Assignment 3 – Generation of Recombinant DNAs

Students must submit their completed work in two locations: Crowdmark and Turnitin. If this is not done
by the deadline, your work will be marked as late. You must submit your work typewritten in either doc
or pdf format, and submission of non-standard file formats or submissions of photos/scans will receive a
zero.

Please ensure you give yourself enough time for proper submission and ensure that your answers are
uploaded in the correct location, otherwise your work may not be graded. Answers that are ambiguous,
unclear, or do not follow instructions will be penalized or receive no credit.

Students are expected to work independently, and any work submitted must be your own. Students who
post assignment content on group chats and third-party websites will be in violation of both the Senate
Policy on Academic Honesty and/or the Canadian Copyright Act.

Preamble

m
Dr. Kovinich approaches you after you generate the primers to amplify the GmMYB103 gene (from the

er as
previous assignment, Phytozome identifier: Glyma.07G054000). Unfortunately for you, he says that this

co
amplified PCR product that codes for the TF needs to be cloned into a plasmid. He provides you the

eH w
sequence for the pGADT7-AD plasmid that you will be working with. The full plasmid map and sequence

o.
for the pGADT7-AD can be found on the course website (and recall that we used this in lecture as well).
rs e
ou urc
Dr. Kovinich says that the full-length amplified PCR product for the GmMYV29 gene should be cloned
anywhere into the MCS of the pGADT7-AD vector. He suggests that you accomplish this by the following
workflow:
o

1. Engineering a NdeI restriction enzyme recognition site immediately before the start codon and a
aC s

XmaI recognition site immediately after the stop codon for the gene, using PCR. To accomplish
vi y re

this, Dr. Kovinich says that you will need to redo the PCR described in Assignment 2 with a new
set of primers.
2. Cutting both the PCR product and vector with NdeI and XmaI, and appropriately purifying the cut
ed d

fragments that you wish to work with. You may assume that all restriction enzymes will work at
100% efficiency.
ar stu

3. Using DNA ligase to join the cut insert and vector together, reforming a circular DNA with the
PCR amplicon now incorporated into the vector within the MCS.
is

Core Questions
Th

1. (4 points) Provide the sequence of two primers that can be used to accomplish the task
described above in step one. For the sake of simplicity, each individual primer should be 25
nucleotides long. Provide these two sequences according to standard scientific conventions.
sh

5’ TGCATGCCTGCAGGTCGAGATCCG 3’

2. (6 points) A postdoctoral fellow in the lab looks over your shoulder at the cloning strategy that
Dr. Kovinich has suggested and laughs at your plight. He thinks there might be some problems

This study source was downloaded by 100000833857888 from CourseHero.com on 10-25-2021 19:41:41 GMT -05:00

https://www.coursehero.com/file/86458093/assignment-3docx/
 with the cloning approach that Dr. Kovinich has suggested. Indicate if any problems exist. If so,
explain what they are. Provide your answer in 4 sentences max.
In my opinion there is no problem in this technique. The use of restrictions enzymes is correct.
Restriction enzymes should cut DNA into fragments into the suitable sizes. And they make cuts
that create single-stranded sticky ends that formation of recombinant DNA.

3. (2 points) You get all paranoid because the postdoc brought this up, and you decide to avoid any
potential problems by just engineering BamHI recognition sites on both ends of the amplified
DNA fragment that encodes your CDS of interest to complete your cloning objective instead.
Make an appropriate pair of primers for PCR that will accomplish this. For the sake of simplicity,
the primer sequences should be 20 nucleotides each. Provide these two sequences in
accordance with standard scientific conventions.

4. (8 points) You cut both the plasmid and PCR product with BamHI and purify the fragments you

m
er as
need. You then ligate the cut plasmid with your cut PCR product and complete your cloning
experiment. You now need to verify that your new construct is correct. Identify restriction

co
eH w
enzymes that you could treat your new construct with to logically confirm that the PCR product
containing the GmMYV29 gene was inserted into the vector in the correct orientation. You have

o.
full access to gel electrophoresis equipment and the following restriction enzymes. At most, you
rs e
may only use two restriction enzymes (they are expensive). Assume all listed enzymes work at
ou urc
100% efficiency. Note that DNA fragments must be at least 100 nucleotides long and differ by at
least 100 nucleotides to clearly resolve them by gel electrophoresis.
o

• BamHI
aC s

• BsrI
vi y re

• PflFI
• AflII
• AgeI
ed d

• SacII
ar stu

Indicate the restriction enzymes that you selected and draw the banding pattern you expect on
an electrophoretic gel when you complete the verification experiment. You are conducting the
verification experiment on three different samples of recombinant plasmid, indicated below.
is

Please use the template provided and indicate exact band sizes. The plasmid and insert is
digested with BamHI enzyme. The restriction enzyme that has the digestion site in the insert
Th

GmMYV29 gene to verify whether it is inserted in correct sequence. If the gene is inserted in tp
correct sequence,the bands obtained will be different length as when the gene is inserted in the
reverse orientation.
sh

This study source was downloaded by 100000833857888 from CourseHero.com on 10-25-2021 19:41:41 GMT -05:00

https://www.coursehero.com/file/86458093/assignment-3docx/
 m
er as
5. You take your newly verified plasmid and use it in a transformation reaction to put it into

co
bacteria. You spread this transformation mixture out onto petri plates, along with a few other

eH w
parallel reactions and control plates that you made as directed by Dr. Kovinich. These plates are

o.
listed below:
rs e
Is there ampicillin on the plate? What was plated? Is there any growth?
ou urc
Plate A N Cells Transformed with Water Y
Plate B N Water Alone Y
o

Plate C Y Cells Transformed with Plasmid Y

aC s

Plate D N Cells Transformed with Plasmid Y

vi y re

Plate E Y Water Alone N

a. (1 point) Which plate should in theory, exclusively contain bacteria that are transformed with
ed d

your plasmid? Explain why in two sentences at most. The plate D contain the bacteria that
ar stu

was transformed with the given plasmid. The transformed bacteria were plated, and it
contains ampicillin. The growth on this plate is indicative of transformed bacteria
is

b. (1 point) Which plate provides the best evidence that the bacterial cells you are using in your
experiment are viable? Explain why in two sentences at most.
Th

The plate B shows that the cells used in this experiment are viable.
c. (1 point) Which plate should provide the best evidence to determine if your experiment was
contaminated by random bacteria in the lab environment? Explain why in two sentences at
sh

most. The plate c shows the best evidence that the cells were contained by other cells
present in the lab environment if contaminated by antibiotic-resistant bacteria, this plate
would have shown growth.

This study source was downloaded by 100000833857888 from CourseHero.com on 10-25-2021 19:41:41 GMT -05:00

https://www.coursehero.com/file/86458093/assignment-3docx/
 d. (1 point) Which plate provides the best evidence that you likely did not get contamination
with antibiotic-resistant bacteria from the lab environment throughout the course of your
experiment? Explain why in two sentences at most.
The plate c shows that the experiment was not contaminated by other antibiotic-resistant
cells present in the lab environment.
e. (2 points) Devise another control plate that provides evidence that untransformed cells do
not already have the capability to resist ampicillin (because they shouldn’t). Indicate
whether this plate should have ampicillin and what should be plated on it, in a similar
fashion to the table above. Explain your reasoning in three grammatically correct sentences
at most. Make a plate with ampicillin present and add cells transformed with water to it.if
we observed no growth in the plate we can say that cells without plasmid are not resistant
to the antibiotic.

f. (2 points) Given this data, do you think your experiment was contaminated? If so, was this
contaminating bacteria antibiotic-resistant? Explain your reasoning in three sentences max.

m
er as
In plate E the material is water alone but as we can see the result there is not growth in the
bacteria so we can understand that the experiment was contaminated so there was no

co
eH w
growth.
g. (2 points) Given the above, was your experiment successful (i.e. did you successfully obtain

o.
transformed bacteria)? Please explain concisely. Any errors in logical reasoning will receive
rs e
no credit. The transformation experiment has been successful means that the DNA will be
ou urc
integrated into one of the cell’s chromosome which we can see from result that the cell
chromosome with plasmid has growth.
o
aC s
vi y re

6. (8 points) Dr. Kovinich is interested in submitting a manuscript for publication using your work to
describe the construction of this plasmid. Write a short Material and Methods section suitable
for publication for your entire procedure, from initiation of the cloning project to the production
ed d

and testing of the final vector. You can see several examples of published Materials & Methods
ar stu

sections that describe this specific process for other genes using different vectors on the course
website. Although these are provided as examples, please do not copy the
words/structure/format of these or any other papers, as that is plagiarism. Please write from
is

memory, in a style suitable for formal, technical writing (read the examples to get a feel for this).
Your writing must be methodologically complete to the point where it is acceptable for
Th

submission for publication (again, read the examples to get a feel for this) and factually correct
to receive full points. No citations are necessary for this question so stop asking me.
Materials and methods for construction of a plasmid
sh

One approach to construct a plasmid without using restriction enzyme is PCR based. In this method,
DNA (gene to be used in the construction of a plasmid is cloned by using PCR with primers designed
in such a way that homologous sequences at both the ends of the PCR product containing MCS and
this DNA is then transformed in the E.coli cells where the homologous recombination system of
E.coli will help in the homologous recombination of homologous sequences at the ends. This will

This study source was downloaded by 100000833857888 from CourseHero.com on 10-25-2021 19:41:41 GMT -05:00

https://www.coursehero.com/file/86458093/assignment-3docx/
 form a closed circluar plasmid. And we have to be sure that the plasmid contains an antibiotic
resistance gene that will help in the selection of transformants from non-transformants.

From the transformant, we can isolate this plasmid.

Steps are as follows:

1. first we have to prepare the reaction with the PCR depends on the volume, and it also requires
forward and reverse primers, buffer, dNTPs, PCR DNA polymerase enzyme, and DNA template.

2. The amount of template DNA depending on the source of DNA, whether it is plasmid DNA or
genomic DNA.

3. Mix all the contents of the reaction mix well and divide its equal volumes in PCR tubes.

4. Put the reaction mixture on the thermocycler. Set the reaction conditions as Initial denaturation at
98C for 1 min, denaturation at 98 degree C for 30 seconds, annealing (55 - 60C) for 30 seconds,
elongation at 72C for 30 seconds and final extension at 72C for 1 min, 25-30 cycles

m
er as
5. Analyse 2-5 microlitre of the PCR product on the gel electrophoresis in TAE buffer containing

co
Ethidium bromide dye to visualise the DNA having concentration of 1microgram/microlitre.

eH w
6. Select the PCR mixture which is appropriate showing single discrete band for further process.

o.
rs e
7. Add a suitable restriction enzyme to remove the intact residual template DNA.
ou urc
8. Transform the host cell DNA with the PCR amplified DNA and plate the transformed cells on
antibiotic containing LB media for their selection and allow them to grow on 18C overnight.
o

9. Pick the colony from the LB plate and isolate the plasmid DNA from the cells.
aC s
vi y re

10. Analyse your results by gel electrophoresis in the TAE buffer containing Ethidium bromide.
ed d

Optional Extension Question

ar stu

7. (1 bonus point) Note that the CDS for GAL4-AD protein comes before the MCS in the pGADT7AD
vector. Given the location of the start codon and what we had discussed in lecture, what effect
will it have on the protein produced by the vector that you have constructed above?
is
Th
sh

This study source was downloaded by 100000833857888 from CourseHero.com on 10-25-2021 19:41:41 GMT -05:00

https://www.coursehero.com/file/86458093/assignment-3docx/
Powered by TCPDF (www.tcpdf.org)