Professional Documents
Culture Documents
1.
a) Using the table of universal genetic code given in the Appendix, translate the DNA sequence into its amino acid sequence. (3 marks) b) A mutation occured in this gene, resulting in the insertion of a cytosine immediately after the start codon. Translate the new mutated sequence. (3 marks) c) What are the consequences of this mutation?
(2 marks)
2.
5'AUGGUUUUGCCGAUUCUACCGUUAAUUGAUGAUCUGGCCUCAUGGAAUAG UGA-3
a) Using the table of universal genetic code given in the Appendix, translate the mRNA sequence into its amino acid sequence. (4 marks) b) What are the start and stop codons for this gene? (2 marks)
c) What are introns and how are they processed during mRNA maturation? (2 marks)
3. Name the enzyme that is used for each of the following experiments and state one (1)function of the enzyme: a) making of complementary DNA b) amplifying DNA c) cleaving DNA fragments d) joining DNA fragments (8 marks)
4.
5'ATGGGAGTACTGGCATGCCCGGGAGTCCGTCATTACCTGGATTGGCATTTACCA TACACCGCAACGCGTGA3' Use Appendix 1 to answer the following questions: a) Write down the mRNA sequence based on the above DNA sequence. (2 marks)
b) How many amino acids are coded for by this gene? Identify the 4th, 11th and 19th amino acids? (4 marks) 5. Describe the differences between transcription and translation (6 marks)