“Biology A” Exam Review Name _____________________________________

Date ____________ HR___ DATE OF EXAM _______

Chemistry of Life: Chapter 2.3 & 2.4

1. What are the 4 macromolecules?
Name ___________
Function: Example:
Name ___________
Function: Example:
Name ___________
Function: Example:
Name ___________
Function: Example:

2. An enzyme is a _________________ that ________________ chemical reactions.

3. What factors affect an enzyme's ability to function properly? (3 of them)
4. What is the relationship between the amount of enzyme and speed of chemical reaction?

5. What is it called when an enzyme is destroyed or is unable to function properly?

6. Why does the reaction rate slow down drastically when the temperature is too high?
7. Using the graph to the right, what is the optimal temperature for this enzyme?

DNA Structure and Function Chapter 13:

8. Who were these people/what did they do: Watson, & Crick.

9. Describe the general shape of a DNA molecule.

10. What are the 3 main parts that make up a nucleotide? Draw it.

11. What nitrogen bases are found in DNA? How do they pair up?

12. DNA always found in the _________________(of eukaryotic cells)?

Cells (Structure and Function) Chapter 8:

13. _______________________ and _________________are the two basic types of cells. Give an example of each.

For The question below: circle each word or phrase that correctly completes the sentence.
14. The instructions for making proteins are coded in the (cytoplasm / DNA / endoplasmic reticulum /
nucleus) of a cell. In a eukaryotic cell, these instructions are located within an organelle (cytoplasm /
DNA / endoplasmic reticulum / nucleus).
15. Which cell structure is correctly matched with its function?
a. vacuole: stores material inside the cell c. lysosome: manufactures proteins
b. cell membrane: divides the cell into two halves d. lysosome: manufactures proteins

16. A student is comparing the cells of a prokaryote, an animal, and a plant. Identifying which two cell parts would show
that the cell was a plant cell, and not a cell of a prokaryote or an animal?
a. nucleus and mitochondria c. cell wall and cell membrane
b. cell wall and chloroplast d. cell membrane and mitochondria
 17. What are the 3 parts of the cell theory?

18. Which part of the cell theory would support the following:
You cut your finger. After two weeks, the scab is gone and the area is healed.

19. Jack is developing a model to show how most proteins are synthesized (made) in animal cells. Which
organelle would be LEAST useful for him to include in the model?
a. golgi apparatus c. endoplasmic reticulum
b. ribosome d. chloroplasts

20. Compare Cell 1 & Cell 2, which organelle is missing from Cell 2?

21. Describe why Cell 2 will not function

22. Compare Cell 1 & Cell 3, which organelle is Cell 3 missing?

23. List 2 reasons why Cell 3 will not survive. Cell 1 Cell 2 Cell 3

24. Explain how the nucleus, ribosomes, ER, and Golgi work together to make
proteins.
● LABEL the above listed organelles
● Make sure to write what each organelle contributes to the creation of
proteins
● Put the steps involved in making the protein in order

Homeostasis & a Healthy You Chapter 27

25. What is homeostasis as it relates to the human body?

26. Differentiate between positive feedback and negative feedback mechanisms.

Provide an example for each

*** Use your body system matrix to help you with the questions below
27. Describe the basic function of the nervous system and how it keeps our body in homeostasis.
● Function-
● Structures-
 ● Homeostasis (In other words… What system does it work with to maintain homeostasis?)

28. The function of the skeletal system is and it helps maintain homeostasis by:
● Function-
● Structures-
● Homeostasis-

29. The function of the muscular system is and it helps maintain homeostasis by:
● Function-
● Structures-
● Homeostasis-

30. The main job of the circulatory system is and it helps to maintain homeostasis by:
● Function-
● Structures-
● Homeostasis-

31. The main role of the respiratory system in your body is and it helps maintain homeostasis by:
● Function-
● Structures-
● Homeostasis-

32. The main role of the digestive system is and it helps maintain homeostasis by:
● Function-
● Structures-
● Homeostasis-

DNA REPLICATION
33. Using the DNA sequence provided below: complete the complementary sequence.
AAAGTCCCTTACGATCACGTT

34. Describe the process of DNA Replication (3 steps). What is the end product?