Genotyping for Y chromosomal haplogroup determination

Except for the M172 marker, all of 18 markers for Y chromosomal haplogroup determination were

analyzed using SBE reactions. Fifteen Y-SNP markers to define haplogroups E, F, G, H, J, K, L, P, Q,

R, R1, R1a1a, R2, R2a and T were genotyped using primers in Table S9, and the other 3 Y-SNP

markers for haplogroups C, O and O3 were genotyped as described in a previous study [39]. Two

multiplex, a duplex and a monoplex PCR were performed in a final volume of 25 μl that contained 1

ng of template DNA, 2.5 μl of Gold ST*R 10× buffer (Promega), 2.0 U (1.0 U for duplex and

monoplex PCR) of AmpliTaq Gold® DNA polymerase (Applied Biosystems) and primer mix. The

reaction mixture was subjected to an initial denaturation at 95°C for 11 min, followed by 33 cycles of

amplification consisting of denaturation at 94°C for 20 s, annealing at 60°C for 60 s and extension at

72°C for 30 s and a final extension at 72°C for 7 min. For the following SBE reaction, 5.0 μl of the

PCR product was purified by incubating at 37°C for 45 min with 1.0 μl of ExoSAP-IT (USB,

Cleveland, OH, USA). The enzyme was then inactivated at 80°C for 15 min. The SBE reactions were

carried out with purified PCR product, SBE primer mix and a SNaPshot™ Multiplex kit (Applied

Biosystems) according to the manufacturer’s instructions. After the SBE reaction, 1 U of SAP (USB)

was added to the extension product, and the mix was incubated at 37°C for 45 min to remove

unincorporated ddNTPs. SAP was inactivated by incubation at 80°C for 15 min. The SBE products

were separated by capillary electrophoresis and analyzed using GeneMapper ID Software versions 3.2

(Applied Biosystems).

The M172 marker, which designates the haplogroup J2, was analyzed by direct sequencing in

individuals belonging to the haplogroup J. PCR was performed in a final volume of 20 μl that

contained 1 ng of template DNA, 2.0 μl of Gold ST*R 10× buffer, 1.0 U of AmpliTaq Gold® DNA

polymerase and a primer pair (Table S9). The reaction mixture was subjected to an initial denaturation

at 95°C for 11 min, followed by 34 cycles of amplification consisting of denaturation at 94°C for 20 s,

annealing at 59°C for 60 s and extension at 72°C for 60 s and a final extension at 72°C for 7 min.
1
PCR products were purified with ExoSAP-IT and sequenced using a BigDye® Terminator v3.1 Cycle

Sequencing Kit (Applied Biosystems) with forward primer. The fluorescent-labeled fragments are

analyzed by electrophoresis using an ABI 3730xl DNA Analyzer (Applied Biosystems).

2
Table S9. Primer sequences and final concentrations for the 16 Y-SNP markers in PCR and SBE reactions.

PCR primer sequences (5′→3′) SBE primer sequencesa

Haplogroup Marker Mutation RefSNP ID
Forward Reverse Conc. (5′→3′) Conc.
Multiplex reaction I
E M40 G/A rs9786608 acctgtaatcccagcccttc ccaggatggtctcaatctcttc 0.6 µM (t)1cccttcgagaggtcaaggc 0.30 µM
F M89 C/T rs2032652 agcttcctggattcagctctc caggatcaccagcaaaggtag 0.4 µM (t)6caactcaggcaaagtgagagat 0.35 µM
G M201 G/T rs2032636 gtttctcagatctaataatccagtatcaa cccatatccagcatcctatca 0.6 µM (t)6(a)1cagatctaataatccagtatcaactgagg 0.60 µM
H M69 T/C rs2032673 agcctgttcaaatccaaaagc tctccccttagctctcctgtt 1.0 µM (t)16ccctttgtcttgctgaaatatatttt 0.80 µM
J M304 A/C rs13447352 ggtaggcaaagaaaagcagga aacgtcttataccaaaatatcaccag 0.4 µM (t)21cgtcttataccaaaatatcaccagttgt 0.60 µM
K M9 C/G rs3900 ggaccctgaaatacagaactgc cgtttgaacatgtctaaattaaagaaaa 0.6 µM (t)35aacggcctaagatggttgaat 0.75 µM
Multiplex reaction II
L M20 A/G rs3911 ggccctttgtgtctgtgagt tcagtgcaaatgcaaccatc 0.4 µM tcaaccaactgtggattgaaaat 0.25 µM
P M45 G/A rs2032631 catcggggtgtggactttac ctggacctcagaaggagcttt 0.4 µM (t)10acctcagaaggagctttttgc 0.30 µM
Q M242 C/T rs8179021 gcaaaaaggtgaccaaggtg gaacaactctgaagcggtgg 0.6 µM (t)19acacgttaagaccaatgccaa 0.18 µM
R M207 A/G rs2032658 gggcaaatgtaagtcaagcaa gccaattaggtcacttcaacc 0.6 µM (t)19caaatgtaagtcaagcaagaaattta 0.12 µM
R1 P231 A/G rs9786465 tggcaagctctgatgacaag tctctggcattccaccagtt 0.6 µM (t)29(a)2ccaccagttgcgtgtgatta 0.30 µM
R1a1a M17 -1bp rs3908 tcaccagagtttgtggttgc cccacatacaacagtcttcaca 0.8 µM (t)39gttgctggttgttacggg 0.12 µM
Duplex reaction
R2 M479 C/T caacaatggtctcctttttgc ggtggtggaagatggaagtg 0.3 µM gggtaggatttgggtggtg 0.10 µM
R2a M124 C/T gggcaacaccagaatctaaca agcaaagttgaggttgcaca 0.3 µM (t)12tggggggaacagggaagt 0.16 µM
Monoplex reaction
T M184 G/A rs20320 tctgtgtctttttcctttgcag cttctccaagttttgcatggt 0.6 µM tgcatggtccaaacaaacag 0.20 µM
Direct sequencing
J2 M172 T/G rs2032604 atgagccctctccatcagaa tcactccatgttggtttgga 0.6 µM
a
The tails added to the 5′ ends of SBE primers are in parentheses.