the surface of midgut epithelial cells
It creates pores in these cells that cause swelling and lysis and eventually kills the insect.
The genes (cry genes) encoding this protein are isolated from the bacterium and incorporated into crop plants like
cotton.The proteins encoded by these cry genes control the pest.
Specifically, cry I Ac and cry II Ab control cotton bollworm (Helicoverpa armigera), an insect belonging to Lepidoptera
which earlier used to destroy the whole crop. (½x 6 = 3)
Explain the events that occur in the host cell on introduction of nematode-resistant gene into the tobacco plant by
using Agrobacterium vectors. 2
RNA interference ½ Mark
• silencing of a specific mRNA due to a complementary RNA ½ Mark
• dsRNA/Introduction of DNA was such that it produced both sense/ and anti-sense RNA in the host cells/these two RNAs
formed dsRNA that initiated RNAi 1 Mark
“Specific Bt Toxin gene is incorporated into cotton plant so as to control infestation of Bollworm”. Mention the
organism from which the gene was isolated and explain its mode of action.
Specific Bt toxin genes isolated from Bacillus thuringiensis is incorporated into cotton is coded by the genes cryIAc and
cryIIAb that control the cotton bollworms (½ + ½ = 1 Mark)
• Bacillus forms protein crystals that contain a toxic insecticidal protein.
• once an insect ingest the inactive toxin, it is converted into an active form
• The toxin in the form of crystals gets solubilised due to alkaline pH in the gut
• The activated toxin binds to the surface of gut epithelial cells and perforate the walls causing the death of insect larva
(½ x2=2 Marks)
A boy has been diagnosed with ADA deficiency. Suggest any one possible treatment
Bone marrow transplant; enzyme replacement therapy/gene therapy (any two) (1/2x2=1)
Name the disease that was first to get the gene therapy treatment. Write the cause of the disease and the
effect it has on the patient.
Ans. Adenosine deaminase deficiency 1
Deletion of gene for the enzyme adenosine deaminase ½
Crucial for immune system to function ½

What is Biopiracy?/ What is biopiracy?

Ans. Use of bioresources by MNC/organizations / individuals, without proper authorization / legal per- mission / without
compensatory payment from the countries and people concerned = ½ + ½
Ans. Illegal / non-authorized / non-compensated use of bioresources by organisations (MNC) [1 Mark]
 ORGANISMS AND POPULATIONS
List any four parasitic adaptations in a parasite.
Loss of unnecessary sense organs/presence of adhesive organ/loss of digestive system/high
reproductive capacity/ presence of suckers/hooks. (any 4)

Draw and explain expanding age pyramids of human population. Why is it so called?

Expanding age pyramids of human population explains that population is growing, because pre reproductive age is more in
number. (½ x 3 labels+ ½ diagram+½ explanation+½ reason=3)
(a) Name the population growth pattern the equation {dN / dt =rN} represents. What does “r”represent in the
equation ? Write its importance in population growth. 5

(b) Explain the principle of carrying capacity by using population Verhulst-Pearl logistic growth curve.

Ans. Exponential/geometric 1
a) r = Intrinsic rate of natural increase
importance – higher the ‘r’ higher the population growth/any biotic or abiotic factor on population growth 1
b) Given habitat has enough resource to support a maximum possible number beyond which no- further growth
is possible. This is carrying capacity K asymptote 1+1
Give an example of an organism that enters 'diapause' and why.
Ans. (Many species of) Zooplankton, unfavourable condition = ½ + ½
5. Apart from being part of the food chain, predators play other important roles. Mention any two such roles
supported by examples.
Ans. - Keeps prey population under control
Biological control methods

- Maintains species diversity

- Reduces intensity of competition among prey species (Any two roles and relevant examples each)[2 marks]
15. Construct an age pyramid which reflects a stable growth status of human population.
-

16. Study the graph given below and answer the question that follow :

(i) Write the status of food and space in the curves (a) and (b).
(ii) In the absence of predators, which one of the two curves would appropriately depict the
prey population ?
(iii) Time has been shown on X-axis and there is a parallel dotted line above it. Give the
significance of this dotted line.
Ans. (i) a - unlimited food and space = ½ b - limited food and space = ½
(ii) Curve a = 1
(iii) Carrying capacity / a given habitat has enough resources to support maximum possible number - beyond which
no further growth is possible = 1 [3 marks]
Differentiate between commensalism and mutualism by taking one example each from plants only.

Ans. Commensalism - In this interaction one species is benefited and the other species is neither benefited nor harmed. = ½

(iv)e.g. an orchid growing as an epiphyte on the branch of a mango. = ½

(v) Mutualism- In this interaction both the interacting species are benefited. = ½
(vi)e.g. Lichens exhibit mutualistic relationship between a fungus that absorbs water and nutrients
from soil and photosynthesizing algae / cyanobacteria. = ½
[½ ×4 = 2 marks]
Construct an age pyramid which reflects an expanding growth status of human population.

Ans.

Describe the mutual relationship between fig tree and wasp and comment on the phenomenon that operates in their
relationship.

Ans. Wasp - helps in pollination / pollinator (specific) Oviposition / seeds and ovules used for nourishing larva. (any two) =
½+½ Co evolution exists between their close specific tight relationship. = 1

The following graph shows the species-area relationship. Answer the following question as directed.

(a) Name the naturalist who studied the kind of relationship shown in the graph. Write the observation made by him.
(b) Write the situations as discovered by the ecologists when the value of 'Z' (slope of the line) lies between:
(i) 0.1 and 0.2
(ii) 0.6 and 1.2
(c) What does 'Z' stand for?
(d) When would the slope of the line 'b' become steeper?
Ans. a) Alexander Von Humboldt. = ½
(b) Within a region species richness increases with increasing explored area but only up to a limit. = ½
i. the slopes of regression lines are similar / unaffected distribution in an area / normal range = ½
ii. the slope of regression is steeper when we analyse the species area relationship among very large areas like entire
continent = ½
(c) Z (slope of the line) regression co-efficient = ½
(d) If species richness is more / 0.62 - 1.2 = ½ [½ x 6 = 3 marks]
Name the type of interaction that exists between barnacles and whale.
Ans. Commensalism
How do mammals living in colder regions and seals living in polar regions able to reduce the loss of their body heat?
Ans. Mammals from colder climates generally have shorter ears and limbs which minimise heat loss (Allen’s rule)
In polar region seals have thick layer of fat (blubber) below their skin that acts as insulator and reduce loss of body heat 1+1
Draw labelled diagrams of stable and declining age pyramids of human population.
Ans.

Labelling- Pre-reproductive, reproductive, Post-reproductive ,correct diagram ½x4=2

What is ‘predation’? Explain with the help of suitable examples why is it required in a community with rich
biodiversity.
Ans. Transfer energy from one trophic level to the next, keeps the prey population under control, biological control, helps
maintain species diversity. 1½
Same points explained with the help of an example 1½
How are productivity, gross productivity, net primary productivity and secondary productivity interrelated?
Ans. Productivity is rate of biomass production = ½ GPP - R = NPP = 1 NPP - biomass available to consumers for secondary
productivity = ½
“Analysis of age-pyramids for human population can provide important inputs for long-term planning strategies.”
Explain.
Ans. Age pyramids show age distribution of males and females in a combined diagram = 1
The shape of the pyramid reflects the growth status of the population whether it is growing or stable or declining = 1
Pyramids also indicate the ratio of pre-reproductive, reproductive and post reproductive individuals in a population = 1//

Planning of health / education / transport / infra-structure / finance / food / employment can depend on the age-pyramid
analysis of a population / any other relevant point. (Any two with proper explanation) = 1 + 1 [5 Marks]
Many fresh water animals cannot survive in marine environment. Explain.
Ans. High salt concentration outside / hypertonic surroundings = 1
Loss of water from body / exosmosis from animal body / animal suffers osmotic problems = 1 [2 Marks]
How does a desert plant adapt to the dry, warmer environmental condition?
Ans. (i) thick cuticle on leaf surface (ii) stomata in deep pits (iii) CAM pathway (iv) leaves modified to spines (Opuntia)
(v) stem flattened and perform photosynthesis / phylloclade (Any two) 1 x 2
A liverwort plant is unable to complete its life-cycle in a dry environment. State two reasons.
Ans. (i) They need water as medium of gamete transfer for fertilisation = 1
(ii) For germination of spores = 1
How do snails, seeds, bears, zooplanktons, fungi and bacteria adapt to conditions unfavorable for their survival?
Ans. Snail-aestivation = ½ Seeds-dormancy/suspended metabolic activities = ½ Bear-Hibernation = ½ Zooplankton
diapause/suspended development = ½ Fungi-Spore/Zygospore = ½ Bacteria-Cyst/spore = ½
(a) List the different attributes that a population has and not an individual organism.
(b) What is population density? Explain any three different ways the populationdensity can be measured, with the help
of an example each.
(a) Attributes of population
Birth rate, Death Rate, sex ratio, age pyramids/age distribution (any two) = ½ × 2
(b) Population density - Number of individuals per unit area at a given time / period = 1 Biomass / % Cover, e.g Hundred
Parthenium plants and 1 huge banayan tree = ½×2 Relative Density, e.g. Number of fish caught per trap from a lake =½×2
Numbers, e.g. Human population = ½ × 2 Indirect estimation, e.g. without actually counting/seeing them e.g tiger census
based on pugmarks and fecal pellets = ½ × 2 (Any three)
Plants that inhabit a rain-forest are not found in a wetland. Explain.
Ans. Plants that inhabit a rain forest are not adapted to survive in aquatic conditions / wetlands.
Plants are conformers / stenothermal / cannot maintain constant internal environment / temperature / osmotic
concentration of the body fluids affects kinetics of enzymes through basal metabolism / activity and other physiological
functions of the organisms (Any one) = 2
Explain with the help of suitable examples the three different ways by which organisms overcome their stressful
conditions lasting for short duration.
Ans. Migration- The organisms (animals) can move away temporarily from stressful habitat to a more hospitable area and
return when stressful period is over = ½ e.g. – humans moving from Delhi to Shimla during summer / many animals or birds
undertake long distance migration to hospitable area any one e.g. = ½
Spore formation – various kind of thick walled spores are formed which germinate on availability of suitable enviornment. =
½ e.g. – bacteria / fungi / lower plants (Any one) = ½
//
Dormancy – seeds or vegetative reproductive structures help to tide over stress by reducing their metabolic activity. =½
e.g. seeds or vegetative reproductive structures of higher plants = ½
//
Hibernation – It takes place during winter = ½ e.g. bears or any other correct relevant example = ½
//
Aestivation – It takes place during summer to avoid heat and dessication (in animals) = ½ e.g. snails / fish or any other correct
relevant example = ½
Diapause:- under unfavorable conditions zooplanktons enter a stage of suspended metabolic activity = ½ e.g. zooplankton = ½
(any two after migration = 1+1 )
(a) Represent diagrammatically three kinds of age-pyramids for human populations.
(b) How does an age pyramid for human population at given point of time helps the policy- makers in planning for
future.
Ans. (a)

(b) Planning of health / education / transport / infra-structure / finance / food / employment can depend on the age-
pyramid analysis of a population / any other relevant point. (Any two explanation) = 1 + 1
Co-evolution is a spectacular example of mutualism between an animal and a plant. Describe co-evolution with the
help of an example.
Ans. Fig & wasp = 1
The female wasp uses the fruit for oviposition / egg laying , uses seeds within the fruit (developing seeds) for nourishing its
larvae , the wasp pollinates the fig inflorescence, the given fig species can be pollinated by its ‘partner’ wasp species & no
other species = ½ × 4 = 2 or any other correct example
Explain Parasitism and co-evolution with the help of one example of each.
Ans. Mode of interaction between two species in which one species (parasite) depends on the other species ( host) for food
and shelter / one organism is benefitted , the other is harmed = ½ + ½
e.g. Human liver fluke / Malarial parasite / Cuscuta = ½ Co-evolution is the relationship between two interacting organisms
where both organisms failed to survive in the absence of the other = 1 e.g. Fig and fig wasp / Ophrys and bumble bee = ½ (or
any other suitable example) [3 Marks]
(a) Name the two growth models that represent population growth and draw the respective growth curves they
represent. (b) State the basis for the difference in the shape of these curves.
(c) Which one of the curves represent the human population growth at present? Do you think such a curve is
sustainable? Give reason in support of your answer.
Ans (a) Exponential growth curve, logistics growth curve = ½ + ½
a - exponential growth curve b - logistic growth curve
(b) Exponential growth - food resources and space unlimited, Logistic growth - food resources and space limited = ½ + ½
(c) Exponential growth = 1 not sustainable, as resources are limited / carrying capacity. = ½ + ½ [5 Marks]
Explain the role played by predators in a community.
Ans. • Predators act as conduits for energy transfer across trophic levels.
They keep prey population under control.
They help in maintaining species diversity in a community by reducing intensity of competition among competing prey
species.
An efficient predator may cause extinction of prey species (Any two) = 1 + 1 [2 Marks]
Explain with the help of two examples how certain plants have evolved morphological and chemical defenses against
primary consumers such as cows and goats.
Ans - Thorns of Acacia / Cactus are morphological means of defence against cows & goats = 1
Plants produce & store chemicals that make herbivore sick when they are eaten inhibit feeding or digestion and disrupt its
reproduction or even kill it = 1. Calotropis produces highly poisonous cardiac glycosides so cows and goats can never browse
on these plants / Chemical substances like nicotine / caffeine / defences / strychnine / opium are actually defences against
grazers & browsers = 1
“Niche is a part of a habitat.” Explain with the help of an example.
Ans. A single habitat may have different kind of organisms in it but within the habitat every organism has defined range of
condition that it can tolerate, resources it utilises and plays a distinct functional role - all these together comprise its niche , for
example pond is a habitat for variety of plants and animals , but in it Gambusia fish is found in its peripheral parts which is its
niche. (Any other suitable example with explanation) = ½ × 4 [2 marks]

Are humming birds and fish regulators or conformers? Give reasons in support of your answer.
Ans. Conformers = ½ Heat loss or gain is a function of surface area = ½
Since small animals have a larger surface area (relative to their volume), they tend to lose body heat very fast when it is cold
outside , they have to expend much energy , to generate body heat through metabolism = ½ × 4 = 2 / (cannot maintain a
constant body temperature)
(a) What is an age-pyramid?
(b) Name three representative kinds of age-pyramids for human population and list the characteristics for each one of
them.
Ans. (a) If the age distribution (per cent individuals of a given age or age group) is plotted for the population the resulting
structure is called the age pyramid = 2 (b) Expanding = ½: pre reproductive population is greater than reproductive or post
reproductive population / growing with maximum no. of individuals in pre reproductive phase and least no. in post
reproductive phase = ½ Stable = ½: Pre-reproductive & reproductive population are almost similar / ideal for population /
mainains balanced continuity / no. of individuals in reproductive and pre reproductive phase is almost same and less no. of
individuals in post reproductive phase = ½ Declining = ½: Pre-reproductive population is less than reproductive population /
less no. of individuals in pre reproductive phase than reproduction phase = ½ (½ × 6)
// (b part) In lieu of the above explanation the following diagram can be considered

[2 + 3 = 5 marks]
When do you describe the relationship between two organisms as mutualistic, competitive and parasitic? Give one
example of each type.
Ans. Mutualistic - Both the interacting organisms are benefitted from each other e.g. Lichens- Algae and fungi mutually help
each other or any other appropriate example = ½ + ½
Competition - When two organisms belonging to closely related species/ unrelated groups compete for the same resources that
are limiting both are losers , e.g. superior barnacle dominates and excludes the small barnacles / in some South American
lakes visiting flamingoes and resident fishes compete for their common food (zooplankton) in the lake / any other appropriate
example = ½ + ½
Parasitic - One of the two organisms is dependent on the other( host ) for nutrition and support / the host is harmed and the
parasite is benefitted e.g. Malarial parasite and human / Cuscuta on host plant / or any other appropriate example = ½ + ½
(a) “Organisms may be conformers or regulators.” Explain this statement and give one example of each.
(b) Why are there more conformers than regulators in the animal world?
Ans (a) Conformers- organisms which cannot maintain a constant internal environment under varying external environmental
conditions // change body temperature and osmotic concentration with change in external enviornment eg. all plants / fishes /
amphibians / reptiles (Any one) = ½ + ½ Regulators - organisms which can maintain homeostasis (by physiological means or
behavioural means ) // maintain constant body temperature and osmotic concentration eg. birds /mammals
= ½ + ½ b) Thermoregulation is energetically expensive for animals = l [3 Marks]
(a) Compare, giving reasons, the J-shaped and S-shaped models of population growth of a species.
(b) Explain “fitness of a species” as mentioned by Darwin.
Ans.

(Any three) = 1 + 1+ 1 Note - Marks to be awarded only if the corresponding difference is written.
When resources are limited, Competition occurs between individuals, fittest will survive, who reproduce to leave more
progeny = ½ × 4 [5 Marks]
(a) The graph given below represents the organisms response to temperature as an environmental condition.

(i) Which one of the two lines represents conformers and why?
(ii) What does the other line in the graph represent and why?
(b) Mention the different adaptations the parasites have evolved with, to be able to successfully complete their life
cycles in their hosts.
Ans. (a) (i) A is a conformer = ½ Cannot maintain homeostasis / constancy of internal environment by physiological means /
their body temperature (osmotic conc. of body fluids ) changes with the ambient temperature = 1
(ii) Regulators = ½ Maintain homeostasis by physiological means / capable of thermoregulation / maintain a constant body
internal environment = 1
(b) Loss of unnecessary sense organs , presence of adhesive organs / suckers to cling on to the host , loss of digestive system ,
high reproductive capacity = Any two = 1 + 1 [3 + 2 = 5 marks
(a) Following are the responses of different animals to various abiotic factors. Describe each one with the help of an
example.
Regulate Conform Migrate Suspend

(b) If 8 individuals in a population of 80 butterflies die in a week, calculate the death rate of population of butterflies
during that period.
Ans. (a) Regulate - Maintain constant internal temperature / osmotic concentration /homeostasis = ½ e.g. birds / mammals = ½
Conform - Do not maintain constant internal temperature / osmotic concentration / No homeostasis = ½ e.g. any one example
of animal other than birds and mammals = ½ Migrate - Temporary movement of organisms from the stressful of habitats to
hospitable areas and return when stressful period is over = ½ e.g. birds from Siberia / or any other correct example = ½
Suspend - Reducing / minimising the metabolic activities during unfavourable conditions = ½
Polar bear / amphibian / snails / fish / any other example of animals = ½
(b)

[4 + 1 = 5 marks]
Define Diapause
OR
Define Standing Crop 1
Diapause is a stage of suspended development in zooplanktons species under unfavourable conditions.
OR
Each trophic level has a certain mass of living material at a particular time called as the standing crop. ½ + ½ mark
a) In a pond there were 200 frogs. 40 more were born in the year. Calculate the birth rate of the population.
b) Population in terms of number is not always a necessary parameter to measure population density. Justify with two
examples
a) Birth rate = No of in individuals born /Total no. of individuals = 40 /200 = 0.5 frogs per year. 1 mark
b) Number is not always a necessary parameter to measure population density. Example –
1. If there are 200 Parthenium plants but only a single huge banyan tree with a large canopy, the population density of
banyan is low relative to that of Parthenium which amounts to underestimating the enormous role of the Banyan in that
community. In such cases, the per cent cover or biomass is a more meaningful measure of the population size.
2. In a dense laboratory culture of a microbial population in a petri dish, the total number of microbes is again not an
easily adoptable measure because population is huge, counting is impossible and time-consuming. (1 +1 mark)
The alarming population growth is leading to scarcity of basic requirements.
Besides acting as ‘conduits’ for energy transfer across trophic levels, predators play other important roles. Justify.
Besides acting as ‘conduits’ of energy transfer across trophic levels, predators play other important roles like
They keep prey population under control.
Predators also help in maintaining species diversity in a community by reducing the intensity of competition among
competing prey species.
Given below is a table depicting population interactions between species A and species B.

Name the types of interactions (a) and (b) in the above table.
Justify giving three reason, how the type of interaction (b) is important in an ecological context.
(a) – Amensalism (1 Mark)
(b) – Predation (1 Mark)
Justifications-
• Nature’s way of transferring energy fixed by plants to higher trophic levels/conduits for energy transfer.
• Keep prey population under control
• Predators help in maintaining species diversity in a community, by reducing the intensity of competition among competing
prey species. (1x3 Points = 3 Marks)
Give an example of an organism that enters 'diapause' and why.
Ans. (Many species of) Zooplankton, unfavourable condition = ½ + ½
ECOSYSTEM
1. Mention any two reasons why the primary productivity varies in different types of ecosystems.
Ans. Type of plant species / environmental factors/ nutrients / photosynthetic capacity ( any 2) (½ X 2 = 1)
2. With suitable examples, explain the energy flow through different trophic levels. What does each bar in this
pyramid represent?
Write any two limitations of ecological pyramids.
Ans. In an ideal energy pyramid the primary producers convert only 1% of the energy in the sunlight available to them. The
subsequent trophic levels pass on 10% of the energy received from previous trophic level to the next trophic level.
each bar /level in the pyramid represent the amount of energy transferred to the next trophic level.
(i) did not take into account the same species belonging to 2 trophic levels. assumes simple food chain and not food web
Saprophyte are not considered (any two)
3. How are productivity, gross productivity, net primary productivity and secondary productivity interrelated?
Ans. Productivity is rate of biomass production = ½ GPP - R = NPP = 1 NPP - biomass available to consumers for secondary
productivity = ½ [½ + 1 +½ = 2 Marks]
4. “It is often said that the pyramid of energy is always upright. On the other hand the pyramid of biomass can be both
upright and inverted.” Explain with the help of examples and sketches.

5. Discuss the role of healthy ecosystem services as a pre-requisite for a wide range of economic, environmental and
aesthetic goods and services.
Ans. Purify air and water, mitigate droughts and floods , cycle nutrients , generate fertile soils , provide wild life - habitat ,
maintain biodiversity , pollinate crops , provide storage site for carbon , provide aesthetic cultural and spiritual value
recreation , climate regulation[½ × 10 = 5]
6. Describe the inter-relationship between productivity, gross primary productivity and net productivity.
Ans Productivity is the rate of biomass production per unit area over a period of time,
Gross primary productivity is the rate of production of organic matter during photosynthesis in an ecosystem,
Net productivity is the gross primary productivity minus respiration losses (R) = 1+1+1
7. “Niche is a part of a habitat.” Explain with the help of an example.
Ans. A single habitat may have different kind of organisms in it but within the habitat every organ- ism has defined range of
condition that it can tolerate, resources it utilises and plays a distinct functional role - all these together comprise its niche , for
example pond is a habitat for variety of plants and animals, but in it Gambusia fish is found in its peripheral parts which is its
niche. (Any other suitable example with explanation) = ½ × 4
8. What does an Ecological Pyramid indicate? Explain the three different types of upright Pyramids in nature with the
help of an example each.

BIODIVERSITY AND ITS CONSERVATION

1. List four causes of biodiversity loss.
Habitat loss, fragmentation, overexploitation, alien species invasion,co-extinction (any four) (1/2x4=2)
Explain the narrowly utilitarian, broadly utilitarian and ethical arguments in favor of conservation of biodiversity.
How is designation of certain areas as hotspots a step towards biodiversity conservation? Name any two hotspots in India.
(a) Narrowly utilitarian – Humans derive countless economic benefits from nature-
food, firewood, fibre, construction material, industrial products (tannins, lubricants, dyes, rennin, perfumes) , medicines
Broadly utilitarian – Role in many ecosystem services that nature provides eg – 20% O2 from Amazon forest, pollination
(any other ecosystem service) Ethical argument – what humans owe to the millions of organisms with whom we share this
planet eg. philosophically/spiritually – every species has an intrinsic value. [1/2 X 6 = 3]
(b) As these regions have very high levels of species richness & high degree of endemism, they need to be identified for
maximum protection. [1/2 X 2 = 1]
Hotspots – Western Ghats & Sri Lanka, Indo- Burma, Himalayas (Any two) [1/2 X 2 = 1]
2. Write the level of biodiversity represented by a mangrove. Give another example falling in the same level.
Ans. Ecological; Estuaries/desert/rain forest/coral reef/ wetland / alpine meadows (anyone) ½+½
3. Provide two reasons that make the count of prokaryotic species difficult.
Ans. Conventional taxonomic methods (Morphological) not suitable; difficult to culture in lab. (1x2=2)
3. Write the name of the organism that is referred to as the 'Terror of Bengal'.
Ans. Eicchornia crassipes / Water Hyacinth
4. Identify ‘a’ and ‘b’ in the figure given below representing proportionate number of major vertebrate
taxa.

Ans. (a) Mammals

(b) Amphibians = ½ + ½
5. There are many animals that have become extinct in the wild but continue to be maintained in Zoological
parks.
(i) What type of biodiversity conservation is observed in this case ?
(ii) Explain any other two ways which help in this type of conservation.
Ans. (i) Ex - situ conservation = 1
(ii) Botanical garden , Wild life safaries , Cryopreservation , In-vitro , Seed bank , Tissue culture propagation
(Any two method explained ) 1 × 2 = 2
6. (a) Why is there a need to conserve biodiversity?
(b) Name and explain any two ways that are responsible for the loss of biodiversity.
Ans. (a) 1.to continue to get the products of human consumption
2. Biodiversity plays a major role in many ecosystem services that nature provides and that is invaluable.
3. It is our moral duty to pass on biological legacy in good order to future generations. (Any two) = (1×2 = 2)
(b)1. Habitat loss and fragmentation- large habitats when broken lead to loss of habitat for animals needing large territories
(are badly affected) – population decline.
2. Overexploitation- leading to extinction of many, especially commercially important species
3. Alien species invasion - alien species when introduced may turn invasive causing decline and extinction of indigenous
species // explain with an example.
4. Coextinction- when one species become extinct, any other organism intimately associated also becomes extinct.(any two)
(1½ × 2) [2 + 3 = 5 marks]
7. Why Western Ghats in India have been declared as biological hot-spots?
Ans. Due to greater species diversity/ presence of endemic species 1
8. Many fresh water animals cannot survive in marine environment. Explain.
Ans. High salt concentration outside / hypertonic surroundings = 1
Loss of water from body / exosmosis from animal body / animal suffers osmotic problems = 1
9. Many plant and animal species are on the verge of their extinction because of loss of forest land by indiscriminate
use threatened species from getting extinct?
Ans. Ex-situ conservation = 1 Threatened animals and plants are taken out from their natural habitat and placed in special
setting where they can be protected and given special care = 1 Botanical garden / tissue culture / micro propagation / seed
bank = ½ Zoological park / wild life safari park / cryopreservation = ½
10. How are productivity, gross productivity, net primary productivity and secondary productivity interrelated?
Ans. Productivity is rate of biomass production = ½ GPP - R = NPP = 1 NPP - biomass available to consumers for secondary
productivity = ½ [½ + 1 +½ = 2 Marks]
11. What is joint forest management? How can it help in conservation of forests ?
Ans. JFM - A programme (initiated by Govt. of India in 1980) where govt. works closely with local communities for
protecting & managing forests = 1 Forests are conserved by locals in a sustainable manner as locals are also benefitted with
forest products / (fruits / gum / rubber / medicines etc) = 1
12. Compare narrowly utilitarian and broadly utilitarian approaches to conserve biodiversity, with the help of suitable
examples.
Ans. Narrowly Utilitarian - Humans derive countless direct economic benefits from nature = 1 eg. dyes / resin / food / wood
etc (or any other suitable example) = ½ Broadly utilatarian - plays major role in many ecosystem services that nature provides
= 1 eg. pollination / aesthetic pleasure / production of oxygen (or any other suitable example) = ½ [3 Marks]
13. List any four techniques where the principle of ex-situ conservation of biodiversity has been employed.
Ans. Cryopreservation, in vitro fertilisation, micro propagation / tissue culture, sperm bank/ seed bank/ gene bank = ½ ×4
14. (a) Why should we conserve biodiversity? How can we do it?
(b) Explain the importance of biodiversity hot-spots and sacred groves.
(a) (i)-Narrowly utilitarian - related examples like derive economic benefits from nature food (cereals, pulses, fruits) /
firewood / fibre / construction materials/ industrial products (tannins, lubricants, dice, resins, perfumes) / product of medicinal
importance / drugs = ½ - Broadly utilitarian - 20% of total O2 from Amazon forests / pollination / aesthetic pleasures = ½
- Ethical - millions of species (plants, animals, microbes) share this planet /we need to realise that every species has an
intrinsic value (even if it may not current or any economic value to us) / we have a moral duty to care for their wellbeing and
pass on our biological legacy to future generations = ½
(ii)- In situ conservation / biosphere reserves / national parks / sanctuaries / sacred groves = ½ //
- Ex situ conservation / zoological parks / botanical gardens / wild life safari parks / cryopreservation / seed banks /
tissue culture (eggs in vitro) = ½
(b) Hot spots - regions with high level of species richness, high degree of endemism = 1 + 1 Sacred groves - tracts of forest
containing tree / wild life were venerated, and given total protection // to protect last refuses for a large number of rare, and
threatened plants = ½ + ½ [2 + 3 = 5 marks]
15. What does nature’s carrying capacity for a species indicate?
Ans. (In nature) a given habitat has enough (limited) resources to support a maximum possible number, no further growth in
population is possible = ½ + ½
16. Suggest four advanced ex-situ methods to conserve threatened biodiversity.
Ans. Cryopreservation, in vitro fertilisation, tissue culture, seed banks = ½ × 4
17. Narrowly utilitarian arguments are put forth in support of biodiversity conservation. Explain the other two
arguments that are put forth in support of the same cause.
Ans. - Broadly utilitarian = ½ Ecosystem services - Purify air, cycling of nutrients , habitat for wildlife , pollinating crops ,
aesthetic pleasure (any two) = ½ × 2 = 1 - Ethical = ½ - Philosophical / spiritual / moral duty towards future generations = ½ ×
2 = 1 (½ + 1 + ½ + 1)
18. (a) Write the percentage of land area that was covered by forests by the end of the last century.
(b) Describe any two practices that led to deforestation.
(c) State the consequences of deforestation.
(d) Suggest a method to overcome deforestation.
Ans (a) 19.4% = ½
-Trees are axed for timber / firewood / land for industrial requirement
-Slash and burn agriculture
habitat loss and fragmentation- clearing of forest land into grass land for raising cattle (Any two) = 1+1
-Deterioration of our environment in terms of air - water and soil quality.
-causes loss of bio diversity
disturbance in hydrological cycle / biogeochemical cycle (Any two) = 1 + 1
Reforestation or any other appropriate alternative = ½
19. (a) Indiscriminate human activities such as alien species invasion, fragmentation and habitat loss have accelerated
the loss of biodiversity. Justify by taking one example for each.(b) State the importance of (i) IUCN Red data list and
(ii) Hot spots in conservation of biodiversity.
Ans. (a) Alien species invasion - When alien species are introduced unintentionally / deliberately for whatever purpose, some
of them turn invasive and cause decline / extinction of indigenous species e.g. the introduction of African catfish / Clarias
gariepinus (for aquaculture purpose) poses a threat to indigenous catfishes in our rivers. The Nile perch introduced into lake
Victoria in East Africa led to the extinction of more than 200 species of Cichlid fish in the lake. Carrot grass / Parthenium ,
Lantana , Water hyacinth / Eichhornia poses a threat to indigenous species
Fragmentation - When large habitats are broken up into small fragments due to various human activities mammals / birds
requiring large territories and certain animals with migratory habits are badly affected.
Habitat Loss - The Amazon rain forest is being cut and cleared for cultivating soyabeans / conversion to grasslands for raising
cattle.
(b) (i) Provides information of extinction of species (ii) Regions with very high levels of species richness, high degree of
endemism / species confined to that region and not found anywhere else are identified which need to be conserve all priority
basis.
20. ‘In-situ’ conservation can help endangered/threatened species. Justify the statement.
Ans. Threatened organisms are conserved in their natural habitat / eco system, and such regions are legally protected = 1+ 1
As hotspots / biosphere reserves / national parks / sancturies / sacred groves / ramsar sites (Any two names) = ½ + ½
OR
Name and describe any three causes of biodiversity losses.
Ans. Habitat loss and fragmentation =½ , Habitat loss from tropical rainforest / The Amazon rain forest is
being cut and cleared / for raising cattle / for conversion to grass lands / for cultivating soyabeans / large habitats are broken
up into small fragments due to human activities / mammals and birds requiring large territories are badly affected leading to
decline in population = ½
Over exploitation = ½ , when ‘need’ turns ‘greed’ lead to over exploitation of natural resources / steller’s sea cow / passenger
pigeon were over exploited / marine fish populations around the world are over exploited / endangering existance of
commercially important species = ½
Alien species invasions = ½ , when introduced unintentionally or deliberately for any purpose some of them turn invasive and
decline indigenous species / carrot grass / parthenium / African cat fish / Clarias gariepinus poses threat to indigenous cat
fishes of our river = ½
Co-extinctions = ½ , when a species becomes extinct the plant or animal species associated with it (an obligate way ) become
extinct / when a host species becomes extinct (its unique assemblage of) parasites meets the same fate / extinction of any
member in plant pollinator mutualism leads to extinction of other = ½ (Any three named and explained) = 1 ×3 [3 marks]
21. Discuss the role of healthy ecosystem services as a pre-requisite for a wide range of economic, environmental and
aesthetic goods and services.
Ans. Purify air and water, mitigate droughts and floods , cycle nutrients , generate fertile soils , provide wild life - habitat ,
maintain biodiversity, pollinate crops, provide storage site for carbon , provide aesthetic cultural and spiritual value recreation,
climate regulation [½ × 10 = 5]
22. Very small animals are rarely found in polar regions. Give two reasons.
Ans. Small animals have larger surface area relative to their volume// loose heat very fast, due to small size, expend much
energy to generate body heat through metabolism.
23. State how ex-situ conservation helps in protecting biodiversity.
Ans. Threatened animals and plants are taken out from their natural habitat and placed in special settings / by cryopreservation
technique / in vitro fertilization of eggs / tissue culture / seedbanks (any four) [ ½ × 4 = 2 Marks]
24.Co-extinction and introduction of alien species too are responsible for the loss of biodiversity. Explain, how.
Ans. Co-extinction- When a species becomes extinct, the plant and animal species associated with it in the obligatory way ,
also becomes extinct = ½ × 3 = 1½ Introduction of alien species - When alien species are introduced, some of them turn
invasive (because of not having their predator there), and hence cause decline / extinction of indigenous species = ½ × 3 = 1½
25. Suggest two practices giving one example of each, that help protect rare or threatened species.
Ans: (1) In situ conservation , biodiversity hotspot / biosphere reserve / national parks /sanctuaries / Ramsar sites / sacred
groves (Any one) = ½ + ½ (2) Ex situ conservation , Zoological parks / botanical garden / wild life safari parks /
cryopreservation techniques / Tissue culture / seed bank / pollen banks (Any one) = ½ + ½ [2 Marks]
26. Describe the inter-relationship between productivity, gross primary productivity and net productivity.
Ans. Productivity is the rate of biomass production per unit area over a period of time, Gross primary productivity is the rate
of production of organic matter during photosynthesis in an ecosystem, Net productivity is the gross primary productivity
minus respiration losses (R) = 1+1+1 [3 Marks]
27. Identify the areas labelled i, ii, iii and iv in the pie chart given below representing the biodiversity of plants showing
their proportionate number of species of major taxa.

Ans. i - Lichen , ii - Algae , iii - Fungi , iv - Mosses = ½ × 4

28. Explain the ‘Ex-situ conservation’ of Biodiversity. How is the in-situ conservation different from it?
Ans. Ex-situ - Threatened animals and plants are taken out from their natural habitat and placed in special settings where they
can be protected and given special care , by keeping the gametes of threatened species preserved in viable and fertile condition
for long time = ½ + ½
Zoological parks / botanical gardens / wildlife safari parks / cryopreservation / eggs can be fertilised in vitro / tissue culture
method / seed banks = Any correct example explained = 1
In-situ conservation, organisms are given protection in their natural habitat in which biodiversity is protected at all levels = 1
29.

(b) Genetic diversity - Diversity / variation within a species over its distributional range / same explained with the help of a
correct example = 1 Species diversity - Diversity / variation at a species level / same explained with the help of a correct
example = 1 [1 + 2 = 3 marks]
30. Alien species are highly invasive and are a threat to indigenous species. Substantiate this statement with any three
examples.
(i) Nile perch introduced into Lake Victoria in East Africa led to the extinction of Cichlids fish. 1 mark
(ii) Parthenium/Lantana/Eichhornia are invasive plants and pose a threat to indigenous species. 1 mark
(iii) Introduction of African catfish (Clarias gariepinus) to aquaculture is a threat to Indian catfishes. 1 mark
31. Evaluate the effect of loss of biodiversity in a region. Mention any four such effects. 2
- Decline in plant production/Decline in number of animal species
- Lowered resistance to environmental perturbations such as drought
- Increased variability in certain ecosystem processes such as plant productivity/ water use / pest & disease cycles
- Species may become endangered/increased rate of species extinction
32. The graph given below shows the distribution of biomes: 1+1+1

(a) What do the ‘X’ and ‘Y’ axis represent?

(b) Identify the ‘grassland’ and ‘coniferous forest’ biomes, from the above figure.
(c) Why is ‘F’ located at the given position in the graph?
Ans. a) ‘X’ axis - Mean annual precipitation (cm) ‘Y’ axis - Mean annual temperature (0C) ½ x 2 = 1
b) Grassland - B Coniferous forest – E ½ x 2 = 1
c) The mean annual temperature ranges from -12 to 20C (error accepted ± 2) and mean annual precipitation ranges from 10 -
125 cm, these are the optimum conditions in tundra biome ½ x 2 = 1
33. The graph below shows species –area relationship:
(A) If b denotes the relationship on log scale-

i) Describe a and b.
ii) How is slope represented? Give the normal range of slope.
iii) What kind of slope will be observed for frugivorous birds and mammals in a tropical forest?
(B) Species diversity of plants (22%) is much less than that of animals (72%). Analyze the reasons for greater
diversity of animals as compared to plants. [3+2=5]
OR

(a) Which of the above represents the increase or decrease of population?

(b) If N is the population density at time t, then what would be its density at time (t+1)? Give the formula.
34. State any two criteria for determining biodiversity hotspots. Name any two hotspots designated in India.3
Ans. criteria for determining biodiversity hot spots are: –
• high levels of species richness (1 Mark)
• High degree of endemism. (1 Mark)
hotspots In India - Western Ghats, Himalaya (Indo-Burma/Sunderland to be accepted)(Any 2) (½+½ = 1Mark)
35. Differentiate between in-situ and ex-situ approaches for conserving biodiversity. Give an example for
each.
In-situ Conservation– Threatened /endangered plants and animals are provided with urgent measures to save from
extinction within their natural habitat and they are protected and allowed to grow naturally.
Example- wildlife sanctuaries/ national parks /biosphere reserves/ sacred groves (Any one example) (½ Mark, 1
Mark for difference)
Ex-situ Conservation –Threatened animals and plants are taken out from their natural
habitat and placed in a setting where they can be protected and given care Example- in botanical gardens/
zoological gardens/ seed/pollen/gene banks (Any one example) (½ Mark, 1 Mark for difference)