Biochemistry Pacop Pinkgreen

Biochemistry-GREEN Page 1 of 10
B 1. The inhibition in a noncompetitive reaction: c. reversible inhibition

a. competes with the active site of the enzyme d. incomplete inhibition
b. binds simultaneously with substrate other than the
active site C 16. The following are waxes except:
c. increases the rate of reaction a. beeswax b. sperm oil
d. both b and c c. bile acids d. lanolin
A 2. The order and sequence of amino acid in a polypeptide A 17. The inactive form of enzymes are called:
determines what protein structure? a. zymogens b. apoenzymes
a. primary c. cofactor d. both b and c
b. secondary
c. tertiary D 18. Which of the following amino acids has no alpha
d. quaternary amino group?
a. praline b. hydroxyproline
B 3. Amino acids that cannot be synthesized in the c. glycine d. both a and b
organism are called _____
a. non essential amino acids b. essential amino acids B 19. An enzyme is a substance which
c. standard amino acids d. alpha amino acids a. convert heat to energy
b. act as a catalyst
A 4. Which hormone regulates the level of blood sodium? c. change chemically in reaction
a. aldosterone b. sterol d. is not specific in reaction
c. corticosteroid d. cortisone
B 20. Milk curdling enzyme present in gastric juice of
B 5. It is a precursor of vitamin A infants:
a. B-carotene b. retinol a. pepsin b. rennin
c. retinal d. opium c. trypsin d. maltase
C 6. Which of the following is a precursor of vitamin D? A 21. Carbohydrates are

a. prostaglandin b. linoleic acid a. polyhydroxyaldehydes / polyhydroxyketones
c. cholesterol d. aldosterone b. polyhydroxy acids
c. hemiacetals
A 7. Which of these class enzymes introduces a double d. polymers of amino acids
bond by the removal of hydrogen?
a. dehydrogenase b. dehydrolase C 22. Insulin is usually classified as:
c. decarboxylase d. lipase a. protein b. enzyme
c. hormone d. carbohydrates
A 8. The ionic property of amino acid is exhibited by its
a. zwitterions form b. NH2 group A 23. What amount of glucose is present in the human
c. COO group d. positively charged blood?
groups a. 60 to 90 mg in 100 ml blood
b. 5 to 6 g in 100 ml blood
D 9. All of the following are simple proteins except: c. 2% of the total human body weight
a. glutelins b. globulins d. none of these
c. albumins d. glycoproteins
A 24. It is the organelle which serves as the site of the
C 10.The simplest monosaccharide is __________ electron transport chain.
a. erythrose b. starch a. mitochondria b. ribosome
c. glyceraldehydes d. arabinose c. nucleus d. lysosome
C 11. Denaturation of protein is a result of: C 25. The end product of the hydrolysis of glycogen is:
a. cleavage of the peptide bond b. formation of H-bond a. galactose b. fructose
c. breaking of H-bond d. none of these c. glucose d. arabinose
A 12. Competitive inhibition is a ______ reaction C 26. Iodine test is a reaction which may be used to identify
a. reversible b. irreversible carbohydrates. The reaction is due to
c. pH and temperature d. none of these a. presence of the free aldehyde group
b. presence of alcohol group
A 13. In the Seliwanioff’s test, the reaction of resorcinol c. . presence of amylose portion
and acid on the sugar forms d. presence of glucose
a. hydroxymethyl furfural b. pyranose
c. hydrazine d. purine B 27. Benedict’s reagent yield positive result to:
a. monosaccharide only b. reducing sugars
A 14. High concentration of neutral salts causes the c. sucrose d. polysaccharides
precipitation of proteins. This is called _______
a. salting out b. salting in B 28. Hypertonic solutions will cause the cell to:
c. coagulation d. both b and c a. swell b. shrink
c. burst d. undergo hemolysis
A 15. The type of enzyme inhibition reaction whereby the
inhibitor competes with the substrate at the active site: A 29. Rancidity of fats maybe due to :
a. competitive inhibition a. oxidation b. hydrogenation
b. noncompetitive inhibition c. saponification d. condensation
C 45. The gland or tissue that regulates the blood glucose
C 30. The deficiency of this hormone causes diabetes level:
mellitus: a. parathyroid b. thyroid
a. progesterone b. testosterone c. pancreas d. adrenal
c. insulin d. glucagons
D 46. Which vitamin is formed in the body by exposure to
A 31. The active proteolytic enzyme in gastric juice is: ultraviolet irradiation or sunlight?
a. pepsin b. trypsin a. vitamin A b. vitamin B
c. maltase d. catalase c. Vitamin C d. vitamin D
B 32. The site of oxidation reaction in electron transport C 47. Excess vitamin A and D is stored in the body, but
chain is in the excess vitamin B and C is readily excreted. What
a. nucleus b. mitochondrion property shows this?
c. ribosome d. golgi bodies a. vit. C and B are water-soluble
b. vit. A and D are fat –soluble
B 33. Protein digestion starts in the c. both a and b
a. mouth b. stomach d. none of these
c. intestine d. pancreas
A 48. It is the entire genetic make up of an organism
A 34. The conversion of an amino acid to sugar is: a. gene b. anticodon
a. gluconeogenesis b. glycolysis c. codon d. mutation
c. glycogenesis d. glycogenolysis
B 49. The vitamin which is used in the prevention of
B 35. Which of the following is not an amino acid? degenerative changes in the central nervous system:
a. leucine b. choline a. vit. A b. vit. B complex
c. valine d. glycine c. vit. C d. vit. D
A 36. The protein part of the enzyme molecule is the:

a. apoenzyme b. coenzyme A 50. It is a model which best explains the enzyme-
c. cofactor d. holoenzyme substrate action:
a. lock and key b. molecular
C 37. Optimum temperature for enzyme activity in the c. VSEPR d. Kreb
body:
a. 40oC b. 60oC D 51. The activation of pepsinogen requires:
c. 37oC d. 10oC a. pepsin b. NaOH
c. enterokinase d. HCl
B 38. Glucose is stored in the liver as:
a. galactose b. glycogen B 52. DNA is primarily found in the
c. lactose d. fructose a. cytosol b. nucleus/mitochondria
c. cell wall d. endoplasmic reticulum
B 39. The enzyme conformation adapts to the incoming
substrate in B 53. It is the enzyme which hydrolyzes starch to dextrin
a. Lock and Key theory and maltose:
b. Induced fit theory a. catalase b. amylase
c. competitive inhibition c. pepsin d. lactase
d. noncompetitive inhibition
D 54. A synthetic DNA is called
B 40. The process of converting glucose into glycogen is a. replicated DNA b. plasmid
called: c. Gene d. recombinant DNA
a. gluconeogenesis b. glycogenesis
c. glycolysis d. glycogenolysis B 55. Hydrolysis of ATP is an
a. energy requiring reaction b. energy producing
A 41. All are pyrimidine bases except: reaction
a. guanine b. cytosine c. no energy is involved d. energy is absorbed
c. uracil d. thymine
C 56. Which of the following is a characteristic of lipid?
B 42. Glucose, amino acid and fatty acid enter the citric acid a. zwitterions b. amphiphilic
cycle by their conversion into: c. hydrophobic d. hydrophilic
a. pyruvate b. acetyl CoA
c. acetoacetyl CoA d. palmitic acid A 57. It is a condition that results when sugar level is below
normal
A 43. A hormone which stimulates glycogenesis: a. hypoglycemia b. hyperglycemia
a. insulin b. glucagons c. ketonuria d. uremia
c. epinephrine d. vasopressin
A 58. An example of globular protein
A 44. Chemicals extracted from organism such as bacteria a. albumin b. collagen
and can inhibit growth or destroy other microorganism: c. fibrin d. silk
a. antibiotic b. enzyme
c. hormone d. vitamins A 59. Complementary base pairs in the DNA double helix
are bonded by
a. H-bond b. ester bond a. Grignard’s b. Xanthoproteic
c. Van der Waals d. dipole- dipole c. Millon-Nasse d. Sakaguchi
C 60. Which nitrogen base is not found in DNA? A 76. The condition that lowers the pH of the blood due to
a. thymine b. cytosine starvation is called
c. uracil d. guanine a. acidosis b. alkalosis
c. hyperglycemia d. glycosuria
C 61. An organic cofactor in an enzyme
a. vitamins b. coenzymes B 77. The substance responsible for the emulsion of fats is:
c. a and b d. none of these a. HCl b. bile acids
c. pepsin d. trypsin
B 62. At what stage of glucose oxidation is most of the
energy produced? B 78. Hubl’s solution if used to ascertain degree of:
a. glycolysis b. aerobic stage a. saturation b. unsaturation
c. glycogenesis d. glygenolysis c. peroxidation d. acidity
D 63. The best known building blocks of RNA and DNA B 79. IUPAC name of acrolein:
are: a. pentenal b. propenal
a. purines b. pyrimidines c. hexanal d. acetone
c. fatty acids d. a and b
C 80. The positive indication for the presence of glycerol in
C 64. It is responsible for the storage and transmission of acrolein test:
genetic information a. yellow colored solution
a. adenine b. RNA b. black markings in filter paper
c. DNA d. nucleic acid c. silver mirror formed in the test tube
d. play of colors from blue to shades of red
C 65. Build up of urea in the kidney is called
a. ketonuria b. glycemia B 81. Cerebrosides are positive in the following tests,
c. uremia d. all of these except:
a. Molisch b. Biuret
A 66. The transfer of genetic information from DNA by the c. Lassaigne’s d. none of the above
formation of mRNA
a. transcription b. translation B 82. Osmic test is used to detect the presence of ____ in
c. trans-amination d. replication lipids:
a. metals b. prostate groups
D 67. What is the end product of electron transport chain? c. unsaturated groups d. glycerol
a. oxygen b. hydrogen
c. carbon dioxide d. water A 83. The most sensitive chemical test to detect the
presence of cholesterol:
B 68. The energy producing reaction a. Liebermann-Burchard
a. metabolic b. catabolic b. Salkowski reaction
c. anabolic d. all of these c. Formaldehyde-sulkfuric acid
d. Colorimetric spectrophotometry
A 69. It is the molecule that directs the activity of the cells
a. DNA b. RNA D 84. The following are phopholipids, except:
c. nucleoproteins d. hormones a. plasmalogen b. lecithin
c. cephalin d. choline
C 70. The sugar involved in DNA
a. ribose b. pentose C 85. A mixed triglyceride contains:
c. deoxyribose d. xylose a. three similar fatty acids esterified with glycerol
b. two similar fatty acids esterified with glycerol
C 71. The common metabolic pathway is c. three different fatty acids esterified with glycerol
a. glycolysis b. beta oxidation d. all of the above choices
c. Kreb’s cycle d. glucogenesis
B 86. The central compound found in the structure of
B 72. Rosenheim’s test is used to detect the presence of: sphingolipids:
a. ethanolamine b. choline a. glycerol b. sphingosine
c. cholesterol d. glycone moiety c. ceramide d. phosphocholine
C 73. Detects the presence of alpha amino acids: A 87. Lipid whose specific test is the Furter-Meyer test:
a. Biuret b. Molisch a. tocopherol b. retinal
c. Ninhydrin d. Hopkins-cole c. sphingomyelin d. cerebroside
B 74. The process of producing fats from acetyl Co-A is A 88. Precipitate of _____ indicates the presence of
called: phospholipids in the lipid sample:
a. glycolysis b. lipogenesis a. ammonium phosphomolybdate
c. glycogenolysis d. glucogenesis b. phosphorus periodate
c. phosphorus triiodide
A 75. The following are test reagents to detect the presence d. phospho-ammonium sulfate complex
of amino acids, except:
B 89. The following are glycolipids, except:
a. globosides b. phosphatides a. anomers b. epimers
c. gangliosides d. cerebrosides c. geometric isomers d. allosteres
B 90. The parent compound of phospholipids: B 105. The complementary strand of

a. glycerol b. phosphatidic acid CGACCTTGATCGACGTCGA:
c. ethanolamine d. none of the above a. TCGTTCCAGCTAGTAACTAG
b. GCTGGAACTAGCTGCAGCT
D 91. A non-pentose sugar which is also positive for c. AGCAAGGTCGATCATGATC
Tollen’s phloroglucinol test: d. ATCAAGGTCGATCATGATC
a. galactose b. glucose
c. fructose d. cellobiose C 106. Alkaline bismuth reagent is used to detect the
presence of:
C 92. The reagent present in Molisch test which is a. polysaccharides b. disaccharides
responsible for the dehydration reaction: c. reducing sugars d. glycitols
a. sodium canbonate b. magnesiumstearate
c. sulfuric acid d. NaOH D 107. Action of dilute alkali on sugars:
a. dehydration b. hyperconjunction
C 93. ID test to detect the presence of glycogen: c. hydrolysis d. tautomerization
a. phloroglucinol b. molisch
c. iodine d. seliwanoff A 108. The following are the components of DNA
nucleosides, except:
C 94. The only sugar readily forms insoluble osazone a. phosphoric acid b. sugar
crystals: c. adenine d. cytosine
a. lactose b. sucrose
c. mannose d. sucrose A 109. Central dogma concept wherein the RNA molecule
is used as template for the synthesis of DNA molecule:
D 95. Important structural material found in the a. transcription b. translation
exoskeletons of many lower animals: c. mutation d. none of the above
a. chnondroitin b. heparin
c. hyaluronic acid d. chitin D 110. The following proteins are present in egg white,
except:
B 96. Hydrolysis of osazones produce: a. ovomucin b. ovoglobulin
a. phenylhydrazones b. ozones c. albumin d. osseomucoid
c. sugars d. none of the above
C 111. Anaerobic glycolysis occurs in the:
C 97. General term for a group of polysaccharides present a. nucleus b. mitochondria
on the primary cell wall: c. cytoplasm d. lysosomes
a. xanthan b. mucilage
c. pectin d. carageenan D 112. Ketogenic amino acids:
a. leucine b. tyrosine
C 98. Specific test for galactose, due to the formation of c. phenylalamine d. all of the above
highly insoluble crystals:
a. phenylhydrazine test b. fermentation B 113. Osazone test is also known as:
c. mucic acid d. molisch a. Nylander’s test b. Kowarsky test
c. Trommer’s test d. Folin’s test
A 99. Type of RNA which serves as template for the amino
acid sequence being synthesized: A 114. Genetic defect characterized by mental retardation
a. mRNA b. tRNA and cataract, since the unmetabolized sugar is toxic to
c. rRnNA d. none of the above the
lens of the eyes:
a. galactosemia b. fructosemia
B 100. Positive indication for Anthrone test: c. pentosuria d. fructosuria
a. purple ring b. blue-green color
c. effervescence d. yellow ppt D 115. Body functions of lipids:
a. transformation into proteins and carbohydrates
B 101. Differentiating test between helical and linear b. catabolism to provide body with heat and energy
polysaccharides: c. nsulation and paddings for organs
a. Molisch b. iodine d. all of the above
c. Schweitzer d. fermentation
C 102. The difference between Benedict’s and Barfoed’s B 116. Pyridoxine is a compound of this enzyme:
test reagent lies in: a. enolase b. decarboxylase
a. sequestering agent used c. hydrogenase d. isomerase
b. active component used
c. pH of the solution B 117. The following are neutral amino acids, except:
d. alkali used a. methionine b. lysine
c. threonine d. leucine
C 103. Hydrolytic product of chitin:
a. iduronatet b. acetylgalactosamine A 118. In man, the principal end product of protein
c. acetylglucosamine d. glucuronic acid metabolism is:
a. uric acid b. lactic acid
C 104. Glucose and fructose are: c. pyruvic acid d. urea
B 119. Condition wherein acetone accumulates in the
blood: B 136. Presence of glucose in appreciable amounts in the
a. ketosuria b. ketonemia urine:
c. ketosis d. ketonuria a. Hematuria b. glycosuria
c. glycosemia d. albuminuria
B 120. Glutamine is a _____ amino acid :
a. neutral b. basic D 137. The following are the tests for kidney efficiency,
c. acidic d. racemin except:
a. phenylsulfophthelein test b. urea clearance test
B 121. Oxidation product of ketone bodies: c. water output test d. crystallization
a. reduced sugars b. carbon dioxide method
c. alcohols d. aldehydes
B 138. Growth hormone is also known as:
C 122. Phosphoprotein found in egg yolk: a. thyrotropic hormone b. somatotropin
a. ovocasein b. tendomucoid c. gonadotropin d. interstitial
c. vitelin d. avidin stimulating hormone
C 123. Amino acids positive for Sakaguchi reaction: A 139. What is the anti-codon in tRNA that corresponds to
a. gelatin b. alanine the codon ACG in mRNA?
c. arginine d. tyrosine a. UGC
b. TGC
B 124. Histidine is negative for: c. GCA
a. Pauly reaction b. Sodium Nitroprusside d. CGU
c. Ninhydrine d. Xanthoproteic
A 140. Condition wherein bile pigment is present in excess
C 125. An official simple protein obtained from corn: in the blood:
a. glutelion b. gliadin a. jaundice b. hepatitis
c. zein d. maize c. cirrhosis d. cystic fibrosis
C 126. Principle involved in the isolation of casein milk:
a. salting in b. salting out B 141. The following are non-essential amino acids, except:
c. isoelectric precipitation d. none of the above a. glycine b. leucine
c. cysteine d. glutamine
A 127. Process of converting liver glycogen into blood
glucose:
a. glycogenolysis b. gluconeogenesis B 142. Principal digestive constituent of the gastric juice:
c. glycolysis d. glycogenesis a. trypsin b. pepsin
B 128. Genetic information is stored and carried in all cells c. gastrin d. enterokinase
by:
a. single-stranded DNA c. double-stranded RNA B 143. Condition wherein the concentration of uric acid
b. double-stranded DNA d. single-stranded circular DNA accumulates in blood reaches as high as 15 mg. Percent:
a. leukemia b. gout
B 129. Principal site for the synthesis of urea: c. murexia d. any of the above
a. kidney b. liver
c. spleen d. intestinal mucosa C 144. The study of the composition and the chemical
processes occurring in the living matter is:
C 130. Pentose present in gum Arabic: a.qualitative chemistry
a. xylose b. ribose b. organic chemistry
c. arabinose d. threose c biochemistry
d. quantitative chemistry
C 131. Which of the following is responsible for the e. inorganic chemistry
transfer of genetic information?
a. ATP b. GTP A 145. What is wobble?
a. the ability of certain anticodons to pair with codons that
c. DNA d. RNA differ at the third base
b. an error in translation induced by streptomycin
C 132. Only form of inorganic nitrogen which can be c. a mechanism that allows for a peptide extension in the 50S
utilized by living cells: sub-unit of the ribosome
a. urea b. ornithine d. thermal motions leading to local denaturation of the DNA
c. ammonia d. nitrogen gas double helix
A 133. The following are essential amino acids, except: C 146. The most important function of HCl in the stomach
a. tyrosine b. lysine is:
c. methionine d. arginine a. hydrolysis of protein
b. neutralization of chyme
C 134. The chief end product of purine metabolism in man: c. activation of pepsinogen
a. CO b. urea d. destruction of bacteria
c. uric acid d. ammonia e. stimulation of pancreatic secretion
D 135. The principal end product of protein metabolism:

a. carbon dioxide b. ammonia C 147. Transamination is:
c. hippuric acid d. urea a. conversion of amino acid to hydroxy acid
b. loss of ammonia from amino acid
c. conversion of amino acids to keto acids C 162. Which of the following amino acids has a net
d. formation of ammonium salt from ammonia positive charge at physiologic pH?
a. cysteine b. glutamic acid
A 148. The lipid that is converted to Vitamin D12 upon c. lysine d. valine
irradiation:
a. ergosterol b. glycerol D 163. Sickle cell anemia is the clinical manifestation of
c. cholesterol d. all of the above homozygous genes for an abnormal hemoglobin molecule.
The mutational event responsible for the mutation in the
A 149. The metabolic degradation of hemoglobin takes beta chain is:
place principally in: a. crossing over b. insertion
a. the reticuloendothilial system c. the white blood cells c. deletion d. point mutation
b. the red blood cells d. the liver cell
C 164. When starches are heated , they produce:
C 150. The amino acid that is an important precursor of a. sugars b. glycogen
hemoglobin is: c. dextrins d. disaccharides
a. alanine b. proline
c. glycine d. cysteine B 165. Check the incorrect statement:
a. ribose is an aldopentose c. galactose is an aldohexose
C 151. Serine is converted to ethanolamine by the removal b. maltose is a ketohexose d. glucose is an aldohexose
of:
a. oxygen b. ammonia A 166. The reducing property of sugars is due to this group:
c. carbon dioxide d. a carboxyl group a. aldehyde b. nitro
c. carboxyl d. methyl
C 152. Ninhydrin gives a blue coloration with:
a. proteins b. carbohydrates D 167. The monosaccharide most rapidly absorbed from the
c. amino acids d. simple sugars small intestine is:
a. glucose b. fructose
A 153. Which is the monomer unit of proteins? c. mannose d. galactose
a. amino acid b. monosaccharide
c. fatty acid d. purine C 168. A condition known as atherosclerosis results as an
accumulation in the blood vessels of
A 154. The proteinase that is found mostly in gastric juice a. calcium b. pathogens
of young animals: c. cholesterol d. ketones
a. rennin c. steapsin e. none of the above
b. pepsin d. ptyalin C 169. Ketoses can be differentiated from aldoses by this
test:
B 155. Conjugated proteins which are a combination of a. Molisch’s test b. Benedict’s test
amino acids and carbohydrates: c. Seliwanoff’s test d. Tollen’s test
a. nucleoproteins
b. glycoproteins C 170. The clinical test for the determination of cholesterol:
c. phosphoproteins a. Liebermann-Burchard b. Salkowski
d. chromoproteins c. both a and b d. none of the above
A 156. Gamma decarboxylation of aspartic acid produces: C 171. Concentrated dehydrating acids change
a. alanine b. asparagines monosaccharides to:
c. glutamic acid d. glycine a. simple sugars b. saccharic acids
c. furfurals d. uronic acids
B 157. Rotation of polarized light is caused by solutions of e. aldaric acids
all of the following amino acids, except:
a. alanine b. glycine C 172. A mucopolysaccharide which possesses an
c. leucine d. valine anticoagulant property:
a. pectin b. hyaluronic acid
A 158. It is a disease due to protein deficiency: c. heparin d. chitin
a. Kwashiorkor b. diabetes e. chondroitin sulfate
c. albuminuria d. jaundice
A 173. Which of the following is the test for reducing
C 159. Which of the following amino acids is not essential sugars for urine?
in mammals? a. Benedict’s test b. acrolein test
a. phenylaline b. lysine c. Biuret test d. Brown Ring test
c. tyrosine d. methionine
B 174. Lactose can be differentiated from fructose by:
D 160. The following are examples of chromopretien, a. Mucic acid test b. Barfoed’s test
except: c. Fehling’s test d. Iodine test
a. chlorophyll b. hemoglobin e. Tollen’s test
c. cytochromes d. heparin
B 175. Polymers that are responsible for the metabolic
D 161. For the amino acid cysteine, choose the appropriate capabilities and morphology of organisms are:
description of its side chain: a. carbohydrates b. proteins
a. acidic b. basic c. polysaccharides d. nucleic acid
c. aromatic d. sulfur-containing
B 176. The product obtained from the partial hydrolysis of a. fibrinogen b. plasma
collagen: c. serum d. thrombin
a. myosin b. gelatin e. none of the above
c. actin d. fibrinogen
e. thrombin C 191. Glycolipids found in high concentrations in the brain
and nerve cells especially in the myelin sheath:
B 177. The main carbohydrate of the blood is: a. lecithin b. cephalins
a. D-fructose b. D-glucose c. cerebrosides d. sphingolipids
c. mannitol d. sorbitol
A 192. Alcohol in the body is :
B 178. A normal value of glucose in the blood: a. oxidized to CO2 and HOH c. excreted by kidneys
a. 100 to 200 mg% b. 80–120 mg% b. excreted mainly by lungs d. excreted by large
c. 50–75 mg% d. 200–300 mg% intestine
B 179. Butter becomes rancid upon exposure to air due to C 193. Which of the following tissues contains the enzyme
formation of: glucose-6-phosphatase and is able to supply glucose to
a. acetic acid b. butyric acid the blood?
c. formic acid d. propionic acid a. heart b. brain
c. liver d. none of the above
C 180. The cholesterol molecule is:
a. an aromatic ring b. a straight chain acid D 194. Complete digestion of all foodstuffs occurs in the :
c. a steroid d. A tocopherol a. large intestine b. stomach c. mouth
d. small intestine e. pancreas
C 181. Which of the following is a phospholipid?
a. glycogen b. prostaglandin B 195. This compound is not a normal constituent of urine:
c. sphingomyelin d. oleic acid a. sodium chloride b. albumin
c. urea d. uric acid
C 182. The passage of the end products of digestion from
the small intestine into the blood stream: A 196. Decomposition of carbohydrates brought about by
a. metabolism b. digestion the action of enzymes liberating ethyl alcohol and CO2:
c. absorption d. oxidation a. fermentation b. adsorption
e. reduction c. detoxification d. hydrolysis
e. saponification
A 183. Endocrine gland that is a small oval body situated at
the base of the brain: C 197. Blood clotting can be prevented by:
a. hypophysis b. pancreas a. sodium chloride b. potassium chloride
c. adrenal d. none of the above c. sodium citrate
A 184. Cellular elements of the blood devoid of nucleus: D 198. This hormone elevates blood sugar concentration:
a. RBC b. WBC a. insulin b. progesterone
c. thrombocytes d. all of the above c. estrogen d. glucagons
B 199. Deficiency in this vitamin causes red blood cell
C 185. Is the sum total of all activities directed towards the fragility:
maintenance of life: a. vitamin A b. vitamin K
a. catabolism b. anabolism c. Vitamin D d. vitamin E
c. metabolism d. photosynthesis
e. fermentation C 200. The end-product in the hydrolysis of glycogen is:
a. galactose b. mannose
C 186. This substance accumulates in the muscles as a c. glucose d. arabinose
result of vigorous exercise:
a. muscle glycogen b. amino acids A 201. In which form is glucose stored in the liver?
c. lactic acid d. glucose a. glycogen b. glucose (unchanged)
c. sucrose d. starch
B 187. A common intermediate of metabolism of
carbohydrates, fatty acids and amino acids is: B 202. Which of the following is NOT an ID test for
a. glycerol b. acetyl CoA proteins and amino acids?
c. acetoacetate d. oxaloacetate a. Ninhydrin b. Bial’s
e. acetylcholine c. Biuret d. Xanthoproteic
B 188. The principal site of glucose production in the D 203. What vitamin deficiency causes pellagra?
human body is the : a. riboflavin b. thiamin
a. blood b. liver c. pantothenic acid d. nicotinic acid
c. pituitary gland d. small intestine
D 204. All are pyrimidine base, except:
A 189. The major buffer of the extracellular fluid: a. cytosine b. thymine
a. bicarbonate-carbon dioxide b. amino acids c. uracil d. guanine
c. phosphate d. none of the above
B 205. The sugar that yields only glucose when hydrolyzed
C 190. Separates from cells when blood is coagulated: is:
a. galactose b. maltose
c. fructose d. sucrose
A 222. Which of the following supplies the highest amount
D 206. Which is not a B-complex vitamin? of energy per gram?
a. folic acid b. nicotinic acid a. fat b. glycogen
c. riboflavin d. ascorbic acid c. protein d. starch
A 207. The following sugars are aldohexoses except: A 223. The following are proteins in milk, except:
a. fructose b. galactose a. rennin b. casein
c. glucose d. mannose c. lactoalbumin d. lactoglobulin
D 208. All the amino acid below contain sulfur, except: A 224. The conversion of beta carotene to vitamin A is
a. cystine b. methionine carried out in the:
c. cysteine d. glycine a. liver b. small intestine
c. lungs d. pancreas
A 209. The following are essential fatty acids, except:
a. oleic acid b. linoleic acid A 225. This sugar is also called an “invert sugar”:
c. linolenic acid d. arachidonic acid a. sucrose b. fructose
c. glucose d. galactose
D 210. This test detects the presence of two or more peptide
bonds: A 226. What type of sugar is found in nucleic acids?
a. Ninhydrin b. Fehling’s a. riboses b. glucoses
c. Tollen’s d. Biuret c. mannoses d. galactoses
B 211. This vitamin easily undergoes oxidation: D 227. The biochemical function of hemoglobin is:
a. vitamin A b. vitamin C a. defense b. regulatory
c. vitamin B12 d. vitamin B1 c. structural d. oxygen transport
B 212. The end product of anaerobic glucose metabolism is: C 228. The following enzymes catalyze hydrolysis
a. pyruvate b. lactate reactions, except:
c. carbon dioxide d. water a. proteases b. esterases
c. transaminases d. nucleases
A 213. The inactive form of an enzyme is sometimes called:
a. zymogen b. holoenzyme C 229. Porphyrins are involved in the building of:
c. apoenzyme d. coenzyme a. bones b. muscles
c. blood d. connective tissue
D 214. Photosynthesis is a process involved in the
manufacture of: B 230. Which among the following sugar is sweetest?
a. carbohydrates b. fats a. glucose b. fructose
c. proteins d. all of the above c. sucrose d. galactose
B 215. The major extracellular cation is: A 231. Information and control centers of the cell:
a. potassium b. sodium a. nucleoproteins b. enzymes
c. calcium d. iron c. carbohydrates d. lipids
B 216. Which sugar will not give a red precipitate with A 232. Hydrolysis of nucleoproteins will yield:
cupric oxide when heated with Benedict’s solution? a. Nucleic acids and histones
a. glucose b. sucrose c. nucleic acid and purines
c. maltose d. fructose b. nucleic acid and sugar
d. nucleic acid and pyrimidines
A 217. Night blindness is a symptom of a deficiency in this
vitamin: C 233. The condition wherein protein is found in the urine
a. vitamin A b. vitamin C is:
c. vitamin B d. vitamin D a. glycosuria b. ketonuria
c. proteinuria d. dysuria
D 218. The activation of pepsinogen requires:
a. NaOH b. bicarbonate A 234. Alpha-hydroxy propionic acid is:
c. acetic acid d. HCl a. lactic acid b. aminoacetic acid
c. ascorbic acid d. pyruvic acid
D 219. Nucleosides upon hydrolysis will yield:
a. adenine + phosphate B 235. This test detects the presence of indole rings:
b. quanine + phosphate a. Molisch b. Hopkin’s cole
c. histones + ribose c. Millon’s d. Ninhydrin
d. cytosine + ribose
C 236. The steps of central states:
C 220. Protein digestion starts in the: a. replication, translation and transcription
a. mouth b. small intestine b. replication, transcription and transmission
c. stomach d. large intestine c. replication, transcription and translation
d. transcription, translation and replication
C 221. Major form of utilizable energy in all cells:
a. ADP b. GDP B 237. Reverse transcription takes place in:
c. ATP d. GTP a. bacteria b. viruses
c. algae d. molds
A 253. Acetyl CoA combines with oxaloacetate to form:
D 238. The number of chromosomes in the human cells is: a. citrate b. carnitine
a. 41 b. 42 c. 43 d. 46 c. acyl-carnitine d. none of the above
A 239. Digestion of starch starts in the : B 254. The proteins that make the fur, wool, claws and
a. mouth b. stomach feathers:
c. small intestine d. large intestine a. collagen b. keratin
c. silk d. none of the above
D 240. The ordered steps in protein synthesis is:
a. transcription, transplantation, activation, elongation B 255. Liquid vegetable oils may be transformed into solid
b. activation, elongation, initiation, termination fats by the process of:
c. initiation, activation, elongation, termination a. oxidation b. hydrogenation
d. activation, initiation, elongation, termination c. substitution d. reduction
D 241. Genetic code is: B 256. The chemical messengers produced by the
a. universal b. composed of 3 nucleotides endocrine glands:
c. continuous d. all are correct a. genes b. hormones
c. vitamins d. enzymes
B 242. Which of the following is called transamination?
a. conversion of amino acids to hydroxy acids A 257. It is the sugar found in milk:
b. conversion of amino acids to keto acids a. lactose b. maltose
c. lose of ammonia from amino acids c. sucrose d. raffinose
d. formation of ammonium salts from ammonia
C 258. Prostaglandins are synthesized from:
A 243. Dextran is: a. oleic b. stearic
a. carbohydrate b. glucose polymer c. essential fatty acid d. non-essential fatty acid
c. glycoside d. protein
C 259. Amino acid at an isoelectric point exists as:
B 244. A genetic disease due to defective mechanism for a. acid b. base
pyrimidine dimmers: c. zwitterions d. none of the above
a. phenyl ketonuria b. xeroderma pigmentosum
c. albinism d. N-glycosyl linkage B 260. The color of the skin, hair and eyes is due to
pigment called:
D 246. The type of RNA molecule that brings amino acids a. cytochrome b. melanin
to the site of protein synthesis is: c. keratin d. heparin
a. rRNA b. aRNA
c. mRNA d. tRNA B 261. Starches are partially digested in the mouth by:
a. protease b. ptyalin
c. pepsionogen d. pepsin
D 247. Most allergies are caused by:
a. Error in the immune system b. histamines produced C 262. The only element in living matter from strong
by the body multiple bonds readily are:
c. dust d. all of the above a. oxygen b. nitrogen
c. carbon d. all of the above
B 248. RNA which plays an important role in the structure
and biosynthetic function of ribosome: A 263. Serotonin, a neurotransmitter, is derived from the
a. mRNA b. rRNA amino acid:
c. tRNA d. DNA a. tryptophan b. threonine
c. tyrosine d. phenylalanine
D 249. In the secondary structure of RNA:
a. adenine will always pair with thymine c .cytosine A 264. Alkaline hydrolysis of fat:
will always pair with uracil; a. saponification b. hydrogenation
b. cytosine will always pair with thymine d. adinine will c. alkalinization d. hydroxylation
always pair with uracil e. all of the above
C 265. The main center of biosynthesis of nucleic acid is

D 250. A nucleic acid is made up of: the:
a. sugar, nucleoside and a base c. nitrogenous a. cell wall b. cytoplasm
base, amino acid and sugar c. nucleus d. none of the above
b. proteins, sugar and a phosphate group d. nitrogenous
base, phosphate and sugar A 266. Normal pH of the blood:
a. 7.4-7.45 b. 6.6-6.9 c. 5.5-6.6 d. 4.8-8
C 251. Bond between 2 amino acids A 267. Known as good cholesterol:

a. glycosidic bond b. N-glycosyl linkage a. HDL b. ergocalciferol
c. peptide bond d. hydrogen bond c. ACTH d. LDL
A 252. Which of the following is not a test for protein? A 268. Blood minus its cellular components:
a. acrolein b. Biuret a. plasma b. serum
c. Millons d. xanthoproteic c. hemoglobin d. fibrin
B 269. Which of the following is not an amino acid: a. aerobic b. anaerobic
a. leucine b. choline c. oxidation d. reduction
c. valine d. lysine
C 288. Compounds of protein with a carbohydrate
A 270. Are globular proteins, except: component:
a. collagen b. serum albumins a. lipoproteins b. phosphoproteins
c. serum globulins d. hemoglobin c. glycoproteins d. nucleoproteins
D 271. The precursor of vitamin A is: D 289. What amino acid functions as a hormone?
a. arachidonic acid b. isoprene a. valine b. leucine
c. naphtoquinone d. carotene c. alanine d. thyroxine
B 272. Are fibrous proteins, except: C 290. The pathway that occurs in the mitochondria:
a. keratin b. histones a. urea cycle b. citric acid cycle
c. elastin d. collagen c. glycolysis d. fatty acid cycle
C 273. A type of antibodies that plays an important role in C 291. Carbohydrates that cannot be hydrolyzed to
allergic response which causes anaphylactic shock, compounds with simpler molecules:
hayfever and asthma: a. oligosaccharides b. disaccharides
a. IgA b. IgM c. IgE d. IgG c. monosaccharides d. polysaccharides
C 274. An inherited disease that affect red blood cells: D 292. In the metabolism of protein, the liver:
a. albinism b. hyperglycemia a. synthesizes amino acids b. breaks down amino acid
c. sickle cell anemia d. hypoglycemia c. absorbs blood d. stores amino acid
D 275. Are esters of fatty acids with glycerol: B 293. What is the stage of glucose oxidation that requires
a. phospholipids b. glycolipids oxygen?
c. waxes d. fats a. anaerobic b. aerobic
c. catabolic d. anabolic
A 276. The metallic salt of a high fatty acid:
a. soap b. detergent c. inorganic salt d. glycerin B 294. An important protein in contractile muscle:
a. keratin b. myosin
A 277. The following are enzymes found in pancreatic c. elastin d. fibrin
juice, except:
a. papain b. trypsin C 295. Which is the main constituent of the group
c. chymotrypsin d. carboxypolypepticase substance in the connective tissue?
a. heparin b. fructosan
C 278. The following are pathological constituents of urine, c. hyaluronic acid d. mannosan
except:
a. glucose b. albumin c. creatinine d. blood C 296. Raffinose, an important non-reducing sugar, is a:
a. monosaccharide b. disaccharide
D 279. All of the following carbohydrates are considered to c. trisaccharide d. tetrasaccharide
be polysaccharide, except:
a. heparin b. starch A 297. Non-protein molecules that are often associated with
c. glycogen d. maltose proteins are called:
a. prosthetic group b. side chain
C 280. Which of the following hormones promotes rapid c. zwitterions d. casein
glycogenolysis in both liver and muscle:
a. ACTH b. glutemine A 298. They are chemical messengers:
c. epinephrine d. prolactin a. hormones b. enzymes
c. vitamins d. amino acids
D 281. Fruity odor of urine is indicative of acetone bodies,
a diagnostic value in case of acidosis in: C 299. It is a polysaccharide:
a. diabetes insipidus b. porphyria a. lactose b. maltose
c. cretinism d. diabetes mellitus c. amylose d. fructose
B 282. Rotation of polarized light is caused by solutions of B 300. Which sugar contains an aldehyde group?
all of the following amino acids, except: a. ketose b. aldose
a. alanine b. glycine c. leucine d. valine c. sorbitol d. mannitol
C 283. The precursor of vitamin D3:

a. ergosterol b. stigmasterol
c. 7-dehydrocholesterol d. cholesterol
B 286. The enzyme present in the stomach which

hydrolyzes proteins:
a. trypsin b. pepsin
c. amylopsin d. enterokinase
B 287. The reaction that takes place in cytoplasm:

BIOCHEMISTRY- PINK B. Genes D. histones
10. Which of the following statements is/ are correct

1. This region in the nucleus is the site of ribosome regarding plasmids.
assembly. I. Plasmids are either DNA or RNA molecules
A. nuclear membrane C. chromatin II. Plamids are found in many types of bacteria
B. nucleolus D. chromosome III. Plasmids replicate independently of the main
chromosome
2. Which of the following cellular structures is unique IV. Each cell contains only a single copy of plasmids
in eukaryotes. A. III only
A. Plasma membrane C. internal cellular B. I and III
membrane C. II and III
B. Ribosomes D .Golgi apparatus D. II and IV
3. These organelles consist of membranous sacs 11. The diversity of the different cell types among
containing powerful oxidase enzyme , and they use various organisms lies in their chemical nature. Which of the
molecular oxygen (O2) to detoxify harmful substances. following pairs is/are accurate?
A. Lysosomes C. peroxisomes A. Bacterial cell membrane- peptidoglycan
B. Golgi apparatus D .mitochondria B. Plant cell wall- cellulose
C. Animal cell membrane-nucleic acid
4. The cellular particles are often referred by their D. None of the above
sedimentation coefficient value, for example, 70s ribosome
that is expressed in terms of 10 seconds. The abbreviation 12. Which of the following is/are true of prions?
stands for A. A prion is an infectious agent that contains both
A. Subunit C. seconds proteins and nucleic acid
B. Svedberg D. none of the above B. The disease bovine spongiform encephalopathy or
mad cow disease is one disease attributed to prions.
5. These are organelles that contain the enzymes for C. Both statement are correct
pyruvate oxidation, citric acid cycle, beta oxidation of fatty D. Both statements are false.
acids, oxidative phosphorylation .and ETC.
A. Golgi apparatus C. nucleus 13. Which of the following structures is/ are present in
B. Lysosomes D. mitochondria the nucleus?
A .nuclear membrane C. all of the above
6. Which of the following is / are true? B. Chromatin D. A and B only
A. The endoplasmic reticulum is a system of fluid filled
cisterns. 14. Which of the following is an active process?
B. The smooth endoplasmic reticulum is responsible A. Transport of molecules through protein pores.
for protein synthesis B. Trans membrane transport through protein pores
C. The rough endoplasmic reticulum is the site of lipid C. Both A and B
synthesis D. None of the above
D. All of the above
15. Which of the following statements differentiate
7. Some organelles are specific to plants or animal simple passive diffusion from facilitated diffusion?
cells . Which of the following organelles are present in plant A. Facilitated diffusion is an active process
cells only? B. Facilitated diffusion is saturable , simple passive
I. Vacuole III. Cell wall diffusion is not
II. Nuclear envelope IV. Lysosomes C. Both statements are correct
A. I only C. II and IV D. None of the above
B. I and II D. I and IV
16. Which of the following is affected by digitalis
8. Viruses are not cellular , but are rather termed as” glycosides and ouabain?
biological entities”. The main reason why viruses are A. Sodium-glucose transport system
considered a cellular entities is because B. CA -Na exchanger
A. A virus contain only one type of nucleic acid, either C. Na-K pump
DNA or RNA. D. All of the above
B. A virus is very small compared to bacteria
C. A virus is pathogenic 17. Which of the following iron is co transported with
D. Scientist cannot classify viruses under the 5 glucose in the small intestine?
kingdoms of Whittaker A. Potassium
B. Sodium
9. Are small , extra chromosomal C. Calcium
circular DNA molecules found in prokaryotes. D. Magnesium
A. Nucleoli C. plasmids
18. The nature of the cell wall of the bacteria is used in B. An error in translation induced by streptomycin
their classification. Which of the following is cross-linked, C. A mechanism that allows for a peptide extension in
multi layered polysaccharide- peptide complex used as the the 50s subunits of the ribosome
basis of gram staining. D. Thermal motions leading to local denaturation of the
A. Peptidoglycan double DNA double helix
B. Teichoic acid
C. Ergo sterol 27. What type of bod connects successive monomer
D. Phospholipids units through a phosphate residue attached to hydroxyl ion
on the 5 carbon of one unit with the 3 hydroxyl of the next?
19. Which of the following is not a biopolymer? A. Hydrogen bond
A. Nucleic acids B. Covalent bond
B. Carbohydrates C. Phosphodiester bond
C. Amino acids D. None of the above
D. Lipids
28. Which of the following groups is responsible for the
20. Which of the following statements is/ are correct. acidic character of nucleic acids?
A. Adenine is nucleoside A. Phosphate group
B. Adenosine is a nucleotide B. Nucleotides
C. Nucleotides are also known as nucleosides C. Both A and B
phosphates D. None of the above, nucleic acid is a misnomer.
D. All of the above Nucleic acids are not acidic
21. Which of the following is/ are found in the 29. Which of the following are purine bases?
cytoplasm? A. Adenine and Thymine
A. Cytosol B. Adenine and guanine
B. Inclusions C. Cytosine and thymine
C. Mitochondrion D. Cytosine and uracil
D. All of the above
E. A and B only 30. Which of the following nitrogenous bases is present
only in DNA?
22. Which of the following is a nucleoside? A. Adenine
A. Guanine B. Thymine
B. Guano sine C. Cytosine
C. guano sine monophosphate D. Uracil
D. Any of the above
31. Which of the following base pairs is boned by a
23. Which carbon in the sugar is responsible for the double bond?
difference between the two nucleic acids. A. Adenine and thymine
A. Carbon-1 B. Cytosine and guanine
B. Carbon-2 C. Adenine and guanine
C. Carbon-3 D. Cytosine and thymine
D. None of the above
32. How many hydrogen bonds are formed between
24. Which of the following statements is/are true cytosine and guanine?
regarding nucleic acid primary structure? A. One
A. DNA contains thymine, while RNA contains uracil B. Two
B. Adenine and guanine are pyridines C. Three
C. Uracil is purine D. No hydrogen bonds are found between them
D. All of the above
E. Only A and B 33. The DNA structure is a double helix containing
chains which are complementary. Which of the following
25. The ribosome in RNA is converted to deoxyribose in statements best describes complementary?
DNA by replacing the in RNA A. In the chains, each end of the helix contains 5 of
with . one strand and the 3 end of the other
B. Adenine binds to thymine, and cytosine binds to
A. Hydroxyl group, hydrogen guanine
B. Hydrogen, hydroxyl group C. Several codons may code for the same amino acid
C. Oxygen, hydroxyl group D. All of the above
D. Hydroxyl group, oxygen
34. Each end of the DNA double helix contains the 5
26. What is wobble? ends of one strand and the 3 end of the other stand , this
A. The ability of certain anticodons to pair with codons statement describes what characteristic of the DNA
that differ at the third base structures?
A. Complementary B. Transcription
B. Antiparallel C. Complementary of base pairing
C. Semiconservative replications D. Semiconservative replication
D. Base pairing
43. Which of the following is correct according to
35. What do you call the bond between the 1 carbon of Watson –crick model for DNA?
the sugar and the base nitrogen? 1. DNA consist of a two strands
A. Hydrogen bond 2. Pairing is A- T and G-C
B. Covalent bond 3. The primary structure of nucleic acids is composed
C. Phosphodiester bond of a double helix stabilized by H- bonds.
D. Glycosidic bond 4. The chains were complementary and parallel
A. 3 only
36. Which of the following statements is correct? B. 1 and 2
A. Some nucleic acid bases are capable of C. 1, 2 and 3
tautomerization D. 1, 2 and 4
B. All enzymes are proteins
C. Both statements A and B 44. The following base pairs form a minor groove?
D. Both statements are incorrect. A. Cytosine –guanine
B. Adenine- thymine
37. Which of the following statements best describes C. Adenine-uracil
pyrimidine bases? D. A and B only
A. They have a 5- membered membrane structure
B. They have a 6 membered membrane structure 45. These are discontinuous stretches in which lagging
C. Adenine and guanine are pyrimidine bases strand is initially synthesized during DN A replication.
D. Some examples include caffeine, theophylline and A. Enhancer
theobromine B. Operon
C. Okazaki fragments
38. The primary difference between nucleoside and D. Primer
nucleotides is the presence of phosphate group in the former
, this statement is; 46. A short piece of nucleic acid (DNA or RNA ) , base
A. True paired with a DNA template strand and provide free 3- OH
B. False end from which DNA polymerase can extend a DNA strand.
A. Enhancer
39. Which of the following best describes the B. Operon
degeneracy of the genetic code? C. Okazaki fragments
A. 1 codon =1 amino acid D. Primer
B. 1 codon =6 amino acid
C. 6 codon=1 amino acid 47. DNA polymerase type has a 5’ to 3’
D. None of the above polymerase and 3’ to 5’ proofreading exonuclease activity.
A. I
40. Deoxyribonucleic acid is a double stranded B. II
polynucleotide. The base content of DNA displays three sets C. III
of equivalent pairs. Which of the following equations are D. IV
true?
1 .A=T 3. A+ G= T+ C 48. This DNA polymerase I s primarily involved in
2. C=G 4. A+ G is not always equal to T+ repairing DNA.
C A. DNA polymerase I
A. 3 only B. DNA polymerase II
B. 1 and 2 C. DNA polymerase III
C. 1, 2 and 3 D. DNA polymerase IV
D. 1, 2 and 4
49. Which of the following statements is/ are true
41. Which of the following is the most form of DNA? regarding the secondary structure of nucleic acids?
A. A-DNA A. Guanine forms base pairs with adenine via 2
B. B-DNA hydrogen bonds
C. Z-DNA B. The B form of the DNA is the most common in
D. All of the following occur in the same frequency in biological systems
nature C. The breaking of H-bonds caused by high
temperature is called melting
42. When the two strands of the DNA double helix are D. A and B
separated , each strand can serve as a template for the E. B and C
replication of the new complementary strand. This describes
A. DNA replication
50. What is the sequence of the major events in DNA B. Transversional
replication? C. Insertion
1. DNA ligase joins fragments of the lagging strands, D. Frame shift
creating a single DNA molecule.
2. DNA polymerase at the replication fork synthesize 58. Which of the following is /are mutations?
DNA in 5’ to 3’ direction. There are two strands, the leading A. Insertion
and the lagging strands. B. Deletion
3. DNA double helix is opened by helicases C. Transition
4. primase creates a temporary RNA D. All of the above
5. DNA polymerase removes RNA primer and fills the E. Only A and B
gaps between the Okazaki fragments.
A. 1-3-5-4-2 59. This mutagenic substance is obtained from smoking
B. 3-4-2-5-1 cigarettes. It intercalates with DNA and causes frame shifts..
C. 1-2-5-4-3 A. Tar
D. 4-3-2-5-1 B. Nicotine
C. Coal
51. This is a rare human disorder, which progresses to D. Benzopyrine
photosensitivity, caused by an inherited excinuclease
deficiency. 60. This refers to the noncoding regions that alternate
A. Xeroderma pigmentosa with coding regions in the polypeptide sequence.
B. Bloom’s syndrome A. Exons
C. Fanconi’s anemia B. Promoters
D. Hodgkin’s lymphoma C. Introns
D. Repressor
52. Alkylating agents are used in the treatment of
Hodgkin’s disease and leukemia’s. Their main mechanism 61. This DNA duplex has a special left handed- helical
of action is to alkylate this nitrogenous base. structure.
A. Adenine A. A-DNA
B. Cytosine B. B-DNA
C. Guanine C. Z-DNA
D. Thymine D. F-DNA
53. These chemotherapeutic agent binds to bacterial 62. Which of the following best describes the
RNA polymerase mechanism of action of Dactinomycin ( actinomycin D )
A. Pyrazinamide A. Bind to bacterial DNA polymerase
B. Actinomycin B. Binds to 30s subunits
C. Bleomycin C. Binds to 50s subunits
D. Rifampicin D. Intercalates with the minor groove of the double
helix
54. Which of the following is/ are true?
A. RNA polymerase, unlike DNA polymerase does not 63. 2- aminopyrine is no longer used clinically. It has
require primer been found to replace adenine ( 6- aminopurine )or guanine
B. DNA polymerase is a nuclease in DNA resulting to bone marrow toxicity , 2 Aminopyrine
C. RNA polymerase is a nuclease exhibit what type of mutation?
D. All of the above A. Transitional
E. Only A and B are correct B. Transversional
C. Frameshift
55. Which of the following is a codon of methionine? D. deletion
A. UAG
B. AUG 64. Which of the following is /are true regarding the
C. UGA central dogma of molecular biology?
D. UAA A. Transcription in the synthesis of RNA and DNA
B. The process of replication produces new RNA
56. This DNA mutations occur when a purine preplaces C. Reverse transcription is impossible
a pyrimidine or vice versa. D. All of the above
A. Transitional
B. Transversional 65. Actinomycin D, an antineoplastic drug intercalates
C. Insertion between two GC pairs in DNA. Which of the following
D. Frame shift processes does it inhibit.
A. Translation
57. The purine replaces another purine in B. Transcription
mutations. C. DNA repair
A. Transitional D. Replication
B. Missense mutation
66. Tumor producing RNA viruses synthesize DNA from C. Silent mutation
RNA in the process called . D. Any of the above
A. Transcription
B. Reverse transcription 75. Glutamine and asparagine amino acids are
C. DNA repair A. Acidic
D. Replication B. Basic
C. Neutral
67. This enzyme is responsible for removing the RNA D. Non polar
primer on DNA.
A. Excinuclease 76. Which Statement is true?
B. DNA ligase A. Cysteine is dimer of cysteine
C. RNA polymerase B. Cysteine is more stable then cysteine
D. DNA polymerase C. Both statements are correct
D. Bothe statement are false
68. Which of the following pairs is an accurate pairing of
the organism and its start codon? 77. Which of the following amino acids contains basic
A. Eukaryote- formylmethionine side chain?
B. Prokaryote- methionine A. Histidine
C. Eukaryote- methionine B. Arginine
D. None of the above C. Leucine
D. All of the above
69. Human catabolize purine to E. Only A and B
A. Urea
B. Uric acid 78. Which of the following amino acids contain side
C. Allantoin chains with sulfur atom?
D. Both B and C A. Methionine
B. Cysteine
70. This refers to the set of prokaryotic structural genes, C. Both A and B
which are transcribed as a unit, along with regulatory D. Neither A or B
elements controlling their expression.
A. Operon 79. Which of the following amino acids is responsible
B. Operator for disrupting the alpha helix because its amino group is not
C. Inducer geometrically compatible with the right handed spiral alpha
D. Repressor helix?
A. Proline
71. When the serum urate levels exceed to solubility B. Valine
limit, the crystals of sodium urate accumulate in soft tissue C. Leucine
and joints and causes an inflammatory reaction known as D. Glycine
A. Lesch nyhan syndrome
B. Osteomalacia 80. Which of the following amino acids has an imino
C. Gouty arthritis group?
D. Von Gierke’s disease A. Phenylalanine
B. Proline
72. Which of the following statements about amino acid C. Tyrosine
is true? D. Threonine
A. Acidic Amino acid bear a positive charge at pH 7.0
B. All amino acid have a chiral carbon 81. Which of the following amino acids possesses a
C. Lysine and arginine are basic amino acids hydroxyl group, which renders it them polar?
D. All of the above A. Serine
B. Threonine
73. This type of mutation occurs when the codon C. Tyrosine
containing the changed base may become a termination D. Only A and B
codon E. All of the above
A. Nonsense mutation
B. Missence mutation 82. What stabilizes the primary structure of proteins?
C. Silent mutation A. Salt bridges
D. Transitional mutation B. Hydrophobic bonds
C. Disulfide bonds
74. The result of a point mutation that occurs when D. All of the above
UCA (coding for serine ) is converted to UCU ( also coding
for serine ) is called 83. Which of the following amino acids possesses a
A. Nonsense mutation phenolic hydroxyl group?
A. Serine 91. The overall arrangement and interrelationship of
B. Threonine various regions in domains, and individual amino acid
C. Tyrosine residues of the single polypeptide chain is
D. Only A and B A. Primary
E. All of the above B. Secondary
84. The isoelectric pH is the pH between pK values on C. Tertiary
either side of the isoelectric process. Which of the following D. Quaternary
equation gives an accurate estimate of isoelectric pH.
A. pI= pK1 =pK2 92. Alpha helix and b- pleated sheets belong to what
B. pI= (pK1+pK2 )/2 structure?
C. pI=(pK1+ pK2 ) 2 A. Primary
D. pI =pK1> pK2 B. Secondary
C. Tertiary
85. Using the equation of pI, calculate the pI( isoelectric D. Quaternary
pH) of alanine pK1 (R-COOH ) = 2.35, p K2 (R-NH3 ) = 9.69
A. 6.02 93. Random coils and triple helices are example to
B. 12.04 what protein structure?
C. 24.08 A. Primary
D. 5.0 B. Secondary
C. Tertiary
86. Thyroxine, which is chemically 3, 5 3, 5 D. Quaternary
tetraidothyronine, is used as a precursor of thyroid
hormones. What type of biopolymer is thyroxine? 94. Fibrous and globular proteins belong to what protein
A. Carbohydrate structure?
B. Lipid A. Primary
C. Protein B. Secondary
D. Nucleic acid C. Tertiary
D. Quaternary
87. Peptide bond, a type of amide bond, binds the
amino terminal of one amino acid to the carboxyl end of 95. The arrangement of polypeptide chains in relation to
another. What type of process involved in the formation of one another in a multi-chained protein refers to what
peptide bonds. structure?
A. Oxidation A. Primary
B. Hydration B. Secondary
C. Reduction C. Tertiary
D. Dehydration D. Quaternary
88. Which of the following statement is correct? 96. What do you call the principal method for
A. The C-N bond in the peptide linkage has a partial determining the primary structure of polypeptides? For its
double bond property that makes it rigid. initial step, it utilizes phenylisocyanate , which combines with
B. Neither the C=O nor the N-H in the peptide bond the terminal amino acid of polypeptide.
can dissociate A. Grignard
C. Each amino acid in the polypeptide chain is called a B. Edman
residue C. Molisch
D. All of the above D. Zollinger
89. This structure of peptide refers to the order of amino 97. Which ofd the following bonds are found in the
acids in the polypeptide chains and the location of the quaternary structure of polypeptides?
disulfide bond. 1. Hydrogen bonds 3. Hydrophobic bonds
A. Primary 2. Electrostatic bonds 4. Covalent bonds
B. Secondary A. 3 only
C. Tertiary B. 1 only
D. Quaternary C. 1-3
D. All of the above
90. This refers to the spatial arrangements of amino
acids residues close to one another in the linear sequence of 98. Denaturation is randomization of the conformation
a polypeptide chain. of polypeptide chain. Chemical agents like strong acids or
A. Primary bases, heat , ionic detergents, etc. are involved in the
B. Secondary process. Which of the following structures remain unaffected
C. Tertiary with denaturation?
D. Quaternary 1. Primary 3. tertiary
2. Secondary 4. Quaternary
A. 1 only
B. 1 and 2 106. Fibrous proteins are elongated, water soluble ,
C. 1 and 3 generally in either alpha-helical, pleated sheet, or triple
D. 1-4 helical forms. Which of the following is an example of fibrous
proteins?
99. Which of the following statements is true?
A. Fibrous proteins are water insoluble A. Hemoglobin
B. Globular proteins are water soluble B. Actin
C. Proteins lose their biologic activity after C. Myosin
denaturation D. Elastin
D. Denaturation of protein are sometimes reversible
E. All of the above 107. Among the fibrous proteins listed below, which are the
major proteins of skin and hair?
100. Which of the following is/are example of essential
amino acids? A. Keratin
B. Collagen
A. Tyrosine C. Elastin
B. Threonine D. Fibronectin
C. Tryptophan
D. Both A and B 108. The fibrous proteins is the most abundant single
E. Both B and C proteins in vertebrates.
101. Dopamine , norepinephrine and epinephrine are A. Keratin

collectively called catecholamines. Which of the following B. Collagen
amino acids serves as a precursor in the synthesis of these C. Elastin
catecholamines? D. Fibronectin
A. Tryptophan 109. Which of the following statements below gives an

B. Threonine accurate description of collagen?
C. Tyrosine
A. It is a fibrous proteins
D. alanine
B. The basic unit of collagen is tropocollagen, a triple
102. Serotonin is synthesized from this amino acid. helix of three polypeptide chain
C. Vitamin A is important in catalyzing the
A. Tryptophan hydroxylation of proline
B. Threonine D. All of the above
C. Tyrosine E. Only A and B
D. Alanine
110. Which of the fibrous protein is an important structural
103. Histamine , a chemical messenger, mediates allergic component of the arterial blood vessels and ligaments?
and inflammatory reactions, gastric acid secretion and
neurotransmission of the brain. Which of the following amino A. Keratin
acids, which when decarboxylated, yields histamine? B. Collagen
C. Elastin
A. Tyrosine D. Fibronectin
B. Histidine
C. Tryptophan 111. One way of classifying protein is through their physical
D. Any of the above properties. Which of the following is soluble in water and salt
solutions, and has no distinctive amino acids?
104. The nonpolar amino acid – alanine, leucine, and
tryptophan, are all expected to be located in the A. Prolamine
B. Globulin
Of a globular protein in aqueous environment. C. Albumin
A. Central D. Histones
B. Peripheral
C. Randomly arranged 112. This is a general term for naturally occurring proteins
D. Scattered that yield only alpha amino acids, or their derivative on
hydrolysis
105. Polar and ionized side chains in globular proteins tend
to move to the surface to form bonds with A. Simple proteins
water. B. Albuminoids
C. Conjugated proteins
A. Inner D. Derived proteins
B. Outer
C. Entire 113. These are proteins that are combined in nature with
D. Regional some non-protein substances, and are classified according
to the nature of their prosthetic group or non- protein portion.
A. Simple proteins 121. These are primary derived proteins formed during the
B. Conjugated proteins early stages of protein hydrolysis by means of acids or alkali.
C. Primary derived proteins
D. Secondary derived proteins A. Metaproteins
B. Acid or alkali albuminates
114. These are proteins that differ only slightly from their C. Both A and B
source original proteins, and are formed by means of the D. Neither A nor B
action of heat, acids, alkali, water, enzymes, and mechanical
shock. 122. Arrange the following secondary derived proteins from
highest to lowest number of molecular weight.
A. Simple proteins
B. Conjugated proteins A. Peptide >peptones>proteoses
C. Derived proteins B. Proteoses>peptides>peptones
D. Proteosis C. Proteoses >peptones >peptides
D. Peptones > proteoses >peptides
115. Keratin in hair and horny tissue, elastin in tendons and
arteries, and collagen in skin and tendons belong to what 123. What enzyme is responsible for converting
type of simple proteins? phenylalanine to tyrosine
A. Glutelins A. Phenylalanine hydroxylase

B. Histones B. Phenylalanine dehydrogenase
C. Protamines C. Phenylalanine ligase
D. Albuminoids D. Phenylalanine kinase
116. Glutenin in wheat (glutelin ) and zein in corn ( 124. The absence of this enzyme results to phenylketonuria.
prolamines ) belong to what classification of proteins?
A. Phenylalanine dehydrogenase
A. Simple proteins B. Phenylalanine hydroxylase
B. Conjugated proteins C. Homogentsate oxidase
C. Denaturated proteins D. Either A or B
D. Coagulated proteins
125. Which of the following is true regarding
117. Casein in milk and ovovitellin in eggyolk are examples phenylketonuria?
of what type of conjugated proteins?
A. The enzyme homogentisate oxidase results to
A. Phospoproteins phenylketonuria
B. Nucleuproteins B. There overproduction of tyrosine
C. Glycoproteins C. There is always an abnormal development of the
D. Chromoproteins child’s brain
D. An artificial protein that lacks phenylalanine is given
118. Nucleoproteins, lipoproteins, and glycoproteins are to children with PKU
classified under what type of proteins?
126. What diet would you advice the child mother with PKU
A. Simple proteins to give to her baby?
B. Conjugated proteins
C. Primary derived proteins A. Rich in tyrosine, lacks phenylalanine
D. Secondary derived proteins B. Equal quantities of tyrosine and phenylalanine
C. Rich in phenylalanine, lacks tyrosine
119 .Fibrin from fibrinogen and myosan from myosin are D. Regular infant formula
examples of what type of primary derived proteins.
127. What enzyme is deficient in alkaptunoria?
A. Proteans
B. Mateproteans A. Phenylalanine dehydrogenase
C. Coagulated protein B. Phenylalanine hydroxylase
D. Peptones C. Homogentisate hydroxylase
D. Any of the above
120. These are primary derived proteins, which are insoluble
substances formed during the early stage of the action of 128. What essential amino acid is used in the synthesis of
water, enzymes and dilute acids. niacin?
A. Proteans A. Tyrosine
B. Conjugated proteins B. Methionine
C. Metaproteins C. Tryptophan
D. Peptones D. Phenylalanie
129. What important neurotransmitter uses tryptophan as its C. 1 and 2
precursor? D. 3 and 4
A. Histamine 136. Which of the following enzymes adds an inorganic

B. Actylcholine phosphate to break a bond?
C. Norepinephrine
D. Serotonin A. Kinase
B. Phosphorylase
130. Which of the following are branched-chain amino acids C. Phosphatase
responsible for the characteristic sweet smell of the urine of D. Ligase
patients with maple syrup urine disease
137. Wernickes- Korsakoff syndrome, which can cause acute
A. Leucine, isoleucine, and valine confusion, ataxia and opthalmoplegia , can be treated with
B. Leucine, alanine and valine which of the following?
C. Lysine, alanine, and valine
D. Lysine, isoleucine and valine A. Riboflavin
B. Ascorbic acid
131. This results from the oxidation of heme protein in C. Thiamine
hemoglobin resulting to increased affinity, and therefore D. Pantothenic acid
failure to adequately deliver oxygen to tissues.
138 .What is the deficiency state of folic acid?
A. Thalassemia
B. Methemolobinemia A. Aplastic anemia
C. Sulfhemoglobinemia B. Microcytic anemia
D. Sickle cell anemia C. Megaloblastic anemia
D. Macrocytic anemia
132. The coenzyme FMN and FAD is responsible for the
oxidative deamination of amino acids. Which of the following 139. Which of the following coenzymes is responsible for
vitamins is related to this coenzymes? carrying I- carbon groups?
A. B1 A. TPP (thiamine pyrophosphate )

B. B2 B. NADH (reduced nicotinamide adenine dinucleotide
C. B3 )
D. B4 C. FAD ( flavin adenine dinucleotide )
D. TFHA (tetrahydrofolic acid )
133 .Myoglobin and hemoglobin possesses a cyclic
tetrapyrole , heme, as a prosthetic group. Which of the 140. Bone disorder and obstructive liver disease maybe
following ions is found centrally located in the heme? diagnosed using which of the following serum enzymes?
A. Mg A. Aminotransferase
B. Al B. Alkaline phosphatase
C. Fe C. Acid phosphatase
D. P D. Lactate dehydrogenase
134. Some serum enzymes are used clinical diagnosis. 141. Which of the following vitamins is present in coenzymes
Which of the following enzyme/s may be used to diagnose required in the transfer of amino groups and decarboxylation
myocardial infarction? of amino acids? Its deficiency state is manifested by
glossitis, peripheral neuropathy and niacin deficiency.
1. Gamma glutamyl transpeptidase
2. AST or SGOT A. Pyridoxine
3. Creatinine phosphokinase B. Niacin
4. Lactate dehydrogenase C. Thiamine
A. 3 only D. Riboflavin
B. 2 and 4 only
C. 1-3 142. The signs of pellagra include dermatitis, diarrhea
D. 2-4 ,dementia, and loss of tongue papillae. Which of the
following is/are deficient in pellagra?
135. Acute pancreatitis maybe diagnose using which serum
enzymes? A. Niacin
B. Tryptophan
1. Acid phosphatase C. Both A and B
2. Alkaline phosphatase D. Pellagra is not a deficiency state. It is an
3. Lipase autoimmune disorder.
4. Amylase
A. 3 only
B. 4 only
143. Trimethoprim and methotrexate are folate reductase 150. This immunoglobulin is capable of crossing the
inhibitors. The used of the aforementioned drugs placenta?
predisposes a person to develop
A. IgA
a. Nausea and vomiting B. IgM
b. Dermatitis C. IgG
c. Normocytic anemia D. IgD
d. Megaloblastic anemia
151. Which of the following act synergistically with Vit E?
144. Cheilosis , glossitis , seborrhea , and photophobia are
manifestations of what deficiency state? A. Se
B. Co
A. Thiamine C. Cu
B. Riboflavin D. Mn
C. Niacin
D. Pyridoxine 152. This are slightly longer, catalytically inactive form of
enzymes?
145 .Certain metals and trace are importants as enzyme
cofactors. A. Haloenzymes
B. zymogen
What metal is present in enzyme gluthathione peroxidase C. haloenzyme
that replaces S is one cysteine in active site? D. Both A and B
A. Fe
B. Co 153. This term refers to an intact with a bound co-factor?
C. Se
D. Zn A. Haloenzyme
B. Apoenzyme
146 .This class of immunoglobulin is produced during the C. Zymogen
early response to invading organisms. It has a relatively D. Prosthetic group
large size that restricts its transport in the bloodstream.
154. Ninhydrin is widely used for detecting amino acids .
A. IgG what is the visible result for ninhydrin test in the presence of
B. IgM proline and and hydroxyproline?
C. IgD
D. IgA A. Violet
B. Green
147. This is the most abundant immunoglobulin in the blood. C. Yellow
Together with IgM , it is capable of triggering system. Which D. Old rose
immunoglobulin is this?
155. Which of the following test is specific for amino acids
A. IgG and free amino group/
B. IgA
C. IgD A. Biuret test
D. IgE B. Hopkins Cole test
C. Ninhydrin
148. This immunoglobulin is responsible for mediating D. Xanthoproteic test
hypersensitivity by causing the release of mediators from
mast cells and basophils upon exposure to antigens or 156. Xanthprotheic test is a test for?
allergens?
A. Free amino groups
A. IgA B. Arginine
B. IgG C. Cysteine
C. IgM D. Tyrosine
D. IgE
157. What is the positive visible result of Xanthoproteic test?
149. This immunoglobulin prevents the attachments of
A. Yellow color deepening into orange
bacteria and viruses to mucuos membranes. It is found in
B. Violet color
body secretions such as tears , colostrum , saliva , sweat
C. Bluish green
and small intestines.
D. Old rose
A. IgD
158. This test is used to identify the presence of peptide
B. IgA
linkage?
C. IgM
D. IgE A. Ninhydrin
B. Biuret
C. Hopkins Cole 166. This is also known as protein calorie malnutrition. It is a
D. Sakaguchi state resulting from the chronic deficiency of calories , which
can occur even in the presence of adequate intake of protein
159. Hopkins Cole is used to identify which of the following
amino acids? A. Marasmus
B. Obesity
A. Threonine C. Hemochromatosis
B. Tryptophan D. Kwashiorkor
C. Lysine
D. Leucine 167. The digestion of protein begins in the
160. Which of the following gives a positive result to basic A. Mouth

lead acetate test? B. Stomach
C. Small intestine
A. Tryptophan D. Pancreas
B. Cysteine
C. Cysteine 168. Pepsinogen is an example of
D. Both A and B
E. Both B and C A. Apoenzyme
B. Holoenzyme
161. Pauly diazo test indicates the presence of C. Cofactor
D. Zymogen
A. histidine
B. tyrosine 169. Racemase and mutase are examples of what type
C. tryptophan of enzymes?
D. both A and B
E. Both B and C A. Lyases
B. Isomerases
162. Specific test for arginine C. Oxidoreductase
D. Ligase
A. Biuret test
B. Basic lead acetate test 169. Racemase , Mutase , are examples of what type of
C. Ninhydrin enzymes?
D. Sakaguchi
A. lyases
163. This test is used to confirm the presence of the phenolic B. isomerases
ring of tyrosine? C. oxireductase
D. ligases
A. Ninhydrin test
B. Anthrone test
170. This is caused by inadequate intake of protein in the
C. Schiffs test
presence of adequate intake of calories?
D. Millons- Nasse
A. Marasmus
164. This is also known as glyoxylic acid reaction?
B. Obesity
A. Millons-nasse C. Hemochromatosis
B. Ninhydrin D. Kwashiorkor
C. Hopkins cole
171. This enzymes adds hydrogen atoms to a molecule.
D. Schiffs test
A. Reductase
165 .Which of the following statement is/ are correct?
B. Oxidase
1. The difference between intake and output of C. Ligase
nitrogenous compounds is known as nitrogen balance. D. Synthase
2. In a healthy adult , nitrogen balance is in equilibrium
172. Which of the following enzymes is an example of
when intake equals output hydrolases?
3. Positive nitrogen balance occurs when dietary A. esterase
intake is less the excretion of nitrogenous compounds B. racemase
4. Negative nitrogen balance results when there is too C. aminotransferase
much protein intake D. decarboxylase
A. 3 only
173. This type of enzymes cleaves a carbon to carbon bond
B. 1 and 2
to create an aldehyde group?
C. 2 and 4 A. esterase
D. 1 and 4 B. transferase
C .aldose
D. protease
D. 1-2-3-4
174. The enzyme decarboxylase is an example of a
enzyme? 184. The stereoisomers of cyclized
A. hydrolase monosaccarides molecules differing only in the configuration
B. ligase of the substituents on the carbonyl carbon.
C. racemase A. diastereomers
D. lyase B. enantiomers
C. epimers
175. These are defined a polyhydroxylated compounds with D. anomers
at least three carbon atoms that may or may not possess a
carbonyl group. 185. Maltose , a disaccharides is composed of
A. proteins A. glucose + galactose
B. carbohydrates B. glucose + fructose
C. lipids C. glucose + glucose
D. nucleic acids D. glucose + mannose
176. Which of the following statement is correct? 186. Which of the following carbohydrates contains the most
A. glyceraldehyde is ketotriose number of carbon atoms?
B. dihydroxyacetone is an aldotriose A. sedoheptulose
C .glyceraldehyde and dihydroxyacetone ate B. sialic acid
tataumers C. ribose
D. all of the above D. glycerose
177. This are sugar alcohol derived from glucose, which 187. Which of the following statement is /are correct?
often accumulates in the lenses of diabetic and produces A. In Fischer projection, when the sugar is written
cataracts. vertically , the lowest carbon is designated as carbon 1
A. mannitol B. If an –OH projects to the right on the Fischer
B. sorbitol structure, it will project downward in the Haworth projection
C. glucitol C. The Haworth projection provides a more exact
D. glycerol representation of the three dimensional conformation of
sugars in nature than chair configuration.
178. Glucose, Fructose and Galactose all have the same D. all of the above
chemical formula C6H12O6, through this information , we
can conclude that these substance are 188. Mutarotation, is a process of interconversion between
A. anomers the alpha and beta forms, using the open chain structure as
B. epimers a intermediate. Which of the following undergoes
C. enantiomers mutarotation .
D. isomers A. monosaccharide’s
179. These stereoisomers are non-superimposible mirror B. disaccharides
image of each other. These are also called optical isomers C. polysaccharides
because they rotate polarized light in opposite directions. D. amino acids
A. enantiomers
B. diastereomers 189. Which of the following present a cylic sugar nature?
C. anomers A. Fischer projection
D. both A and B B. Haworth projection
C. Chair projection
180. D- threose and L- threose are examples of D. boat conformation
A. anomers
B. enantiomers 190. Glucose and galactose differ only in the configuration of
C. diastereomers their hydroxyl group at carbon 4, thus they are called”
D. conformational isomers A. diastereomers
B. enantiomers
181. Which of the following has the most number of carbon C. epimers
atoms? D. anomers
A. erythrose 191. Glycogen is an example of a
B. sedoheptulose A. disaccharide
C. galactose B. monosaccharide
D. ribose C. polysaccharide
D. none of the above
182. Which of the following statements is /are true?
A. the carbonyl carbon is aldoses in carbon 1 192. Which of the following statements is correct about boat
B. the carbonyl group is ketoses in carbon 2 and conformation?
C. Both statements are correct A. Axial bonds are parallel to the axis
D. both statements are false B. equatorial bonds are perpendicular to the axis
C. For the 6 carbon pyranose , the chair from is more
183. Arrange the following monosaccharides from the stable than the boat form
highest number to lowest number of carbon atoms? D. all of the above
1. erythrose 3. Galactose E. only C is correct
2. sedoheptulose 4. Ribose
A. 4-3-1-2 193. The OH group on the penultimate or second to the last
B.3-2-1-4 carbon atoms determines
C. 2-3-4-1
A. D (dextro ) L ( levo ), dextro pointing to the right and B. stomach
levo pointing to the left C. small intestine
B. D (dextro ) L ( levo ), regarding optical activity D. duodenum
C. both statements are correct
D. both statements are incorrect 203. The nonsugar portion of glycosides is known as
A. aglycone
194. The glycosidic formed in glycosides is an example of B. genin
A. ester bond C. glycine
B . ether bond D. both A and B
C .ketone bond E. both B and C
D.Noncovalent bond
204. What type of glycisidic bond joins the dimer of glucose
195. Benedicts test is the traditional test for glucose in the to form maltose?
urine . What is the basis for the test? A. alpha 1, 4
B. beta 1, 4
A. oxidation of cuprous ions to cupric oxides C. alpha 1, 2
B. reduction of cupric ions to cuprous oxide D. beta 1, 2
C. enzymatic degradation of glucose
D. reation of glucose with complexing agents 205. The cell markers, which serve as basis for the ABO
blood types, are classified as what type of biopolymers?
196. Glucose normally absent in the urine because kidneys A. proteins
normally completely reabsorbed all glucose . Which of the B. carbohydrates
following is true? C. lipids
A. Glucosuria confirms diabetes mellitus D. nucleic acids
B. Glucosuria necesarrily means hyperglycemia
C. Glucosuria is solely attributed to insulin problems 206. Which of the following blood types is considered as the
D. Glucosuria may occur in other disease state universal donor?
A. A
197. Ascorbic acid, glucoronides and some drugs act as B. B
reducing agents . How would test substances affect C. AB
Benedicts test result? D. O
A. They may give false negative results
B. They may give false positive results 207. Which of the following is the reason why blood type AB
C. They would not affect that results is considered as universal recipient?
D. They would enhance the sensitivity to the test A. It is the most common among the ABO blood types
B. Blood type AB has neither A nor B substances
198. Testape (Lilly ) , Clinistix ( Bayer ) , Multistix ( Bayer ) C. blood type AB has neither anti- A nor anti- B
are based on what principles? antibodies
A. oxidation D. all of the above
B. reduction
C. enzymatic action 208. Which of the following statements is/ are true?
D. Both A and B A. amylose is long, unbranched polymer with alpha 1,
E. both A and C 4 bonds
B. starch consist of a greater proportion of amylopectin
199. Insulin promotes the storage of fat and glucose in than amylose
specialized target cells. Which pancreatic cell type of its C. all of the above
responsible for secreting this hormone? D. A and B only
A. A cell or alpha
B. B cell or beta 209. The enzyme alpha amylase cleaves to
C. D cell or delta maltose and maltotriose.
D. F cell or Delta A. chondroitin
B. cellulose
200. This hormones may sometimes be useful in reversal of C. heparin
cardiac effects of Beta blocker overdose because of its ability D. amylopectin
to increase cAMP production in the heart
E. amylase
A. Insulin 210. Which of the following is a homopolymer of N – acetyl
B.Somatostatin beta –D – glucosamine whose best known function is in
C. Somatomedin invertebrate animals?
D. glucagon A. xylan
B.peptidoglycan
201. The deficiency of which the following enzymes C. hyaluronic acid
predisposes persons taken sme therapeutic agents (e.g 4
aminoquinoline, sulfonamides , and propanthelin ) to
hemolytic anemia. D. chitin
A. glucose 1 –phosphate 211. Which of the following is / are examples of
B. glucose 6-phosphate glycosaminoglycans?
C. pyruvate dehydrogenase A. hyaluronic acids
D. thymidylate synthase B. mucopolysaccharides
C. chondroitin sulfate
202. The digestion of carbohydrates begins in the D. all of the above
A. mouth
E. only A and C 222. What test can be used to diffentiate galactose from
212. Which of the following is/ are examples of lactose?
trisaccharides? A. Benidicts test
A. raffinose B. iodine test
B. gentianose C. Barfoed test
C. melezitose D. Mucic acid test
D. all of the above
223. What is the positive result for Fehling test?
E. A and B only A. violet precipitate
213.Raffinose, a trisaccharides also known as B. brick red precipitate
A. melitose C. green precipitate
B. melitriose D. amorphous crystals
C. melezitose
D. Both A and B 224. This is the general test for carbohydrates?
E. Both B and C A. alpha napthol reaction
B. molisch test
214. Alpha napthol reaction is also known as C. Phenylhydrazine Test
A. Molisch test D. Both A and B
B. Ninhydrin test E. Both B and C
C. Phenylhydrazine test
D. Fehlings test 225. Which of the following sugars forms an insoluble white
phenylhydrazone readily?
215. What is the visible result for Molisch test? A. sucrose
A. green or blue green B. galactose
B. brick red precipitate C. arabinose
C. cherry red color D. mannose
D. purple ring at the junction
226. Which hydrolysis product of starch is responsible for
216. This is the other name of Taubers test for ketoses? forming a dark blue complex with iodine?
A. Anthrone test A. amylopectin
B. Seliwanoffs test B. amylose
C. Aminoguanidine reaction C. maltose
D. Mucic acid test D. all of the above
217. What is the visible result of aminoguanidine reaction? 227.This is differentiating test for aldose and ketose sugars?
A. purple ring at the junction A. Seliwanoffs test
B. green B. Mucic acid test
C. brownish black precipitate C. Barfoed test
D. bright reddish precipitate D. any of the above
218. Which of the following accurately describes Barfoeds 228. This is also known as Embden- Mayeroff pathway?
test?
A. general test for carbohydrates A. glycolysis
B. test for ketoses B. Gluconeogenesis
C. specific test for galactose C. glycogenesis
D. test to differentiate monosaccharides and D. glycogenolysis
disaccharides
229. Which of the following is / are ATP consuming stage (s)
219. The addition of a few drops of iodine to a solution in glycolysis?
produces blue color. This indicates the presence of A. Irreversible phosporylation of glucose to glucose 6-
A. starch phosphate
B. dextrin B. Irreversible phoporylation of fructose-6-phosphate
C. all of the above to fructose- 1, 6- biphosphate
D. A and B only C. phospoenolpyruvate to pyruvate
E. A and B only D. A and B
E. B and C
220. A reddish solution results after addition of iodine TS to
unknown solution. Subsequent addition of ammoniacal basic 230. Which of the following enzymes is responsible for
lead acetate to a portion of the unknown solutions to the catalyzing the reaction of glucose to glucose – phosphate?
formation of a precipitate. The results to the test confirm the A. hexokinase
presence of B. pyruvate kinase
A. glycogen C. PFK
B. dextrin D. glyceraldehyde phosphate dehydrogenase
C. starch
D. lactose 231. This enzyme catalyzes the conversion of fructose-6-P to
fructose-1, 6-bi- Phosphate?
221. This gives a negative to benedicts test A .hexokinase
A. glucose B. pyruvate kinase
B. sucrose C. PFK
C. lactose D. glyceraldehyde phosphate dehydrogenase
D. maltose
232. The enzymes for glycolysis are found in the A. cytososl
A. mitochondrion B. mitochondria
B. cytososl C. ribosomes
C. ribosome D. any of the above
D. nucleus
242. Among the different cells in the body , only these lack
233. Which of the following enzymes is most important in mitochondria, which render them incapable of TCA.
controlling glycolysis? A .platelets
A. hexokinase B. leukocytes
B.pyruvate kinase C. erythrocytes
C. PFK D. brain cells
D. none of the above
243. Which of the following is the central hub in the
234. This enzyme is the key that links glycolysis, TCA cycle, metabolism of carbohydrates, lipids and amino acids?
amino acid metabolism, and fatty acid oxidation. A. glycolysis
A.hexokinase B. pentose Phosphate Pathway
B. pyruvate kinase C. beta –oxidation
C. PFK
D. none of the above D. citric acid cycle
244. What enzymes catalyze the conversion of Acetyl- CoA
235. In the phosphorylation reaction, this metal is an and oxaloacetate to citrate?
essential cofactor? A. citrate synthase
A. Cu B. isocitrate dehydrogenase
B. Fe C. fumarase
C. Mg D. malate dehydrogenase
D. Al
245. Which of the following is /are the control points in the
236. This is the main pathway for the carbohydrate TCA?
catabolism in all human tissues? A. the citrate reaction , which is inhibited by ATP
A. glycolysis B. Isocitrate dehydrogenase reaction, which is inhibited
B. glycogenolysis by ATP
C. fructose catabolism C. alpha ketoglutarate dehydrogenase reaction , which
D. galactose catabolism is inhibited by the end products Succinyl CoA and NADH
D. all of the above
237. Which of the following enzymes catalyze irreversible E. a and B only
steps in glycolysis?
1. PFK 3. Pyruvate kinase 246. The electron transport chain (ETC ) is the final common
2. hexokinase 4. Pyruvate pathway by which electrons derived from the different fuels
dehydrogenase of the body flow to oxygen . Where does ETC occur?
A. 3 only A. outer mitochondrial membrane
B. 1 and 2 only B. inner mitochondrial membrane
C. 1, 2, 3 C. cytosol
D. 2 and 4 D. ribosome
238. The NADH in glycolysis (cytosol ) must be transported
to the mitochondrion to undergo oxidative phosphorylation. 247. This is the product of the complete reduction of oxygen?
However, neither NAD or NADH can penetrate the A. water
mitochondrion. This problem is addressed by the use of B. superoxide anions
shuttles. Which of the following statements regarding the C.hydrogen peroxide
shuttles is correct? D. hydroxyl radicals
A. glycerol-PO4 shuttle yields 3 ATP
B. malate aspartate shuttle yields 2 ATP 248. Which of the following enzymes converts hydrogen
C. both statements are correct peroxide in water?
D. both statements are false A. superoxide dismutase
B. catalase
239. Which of the following statements is/ are true regarding C. cytochrome reductase
anaerobic glycolysis? D. cytochrome oxidase
A. The formation of lactate and 2ATP is the net yield
B. There is a net of 2 NADH produced in the process 249. Tocopherol, carotene, glutathione are ascorbate are all
C. The anaerobic glycolysis is slower than the aerobic examples of
glycolysis A. reducing agents
D. all of the above B. antioxidants
E. Both A and B C. both A and B
D. neither A nor B
240. The total bet ATP produced in aerobic glycolysis is 250. Gluconeogenesis, the formation of new glucose , have
ATPs per mole of hexose , depending on which shuttle enzymes that are confined only in some organs , which
predominates in the transport NAD/ NADH. include
A. 4 to 6 A. muscles
B. 6 to 8 B. liver
C. 4 to 8 C. kidneys
D. 8 to 10 D. Both A and B
E. Both B and C
241. The site of citric acid
251. What enzyme in gluconeogenesis is include to bypass 260. How many ATPs are produced in the reduction of one
the hexokinase reaction, which is the conversion of glucose mole of NAD to NADH?
to glucose- phosphate? A. 2
A. pyruvate carboxylase B. 3
B. PEP carboxykinase C. 3
C. fructose biphosphate D. 12
D. glucose -6 –phosphatase
261. How many ATPs are produced in the convertion of one
252. Which of the following enzymes in gluconeogenesis is mole of FADH2 to FAD?
used to bypass the PFK reaction? A. 2
A. pyruvate carboxylase B .3
B. PEP carboxykinase C. 4
C. fructose biphosphate D. 12
D. glucose -6 –phosphatase
262. This refers to aldose-ketose interconvertion?
253. What two enzymes are used to bypass the pyruvate A. tautomerization
kinase reaction of glycolysis? B. mutarotation
1 . pyruvate carboxylase C. isomerism
2. PEP carboxykinase D. conjugation
3. fructose biphosphate
4. glucose -6 –phosphatase 263. Which of the following occurs in the cytosol?
A. 1 and 2 A. TCA
B. 1 and 3 B. glycolysis
C. 2 and 4 C. PPP
D. 3 and 4 D. both A and B
E. Both B and C
254. The pentose phosphate pathway occur in the
of the liver, muscle and kidney. 264. The site of acylglycerol synthesis.
A. inner mitochondria A. ribosome
B. outer mitochondria B. endoplasmic reticulum
C. cytosol C. cytosol
D. ribosomes
D. mitochondrion
255. Which of the following includes the main goals of 265. This refers to the totality of the chemical reactions that
Pentose Phosphate Pathaway? occur in an organism?
A. produce ribose -5 –phosphate for nucleotide A. metabolism
synthesis B. anabolism
B. produce NAPDH and NADP for fatty acid and steroid C. catabolism
biosynthesis D. amphibolism
C. to interconvert pentoses and hexoses
D. all of the above 266. The citric acid cycle is an example of an
E. A and B only metabolism
A. anabolic
256. Which of the following enzymes is present only in the B. catabolic
liver and kidney and not in the muscles? C. amphibolic
A. pyruvate carboxylase D. none of the above
B. PEP carboxykinase
C. fructose biphosphate 267. Which of the following is true regarding anabolism?
D. glucose – 6- phosphatase A. it is involved in the breakdown of larger molecules
B. It consumes energy
257. This is only the eraction coupled with substrate level C. it commonly involves oxidative reactions
phosphorylation in the TCA? D. It is exergonic
A. citrate to isocitrate
B. isocitrate to alpha –ketoglutarate 268. Which of the following is/ are true example of
C. succinyl CoA to succinyl catabolism?
D. succinate to fumarate A. glycogenesis
B. glycolysis
258. This is only the reaction in TCA that involves FAD / C. beta oxidation of fatty acid
FAD2? D. both A and B
A. citrate to isocitrate E. Both B and C
B. isocitrate to alpha –ketoglutarate
C. succinyl CoA to succinyl 269. After digestion and absorption, all biopolymers are
D. succinate to fumarate converted to the common product,
A. acetyl CoA
259. How many ATPs are produced for every acetyl CoA B. pyruvate
oxidized? C. citrate
A. 10 D. any of the above
B. 12
C. 14 270. This refers to a class of a heterogenous group of
D. 8 compound , which are more relate by their physical than by
their chemical properties.
A. proteins
B. nucleic acids E. Both B and C
C. carbohydrates
D. lipids 281. Which of the following statements is / are correct?
1. Although cocoa butter is a vegetable oil, it is solid at
271. These are esters of fatty acids and glycerol? room temperature
A. fixed oils and fats 2. Although cocoa butter is an animal fat , it is liquid at
B. waxes room temperature
C. sterols 3. Although cod liver is an animal fat, it is liquid at room
D. phospholipids temperature
4. Although cod liver oils is vegetable oil, it is solid at
272. These are esters of high molecular weight, monohydric roim temperature
alcohols and high molecular weight fatty acids. A. 3 only
A. fixed oils and fats B. 1 and 3
B. waxes C. 2 and 4
C. sterols D. 2 only
D. phospholipids
282. Which of the following statements is true when fats and
273. These are alcohols containing CPPP nucleus? fixed oils are heated strongly?
A. fixed oils and fats
B. waxes A. fats liquefy
C. sterols B. oils becomes less viscous
D. phospholipids C. decomposition occurs accompanied by the production
of acrid flammable vapors
274. These are esters of glycerol in combination with fatty D. saponication occurs
acids, phosphoric acid, and certain nitrogenous compounds.
A. fixed oils and fats
B. waxes 283. Which of the following is true when fats and fixed oils
C. sterols are heated moderately?
D. phospholipids A. fats becomes less viscous, oil liquefy
B. fats liquefy, oils becomes less viscous
275. Lard is an example of what chemical class of lipids? C. decomposition occurs with the production of acrid
A. fixed oils and fats flammable odor
B. waxes D. saponication occurs
C. sterols
D. phospholipids 284. Which of the following is the common property of lipids?
A. they are insoluble in water
276. Which of the following is a wax? B. they are soluble in nonpolar solvents
A. cholesterol C. they are completely immiscible with hexane
B. ergosterol D. all of the above
C. spermacetti E. Both A and B
D. lecithin 285. Which of the following are properties of fats and fixed
oils?
277. Lecithin is an example of 1. Greasy to touch
A. fixed oils and fats 2. Leave a permanent oily stain upon the filter paper
B. waxes 3. A few of them are soluble in alcohol
C. sterols 4. They undergo saponification
D. phospholipids A. 3 only
B. 1 and 2
278. Which of the following is / are true regarding fats and C. 3 and 4
fixed oils? D. 1 and 4
A. the difference in consistency is caused by the glyceryl
ester present. 286. These are lipids that contain carbohydrate ( galactose
B. Fixed oils are fats that are solids at room temperature or glucose ) one fatty acid and sphingosine , but no
C. Fixed oils have a higher proportion of saturated phosphoric acid or glycerol?
glycerides. A. cerebrosides
D. Fats have a higher proportion of unsaturated B. gangliosides
glycerides C. cytolipins
E. all of the above D. any of the above
279. What phospholipids are associated with the process of 287. These are compounds related to cerebrosides that
blood clotting? contain sphingosine , long chain fatty acids , hexoses (
A. lecithin usually galactose or glucose ) and neuraminis acid?
B. cephalin A. cerebrosides
C. spingomyelin B. gangliosides
D. none of the above C. cytolipins
280. Which of the following statements is/ are true? D. lecithins

A. Unsaturated fatty acids have lower meltin point than 288. Gangliosides , cerebrosides and cytolipins are
saturated fatty acids collectively called
B. vegetable oils are generally liquid A. phospholipids or phosphatides
C. vegetable oils are generally solid B. glycolipids
D. Both A and B C. sulofolipids
D. lipoproteins
299. Which vitamin can be used in the management of
289. This is the disposition of lipid plaques on the lining of hyperlipidemia?
the arteries? A. thiamine
A. Atherosclerosis B. riboflavin
B. Gaucher disease C. niacin
C. Tay Sac’s disease D. pantothenic acid
D. hyperlipoprotenimia
300. Which of the following drugs is a structural analog of
HMG- CoA?
290. Which of the following is/ are true regarding lipolysis? A. clofibrate
A. It is triglyceride hydrolysis B. colestipol
B. It liberates free fatty acids from their main storage C. cholestyramine
depots in the triglycerides D. lovastatin
C. It begins in the intestinal hydrolysis of dietary
triglycerides by pancreatic lipase
D. all of the above
291. Beta oxidation of fatty occurs in the

A. cytosol
B. mitochondria
C. endoplasmic reticulum
D. ribosomes
292. Fatty acid elongation occurs in the

A. cytosol
B. mitochondria
C. endoplasmic reticulum
D. microsomes
293.This 3- carbon fatty acid derivatives arises from the

catabolism of fatty acids containing odd numbered carbons.
A. acetyl CoA
B. acyl CoA
C. propionyl CoA
D. Butyryl CoA
294. Which of the following are ketone bodies?

1. acetone 3. Acetoacetic acid
2. acetic acid 4. Beta hydroxybutyric acid
A. 1 and 2
B. 1, 2 and 3
C. 1, 2 and 4
D. 1 , 3 and 4
295. The state of high serum levels of acetoacetic acid and

beta- hydroxybutyric acid is called
A. ketonemia
B. ketonuria
C. ketosis
D. ketoacidosis
296. The Salkoowski test for cholesterol utilizes what strong

acid?
A. nitric acid
B. sulfuric acid
C. hydrochloric acid
D. perchloric acid
297. The acetic acid acid- sulfuric acid test for cholesterol is
more commonly known as
A. microscopic examination for cholesterol
B. Salkowkis test
C. Liebermann- Burchard test
D. Formaldehyde test
298. What is the positive visible result for Liebermann –

Burchard test?
A. yellow crystal
B. black precipitate
C. white amorphous precipitate
D. bluish green color

Biochemistry Pacop Pinkgreen

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Biochemistry Pacop Pinkgreen

Uploaded by

Copyright:

Available Formats

Biochemistry-GREEN Page 1 of 10

B 1. The inhibition in a noncompetitive reaction: c. reversible inhibition

C 6. Which of the following is a precursor of vitamin D? A 21. Carbohydrates are

A 36. The protein part of the enzyme molecule is the:

B 90. The parent compound of phospholipids: B 105. The complementary strand of

D 135. The principal end product of protein metabolism:

C 265. The main center of biosynthesis of nucleic acid is

C 251. Bond between 2 amino acids A 267. Known as good cholesterol:

C 283. The precursor of vitamin D3:

B 286. The enzyme present in the stomach which

B 287. The reaction that takes place in cytoplasm:

10. Which of the following statements is/ are correct

101. Dopamine , norepinephrine and epinephrine are A. Keratin

A. Tryptophan 109. Which of the following statements below gives an

A. Glutelins A. Phenylalanine hydroxylase

A. Histamine 136. Which of the following enzymes adds an inorganic

A. B1 A. TPP (thiamine pyrophosphate )

160. Which of the following gives a positive result to basic A. Mouth

280. Which of the following statements is/ are true? D. lecithins

291. Beta oxidation of fatty occurs in the

292. Fatty acid elongation occurs in the

293.This 3- carbon fatty acid derivatives arises from the

294. Which of the following are ketone bodies?

295. The state of high serum levels of acetoacetic acid and

296. The Salkoowski test for cholesterol utilizes what strong

298. What is the positive visible result for Liebermann –

You might also like