Gene expression

Chromosomes and the genetic cycle

Gene: length of DNA that codes for a protein allele
*

is alternate form
of gene
I
can be inheritable
4 control individuals
Why do we have 2 copies? specific characteristics of

one from mother, one from father Structure: really condensed into chromosomes
Chromosome: DNA that has been coiled DNA molecules which contains genetic
information in the form of genes

98
review:
eukaryotes is
anything with a nucleus

Chromosomes often organized in pairs called homologous pairs

homo: same
* -> ex. ↳ same length B b
homosexual
hetero:different ->
* ↳ Same genes in
ex, heterosexual
same location
en
NOT IDENTIAL

Genetic code: base sequence of nucleotides in either DNA or RNA

genes do NOT make proteins; provides INSTRUCTIONS
Genetic codes are written in sequence of 3 bases,
called codons
one set of codon codes for an amino acid
3 codons &
solypeptide
 Gene expression

Protein synthesis
Protein synthesis: also known as gene expression is the process of instructions in
DNA converting into protein

2 steps:

1. Transcription: DNA is copied into complementary mRNA

2. Translation: genetic information in mRNA is translated to A sequence of

amino acids in a polypepticle chain

Central dogma of molecular biology: genetic information flows in one direction,

DNA > RNA > protein
Transcription

the
DNA - mRNA transcript
1. DNA is unfounded by the enzyme RNA
polymerase in the nucleus
2. RNA poly Erin moves and reads the
gene on DNA
3. Using one strand as template, RNA polymerase
synthesizes complementary mRNA copies
Scytoplasm) 4. Once gene is copied DNA rewinds and mRNA leaves
nucleus via nuclear pore into cytoplasm.
 Gene expression

Translation
mRN protein
⑪ amino acid
1. mRNA bonds to ribosome
2. Ribosome reads mRNA, one

⑲ End colon at a time

g.
RNA
+
3. tRNA brings amino acid to the
/
ribosome

e 4. Amino acids from peptide bonds,

combining into a polypepticle
 Assessment tasks
⑪ Humans typicallyhave 23 pairs of chromosomes in their bodycells. In some cases, when a sperm o r over is produced,

they have 22 or 24 chromosomes, resulting from a process called non-disjunction. Research two different disorders:one
where the human has 47chromosomes and one where the human has 45. For each, provide the name and a description
of the effects this has on the individual.
47: Down characteristics, increased
syndrome, distinctive facial risk of

heart defects, mental retardation, etc. Turner syndrome, affects females,

45:

medical and developmental problems, short height, failure of ovaries to develop.

②
Using the following DNA template strand below, deduce the mRNA transcript that would be produced in transcription.
TACAATCGCTTTGGTAAAACT
AGWAG6AAUVA

BUsing the following mRNA codon table, deduce the amino acid sequence that would be translated from
the transcript in 2 met, leu, ala, lys, pro, the,stay

⑰Contrast the structure of DNA and RNA

DNA RNA

structure double strand single-strand

nitrogenous base A,C,6,T AN,CO

deoxyribose ribose
sugar
 Assessment tasks
⑮ A stem cell and lymphocyte are extracted from a person. How would these cells be similar and how would they be
different?