Restriction enzymes 2

DNA molecules are very long

They may consist of millions of base pairs

In order to study the structure of DNA, the

molecules are broken up into smaller fragments
by enzymes called restriction enzymes

Restriction enzymes do not break up the DNA

molecule randomly but ‘cut’ it at particular sites
Restriction fragments 3
For example, a restriction enzyme called EcoR1*
‘recognises’ the base sequence CAATTC and cuts it
between the two As
recognised

--C-C-G-C-A-G-C-T-G-T-C-A-A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-A

cut
--C-C-G-C-A-G-C-T-G-T-C-A A-T-T-C- T-C-T-C-C-G-G-A-T-C-C-A-

Other restriction enzymes cut the DNA in different places

and so produce fragments which are easier to analyse

--C-C-G-C-A-G-C-T-G-T-C-A A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-C-A-

--C-C-G-C-A-G C-T-G-T-C-A A-T-T-C-T-C-C-G G-A-T-C-C-C-A-

 4

The fragments cut by the restriction enzymes are called

restriction fragments

The fragments can be separated using gel electrophoresis

(See slides 7 – 11)
 5
Genetic fingerprinting
90% or more of DNA does not carry nucleotide triplets that code
for proteins
The non-coding DNA is often called ‘junk DNA’ but this only
means that its functions have not yet been discovered

Some of the non-coding regions consist of repeated sequences

of nucleotides

For example -C-A-T-G-C-A-T-G-C-A-T-G-C-A-T-G- *

The number of repeats in any one section of DNA varies

from one individual to the next

Since these sections do not code for proteins (and, therefore are
not genes) there is no observable difference in these individuals
Genetic fingerprinting
Restriction enzymes 6

Particular repeat sequences can be ‘cut out’ by restriction enzymes

For example
restriction enzyme cuts

here……………and…..….…..here

-CATCCACGACATGCATGCATGCATGCCACATCCA-
or

here…….…..…..………and…...….…………..here

-CCACGACATGCATGCATGCATGCATGCATGCCACAT-
 7

Gel electrophoresis
The different sized fragments are separated by a process
called gel electrophoresis

The separation takes place in a sheet of a firm but

jelly-like substance (a ‘gel’)

Samples of the DNA extracts are placed in shallow

cavities (‘wells’) cut into one end of the gel
A voltage is applied to opposite ends of the gel

DNA has a negative charge and moves slowly towards

the positive end

The shorter fragments travel through the gel faster than the
longer fragments
Gel electrophoresis
Gel electrophoresis 8

DNA extract
added
well

gelatinous sheet

solution
Gel electrophoresis 9

DNA samples placed in

wells cut in gel
thin slab of
Voltage supply
gel
negative electrode

positive DNA fragments

electrode + Move from negative
To positive
 10

A sample with the

shorter DNA fragments
travels through the gel
faster than a sample
with the larger fragments
 11

Next slide
 12
Appearance of separated fragments on gel

These bands will

contain the shorter
DNA fragments

These bands will

contain the longer
DNA fragments

Prof.E.J.Wood
©©Prof. E. Wood

starting positions Appearance of bands

 13
Genetic fingerprinting

DNA analysis can be used for catching criminals, establishing

parentage, finding how closely organisms are related and many other
applications.

The pattern of bands in a gel electrophoresis is known as a

genetic fingerprint or a ‘genetic profile’

If a genetic fingerprint found in a sample of blood or other tissue

at the scene of a crime matches the genetic fingerprint of a suspect,
this can be used as evidence

A DNA sample can be obtained from the suspect using blood, cheek
epithelial cells taken from the mouth lining or even the cells clinging
to the root of a hair

Genetic fingerprinting
Chances of a match Suppose that………… 14

….there is a chance of 1 in 10 that this

fragment occurs in many individuals…

…and.there is a chance of 1 in 20 that this

fragment occurs in many individuals…

…and.there is a chance of 1 in 10 that this

fragment occurs in many individuals…

…and.there is a chance of 1 in 30 that this

fragment occurs in many individuals, but…
Probability of a match 15

…the probability of all 4 bands matching in any person other than

the suspect is

1 in 10 x 1 in 20 x 1 in 10 x 1 in 30

= 1 in 10 x 20 x 10 x 30 That is 1 in 60,000

When a larger number of bands is involved, the probability that

the suspect is not guilty becomes one in many thousands*
 DNA profiles 16
V S S1 S2 S3
V Victim

S Sample from crime scene

S1 Suspect 1

S2 Suspect 2

S3 Suspect 3

More than 20 fragments

from Suspect 1 match those
taken from the crime scene
 17
Evidence from genetic fingerprinting
Genetic fingerprinting is powerful evidence in criminal trials but…

Many restriction fragments may be crowded into a single band

There may be variability in the speed with which a fragment travels

through the gel

There is a chance of contamination with ‘foreign’ DNA

e.g. from bacteria

The jury may not understand the significance of genetic

fingerprinting and may be dependent on conflicting claims from
‘expert’ witnesses

There may be arguments about the statistical significance of a

match between DNA profiles
Evidence from genetic fingerprinting
Limitations of DNA evidence 18

Even if there is agreement about a match between the suspect’s

DNA profile and forensic samples, it shows only that the suspect
was present at the scene of the crime and does not prove that he or
she committed the crime

DNA evidence should be considered as conclusive proof of guilt

only if there is other supporting evidence

In cases of paternity disputes, the genetic evidence can be conclusive

Paternity can be decided on the basis of a single restriction site

 19
Paternity test
mother father

position of part of DNA strand

restriction
fragment

child

Child will receive one copy of the restriction fragment from the
mother and one from the father. It could be any one of these
combinations
 20
Genetic fingerprint of …
1 mother
2 child

3 possible father A
4 possible father B

There is a match between one of

the child’s restriction fragments
and one of the mother’s.

There is also a match between the

child’s other fragment and one from
possible father A.

Neither of the child’s restriction

1 2 3 4 fragments match those of possible
father B
Starting position of sample Paternity test
 21
The Human Genome Project

An organism’s genome is its entire genetic make-up

The genome includes …

all the chromosomes
all the genes on the chromosomes
and all the DNA of the chromosomes

The human genome project set out to …

identify the genes in the human genome (about 25,000*)
discover the sequence of the base pairs (about 2.8 billion)

99% of the gene-containing part of human DNA had been

analysed by 2003
Human genome project
 22
Mapping is the identification of genes and their positions in
the chromosome

Modern biochemical techniques are used to identify genes

and their positions in the chromosome

Special staining methods reveal bands in the chromosomes

These do not necessarily represent genes but help to identify
the position of genes

Chromosome 7

position of gene for cystic fibrosis

Chromosome 11

position of gene for sickle cell anaemia

Mapping
Giant chromosomes 23

By special staining techniques, bands appear in

the ‘giant chromosome’ of the fruit-fly (Drosophila)

© Biophoto Associates
 24
The bands do not necessarily represent genes but if, in mutant
flies, some of the bands are missing, there is a corresponding
defect in the fly

If bands are missing from this If this band is missing there

region, the fly has no colour is an irregularity in the wing
in its eyes (normally red)

Loss of this band leads to a change One or more of the bands in

in the texture of the eye surface this region controls the normal
development of bristles
Chromosome banding
 25
Sequencing

Sequencing aims to find out the sequence of nucleotides in a

stretch of DNA
The process can be automated to give results relatively quickly

Analysis of a small piece of DNA might give results something

like this
GCTTATCGATTCGGTGATACCATAGTGTAGTGTAGTCGCT
ATCCATCGCTTACGAGTCTGATGCGCATTAGCTAGCTAGCT
AGCTAGCCTCAGTTGATCATCGAGTGAGTACTGGACCATGC

Further analysis is needed to decide which sequences code for

proteins and represent genes

Sequencing
 26
Applications of results from the Human Genome Project

It is hoped that a knowledge of the human genome will enable…

identification of defective genes and the chance of early treatment

identification of genes which could make a person susceptible to
certain diseases, and so lead to preventative measures

prediction of the proteins that genes produce, giving the opportunity

to enhance or inhibit these proteins by specially designed drugs

Among the possible drawbacks are the possibilities that …

insurance companies may refuse cover for people at risk of
developing a genetic disability or disease
prediction of a disease or disability could blight a person’s life
Application
 27

Question 1
A restriction enzyme cuts DNA

(a) at random sites

(b) at sites with repeat nucleotides

(c) into single nucleotides

(d) at specific sites

 28

Question 2

The proportion of human DNA which codes for proteins is

(a) 3-10%

(b) 10-20%

(c) 50-80%

(d) 80-90%
 29

Question 3
Junk DNA is DNA which

(a) is functionless

(b) does not code for proteins

(c) codes for harmful genes

(d) may have functions not yet discovered

 30

Question 4

A restriction fragment is a piece of DNA which

(a) contains a gene

(b) contains repeated nucleotide sequences

(c) breaks up DNA at specific sites

(d) codes for a protein

 31

Question 5

In gel electrophoresis, the restriction fragments are separated

(a) by heat

(b) by chemicals

(c) by electricity

(d) by X-rays
 32

Question 6
In gel electrophoresis

(a) short DNA fragments move faster than long fragments

(b) long DNA fragments move faster than short fragments

(c) the fragments move towards the positive end

(d) the fragments move towards the negative end

 33

Question 7
If, in electrophoresis, specific bands appear in the same place
in 10% of the population, what are the chances of 5 of these bands
occurring in one individual?

(a) 1 in 100

(b) 1 in 1000

(c) 1 in 10,000

(d) 1 in 100,000
 34

Question 8
In slide 19, each individual has two bands in the electrophoresis
separation. This is because

(a) only two fragments are being analysed

(b) DNA is double stranded

(c) in each individual, one of their fragments is inherited

from the father and one from the mother

(d) the results are intended to distinguish between two

possible fathers
 35

Question 9

The human genome includes

(a) all the genes

(b) all the DNA

(c) all the nucleotides

(d) all the bases

 36

Question 10
Mapping is

(a) identifying the genes

(b) finding the position of genes in the chromosome

(c) finding the sequence of nucleotides

(d) finding the number of genes in a chromosome

 37

Question 11

Sequencing aims to find

(a) the sequence of nucleotides in DNA

(b) the sequence of genes in DNA

(c) the sequence of events in DNA replication

(d) the timing of the stages in replication

Answer

Correct
Answer

Incorrect