Primer pair 2

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity
Forward primer TGGATTATTACTTGAAGACCTGTGTGGGTA Plus 30 71 100 63.66 40.00 5.00
Reverse primer TTACGGAGTTGCATTTCCAACATCACAAAG Minus 30 194 165 64.79 40.00 6.00
Product length 124
Primer pair 3
Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity
Forward primer AATGGATTATTACTTGAAGACCTGTGTGGG Plus 30 69 98 63.28 40.00 5.00
Reverse primer TACGGAGTTGCATTTCCAACATCACAAAGA Minus 30 193 164 65.41 40.00 6.00
Product length 125
Primer pair 4
Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity
Forward primer AAGACCTGTGTGGGTAGAAAATATGAATGA Plus 30 85 114 62.62 36.67 4.00
Reverse primer TGCATTTCCAACATCACAAAGATTTTACAT Minus 30 185 156 61.51 30.00 4.00
Product length 101
https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1634530685&job_key=pK57HSpJJ-EA3yLaL7oG6FWhF9p4sgzHeQ
PRIMER FORWARD

Thermodynamics of Folding
Thermodynamics of Folding:   ΔG = ΔH - TΔS

 ΔG = -1.65 kcal/mol at 37 °C
 ΔH = -36.70 kcal/mol
 ΔS = -113 cal/(K·mol)
 Tm = 51.6 °C assuming a 2 state model.
 linear DNA folding.
+ ++
 Ionic conditions: [Na ] = 1.0 M, [Mg ] = 0.0 M.
 Standard errors are roughly ±5%, ±10%, ±11% and 2-4 °C for free energy, enthalpy, entropy and T m,
respectively.

Structure 1
21Oct18-04-43-45
ΔG = -1.65

Structural
δG Information
element

External loop -1.05 18 ss bases & 1 closing helices.

Stack -1.44 External closing pair is A 4-T 15

Stack -1.84 External closing pair is C 5-G 14

Stack -0.32 External closing pair is C 6-G 13

Helix -3.60 4 base pairs.

Hairpin loop 3.00 Closing pair is T 7-G 12

PRIMER REVERSE

Thermodynamics of Folding
Thermodynamics of Folding:   ΔG = ΔH - TΔS

 ΔG = -0.54 kcal/mol at 37 °C
 ΔH = -25.80 kcal/mol
 ΔS = -81.4 cal/(K·mol)
 Tm = 43.6 °C assuming a 2 state model.
 linear DNA folding.
+ ++
 Ionic conditions: [Na ] = 1.0 M, [Mg ] = 0.0 M.
 Standard errors are roughly ±5%, ±10%, ±11% and 2-4 °C for free energy, enthalpy, entropy and T m,
respectively.

Structure 1
21Oct18-04-49-52
ΔG = -0.54

Structural
δG Information
element

External loop -0.66 19 ss bases & 1 closing helices.

Stack -0.88 External closing pair is A 13-T 23

Stack -1.30 External closing pair is T 14-A 22

Helix -2.18 3 base pairs.

Hairpin loop 2.30 Closing pair is C 15-G 21