Bio - Difficult PYQs from Contact Number: 9667591930 /

2012 to 2023 8527521718

1 The common characteristics between tomato and 7 Read the following statements and identify the
potato will be maximum at the level of their: characters related to the alga shown in the diagram:
1. Family
2. Order
3. Division
4. Genus
a. It is a member of Chlorophyceae.
Food is stored in the form of
2 In the five-kingdom classification, Chlamydomonas b.
starch.
and Chlorella have been included in:
It is a monoecious plant showing
1. Algae 2. Plantae c.
oogonium and antheridium.
3. Monera 4. Protista
Food is stored in the form of
d.
laminarin or mannitol.
3 Ciliates differ from all other protozoans in? It shows dominance of pigments
1. using flagella for locomotion e.
chlorophyll a, c and Fucoxanthin.
having a contractile vacuole for removing excess
2.
water
3. using pseudopodia for capturing prey
4. having two types of nuclei
Choose the correct answer from the options given below
4 Which one is the wrong statement? :
Archegonia are found in Bryophyta, Pteridophyta and 1. (a) and (b) only
1. 2. (a), (b) and (c) only
Gymnosperms.
3. (a), (c) and (d) only
2. Mucor has biflagellate Zoospores
4. (c), (d) and (e) only
Haploid endosperm is a typical feature of
3.
gymnosperms. What is common in all the three, Funaria,
8
4. Brown algae have chlorophyll a and c fucoxanthin. Dryopteris and Ginkgo?
1. Presence of archegonia
5 Which statement is wrong for viruses? 2. Well-developed vascular tissues
1. All are parasites 3. Independent gametophyte
2. All of them have helical symmetry 4. Independent sporophyte
They have the ability to synthesize nucleic acids and
3.
proteins 9 Read the following five statements (I to V) and
4. Antibiotics have no effect on them select the option with all correct statements.
Mosses and lichens are the first organisms to
I:
6 Read the following statements (A-E) and answer the colonise bare rock.
question which follows them. II: Selaginella is a homosporous pteridophyte.
In liverworts, mosses, and ferns gametophytes are III: Coralloid roots in Cycas have VAM.
A: Main plant body in bryophytes is gametophytic,
free-living
B: Gymnosperms and some ferns are hetero-sperms IV: whereas in
pteridophytes it is sporophytic.
Sexual reproduction in Fucus, Volvox and Albugo is
C: In gymnosperms, male and female gametophytes
oogamous
V: are present
The sporophyte in liverworts is more elaborate than
D: within sporangia located on sporophytes.
that in mosses
E: Both, Pinus and Marchantia are dioecious
1. I, III and IV 2. II, III and IV
How many of the above statements are correct?
1. Two 3. I, IV and V 4. II, III and V
2. Three
3. Four
4. One

Page: 1
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

10 Which one of the following pairs is wrongly 15 Which of the following represents order of Horse’?
matched? 1. Perissodactyla
1. Salvinia - Prothallus 2. Caballus
2. Viroids – RNA 3. Ferus
3. Mustard-Synergids 4. Equidae
4. Ginkgo-Archegonia
16
11 Cycas and Adiantum resemble each other in having: Which of the following animals does not undergo
1. Seeds metamorphosis?
2. Motile sperms 1. Earthworm
3. Cambium 2. Tunicate
4. Vessels 3. Moth
4. Starfish
12 Sharks and dogfishes differ from skates and rays by:
17 Given below are two statements:
1. Gill slits are ventrally placed Amphibians and reptiles have a 3-chambered heart
2. Head and trunk are widened considerably I with two atria and a single ventricle, and are
3. Distinct demarcation between body and tail oviparous in nature
Their pectorals fins are distinctly marked off from Crocodiles possess a 4 chambered heart with two
4. II
cylindrical bodies ventricles and two atria and are viviparous in nature

Select the most appropriate option:

1. I is correct but II is incorrect.
13 Which of the following are correctly matched with 2. I is incorrect but II is correct.
3. Both I and II are correct.
respect to their taxonomic classification? 4. Both I and II are incorrect.
1. Centipede, millipede, spider, scorpion-Insecta
2. House fly, butterfly, tsetse fly, silverfish-Insecta 18 Select the incorrect statements with respect to
Spiny anteater, sea urchin, sea cucumber- Cyclostomes :
3.
Echinodermata a. They lack scales and paired fins.
4. Flying fish, cuttlefish, silverfish- Pisces b. They have circular mouth with Jaws.
c. They bear 6-15 pairs of gills.
14 Which of the following represents the correct d. They migrate to deep sea for spawning.
combination without any exception? Choose the most appropriate answer from the options
given below :
Characteristic Class
1. (a) and (b) only
(a) Mammary gland; hair on body; 2. (b) and (c) only
Mammalia
pinnae; two pairs of limbs 3. (b) and (d) only
(b) Mouth ventral; gills without 4. (a) and (d) only
operculum; skin with placoid scales; Chondrichthyes
persistent notochord 19 Which of the following statement is not correct?
(c) Sucking and circular mouth; jaws
absent; integument without scales; Cyclostomata 1. Rhizome is a condensed form of stem.
paired appendages
The apical bud in rhizome always remains above the
(d) Body covered with feathers; skin 2.
ground.
moist and glandular; lungs with air Aves
The rhizome is aerial with no distinct nodes and
sacs; forelimbs from wings 3.
internodes.
1. a 2. b
4. The rhizome is thick, prostrate and branched.
3. c 4. d

Page: 2
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

20 Inflorescence is racemose in: 27 Which of the following statement is not true for
1. Brinjal stomatal apparatus?
2. Tulip
3. Aloe Guard cells invariably possess chloroplasts and
4. Soybean 1.
mitochondria
2. Guard cells are always surrounded by subsidiary cells
21 How many plants in the list given below have 3. Stomata are involved in gaseous exchange
marginal placentation? 4. Inner walls of guard cells are thick
Mustard, Gram, Tulip, Asparagus, Arhar, Sun hemp,
Chilli, Colchicine, Onion, Moong, Pea, Tobacco, Lupin
1. Five
2. Six
3. Three 28 Read the following statements about the vascular
4. Four bundles:

22 Among flowers of Calotropis, tulip, Sesbania, In roots, xylem and phloem in a vascular bundle are
Asparagus, Colchicine, Sweet pea, Petunia, Indigofera, a. arranged in an alternate manner along the different
Mustard, Soybean, Tobacco and groundnut how many radii.
plants have corolla with valvate aestivation? Conjoint closed vascular bundles do not possess
b.
1. Six 2. Seven cambium.
3. Eight 4. Five In open vascular bundles, cambium is present in
c.
between xylem and phloem.
23 Among China rose, mustard, brinjal, potato, guava, The vascular bundles of dicotyledonous stem possess
d.
endarch protoxylem.
cucumber, onion and tulip, how many plants have
superior ovary? In monocotyledonous root, usually there are more
e.
1. Five than six xylem bundles present.
2. Six
3. Three Choose the correct answer from the options given
4. Four below:
1. (a), (c), (d) and (e) only
24 How many plants in the list given below have 2. (a), (b) and (d) only
composite fruits that develop from an inflorescence? 3. (b), (c), (d) and (e) only
Walnut, poppy, radish, fig, pineapple, apple, tomato, 4. all statements are correct
mulberry
1. Four 29 In old trees the greater part of secondary xylem
2. Five is dark brown and resistant to insect attack due to :
3. Two secretion of secondary metabolites and
a.
4. Three their deposition in the lumen of vessels.
deposition of organic compounds like tannins and
b.
25 An aggregate fruit is one which develops from: resins in the central layers of stem.
1. Multicarpellary syncarpous gynoecium deposition of suberin and aromatic substances in the
c.
2. Multicarpellary apocarpous gynoecium outer layer of stem.
3. Complete inflorescence deposition of tannins, gum, resin and aromatic
4. Multicarpellary superior ovary d.
substances in the peripheral layers of stem.
presence of parenchyma cells, functionally active
26 The viability of seeds is tested by: e.
xylem elements and essential oils.
1. 2, 6 dichlorophenol indophenols
2. 2, 3, 5 triphenyl tetrazolium chloride Choose the correct answer from the options given below
3. DMSO 1. (b) and (d) Only
4. Safranine 2. (a) and (b) Only
3. (c) and (d) Only
4. (d) and (e) Only

Page: 3
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

30 A major characteristic of the monocot root is the 34 Consider the following tissues in the stellar region
presence of: of a stem showing secondary growth.
1. Scattered vascular bundles (A) Primary xylem
2. Vasculature without cambium (B) Secondary xylem
(C) Primary phloem
Cambium sandwiched between
3. (D) Secondary phloem
phloem and xylem along the radius
Arrange these in the correct sequence of their position
4. Open vascular bundles from pith towards cortex.
1. (A), (B), (D), (C) 2. (B), (A), (C), (D)
31 Read the different components from I to IV in the 3. (A), (B), (C), (D) 4. (B), (A), (D), (C)
list given below and tell the correct order of the
components with reference to their arrangement from the
outer side to the inner side in a woody dicot stem.
35 Gymnosperms are also called softwood
I. Secondary Cortex spermatophytes because they lack:
II. Wood 1. Cambium
III. Secondary phloem 2. Phloem fibres
IV. Phellem 3. Thick-walled tracheids
The correct order is: 4. Xylem fibres
1. III,IV,II,I
2. I,II,IV,III 36 Tracheids differ from the tracheary elements in:
3. IV,I,III,II 1. Having casparian strips
4. IV,III,I,II 2. Being imperforate
3. Lacking nucleus
32 Interfascicular cambium is present between: 4. Being lignified
1. Primary xylem and primary phloem
2. Pericycle and endodermis 37 The type of tissue commonly found in the fruit wall
3. Two vascular bundles of nuts is :
4. Secondary xylem and secondary phloem 1. Parenchyma 2. Collenchyma
3. Sclerenchyma 4. Sclereid
33 Give below are two statements :
38 Which of the following statements about cork
Endarch and exarch are the terms often used cambium is incorrect?
Statement
for describing the position of secondary 1. It forms a secondary cortex on its outside
I:
xylem in the plant body.
2. It forms a part of periderm
Statement Exarch condition is the most common
3. It is responsible for the formation of lenticels
II: feature of the root system.
4. It is a couple of layers thick
In the light of the above statements, choose the correct
answer from the options given below: 39 Select the correct route for the passage of sperms in
1. Statement I is incorrect but Statement II is true. male frogs:
2. Both Statement I and Statement II are true. Testes → Vasa efferentia → Kidney → Seminal
1.
3. Both Statement I and Statement II are false. Vesicle→ Urinogenital duct → Cloaca
4. Statement I is correct but Statement II is false. Testes → Vasa efferentia → Bidder's canal →
2.
Uretar→ Cloaca
Testes → Vasa efferentia → Kidney → Bidder's
3.
canal → Urinogenital duct → Cloaca
Testes → Bidder's canal→ Kidney→ Vasa
4.
efferentia→ Urinogenital duct→ Cloaca

Page: 4
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

40 The four sketches (A, B, C, and D) given below, 45 A protoplast is a cell:

represent four different types of animal tissues. Which 1. Without plasma membrane
one of these is correctly identified in the options given, 2. Without nucleus
along with its correct location and function? 3. Undergoing division
4. Without cell wall

46
Select the incorrect match:

Column I Column II
1. Lampbrush Diplotene bivalents chromosomes
2. Allosomes Sex chromosomes
Tissue Location Function 3. Submetacentric L-shaped chromosomes
Attach skeletal 4. Polytene Oocytes of amphibians chromosomes
1. (C) Collagen fibres Cartilage
muscles to bones
Smooth muscle
2. (D) Heart Heart contraction
tissue
3. (A)
Columnar
Nephron
Secretion and 47 Which of the following cell organelles is present in
epithelium absorption the highest number in secretory cells?
Glandular 1. Mitochondria 2. Golgi complex
4. (B) Intestine Secretion
epithelium
3. Endoplasmic reticulum 4. Lysosomes

41 Balbiani rings are sites of? 48 Which type of substances would face difficulty in
1. Lipid synthesis
passing through the cell membrane?
2. Nucleotide synthesis
3. Polysaccharide synthesis
4. RNA and protein synthesis 1. Substances with hydrophobic moiety
2. Substances with hydrophilic moiety
42 Which one of the following does not differ in E.coli 3.
All substances, irrespective of hydrophobic and
and Chlamydomonas? hydrophilic moiety
1. Ribosomes 4. Substances which are soluble in lipids
2. Chromosomal organization
3. Cell wall 49 Primary proteins are also known as polypeptides,
4. Cell membrane because:
1. they are linear chains.
43 The solid linear cytoskeletal elements having a 2. they are polymers of peptide monomers.
diameter of 6 nm and made up of a single type of 3. successive amino acids are joined by peptide bonds.
monomer are known as: 4. they can assume many conformations.
1. Microtubules
2. Microfilaments 50 Uridine, present only in RNA is:
3. Intermediate filaments 1. nucleoside
4. Lamins 2. nucleotide
3. purine
44 Cytochromes are found in: 4. pyrimidine
1. matrix of mitochondria
2. outer wall of mitochondria 51 Which of the following is the least likely to be
3. cristae of mitochondria involved in stabilizing the three-­dimensional folding of
4. lysosomes most proteins?
1. Hydrogen bonds 2. Electrostatic interaction
3. Hydrophobic interaction 4. Ester bonds

Page: 5
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

52 Which one of the following statements is incorrect?
A competitive inhibitor reacts reversibly with the
1. enzyme to
form an enzyme inhibitor.
In competitive inhibition, the inhibitor molecule is
2. not chemically
changed by the enzyme.
The competitive inhibitor does not affect the rate of
3. breakdown
of the enzyme-substrate complex.
The presence of the competitive inhibitor decreases
4. the km of
the enzyme for the substrate.
53 In the enzyme which catalyses the breakdown of:
H2 O 2 → H2 O + O 2
57 Given below are two-statements:
Statement During G0 phase of cell cycle, the cell is
I: metabolically inactive.
Statement The centrosome undergoes duplication
II: during S phase of interphase.
In the light of the above statements, choose the most
appropriate answer from the options given below:
1. Statement I is incorrect but Statement II is correct.
2. Both Statement I and Statement II are correct.
3. Both Statement I and Statement I are incorrect.
4. Statement I is correct but Statement II is incorrect.
58 Given below are two statements : One is labeled as

the prosthetic group is : Assertion (A) and the other is labeled as Reason (R)
1. Nicotinamide adenine dinucleotide The growth of the multicellular
Assertion (A):
2. Haem organism is due to mitosis
3. Zinc Mitosis is also called as equational
Reason (R):
4. Niacin division and it offers genetic stability

54 During which phase(s) of the cell cycle, amount of In light of the above statements choose the correct
DNA in a cell remains at 4 C level if the initial amount is answer from the options given below:
denoted as 2C: 1. (A) is correct but (R) is not correct.
1. G0 and G1 2. (A) is not correct but (R) is correct.
2. G1 and S Both (A) and (R) are correct and (R) is the correct
3.
3. Only G2 explanation of (A).
4. G2 and M Both (A) and (R) are correct but (R) is not the correct
4.
explanation of (A).
55 A somatic cell that has just completed the S-phase
After meiosis I, the resultant daughter cells have
of its cell cycle, as compared to a gamete of the same 59
species has: 1. same amount of DNA as in the parent cell in S
twice the number of chromosomes and twice the 2. twice the amount of DNA in comparison to haploid
1.
amount of DNA same amount of DNA in comparison to haploid
3.
the same number of chromosomes but twice the gamete
2.
amount of DNA four times the amount of DNA in comparison to
4.
twice the number of chromosomes and four times haploid gamete
3.
the amount of DNA
4.
four times the number of chromosomes and twice 60 Water-soluble pigments found in plant cell vacuoles
the amount of DNA are:
1. chlorophylls 2. carotenoids
56 Cells in G phase:
0
3. anthocyanins 4. xanthophylls
1. terminate the cell cycle
2. exit the cell cycle 61 The ratio of carbon dioxide fixation between C4
3. enter the cell cycle
plants and C3 plants is :
4. suspend the cell cycle
1. 2:1 2. 2: 3
3. 1:1 4. 1:2

Page: 6
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

62 The oxygenation activity of RuBisCo enzyme in 68 The figure shows a human blood cell. Identify it and
photorespiration leads to the formation of: give its characteristics:
1. 1 molecule of the 3-C compound
2. 1 molecule of the 6-C compound
1 molecule of a 4-C compound and 1 molecule of the
3.
2-C compound
4. 2 molecules of the 3-C compound

63 What is the role of NAD+ in cellular respiration?

Blood cell Characteristics
1. It functions as an enzyme
1. Basophils Secrete serotonin
2. It functions as an electron carrier
B- form about 20% of blood cells
3. It is a nucleotide source for ATP synthesis 2.
lymphocytes involved in immune response
It is the final electron acceptor for anaerobic
4. 3. Neutrophils Most abundant blood cells, phagocytic
respiration
4. Monocytes Life spans 3 days, produce antibodies
64 In tissue culture experiments, leaf mesophyll cells
are put in a culture medium to form callus. This
69 All the components of the nodal tissue are
phenomenon may be called as autoexcitable. Why does the SA node act as the normal
pacemaker?
1. Senescence 2. Differentiation
1. SA node has the lowest rate of depolarisation
3. Dedifferentiation 4. Development
SA node is the only component to generate the
2.
threshold potential.
65 The pineapple which under natural conditions is
Only SA node can convey the action potential to the
difficult to blossom has been made to produce fruits 3.
other
throughout the year by application of:
1. NAA, 2, 4- D 4. SA node has the highest rate of depolarisation.
2. GA3
3. Cytokinin 70 What would be the heart rate of a person if the
4. IAA, IBA cardiac output is 5L, blood volume in the ventricles at
the end of diastole is 100 mL and at the end of
66 During seed germination its stored food is ventricular systole is 50 mL?
mobilized by: 1. 125 beats per minute
1. Cytokinin 2. 50 beats per minute
2. ABA 3. 75 beats per minute
3. Gibberellin 4. 100 beats per minute
4. Ethylene Which one of the following statements is correct?
71
67 The maximum volume of air a person can breathe in
after a forced expiration is known as: Increased ventricular pressure causes closing of the
1.
1. Expiratory Capacity semilunar valves.
2. Vital Capacity The atrio-ventricular node (AVN) generates an action
2.
3. Inspiratory Capacity potential to stimulate atrial contraction.
4. Total Lung Capacity The tricuspid and the bicuspid valves open due to the
3. pressure exerted by the simultaneous contraction of
the atria.
Blood moves freely from atrium to the ventricle
4.
during joint diastole.

Page: 7
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

72 76 Use of an artificial kidney during hemodialysis may

In mammals, which blood vessel would normally carry result in:
the largest amount of urea? a. Nitrogenous waste build-up in the body
1. Dorsal Aorta b. Non-elimination of excess potassium ions
2. Hepatic Vein
Reduced absorption of calcium ions from gastro-
3. Hepatic Portal Vein c.
intestinal tract
4. Renal Vein
d. Reduced RBC production
73 Given below are two statements: one is labelled as
Which of the following options is the most appropriate?
Assertion (A) and the other is labelled as Reason (R)
1. (a) and (d) are correct
Ascending limb of the loop of Henle is 2. (a) and (b) are correct
impermeable to water and allows 3. (b) and (c) are correct
Assertion (A):
transport of electrolytes actively or 4. (c) and (d) are correct
passively.
Dilution of filtrate takes place due to 77 Sliding filament theory can be best explained as:
Reason (R): efflux of electrolytes in the medullary
fluid when myofilaments slide past each other, actin
1. filaments shorten
In light of the above statements, choose the correct
while myosin filament does not shorten
answer from the options given below:
actin and myosin filaments shorten and slide past
1. (A) is True, (R) is False 2.
each other
2. (A) is False, (R) is True
actin and myosin filaments do not shorten but rather
Both (A) and (R) are True and (R) is the correct 3. slide pass
3.
explanation of (A) each other
Both (A) and (R) are True but (R) is not the correct when myofilaments slide past each other, myosin
4.
explanation of (A) 4. filaments shorten
While actin filaments do not shorten
74 Which of the following does not favour the
formation of large quantities of dilute urine? 78 Which of the following statements are correct
1. Alcohol regarding skeletal muscle?
2. Caffeine
3. Renin
Muscle bundles are held together by collagenous
4. Atrial-natriuretic factor A.
connective tissue layer called fascicle.
Sarcoplasmic reticulum of muscle fibre is a store
75 Which of the following would help in prevention of B.
house of calcium ions.
diuresis?
Striated appearance of skeletal muscle fibre is due
+ C.
1. Reabsorption of Na and water from renal tubules to distribution pattern of actin and myosin proteins.
due to aldosterone M line is considered as functional unit of contraction
2. Atrial natriuretic factor causes vasoconstriction D.
called sarcomere.
3. Decrease in the secretion of renin by JG cells
More water reabsorption due to under secretion of Choose the most appropriate answer from the options
4.
ADH given below:
1. C and D only 2. A, B and C only
3. B and C only 4. A, C and D only

Page: 8
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

79 85 Transmission tissue is a characteristic feature of:

Lack of relaxation between successive stimuli in 1. hollow style
sustained muscle contraction is known as? 2. solid style
1. fatigue 3. dry stigma
2. tetanus 4. wet stigma
3. tonus
4. spasm 86 Winged pollen grains are present in:
1 Mustard
80 Which of the following regions of the brain is 2. Cycas
incorrectly paired with its function? 3. Mango
1. Medulla oblongata-Homeostatic control 4. Pinus
2. Cerebellum-Language comprehension
Corpus callosum-Communication between 87 Bee-keeping helps to improve the yield of following
3. crops Except ____________.
the left and right cerebral cortices
4. Cerebrum-Calculation and contemplation 1. Jowar
2. Sunflower
3. Apple
81 Destruction of the anterior horn cells of the spinal 4. Mustard
cord would result in loss of?
1. Sensory impulses 88 What will be the ploidy of endosperm of a seed
2. Voluntary motor impulses
produced after crossing tetraploid female plant with
3. Commissural impulses
tetraploid male plant?
4. Integrating impulses
1. Pentaploid
2. Hexaploid
82 3. Diploid
The amino acid, tryptophan is the precursor for the 4. Triploid
synthesis of?
1. thyroxine and tri-iodothyronine 89 The plant parts which consist of two generations,
2. estrogen and progesterone
one within the other, are:
3. cortisol and cortisone
4. melatonin and serotonin a. Pollen grains inside the anther
b. Germinated pollen grain with two male gametes
c. Seed inside the fruit
83 An intestinal hormone that stimulates the pancreas d. Embryo sac inside the ovule
to release a watery secretion that is rich in bicarbonate
ions: 1. (a), (b), and (c)
1. Cholecystokinin 2. (c) and (d)
2. Gastric Inhibitory Peptide 3. (a) and (d)
3. Enterokinin 4. (a) only
4. Secretin
90 Which one of the following statements is false in
84 Male gametophyte with least number of cells is respect of viability of mammalian sperm?
present in: 1. Sperm is viable for only up to 24 hours
1. Pteris Survival of sperm depends on the pH of the medium
2. Funaria 2.
and is more active in alkaline medium
3. Lilium
3. Viability of sperm is determined by its motility
4. Pinus
4. Sperms must be concentrated in a thick suspension

Page: 9
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

91 94 Given below are two statements: one is labelled as

Identify the correct statement on 'inhibin': Assertion (A) and the other is labelled as Reason (R).
Is produced by granulosa cells in the ovary and
1.
inhibits the secretion of FSH Endometrium is necessary for
Assertion (A):
Is produced by granulosa cells in the ovary and implantation of blastocyst.
2.
inhibits the secretion of LH In the absence of fertilization, the
Is produced by nurse cells in the testes and inhibits Reason (R): corpus luteum degenerates that causes
3. disintegration of endometrium.
the secretion of LH
4. Inhibits the secretion of LH, FSH and prolactin.
In the light of the above statements, choose the correct
answer from, the options given below:
92 Given below are two statements:
1. (A) is false but (R) is true.
Statement The release of sperms from the
I: seminiferous tubules is called spermiation. Both (A) and (R) are true and (R) is the correct
2.
explanation of (A).
Statement Spermiogenesis is the process of formation
II: of sperms from spermatogonia. Both (A) and (R) are true but (R) is NOT the correct
3.
explanation of (A).
In the light of the above statements, Choose the most 4. (A) is true but (R) is false.
appropriate answer from the option given below :
1. Statement I is incorrect but Statement II is correct. 95 Select the correct option describing gonadotropin
2. Both Statement I and Statement II are correct. activity in a normal pregnant female:
3. Both Statement I and Statement II are incorrect. High level of FSH and LH stimulates the thickening
4. Statement I is Correct but Statement II is incorrect. 1.
of endometrium.
High level of FSH and LH facilitate implantation of
93 Which of the following statements are true for 2. the embryo
spermatogenesis but do not hold true for Oogenesis? High level of hCG stimulates the synthesis if estrogen
3.
and progesterone
a. It results in the formation of haploid gametes. High level of hCG stimulates the thickening of the
Differentiation of gamete occurs after the completion 4.
b. endometrium.
of meiosis.
Meiosis occurs continuously in a mitotically dividing 96
c.
stem cell population. The amnion of mammalian embryo is derived from?
It is controlled by the Luteinising hormone (LH) and 1. ectoderm and mesoderm
d. Follicle Stimulating Hormone (FSH) secreted by the 2. endoderm and mesoderm
anterior pituitary. 3. mesoderm and trophoblast
e. It is initiated at puberty. 4. ectoderm and endoderm

Choose the most appropriate answer from the option 97 Which of these is not an important component of
given below: the initiation of parturition in humans?
1. (b), (c), and (e) only 2. (c) and (e) only 1. Increase in oestrogen and progesterone ratio
3. (b) and (c) only 4. (b), (d) and (e) only 2. Synthesis of prostaglandins
3. Release of oxytocin
4. Release of prolactin

98 Which of the following secretes the hormone,

relaxin, during the later phase of pregnancy?
1. Foetus
2. Uterus
3. Graafian follicle
4. Corpus luteum

Page: 10
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

99 Which of these is not an important component of 103 Given below are two statements:
initiation of parturition in humans? Intra Cytoplasmic sperm injection (ICSI) is another
1. Release of oxytocin I:
specialized procedure of in-vivo fertilization.
2. Release of prolactin Infertility cases due to the inability of the male
3. Increase in estrogen and progesterone ratio II: partner to inseminate the female can be corrected by
4. Synthesis of prostaglandins artificial insemination (AI)
In light of the above statements, choose the correct
100 Given below are two statements : one is labelled as answer from the options given below:
Assertion (A) and the other is labelled as Reason (R). 1. Statement I is correct but Statement II is false
2. Statement I is incorrect but Statement II is true
Pregnancy is characterised by metabolic 3. Both Statement I and Statement II are true
Assertion (A):
changes in the mother. 4. Both Statement I and Statement II are false
During pregnancy the level of thyroxine
Reason (R):
is increased in the maternal blood. 104 Venereal diseases can spread through:
(a) Using sterile needles
In the light of the above statements, choose the most (b) Transfusion of blood from an infected person
appropriate answer from the options given below:
(c) Infected mother to foetus
(d) Kissing
Both (A) and (R) are correct and (R) is the correct
1. (e) Inheritance
explanation of (A).
Both (A) and (R) are correct but (R) is not the correct Choose the correct answer from the options given
2. below:
explanation of (A).
3. (A) is correct but (R) is not correct. 1. (b) and (c) only 2. (a) and (c) only
4. (A) is not correct but (R) is correct. 3. (a), (b), and (c) 4. (b), (c), and (d)

101 The contraceptive 'SAHELI': 105 The number of contrasting characters studied by
Mendel for his experiments was:
blocks estrogen receptors in the uterus, preventing
1. 1. 14
implantation.
2. 4
increases the concentration of estrogen and prevents 3. 2
2.
ovulation in females. 4. 7
3. is an lUD.
4. is a post-coital contraceptive. 106 Multiple alleles are present:
1. on different chromosomes
102 In Which of the following techniques, the embryos 2. at different loci on the same chromosome
are transferred to assist those females who cannot 3. at the same locus of the chromosome
conceive? 4. on non-sister chromatids
1. GIFT and ZIFT 2. ICSI and ZIFT
3. GIFT and ICSI 4. ZIFT and IUT 107 Which of the following statements is not true of
two genes that show 50% recombination frequency?
1. The genes are tightly linked.
2. The genes show independent assortment.
If the genes are present on the same chromosome,
3. they undergo more than one crossing-over in every
meiosis.
4. The genes may be on different chromosomes.

Page: 11
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

108 What map unit (Centimorgan) is adopted in the 112 Which one is the incorrect statement with regards
construction of genetic maps? to the importance of pedigree analysis?
A unit of distance between genes on chromosomes,
1.
representing 50% cross-over. It confirms that DNA is the carrier of genetic
1.
A unit of distance between two expressed genes, information
2.
representing 10% cross-over. It helps to understand whether the trait in question is
2.
A unit of distance between two expressed genes, dominant or recessive
3.
representing 100% cross-over. It confirms that the trait is linked to one of the
3.
A unit of distance between genes on chromosomes. autosomes
4.
representing 1% cross-over. 4. It helps to trace the inheritance of a specific trait

109 What is the expected percentage of F2 progeny

with yellow and inflated pod in dihybrid cross
experiment involving pea plants with green coloured, 113 If both parents are carriers for thalassemia, which
inflated pod and yellow coloured constricted pod ? is an autosomal recessive disorder, what are the chances
1. 100% of pregnancy resulting in an affected child?
2. 56.25% 1. 50% 2. 25 %
3. 18.75 % 3. 100% 4. no chance
4 9%
114 An abnormal human baby with 'XXX' sex
110 Select the correct statements with respect to
chromosomes was born due to:
pleiotropism 1. formation of abnormal ova in the mother
A gene is said to be pleiotropy if it affects more than 2. fusion of two ova and one sperm
(a)
one trait 3. fusion of two sperms and one ovum
(b) Phenylketonuria is an example of pleiotropy 4. formation of abnormal sperms in the father
A condition where one gene has several alleles is
(c)
referred to as pleiotropism 115 In the following human pedigree, the filled
A trait is said to be pleiotropic if several genes symbols represent the affected individuals. Identify the
(d)
control it type of given pedigree:
Choose the correct answer from the options given
below:
1. (a) and (b) only
2. (a) and (d) only
3. (a), (b) and (c) only
4. (b), (c) and (d) only

111
Which of the following statements is not true for cancer
cells in relation to mutations?
1. Mutations destroy telomerase inhibitor
2. Mutations inactive the cell control
1. Autosomal dominant
3. Mutations inhibit the production of telomerase 2. X-linked recessive
Mutations in proto–oncogenes accelerate the cell 3. Autosomal recessive
4.
cycle 4. X-linked dominant

116 In a cross between a male and female, both

heterozygous for sickle cell anaemia gene, what
percentage of the progeny will be diseased?
1. 25% 2. 100%
3. 50% 4. 75%

Page: 12
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

117 Which of the following characteristics represent 123 Given below are two statements: One is labelled as
the 'Inheritance of blood groups' in humans? Assertion (A) and the other is labelled as Reason (R)
a. Dominance Semiconservative replication was
b. Co-dominance Assertion (A): experimentally proved by Mathew
c. Multiple allelism Meselson and Franklin Stahl (1958)
d. Incomplete dominance Meselson and Stahl used radioactive
e. Polygenic inheritance Reason (R): isotope N and equilibrium density
15

1. b, c, and e 2. a, b and c gradient centrifugation technique.

3. b, d, and e 4. a, c, and e
118 In the polynucleotide chain of DNA, a nitrogenous 1. (A) is correct but (R) is not correct.
base is linked to the –OH of:
1. 2'C pentose sugar 2. 3'C pentose sugar
3. 5'C pentose sugar 4. 1'C pentose sugar
119 Identify the correct order of organization of genetic
material from largest to smallest.
1. Chromosome, gene, genome, nucleotide
2. Genome, chromosome, nucleotide, gene
3. Genome, chromosome, gene, nucleotide
4. Chromosome, genome, nucleotide, gene
120 Why is a capsule advantageous to a bacterium?
1. It protects the bacterium from desiccation
2. It provides means of locomotion
It allows the bacterium to "hide" from the host's
3.
immune system.
4. It allows the bacterium to attach to the surface
121 Ten E.coli cells with N - ds DNA are incubated 4. Degenerate, Non-overlapping, Non-ambiguous
15
In the light of the above statements, choose the correct
answer from the options given below:
2. (A) is not correct but (R) is correct.
Both (A) and (R) are correct and (R) is the correct
3.
explanation of (A).
Both (A) and (R) are correct but (R) is not the correct
4.
explanation of (A).
124 Which one of the following is the sequence on
corresponding coding strand, if the sequence on mRNA
formed is as follows
5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
1. 3' ATCGATCGATCGATCGATCGATCGATCG 5'
2. 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
3. 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
4. 5' ATCGATCGATCGATCGATCGATCGATCG 3'
125 From the following, identify the correct
combination of salient features of the Genetic Code:
1. Universal, Non-ambiguous, Overlapping
2. Degenerate, Overlapping, Commaless
3. Universal, Ambiguous, Degenerate

in medium containing N nucleotide. After 60 minutes,

14

how many E.coli cells will have DNA totally free from 126
N ?
15

Statement The codon AUG' codes for methionine and

1. 80 cells I: phenylalanine.
2. 20 cells
Statement AAA' and 'AAG are both codons that code
3. 40 cells
II: for the amino acid lysine.
4. 60 cells
In light of the above statements, choose the correct
122 DNA replication in bacteria occurs:
answer from the options given below:
1. Within nucleolus
1. Statement I is correct but Statement II is false.
2. Prior to fission
3. Just before transcription 2. Statement I is incorrect but Statement II is true.
4. During S phase 3. Both Statement I and Statement II are true.
4. Both Statement I and Statement II are false.

127 How many different proteins does the ribosome

consist of?
1. 20 2. 80
3. 60 4. 40

Page: 13
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

128 Read the following four statements (A-D): 133 An analysis of chromosomal DNA using the
I. In transcription, adenosine pairs with uracil Southern hybridization technique does not use:
Regulation of lac operon by a repressor is referred 1. Electrophoresis
II. 2. Blotting
to as positive regulation
3. Autoradiography
III. The human genome has approximately 50,000 genes
4. PCR
V. Haemophilia is a sex-linked recessive disease
134 DNA fingerprinting involves identifying
How many of the above statements are right?
differences in some specific regions in DNA sequence
1. Three
called:
2. Four
3. One 1. Single nucleotides 2. Polymorphic DNA
4. Two 3. Satellite DNA 4. Repetitive DNA

129 Which enzyme(s) will be produced in a cell in 135 Which of the following is the correct sequence of
which there is a non-sense mutation in the lac Y gene? events in the origin of life?
1. Lactose permease I. Formation of protobionts.
2. Transacetylase II. Synthesis of organic monomers.
III. Synthesis of organic polymers.
3. Lactose permease and transacetylase IV. Formation of DNA-based genetic systems.
4. β - galactosidase 1. I, II, III, IV 2. I, III, II, IV
3. II, III, I, IV 4. II, III, IV, I
130 Gene regulation governing lactose operon of E.
coli that involves the lac I gene products is: 136 Select the correct group/set of Australian
positive and inducible because it can be induced by Marsupials exhibiting adaptive radiation.
1.
lactose. 1. Lemur, Anteater, Wolf
negative and inducible because repress or protein 2. Tasmanian wolf, Bobcat, Marsupial mole
2.
prevents transcription. 3. Numbat, Spotted cuscus, Flying phalanger
negative and repressible because repress or protein 4. Mole, Flying squirrel, Tasmanian tiger cat
3.
prevents transcription.
feedback inhibition because excess of β galactosidase 137 Artificial selection to obtain cows yielding higher
4.
can switch off transcription. milk output represents:
Directional, as it pushes the mean of the character in
1.
131 In an E.coli strain i gene gets mutated and its one direction
product cannot bind the inducer molecule. If growth Disruptive, as it splits the population into two, one
2.
medium is provided with lactose, what will be the yielding higher output and the other lower output
outcome ? Stabilizing followed by disruptive, as it stabilizes the
1. RNA polymerase will bind the promoter region 3.
population to produce higher-yielding cows
2. Only z gene will get transcribed Stabilizing selection, as it stabilizes this character in
3. z, y, a genes will be transcribed 4.
the population
4. z, y, a genes will not be translated
Genetic Drift occurs due to :
132 Genes of interest can be selected from a genomic 138
1. Natural selection
library by using:
2. Sudden population migration
1. Cloning vectors
3. Continuous gene migration
2. DNA probes
4. Mutation
3. Gene targets
4. Restriction enzymes

Page: 14
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

139 Match each disease with its correct type of 143 Read the following four statements (I-IV):
vaccine: Colostrum is recommended for the newborn because
I.
Column I Column II it is rich in antigen
A Tuberculosis 1 Harmless virus Chikungunya is caused by a Gram-negative
II.
B Whooping cough 2 Inactivated toxin bacterium
C Diptheria 3 Killed bacteria Tissue culture has proved useful in obtaining virus-
III.
D Polio 4 Harmless bacteria free plants
Beer is manufactured by distillation of fermented
IV.
1. A-2 B-1 C-3 D-4 grape juice
2. A-3 B-2 C-4 D-1
3. A-4 B-3 C-2 D-1 How many of the above statements are wrong?
4. A-1 B-2 C-4 D-3 1. Three
2. Four
140 Which of the following diseases is caused by a 3. One
protozoan? 4. Two
1. Syphilis
2. Influenza 144
3. Babesiosis Which of the following is not an autoimmune disease?
4. Blastomycosis 1. Psoriasis
2. Rheumatoid arthritis
141 The active form of Entamoeba histolytica feeds 3. Alzheimer's disease
upon: 4. Vitiligo
1. erythrocytes mucosa and submucosa of the colon
2. mucosa and submucosa of colon only 145 Humans have acquired an immune system that
3. food in the intestine produces antibodies to neutralize pathogens. Still innate
4. blood only immune system is present at the time of birth because it:
1. is very specific and uses different macrophages
142 Give below are two statements : 2.
produces memory cells for mounting a fast secondary
When an infected female Anopheles response
Statement
mosquito bites, it releases gametocytes of has natural killer cells that can phagocytose and
I 3.
plasmodium into the healthy person. destroy microbes
The female Anopheles mosquito takes up 4. provides passive immunity
Statement sporozoites of Plasmodium with blood meal
II from an infected person, suffering from 146 Which one of the following is a hallucinogenic
malaria. drug?
1. Caffeine
In light of the above statements, choose the most 2. Morphine
appropriate answer from the options given below : 3. Lysergic acid diethylamide
1. Statement I is correct but Statement II is incorrect. 4. Opium
2. Statement I is incorrect but Statement II is correct.
3. Both Statement I and Statement II are correct. 147 Which one of the following fungi contains
4. Both Statement I and Statement II are incorrect. hallucinogens?
1. Morchella esculenta
2. Amanita muscaria
3. Neurospora sp.
4. Ustilago sp.

Page: 15
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

148 Which one of the following is an example of 152 Which of the following methods is not commonly
carrying out biological control of pests/diseases using used for introducing foreign DNA into the plant cell?
microbes? 1. Agrobacterium mediated transformation
1. Trichoderma sp. against certain plant pathogens 2. Gene gun
2. Nucleopolyhedrovirus against white rust in Brassica 3. 'Disarmed pathogen' vectors
3. Bt-cotton to increase cotton yield 4. Bacteriophages
4. Ladybird beetle against aphids in mustard
153 Which of the following statement is incorrect
149 Which of the following restriction enzymes above Agrobacterium tumefaciens ?
produces blunt ends? It is used to deliver gene of interest in both
1. Sal l 1.
prokaryotic as well as eukaryotic host cells.
2. Eco RV 'Ti' plasmid from Agrobacterium tumefaciens used for
3. Xho 2.
gene transfer is not pathogenic to plant cells.
4. Hind lll
3. It transforms normal plant cells into tumor cells
150 Plasmid pBR322 has a PstI restriction enzyme site 4. It delivers 'T-DNA' into plant cell
within gene ampR that confers ampicillin resistance. If 154 Match List - I with List - II
this enzyme is used for inserting a gene for β-
galactoside production and the recombinant plasmid is List-I List-II
inserted in an E.coli strain, Delivers genes into animal
(A) Kanamycin (I)
1. it will lead to the lysis of host cells. cells
it will be able to produce a novel protein with dual (B) ClaI (II) Selectable marker
2. Disarmed
abilities. (C) (III) Restriction site
it will not be able to confer ampicillin resistance to retroviruses
3.
the host cell. (D) Kanamycin Rgene (IV) Antibiotic resistance
the transformed cells will have the ability to resist Choose the correct answer from the options given
4.
ampicillin as well as produce β -galactoside. below:
Options: (A) (B) (C) (D)
151 Given below are two statements one is labelled as 1. II III I IV
Assertion (A) and the other is labelled as Reason (R). 2. III I IV II
3. IV III I II
When a particular restriction enzyme 4. II IV I III
Assertion (A): cuts strands of DNA, overhanging
stretches or sticky ends are formed.
Some restriction enzymes cut the strand
Reason (R): of DNA a little away from the centre of
palindromic site.

In light of the above statements, choose the correct

answer from the options given below:

Both (A) and (R) are correct and (R) is the correct
1.
explanation of (A).
Both (A) and (R) are correct but (R) is not the correct
2.
explanation of (A).
3. (A) is correct but (R) is not correct.
4. (A) is not correct but (R) is correct.

Page: 16
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

155 Given below are four statements pertaining to the 157 Main steps in the formation of Recombinant DNA
separation of DNA fragments using gel electrophoresis. are given below. Arrange these steps in a correct
Identify the incorrect statements: sequence.
DNA is a negatively charged molecule and so it is
a.
loaded on gel towards the anode terminal. A. Insertion of recombinant DNA into the host cell.
DNA fragments travel along the surface of the gel, Cutting of DNA at specific location by restriction
B.
b. whose concentration does not affect the movement of enzyme.
DNA. C. Isolation of desired DNA fragment.
The smaller the DNA fragment, the greater the D. Amplification of gene of interest using PCR.
c.
distance it travels through it.
Pure DNA can be visualized directly by exposing it Choose the correct answer from the options given
d.
to UV radiation. below:
Choose the correct answer from the options given 1. B, D, A, C 2. B, C, D, A
below: 3. C, A, B, D 4. C, B, D, A
1. (a), (c) and (d)
2. (a), (b) and (c)
3. (b), (c) and (d)
158 Which one of the following vectors is used to
4. (a), (b) and (d) replace the defective gene in gene therapy?
1. Adenovirus
Given below are two statements: One is labelled as 2. Cosmid
156
3. Ri plasmid
Assertion (A) and the other is labelled as Reason (R). 4. Ti plasmid
In rDNA technology non-recombinants
transformed bacteria grow on the 159 Which of the following statements is not true about
Assertion (A):
medium containing ampicillin as well as
somatic embryogenesis?
medium containing tetracycline
Recombinant plasmids contain the
Reason (R): The pattern of development of a somatic embryo is
foreign gene of interest. 1.
comparable to that of a zygotic embryo
2. Somatic embryos can develop from microspores
In the light of the above statements, choose the correct
answer from the options given below: Somatic embryo is induced usually by an auxin such
3.
1. (A) is correct but (R) is not correct. as 2, 4–D
2. (A) is not correct but (R) is correct. 4. A somatic embryo develops from a somatic cell
Both (A) and (R) are correct and (R) is the correct
3.
explanation of (A).
Both (A) and (R) are correct but (R) is not the correct
4. 160 In vitro clonal propagation in plants is
explanation of (A).
characterized by:
1. PCR and RAPD
2. Northern blotting
3. Electrophoresis and HPLC
4. Microscopy

161 There are 250 snails in a pond and within a year

their number increases to 2500 by reproduction. What
should be their birth rate (in per snail per year)?
1. 10 2. 9
3. 25 4. 15

Page: 17
 Bio - Difficult PYQs from Contact Number: 9667591930 /
2012 to 2023 8527521718

162 An association of individuals of different species 166 The upright pyramid of number is absent in:
living in the same habitat and having functional 1. Pond
interactions is known as: 2. Forest
1. Ecological niche 2. Biotic community 3. Lake
3. Ecosystem 4. Population 4. Grassland

The largest tiger reserve in India is:

163 The amount of biomass or organic matter produced 167
per unit area over a time period by plants during 1. Valmiki
photosynthesis is called: 2. Nagarjunsagar - Srisailam
1. Secondary production 3. Periyar
2. Primary production 4. Nagarhole
3. Gross primary production
4. Net primary production 168 The UN Conference of Parties on climate change
in the year 2011 was held in:
164 Which of the following is not correct regarding the 1. Poland
decomposition of wastes? 2. South Africa
3. Peru
(a) Low temperature inhibits decomposition
4. Qatar
(b) Warm and moist environment favors the process
(c) The process is anaerobic
It is slower if detritus is rich in proteins and
(d) Fill OMR Sheet*
carbohydrates
Detritus is degraded into simpler inorganic
(e) *If above link doesn't work, please go to test link from
substance by fungal and bacterial enzymes
Choose the correct answer from the options given where you got the pdf and fill OMR from there. After
below: filling the OMR, you would get answers and explanations
1. (b) and (c) only 2. (c) (a) and (d) only for the questions in the test.
3. (c) and (d) only 4. (c) (d) and (e) only

165 Given below is an imaginary pyramid of numbers.

What could be one of the possibilities about certain CLICK HERE to get
organisms at some of the different levels?
FREE ACCESS for 2
days of ANY
NEETprep course
Level PC is insects and level SC is small
1.
insectivorous birds
Level PP is phytoplanktons in the sea and Whale on
2.
top-level TC
3. Level PP is pipal trees and the level SC is sheep
4. Level PC is rats and level SC is cats

Page: 18