DNA Practice TEST/Study Guide

DNA
1. DNA is made up of monomers called ________________________________________________
2. What is the name given to the group of polymers that includes DNA and RNA? ______________
3. DNA has four nitrogen bases. Name them ____________________________________________
4. Draw a nucleotide and label the three parts

5. What is the difference between a purine and a pyrimidine? Which bases belong to which group?
_______________________________________________________________________________
6. Describe the DNA structure in detail.
____________________________________________________________________________________
7. What is a base pair? _________________________________________________________
8. Who uncovered complementary base pairing? ____________________________________
9. Why do the bases always pair as they do? ________________________________________
10. Why is DNA important? _____________________________________________________
11. Who is responsible for uncovering the structure of the DNA model? ___________________
Replication
12. What is replication? ______________________________________________________________
13. How do the amounts of A, T, C, G compare in a DNA model? ____________________________
14. Explain the steps in replication.
___________________________________________________________________________________________
___________________________________________________________________
15. What does semi-conservative mean in replication? ______________________________________
16. If the DNA strand is ATGACTGATACGATAATGGCC, what will the new stand look like?
_______________________________________________________________________________
Protein Synthesis
17. DNA codes for the production of what molecule? ____________________
18. Put the following words in order by size from largest to smallest: Chromosome, nucleotide, gene, DNA
sequence, guanine ______________________________________________________
19. What is a codon and what does it represent? ______________________________________
20. What determines the order of the amino acids? ____________________________________
21. Define transcription and where does this happen in the cell? _________________________
22. What type of RNA is made by transcription? ______________________________________
23. What are the steps in transcription?
___________________________________________________________________________________________
___________________________________________________________________
24. Define translation. Where does it take place in the cell? _________________________________
25. What is the role of tRNA in the cell? ________________________________________________
26. Briefly describe the steps involved in translation.
___________________________________________________________________________________________
___________________________________________________________
27. What is the code on the tRNA called? _______________________________________________
28. What are the two main processes involved in protein synthesis?
______________________________________________________________________________
29. Where does it start and where is the protein finally made?
______________________________________________________________________________

30. What is uracil? ________________________________________________________________

31. Compare and contrast DNA and RNA.
52. # Strands 53. Nitrogen Bases 54. Sugar present

55. DNA 56. 57. 58.

59. RNA 60. 61. 62.

The Cell Cycle

1. __________ The gender determining chromosomes
2. __________ DNA that is tightly wound into easily seen bodies
3. __________ DNA that is unwound
4. __________ A picture of an organism's chromosomes to detect genetic disorders
5. __________ The proteins that help to pull the chromosome to the pole in mitosis
6. __________ Half of the normal number of chromosomes (n)
7. __________ The organelle that produces spindle fibers during cell division
8. __________ The chromosomes numbered 1-22
9. __________ A full set of chromosomes (2n)
10.________ One of two identical chromosome strands into which a chromosome splits for cell division
11.________ Sex Cells are called this
12.________ DNA replication occurs during this phase of Interphase
13.________ The part of a chromosome that will split to allow one chromosome to move to each pole
14.________ The division of the nucleus
15.________ The division of the cytoplasm

16. Label the Phases.

17. Put them in order from the beginning to the end.

18. Label - chromatids, Chromosomes, spindle fibers, centromere, centrioles