Textbook Patient Specific Induced Pluripotent Stem Cell Models Generation and Characterization 1St Edition Andras Nagy Ebook All Chapter PDF

Patient Specific Induced Pluripotent
Stem Cell Models Generation and

Characterization 1st Edition Andras
Nagy
Visit to download the full and correct content document:
https://textbookfull.com/product/patient-specific-induced-pluripotent-stem-cell-models-
generation-and-characterization-1st-edition-andras-nagy/
More products digital (pdf, epub, mobi) instant
download maybe you interests ...
Pluripotent Stem Cell Therapy for Diabetes 1st Edition

Lorenzo Piemonti
https://textbookfull.com/product/pluripotent-stem-cell-therapy-
for-diabetes-1st-edition-lorenzo-piemonti/
Studies of Pluripotency in Embryonic Stem Cells and

Induced Pluripotent Stem Cells 1st Edition Xiaoyang
Zhao (Auth.)
https://textbookfull.com/product/studies-of-pluripotency-in-
embryonic-stem-cells-and-induced-pluripotent-stem-cells-1st-
edition-xiaoyang-zhao-auth/
Stem Cell Derived Models in Toxicology 1st Edition Mike

Clements
https://textbookfull.com/product/stem-cell-derived-models-in-
toxicology-1st-edition-mike-clements/
Stem Cell Proliferation and Differentiation 1st Edition

Thomas G. Fazzio
https://textbookfull.com/product/stem-cell-proliferation-and-
differentiation-1st-edition-thomas-g-fazzio/
Stem Cell Manufacturing 1st Edition Joaquim M. S.
Cabral
https://textbookfull.com/product/stem-cell-manufacturing-1st-
edition-joaquim-m-s-cabral/
Human stem cell toxicology 1st Edition James L Sherley
https://textbookfull.com/product/human-stem-cell-toxicology-1st-
edition-james-l-sherley/
Stem Cell Research : Hope or Hype? 1st Edition Alt
https://textbookfull.com/product/stem-cell-research-hope-or-
hype-1st-edition-alt/
Stem Cell Renewal and Cell Cell Communication Methods

and Protocols Methods in Molecular Biology 2346 Kursad
Turksen Editor
https://textbookfull.com/product/stem-cell-renewal-and-cell-cell-
communication-methods-and-protocols-methods-in-molecular-
biology-2346-kursad-turksen-editor/
Computational Stem Cell Biology Methods and Protocols

Patrick Cahan
https://textbookfull.com/product/computational-stem-cell-biology-
methods-and-protocols-patrick-cahan/
Methods in
Molecular Biology 1353
Andras Nagy
Kursad Turksen Editors
Patient-Specific
Induced
Pluripotent
Stem Cell Models
Generation and Characterization
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK
For further volumes: http://www.springer.com/series/7651

Patient-Specific Induced
Pluripotent Stem Cell Models
Generation and Characterization
Edited by
Andras Nagy
Lunenfeld-Tanenbaum Research Institute, Toronto, ON, Canada
Kursad Turksen
Ottawa Hospital Research Institute, Ottawa, ON, Canada
Editors
Andras Nagy Kursad Turksen
Lunenfeld-Tanenbaum Research Institute Ottawa Hospital Research Institute
Toronto, ON, Canada Ottawa, ON, Canada
ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-3033-3 ISBN 978-1-4939-3034-0 (eBook)
DOI 10.1007/978-1-4939-3034-0
Library of Congress Control Number: 2015951804
Springer New York Heidelberg Dordrecht London

# Springer Science+Business Media New York 2016
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.
Printed on acid-free paper
Humana Press is a brand of Springer

Springer Science+Business Media LLC New York is part of Springer Science+Business Media (www.springer.com)
Preface
Rapid developments in the field of induced pluripotent stem (iPS) cells have provided novel
opportunities and approaches, both for better understanding a number of human diseases
and for developing new platforms for drug development and screening for such diseases.
To complement our volume on methods for establishing iPS cells, we have also collected
representative protocols on various disease models. We are grateful to all the contributors
who shared the details of their protocols for this volume; without their generous efforts,
this volume would not have been possible.
Dr. John Walker, Editor in Chief of Methods in Molecular Biology, was instrumental in
getting this volume off the ground, and we thank him for it. Patrick Marton, Editor of
Springer Protocols, was also very supportive as we put together this volume. We also thank
David Casey and Monica Suchy for helping us to correct missing details during book
production.
Toronto, ON, Canada Andras Nagy

Ottawa, ON, Canada Kursad Turksen
v
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
Generation of Patient-Specific induced Pluripotent Stem Cell
from Peripheral Blood Mononuclear Cells by Sendai
Reprogramming Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Oscar Quintana-Bustamante and Jose C. Segovia
A Doxycycline-Inducible System for Genetic Correction of iPSC
Disease Models . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Xiuli Sim, Fabian L. Cardenas-Diaz, Deborah L. French
and Paul Gadue
Generation and Characterization of Patient-Specific Induced
Pluripotent Stem Cell for Disease Modeling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Renuka Sivapatham and Xianmin Zeng
Modeling Genomic Imprinting Disorders Using Induced
Pluripotent Stem Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
Stormy J. Chamberlain, Noelle D. Germain, Pin-Fang Chen,
Jack S. Hsiao, and Heather Glatt-Deeley
Generation and Characterization of Induced Pluripotent
Stem Cells from Patients with mtDNA Mutations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
Riikka H. H€ a m€a l€a inen and Anu Suomalainen
Skin Biopsy and Patient-Specific Stem Cell Lines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77
Yao Li, Huy V. Nguyen, and Stephen H. Tsang
Directed Myogenic Differentiation of Human Induced
Emi Shoji, Knut Woltjen, and Hidetoshi Sakurai
Using Human Induced Pluripotent Stem Cells
to Model Skeletal Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101
Emilie Barruet and Edward C. Hsiao
Modeling Cardiovascular Diseases with Patient-Specific
Human Pluripotent Stem Cell-Derived Cardiomyocytes . . . . . . . . . . . . . . . . . . . . . . . . 119
Paul W. Burridge, Sebastian Diecke, Elena Matsa,
Arun Sharma, Haodi Wu, and Joseph C. Wu
Calcium Imaging in Pluripotent Stem Cell-Derived
Cardiac Myocytes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131
Anna Walter, Tomo Šarić, Jürgen Hescheler
and Symeon Papadopoulos
Patient-Specific Induced Pluripotent Stem Cell Models:
Generation and Characterization of Cardiac Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147
Fabian Zanella and Farah Sheikh
vii
viii Contents
Differentiation of Human Pluripotent Stem Cells to Cardiomyocytes

Under Defined Conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163
Cathelijne W. van den Berg, David A. Elliott, Stefan R. Braam,
Christine L. Mummery, and Richard P. Davis
Generation of Cardiomyocytes from Pluripotent Stem Cells . . . . . . . . . . . . . . . . . . . . 181
Hiroko Nakahama and Elisa Di Pasquale
Generation and Characterization of Patient-Specific iPSC
Model for Cardiovascular Disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
Yee Ki Lee, X. Ran, K.W.H. Lai, V.Y.M. Lau,
D.C.W. Siu, and H.F. Tse
Transgene-Free Disease-Specific iPSC Generation from Fibroblasts
and Peripheral Blood Mononuclear Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215
Kerem Fidan, Ayyub Ebrahimi, Özlem H. Çağlayan,
Burcu Özçimen, and Tamer T. Önder
Generation and Neuronal Differentiation of Patient-Specific
Induced Pluripotent Stem Cells Derived from Niemann-Pick
Type C1 Fibroblasts. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 233
Michaela Trilck, Rayk Hübner, and Moritz J. Frech
Multisystemic Disease Modeling of Liver-Derived Protein
Folding Disorders Using Induced Pluripotent Stem Cells (iPSCs) . . . . . . . . . . . . . . . 261
Amy Leung and George J. Murphy
In Vitro Modeling of Alcohol-Induced Liver Injury Using Human-Induced
Lipeng Tian, Neha Prasad, and Yoon-Young Jang
Generation of Human Induced Pluripotent Stem Cells Using
RNA-Based Sendai Virus System and Pluripotency Validation
of the Resulting Cell Population. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285
Valeria Chichagova, Irene Sanchez-Vera, Lyle Armstrong,
David Steel, and Majlinda Lako
Modeling Axonal Phenotypes with Human Pluripotent Stem Cells . . . . . . . . . . . . . . 309
Kyle R. Denton, Chong-Chong Xu, and Xue-Jun Li
Mitochondrial Disease-Specific Induced Pluripotent Stem
Cell Models: Generation and Characterization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 323
Xuan Zhang, Shishi Li, Wei Yang, Huaye Pan, Dajiang Qin,
Xufen Zhu, and Qingfeng Yan
Patient-Specific Induced Pluripotent Stem Cell Models:
Characterization of iPS Cell-Derived Cardiomyocytes . . . . . . . . . . . . . . . . . . . . . . . . . . 343
Toru Egashira, Shinsuke Yuasa, Shugo Tohyama, Yusuke Kuroda,
Tomoyuki Suzuki, Tomohisa Seki, and Keiichi Fukuda
Generation of Integration-Free Patient Specific iPS Cells Using
Episomal Plasmids Under Feeder Free Conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 355
Sara Caxaria, Susanne Arthold, Amit C. Nathwani
and Pollyanna Agnes Goh
Index. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 367
Contributors
LYLE ARMSTRONG Institute of Genetic Medicine, Newcastle University,

Newcastle-upon-Tyne, UK
SUSANNE ARTHOLD UCL Cancer Institute, University College London, London, UK
EMILIE BARRUET Division of Endocrinology and Metabolism, Department of Medicine,
Institute for Human Genetics, University of California, San Francisco, CA, USA
CATHELIJNE W. VAN DENBERG Department of Anatomy and Embryology, Leiden University
Medical Center, Leiden, The Netherlands
STEFAN R. BRAAM Pluriomics BV, Leiden, The Netherlands
ÖZÇIMEN BURCU School of Medicine, Koç University, Istanbul, Turkey
PAUL W. BURRIDGE Department of Medicine (Division of Cardiology), Stanford
Cardiovascular Institute, Institute for Stem Cell Biology and Regenerative Medicine,
Stanford University School of Medicine, Stanford, CA, USA
ÖZLEM H. ČAĞLAYAN School of Medicine, Koç University, Istanbul, Turkey
FABIAN L. CARDENAS-DIAZ Center for Cellular and Molecular Therapeutics, The
Children’s Hospital of Philadelphia, Philadelphia, PA, USA
SARA CAXARIA UCL Cancer Institute, University College London, London, UK
STORMY J. CHAMBERLAIN University of Connecticut Health Center, Farmington, CT, USA
PIN-FANG CHEN University of Connecticut Health Center, Farmington, CT, USA
VALERIA CHICHAGOVA Institute of Genetic Medicine, Newcastle University,
Newcastle-upon-Tyne, UK
RICHARD P. DAVIS Department of Anatomy and Embryology, Leiden University
KYLE R. DENTON Department of Neuroscience, University of Connecticut Health Center,
Farmington, CT, USA
SEBASTIAN DIECKE Max Delbrück Center, Berlin Institute of Health, Berlin, Germany
AYYUB EBRAHIMI School of Medicine, Koç University, Istanbul, Turkey; Molecular Biology
and Genetics Department, Faculty of Science, Istanbul University, Istanbul, Turkey
TORU EGASHIRA Department of Cardiology, Keio University School of Medicine, Tokyo,
Japan
DAVID A. ELLIOTT Murdoch Childrens Research Institute, The Royal Children’s Hospital,
Parkville, VIC, Australia
KEREM FIDAN School of Medicine, Koç University, Istanbul, Turkey
MORITZ J. FRECH Albrecht-Kossel-Institute for Neuroregeneration (AKos), University of
Rostock, Rostock, Germany
DEBORAH L. FRENCH Center for Cellular and Molecular Therapeutics, The Children’s
Hospital of Philadelphia, Philadelphia, PA, USA
KEIICHI FUKUDA Department of Cardiology, Keio University School of Medicine, Tokyo,
Japan
PAUL GADUE Center for Cellular and Molecular Therapeutics, The Children’s Hospital
of Philadelphia, Philadelphia, PA, USA; Department of Pathology and Laboratory
Medicine, The Children’s Hospital of Philadelphia, Philadelphia, PA, USA
NOELLE D. GERMAIN University of Connecticut Health Center, Farmington, CT, USA
HEATHER GLATT-DEELEY University of Connecticut Health Center, Farmington, CT, USA
ix
x Contributors
POLLYANNA AGNES GOH Centre for Paediatrics, Barts and The London Medical School,
Blizard Institute, Queen Mary University of London, London, UK
RIIKKA H. H€aM€aL€aINEN Research Program of Molecular Neurology, Biomedicum-Helsinki,
University of Helsinki, Helsinki, Finland; A.I.Virtanen Institute for Molecular Sciences,
University of Eastern Finland, Kuopio, Finland
JÜRGEN HESCHELER Center for Physiology and Pathophysiology, Institute for
Neurophysiology, Medical Faculty, University of Cologne, Cologne, Germany
JACK S. HSIAO University of Connecticut Health Center, Farmington, CT, USA
EDWARD C. HSIAO Division of Endocrinology and Metabolism, Department of Medicine,
Institute for Human Genetics, University of California, San Francisco, CA, USA
RAYK HÜBNER Albrecht-Kossel-Institute for Neuroregeneration (AKos), University of
YOON-YOUNG JANG Institute for Cell Engineering, Johns Hopkins University School of
Medicine, Baltimore, MD, USA; Cellular and Molecular Medicine Graduate Program,
Johns Hopkins University School of Medicine, Baltimore, MD, USA; Department of
Oncology, The Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University
School of Medicine, Baltimore, MD, USA
YUSUKE KURODA Department of Cardiovascular Research, Research Institute of
Environmental Medicine, Nagoya University, Aichi, Japan
K. W. H. LAI Cardiology Division, Department of Medicine, Li Ka Shing Faculty of
Medicine, The University of Hong Kong, Hong Kong, China
MAJLINDA LAKO Institute of Genetic Medicine, Newcastle University, Newcastle-upon-
Tyne, UK
V. Y. M. LAU Cardiology Division, Department of Medicine, Li Ka Shing Faculty of
YEE KI LEE Cardiology Division, Department of Medicine, Li Ka Shing Faculty of
AMY LEUNG School of Medicine and the Center for Regenerative Medicine (CReM),
Boston University, Boston, MA, USA
SHISHI LI Institute of Genetics, College of Life Sciences, Zhejiang University, Hangzhou,
Zhejiang, China
XUE-JUN LI Department of Neuroscience, University of Connecticut Health Center,
Farmington, CT, USA; The Stem Cell Institute, University of Connecticut Health Center,
Farmington, CT, USA
YAO LI Barbara and Donald Jonas Laboratory of Stem Cell and Regenerative Medicine,
Department of Ophthalmology, Columbia University, New York, NY, USA; Bernard and
Shirlee Brown Glaucoma Laboratory, Department of Ophthalmology, Columbia
University, New York, NY, USA
ELENA MATSA Department of Medicine (Division of Cardiology), Stanford
CHRISTINE L. MUMMERY Department of Anatomy and Embryology, Leiden University
GEORGE J MURPHY School of Medicine and the Center for Regenerative Medicine (CReM),
Boston University, Boston, MA, USA
HIROKO NAKAHAMA Humanitas Clinical and Research Center, Rozzano, MI, Italy
AMIT C. NATHWANI UCL Cancer Institute, University College London, London, UK
Contributors xi
HUY V. NGUYEN Columbia University College of Physicians and Surgeons, New York, NY,
USA
TAMER T. ÖNDER School of Medicine, Koç University, Istanbul, Turkey
HUAYE PAN Institute of Genetics, College of Life Sciences, Zhejiang University, Hangzhou,
Zhejiang, China
SYMEON PAPADOPOULOS Center for Physiology and Pathophysiology, Institute for Vegetative
Physiology, Medical Faculty, University of Cologne, Cologne, Germany
ELISA DI PASQUALE Humanitas Clinical and Research Center, Rozzano, MI, Italy;
Istituto di Ricerca Genetica e Biomedica, National Research Council of Italy, Milan,
Italy; Humanitas Clinical and Research Center, Rozzano, MI, Italy
NEHA PRASAD Department of Oncology, The Sidney Kimmel Comprehensive Cancer
Center, Johns Hopkins University School of Medicine, Baltimore, MD, USA
DAJIANG QIN Guangzhou Institutes of Biomedicine and Health, Chinese Academy of
Sciences, Guangzhou, China
OSCAR QUINTANA-BUSTAMANTE Differentiation and Cytometry Unit, Hematopoietic
Innovative Therapies Division, Centro de Investigaciones Energéticas, Medioambientales y
Tecnológicas (CIEMAT) – Centro de Investigaciones Biomédicas en Red de Enfermedades
Raras (CIBERER) – Instituto de Investigación Sanitaria Fundación Jiménez Dı́az
(IIS-FJD), Madrid, Spain
X. RAN Cardiology Division Department of Medicine, Li Ka Shing Faculty of Medicine,
The University of Hong Kong, Hong Kong, China
HIDETOSHI SAKURAI Center for iPS Cell Research and Application (CiRA), Kyoto
University, Kyoto, Japan
IRENE SANCHEZ-VERA Institute of Genetic Medicine, Newcastle University, Newcastle-
upon-Tyne, UK
TOMO ŠARIC´ • Center for Physiology and Pathophysiology, Institute for Neurophysiology,
Medical Faculty, University of Cologne, Cologne, Germany
JOSE C. SEGOVIA Differentiation and Cytometry Unit, Hematopoietic Innovative
Therapies Division., Centro de Investigaciones Energéticas, Medioambientales y
Tecnológicas (CIEMAT) - Centro de Investigaciones Biomédicas en Red de Enfermedades
Raras (CIBERER) - Instituto de Investigación Sanitaria Fundación Jiménez Dı́az
(IIS-FJD), Madrid, Spain
TOMOHISA SEKI Department of Cardiology, Keio University School of Medicine, Tokyo,
Japan
ARUN SHARMA Department of Medicine (Division of Cardiology), Stanford
FARAH SHEIKH Cardiology Division, Department of Medicine, University of
California-San Diego, La Jolla, CA, USA
EMI SHOJI Center for iPS Cell Research and Application (CiRA), Kyoto University,
Kyoto, Japan
XIULI SIM School of Medicine, University of Pennsylvania, Philadelphia, PA, USA;
Center for Cellular and Molecular Therapeutics, The Children’s Hospital of Philadelphia,
Philadelphia, PA, USA
D. C. W. SIU Cardiology Division, Department of Medicine, Li Ka Shing Faculty of
Medicine, The University of Hong Kong, Hong Kong, China; Research Center of Heart,
Brain, Hormone and Healthy Aging, Li Ka Shing Faculty of Medicine, The University of
Hong Kong, Hong Kong, SAR, China; Shenzhen Institutes of Research and Innovation,
xii Contributors
University of Hong Kong, Hong Kong, China; Division of Cardiology, Queen Mary
Hospital, Hong Kong, China
RENUKA SIVAPATHAM Buck Institute for Research on Aging, Novato, CA, USA
DAVID STEEL Institute of Genetic Medicine, Newcastle University, Newcastle-upon-Tyne,
UK
ANU SUOMALAINEN Research Program of Molecular Neurology, Biomedicum-Helsinki,
University of Helsinki, Helsinki, Finland; Department of Neurology, Helsinki University
Central Hospital, Helsinki, Finland; Neuroscience Centre, University of Helsinki,
Helsinki, Finland
TOMOYUKI SUZUKI Department of Cardiovascular Research, Research Institute of
Environmental Medicine, Nagoya University, Aichi, Japan
LIPENG TIAN Department of Oncology, The Sidney Kimmel Comprehensive Cancer Center,
Johns Hopkins University School of Medicine, Baltimore, MD, USA
SHUGO TOHYAMA Department of Cardiology, Keio University School of Medicine, Tokyo,
Japan
MICHAELA TRILCK Albrecht-Kossel-Institute for Neuroregeneration (AKos), University of
STEPHEN H. TSANG New York Presbyterian Hospital/Columbia University Medical
Center, New York, NY, USA; Department of Pathology and Cell Biology, Columbia
University, New York, NY, USA; Edward Harkness Eye Institute, New York, NY, USA
H. F. TSE Cardiology Division, Department of Medicine, Li Ka Shing Faculty of
Medicine, The University of Hong Kong, Hong Kong, China; Research Center of Heart,
Brain, Hormone and Healthy Aging, Li Ka Shing Faculty of Medicine, The University of
Hong Kong, Hong Kong, SAR, China; Shenzhen Institutes of Research and Innovation,
University of Hong Kong, Hong Kong, China; Hong Kong-Guangdong Joint Laboratory
on Stem Cell and Regenerative Medicine, Hong Kong, China; Division of Cardiology,
Queen Mary Hospital, Hong Kong, China
ANNA WALTER Center for Physiology and Pathophysiology, Institute for Vegetative
Physiology, Medical Faculty, University of Cologne, Cologne, Germany
KNUT WOLTJEN Center for iPS Cell Research and Application (CiRA), Kyoto University,
Kyoto, Japan
JOSEPH C. WU Department of Medicine (Division of Cardiology), Stanford
HAODI WU Department of Medicine (Division of Cardiology), Stanford Cardiovascular
Institute, Institute for Stem Cell Biology and Regenerative Medicine, Stanford University
School of Medicine, Stanford, CA, USA
CHONG-CHONG XU Department of Neuroscience, University of Connecticut Health
Center, Farmington, CT, USA
QINGFENG YAN Institute of Genetics, College of Life Sciences, Zhejiang University,
Hangzhou, Zhejiang, China
WEI YANG Institute of Genetics, College of Life Sciences, Zhejiang University, Hangzhou,
Zhejiang, China
SHINSUKE YUASA Department of Cardiology, Keio University School of Medicine, Tokyo,
Japan
FABIAN ZANELLA Cardiology Division, Department of Medicine, University of California-
San Diego, La Jolla, CA, USA
XIANMIN ZENG Buck Institute for Research on Aging, Novato, CA, USA
Contributors xiii
XUAN ZHANG Institute of Genetics, College of Life Sciences, Zhejiang University,

Hangzhou, Zhejiang, China
XUFEN ZHU Institute of Genetics, College of Life Sciences, Zhejiang University, Hangzhou,
Zhejiang, China
Methods in Molecular Biology (2016) 1353: 1–11
DOI 10.1007/7651_2014_170
© Springer Science+Business Media New York 2014
Published online: 19 December 2014
Generation of Patient-Specific induced Pluripotent Stem

Cell from Peripheral Blood Mononuclear Cells by Sendai
Reprogramming Vectors
Oscar Quintana-Bustamante and Jose C. Segovia
Abstract
Induced pluripotent stem cells (iPSC) technology has changed preclinical research since their generation
was described by Shinya Yamanaka in 2006. iPSCs are derived from somatic cells after being reprogrammed
back to an embryonic state by specific combination of reprogramming factors. These reprogrammed cells
resemble all the characteristic of embryonic stem cells (ESC). The reprogramming technology is even more
valuable to research diseases biology and treatment by opening gene and cell therapies in own patient’s
iPSC. Patient-specific iPSC can be generated from a large variety of patient cells by any of the myriad of
reprogramming platforms described. Here, we describe the generation of patient-specific iPSC from patient
peripheral blood mononuclear cells by Sendai Reprogramming vectors.
Keywords: Patient-Specific induced Pluripotent Stem Cell, Peripheral blood mononuclear cells,
Sendai vectors, Reprogramming, Pluripotency, Self-renewal
1 Introduction
The generation of induced pluripotent stem cells (iPSC) described

by Shinya Yamanaka (1–3) has meant a new stage in biomedicine.
Although somatic cells can be reprogrammed back to an embryonic
state by cell fusion or nuclear transfer since long time ago, only few
laboratories had cell reprogramming technology applied to a limit
number of cell types from a reduce variety of species. However, when
Shinya Yamanaka described for the first time a simple method to
reprogram mouse (1, 2) and human fibroblasts (2) back to a plurip-
otent state by the delivery of four embryonic transcription factors
(OCT4, SOX2, KLF4, and cMYC), cell reprogramming was broadly
opened to the research community. This newly described technology
was widely expanded by its high reproducibility and easy implemen-
tation. Quickly, the original iPSC technology was modified regard-
ing combinations of reprogramming factors (4–6), their delivery
method (7–12), or the cell type to be reprogrammed (3, 13–16).
More importantly, iPSC platforms were used to reprogram back
somatic cells from patients of numerous genetic diseases (17).
1
2 Oscar Quintana-Bustamante and Jose C. Segovia
These patient-specific iPSCs show self-renewal and pluripotency

similar to embryonic stem cells (ESC), which are leading up the
development of new autologous cell and gene therapy approaches
(17) and compelling disease models (18). Here, we described a
simple method to generate patient-specific iPSC from peripheral
blood mononuclear cells (PB-MNC) by Sendai Reprogramming
vectors (SeV). PB-MNC means a noninvasive, easily accessible, and
routine somatic cell source in the clinic. SeV implies an integration-
free and self-erasable reprogramming system, since these viruses are
no genotoxic, are able to infect a wide range of cell types with high
transduction efficiency, and are eliminated from the cell once repro-
grammed because of their lower replication rate compared to the
iPSC one. We have successfully reprogrammed PB-MNC samples
from healthy donors and from anemic patients, indicating the effi-
cacy of the reprogramming protocol described here.
2 Materials
All the procedures described here are based on our feeder-

dependent iPSC culture; however, this system can be adapted to
other iPSC culture conditions.
2.1 General 1. Biohazard safety cabinet certified for handling of biological

Equipment materials.
2. Incubator set at 37 C with 5 % CO2 and 95 % humidity.
3. Standard light microscope for cell counting.
4. Stereomicroscope equipped with a zoom from 1 to 6.3 and
thermo plate able to heat at 37 C. The stereomicroscope has to
be placed in a biological safety cabinet.
5. Laboratory centrifuge.
6. Vortex.
7. Laboratory water bath.
8. Pipette-aid.
9. Micropipettors.
10. Stripper (MidAtlantic Diagnostics, Inc., Marlton, NJ, USA)
equipped with 200 μm stripper tips.
11. Neubauer hemocytometer.
12. 15 mL conical tubes.
13. 50 mL conical tubes.
14. Tissue culture treated 6-well plates.
15. Tissue culture treated 24-well plates.
16. Tissue culture treated p100 plates.
Generation of Patient-Specific Induced Pluripotent Stem Cell. . . 3
17. Tissue culture treated p150 plates.

18. Cryotubes.
19. Mr. Frosty Freezing container (Thermo Fisher Scientific, Wal-
tham, MA, USA).
20. Cryogenic tank.
2.2 Peripheral Blood 1. PBE buffer: Dulbecco’s phosphate buffered saline without
Mononuclear Cell calcium chloride and magnesium chloride (PBS, Sigma-
Aldrich, St. Louis, MO, USA)/0.5 % v/v bovine serum albu-
min (BSA, Sigma-Aldrich)/2 mM ethylenediaminetetraacetic
acid (EDTA, Sigma-Aldrich). Filtered through a 0.22 μm filter.
2. Ficoll-Paque Plus (density 1.077, GE Healthcare Life Science,
Madrid, Spain).
3. T€urk’s solution: 1 mL of 1 % w/v aqueous methylene blue
solution (Sigma-Aldrich)/2 % acetic acid in water.
4. Trypan Blue Solution (Life Technologies, Madrid, Spain).
5. Dimethyl sulfoxide (DMSO, Sigma-Aldrich).
6. Hyclone Fetal Bovine Serum (FBS, GE Healthcare Life Science).
7. Penicillin-Streptomycin (PS, Life Technologies).
2.3 SeV 1. StemSpan™ SFEM (STEMCELL Technologies, Vancouver,

Reprogramming Canada).
2. Human Stem Cell Factor (hSCF, EuroBiosciences, Friesoythe,
Germany).
3. Human Fms-related tyrosine kinase 3 ligand (hFLT3L,
EuroBiosciences).
4. Human thrombopoietin (hTPO, EuroBiosciences).
5. Human granulocyte colony-stimulating factor (G-CSF, Neu-
lasta, Amgen, Barcelona, Spain).
6. Human interleukin 3 (hIL3, EuroBiosciences).
7. PB-MNC medium: 0.22 μm filtered StemSpan™ SFEM/
100 ng/mL hSCF/100 ng/mL hFLT3L/20 ng/mL
hTPO/10 ng/mL G-CSF/2 ng/mL hIL3/0.5 % PS.
8. CytoTune®-iPS Sendai Reprogramming Kit (Life
Technologies).
2.4 Human-Induced 1. Dulbecco’s Modified Eagle Medium (DMEM, Life

Pluripotent Cell Technologies).
Culture 2. hFGF-basic (154 aa) (Peprotech, Rocky Hill, NJ, USA).
3. Knockout™ DMEM medium (KO-DMEM, Life Technologies).
4. MEM Nonessential Amino Acids Solution (NEAA, Life
Technologies).
5. GlutaMAX™ supplement (Life Technologies).

6. Knockout™ Serum Replacement (KO-SR, Life Technologies).
7. 2-Mercaptoethanol (Life Technologies).
8. Gelatin solution: 0.22 μm filtered 0.1 % gelatin (Sigma-
Aldrich) in water.
9. TrypLE™ Select (Life Technologies).
10. Feeder medium: 0.22 μm filtered DMEM/20 % FBS/1 %
GlutaMAX/1 % NEAA/1 % PS.
11. hES medium: 0.22 μm filtered KO-DMEM/1 % NEEA/1 %
GlutaMAX/0.5 % PS/20 % KO-SR/50 μM 2-mercaptoetha-
nol/10 ng/mL hFGF-basic.
12. Human foreskin fibroblast (HFF-1, ATCC, Barcelona, Spain).
13. Mouse embryonic fibroblast CF-1 (MEF, ATCC).
14. Collagenase IV solution: dissolve 10 mg/mL of Collagenase
IV (Life Technologies) in KO-DMEM. Dilute this first solu-
tion to 1 mg/mL Collagenase IV and filter it by 0.22 μm filter.
Collagenase IV concentration can be kept at 20 C; however,
they lose activity very quickly at 4 C.
15. Y-27632 (Rock Inhibitor, Reagents Direct, Encinitas, CA).
3 Methods
All procedures for cell processing should be performed using sterile

technique and universal handling precautions in a biological safety
cabinet. ESC/iPSC culture skills are required.
3.1 Peripheral Blood 1. Collect 5–10 mL peripheral blood (PB) by standard proce-
Mononuclear Cell dures. Keep it at room temperature in the presence of an
Purification anticoagulant.
2. Mix the PB with twice the volume of PBE buffer.
3. Add 5 mL of Ficoll-Paque Plus to a 15 mL conical tube (see
Note 1).
4. Slowly layer 10 mL of PB on top of the Ficoll-Paque Plus (see
Note 2) (Fig. 1). Avoid disturbing the two layers (see Note 3).
5. Centrifuge at 400 g for 25 min at room temperature with
the centrifuge brake off.
6. The sample will be separated in different layers by a density
gradient (Fig. 1). Handle the tube very carefully not to alter the
layer distribution.
7. Remove the plasma upper layer by a sterile pipette. Care not to
disturb the white layer of PB-MNC underneath. Keep part of
this plasma to analyze mycoplasma contamination in the sample
(see Note 4).
Plasma
Peripheral
Blood PB-MNC
400 x g
Ficoll-Paque
25 minutes
Ficoll-Paque
Granulocytes
Red Blood Cells
Fig. 1 Diagram shows the layer distribution before and after Ficoll-Paque
gradient is formed by centrifugation. Different cell layers are indicated
8. Take off thoroughly with the tip of a pipette 5 mL any cell

clump stuck in the tube wall in the PB-MNC layer.
9. Remove the PB-MNC layer and transfer it to a 15 mL conical
tube.
10. Wash this cell suspension by adding enough PBE volume to
dilute any Ficoll-Paque Plus still present. Centrifuge at
300 g at room temperature for 7 min with brake on.
11. Discard the supernatant without disrupting the PB-MNC
pellet.
12. Resuspend the PB-MNC pellet by adding 1 mL of PBE.
13. Dilute a small aliquot of cell suspension with T€
urk’s solution
(see Note 5). Count it in the Neubauer hemacytometer.
14. PB-MNC can be used freshly in the next step or can be frozen
(see Note 6).
3.2 Irradiated HFF-1 1. Grow primary fibroblast in gelatin-coated p150 plate with
(irHFF-1) or Irradiated feeder medium (25 mL/p150 plate).
MEF (irMEF) 2. When the feeder is close to confluence, wash it with PBS
Preparation (Sigma-Aldrich) and detach the cells from the plate by adding
10 mL of TrypLE™ Select/plate and treatment at 37 C for
5–7 min.
3. Collect the cells in a 15 mL conical and wash the plate with
5 mL of PBS/5 % FBS. Centrifuge the cell suspension at
300 g for 7 min.
4. Resuspend the cells in feeder medium and seed into new
gelatin-coated p150 at 1.7 104 cell/cm2 cell density with
22–25 mL feeder medium.
5. Expand the primary feeders up to four to five passage. To
irradiate the primary fibroblasts, wash the cells with PBS and
treat by TrypLE™ Select to detach them.
6. Collect the cells in 50 mL conical tube and centrifuge. Resus-

pend the cells in fresh feeder medium.
7. Irradiate the cell suspension with 45 Gy using a Philips MG324
X-ray equipment (Philips, Hamburg, Germany) set at 300 kV,
10 mA, delivering a dose rate of 1.03 Gy/min.
8. Centrifuge the irradiated fibroblasts at 300 g for 7 min.
Resuspend in feeder medium and count cell concentration.
Adjust cell concentration to get 8 106 cells/mL.
9. Distribute 4 106 irradiated fibroblasts per each cryotube.
Add 500 μL of chill 20 % DMSO/80 % FBS in each cryotube.
Keep all the cryotubes in a Mr. Frosty Freezing container at
80 C. After 24–48 h, transfer the cryotubes to a cryogenic
tank.
3.3 Plate Coating by 1. Cover the plate surface with gelatin solution, and keep at 37 C
Irradiated Feeder for at least 30 min.
2. Thaw an irradiated fibroblast cryotube in a 37 C water bath.
Transfer thawed cell to 15 mL conical tube. Dilute cell suspen-
sion by adding 10 mL of feeder medium. Centrifuge at
300 g for 7 min. Resuspend the cells in feeder medium.
Count by treating with Trypan Blue to exclude dead cells.
3. Remove gelatin solution from the 37 C warm plate and add
feeder medium containing the cells. Add enough volume of cell
suspension to the plate to get 0.7–1.5 104 cell/cm2. Allow
cells to attach for at least 12 h. Keep at 37 C until using.
4. Before adding hiPSC, wash the plate with KO-DMEM. Dis-
card nonused feeder-coated plates after 4 days to be seeded.
3.4 Generation of 1. Culture PB-MNC up to 5 105 cells per mL in PB-MNC

PB-MNC hiPSC by SeV medium (see Notes 7 and 8).
2. Keep the cells at 37 C for 4 days (see Note 9).
3. Transfer the cell suspension into a 15 mL conical tube. Wash
the plate thoroughly with StemSpan™ SFEM to collect the
remained cells.
4. Centrifuge cells at 300 g at room temperature for 7 min.
5. Aspirate supernatant (being careful not to disturb the cell
pellet).
6. Dilute the cell pellet in StemSpan™ SFEM/0.5 % PS.
7. Count by T€
urk’s or Trypan Blue solution.
8. Adjust the cell concentration to 1 106 cells per mL in PB-
MNC medium.
9. Mix SeV from CytoTune®-iPS Sendai Reprogramming Kit in a

same volume of PB-MNC medium as the cell suspension vol-
ume (see Note 10).
10. Keep the cells at 37 C overnight.
11. Wash the cells by transferring to a 15 mL conical tube and
spinning down at 300 g at room temperature for 7 min.
12. Resuspend the infected PB-MNC in PB-MNC medium at
5 105 cells per mL.
13. Keep the cells at 37 C for 4 days.
14. Observe the cells dairy (Fig. 2) (see Note 11).
15. Supplement the medium with 10 ng/mL hFGF-basic after 4
days of infection.
Cytokine
Reprogramming PB-MNC iPSC expansion
instruction
Day: 0 4 5 8 9 20-40
PB-MNC
PB-MNC
iPS
irHFF-1
SeV hFGF-basic
Fig. 2 Scheme of the PB-MNC reprogramming by SeV. Representative images of each stage are showed.
Initial heterogeneous population of PB-MNC are instructed by a specific cytokine combination (left panel).
Reprogramming process, where the SeV-infected PB-MNCs proliferate and change their morphology (middle
panel). Complete PB-MNC iPSC clone generated by SeV reprogramming (right panel). Azami Green SeV was
added to the SeV reprogramming cocktail to be able to track the reprogramming process. All the pictures were
taken at 100 magnification
16. Next day, collect the cells and transfer to 15 mL conical tube,-
centrifuge at 200 g at room temperature for 5 min (see
Note 12).
17. Resuspend the cells in hES medium.
18. Transfer 5 104 SeV-infected PB-MNC to an irHFF-coated
p100 plate and add up to 10 mL of hES medium (see Note 13).
19. Replace hES medium every 2 days for warm fresh hES medium;
avoid to disturb the cells.
20. Some hES-like colonies will appear on the irHFF. Pick these
hES-like colonies under the stereomicroscope by the stripper
and transfer the colony fragments to an irHFF-coated p24 well
with hES medium (see Notes 14 and 15).
3.5 PB-MNC hiPSC 1. Passage these PB-MNC hiPS clones every 5–7 days using con-
Culture ventional hES procedures:
2. Manual picking: under the stereomicroscope break up the
colonies by the stripper tip or by a 10 μL tip. Transfer to a
15 mL conical tube and centrifuge at 200 g for 2 min.
Discard the supernatant carefully without disturbing the cell
pellet. Resuspend the cells with fresh hES medium, mix by a
soft twice to three times pipetting. Transfer to a new irHFF-1-
coated plate.
3. Collagenase IV treatment: wash the hiPSC culture by KO-
DMEM. Incubate for 5 min at 37 C with Collagenase IV
solution. Pick up the colonies by stripper tip or by a 10 μL tip
under the stereomicroscope. Transfer to a 15 mL conical tube
and centrifuge at 200 g for 2 min. Discard the supernatant
carefully without disrupting the cell pellet. Resuspend the cells
with fresh hES medium, mix by a soft pipetting for five to six
times to divide the colonies in a small fragments without break-
ing up them to a single cell suspension. Transfer to a new
irHFF-1-coated plate.
4. Expand each PB-MNC iPSC clone independently (see Notes
16–18).
5. Cryopreserve part of each PB-MNC iPSC clone when there are
enough number of iPSC colonies (around 15–20 colonies). To
cryopreserve iPSC, the culture has to be pretreated by hES
medium supplemented by 10 μM Rock inhibitor for at least
1 h. Then, break up the colonies in large fragments. Collect the
iPSC fragments in a 15 mL conical tube. Spin down at 200 g
for 2 min. Discard the supernatant. Resuspend in 500 μL of
chill FBS and transfer to a cryotube. Mix in the cryotube with
500 μL of freshly prepared 20 % FBS/80 % DMSO. Keep for
24 h at 80 C. Transfer for a long storage to a cryogenic tank
(see Note 19).
6. The rest of each PB-MNC iPSC clone will be expanded by

further pluripotency characterization and SeV clearance (see
Notes 20 and 21).
4 Notes
1. Ficoll-Paque Plus should be warmed to room temperature

before using.
2. Different PB volumes can be used while PB:Ficoll-Paque Plus
ratio will be kept.
3. If the layers are disturbed, different layers will not form after
centrifugation.
4. Mycoplasma contamination in a sample avoids iPSC genera-
tion. Everything involved in iPSC generation/culture must be
mycoplasma-free.
5. The acetic acid present in the T€
urk’s solution destroys red
blood cells (RBC) from the PB-MNC suspension, facilitating
the cell counting.
6. Hematopoietic cells are frozen by diluting 1:1 the cell suspen-
sion with 20 % DMSO/80 % Hyclone FBS at 2 106–2 107
cell per 1 mL cryotube. The cryotubes have to be kept in a Mr.
Frosty Freezing (Thermo Scientific) container at 80 C for
24 h and then transfer to a cryogenic tank.
7. Cytokine combination is a key factor to lead reprogramming
from a specific hematopoietic lineage (19). The cytokine com-
bination described here promotes cell reprogramming by SeV
from hematopoietic progenitors and/or myeloid cells, avoiding
T or B lymphocytes. Other cytokines can be tested to address
reprogramming of different cell types.
8. PB-MNC should be placed in the central wells of the plate, and
surrounding wells must be filled with PBS or water to avoid the
evaporation of PB-MNC medium.
9. Either massive cell death or cell proliferation can be observed.
Washing of cells is recommended when cell death occurs or
addition of fresh medium to maintain cell concentration when
proliferation happens.
10. SeV must be kept on dry ice until addition to the medium.
Avoid repeated freezing and thawing of SeV. The multiplicity
of infection (MOI) of each SeV carrying each Yamanaka’s
factor should be 3, meaning three SeV infectious particles of
each reprogramming factor per cell. Additionally a SeV coding
for a reporter gene (i.e., Azami Green) can be included to
visualize the percentage of transduction.
11. 24–48 h post SeV infection, some fluorescent green cells will
appear if Azami Green SeV was added to the reprogramming
SeV cocktail. During these 4 days after SeV infection, morpho-
logical changes will be observed, such as the presence of highly
proliferative large cells (Fig. 2).
12. Since some cells are being reprogrammed, the centrifugation
speed must be reduced to avoid the killing of these fragile cells.
13. Irradiated feeder must be prepared the day before. irHFF-1 or
irMEF can be used. Before adding the cells, feeder density
has to be checked, and feeder medium must be washed by
KO-DMEM.
14. The first hES-like colonies will appear around day 5–7 post
infection; however, these colonies are usually unstable, and
they are not able to be expanded as hES-like cells. The more
stable and with correct morphology, hES-like colonies will
appear 2 weeks after SeV infection.
15. In our experience, when SeV reprogramming is successful, one
hiPSC-derived PB-MNC was generated per 6,000 PB-MNCs.
16. We were able to maintain around one sixth of the picked
colonies when SeV reprogramming was successful.
17. The PB-MNC iPSC culture has to reach a 50–60 % confluence,
and then the cells can be split from one plate to four to six
plates.
18. To expand hiPSC quickly, Rock inhibitor can be added to the
hES medium in each passage for few passages, because if iPSCs
get used to Rock inhibitor, they lessen their properties.
19. To thaw the frozen iPSC clones, introduce the frozen cryovial
in a 37 C water bath. Transfer the cell suspension to a 15 mL
conical tube and add slowly 10 mL of hES medium. Spin down
at 200 g for 2 min. Resuspend the cell softly with hES
medium/10 μM Rock inhibitor, and seed the hiPSC in a new
HFF-1-coated 6-well plate with hES medium/10 μM Rock
inhibitor. Keep at 37 C for 48 h without disturbing. Change
the medium daily.
20. Standard pluripotency test will consist in analysis of embryonic
gene expression, such as OCT4, NANOG, SSEA4, Tra-1-60,
SOX2, cMYC, and REX-1, by qRT-PCR and immunofluores-
cence, karyotype, embryo body, and teratoma formation.
21. SeV clearance will be assessed by disappearance of Azami Green
fluorescence, when Azami Green SeV is added to the SeV
reprogramming cocktail, and by RT-PCR using specific primers
(SeV F GGATCACTAGGTGATATCGAGC and SeV R
ACCAGACAAGAGTTTAAGAGATATGTATC).
Acknowledgments
This work was supported by the following grants: Dirección

General de Investigación de la Comunidad de Madrid (CellCAM;
Ref S2010/BMD-2420), Fondo de Investigaciones Sanitarias,
Instituto de Salud Carlos III (RETICS-RD12/0019/0023), and
MINECO (SAF2011-30526-C02-01).
References
1. Takahashi K, Yamanaka S (2006) Induction of Hashimoto H, Kodaira M et al (2010) Genera-

pluripotent stem cells from mouse embryonic tion of induced pluripotent stem cells from
and adult fibroblast cultures by defined factors. human terminally differentiated circulating T
Cell 126:663–676 cells. Cell Stem Cell 7:11–14
2. Okita K, Ichisaka T, Yamanaka S (2007) Gen- 11. Park HY, Noh EH, Chung HM, Kang MJ, Kim
eration of germline-competent induced plurip- EY, Park SP (2012) Efficient generation of
otent stem cells. Nature 448:313–317 virus-free iPS cells using liposomal magneto-
3. Takahashi K, Tanabe K, Ohnuki M, Narita M, fection. PLoS One 7:e45812
Ichisaka T, Tomoda K, Yamanaka S (2007) 12. Kaji K, Norrby K, Paca A, Mileikovsky M,
Induction of pluripotent stem cells from adult Mohseni P, Woltjen K (2009) Virus-free induc-
human fibroblasts by defined factors. Cell tion of pluripotency and subsequent excision of
131:861–872 reprogramming factors. Nature 458:771–775
4. Yu J, Vodyanik MA, Smuga-Otto K, 13. Wernig M, Meissner A, Foreman R, Brambrink
Antosiewicz-Bourget J, Frane JL, Tian S, Nie T, Ku M, Hochedlinger K, Bernstein BE, Jae-
J, Jonsdottir GA, Ruotti V, Stewart R et al nisch R (2007) In vitro reprogramming of
(2007) Induced pluripotent stem cell lines fibroblasts into a pluripotent ES-cell-like state.
derived from human somatic cells. Science Nature 448:318–324
318:1917–1920 14. Aoi T, Yae K, Nakagawa M, Ichisaka T, Okita
5. Judson RL, Babiarz JE, Venere M, Blelloch R K, Takahashi K, Chiba T, Yamanaka S (2008)
(2009) Embryonic stem cell-specific micro- Generation of pluripotent stem cells from adult
RNAs promote induced pluripotency. Nat Bio- mouse liver and stomach cells. Science
technol 27:459–461 321:699–702
6. Hou P, Li Y, Zhang X, Liu C, Guan J, Li H, 15. Haase A, Olmer R, Schwanke K, Wunderlich S,
Zhao T, Ye J, Yang W, Liu K et al (2013) Merkert S, Hess C, Zweigerdt R, Gruh I,
Pluripotent stem cells induced from mouse Meyer J, Wagner S et al (2009) Generation of
somatic cells by small-molecule compounds. induced pluripotent stem cells from human
Science 341:651–654 cord blood. Cell Stem Cell 5:434–441
7. Sommer CA, Stadtfeld M, Murphy GJ, Hoche- 16. Loh YH, Agarwal S, Park IH, Urbach A, Huo
dlinger K, Kotton DN, Mostoslavsky G (2009) H, Heffner GC, Kim K, Miller JD, Ng K, Daley
Induced pluripotent stem cell generation using GQ (2009) Generation of induced pluripotent
a single lentiviral stem cell cassette. Stem Cells stem cells from human blood. Blood
27:543–549 113:5476–5479
8. Cho HJ, Lee CS, Kwon YW, Paek JS, Lee SH, 17. Garate Z, Davis BR, Quintana-Bustamante O,
Hur J, Lee EJ, Roh TY, Chu IS, Leem SH et al Segovia JC (2013) New frontier in regenerative
(2010) Induction of pluripotent stem cells medicine: site-specific gene correction in
from adult somatic cells by protein-based patient-specific induced pluripotent stem cells.
reprogramming without genetic manipulation. Hum Gene Ther 24:571–583
Blood 116:386–395 18. Saha K, Jaenisch R (2009) Technical challenges
9. Warren L, Manos PD, Ahfeldt T, Loh YH, Li in using human induced pluripotent stem cells
H, Lau F, Ebina W, Mandal PK, Smith ZD, to model disease. Cell Stem Cell 5:584–595
Meissner A et al (2010) Highly efficient repro- 19. Staerk J, Dawlaty MM, Gao Q, Maetzel D,
gramming to pluripotency and directed differ- Hanna J, Sommer CA, Mostoslavsky G, Jae-
entiation of human cells with synthetic nisch R (2010) Reprogramming of human
modified mRNA. Cell Stem Cell 7:618–630 peripheral blood cells to induced pluripotent
10. Seki T, Yuasa S, Oda M, Egashira T, Yae K, stem cells. Cell Stem Cell 7:20–24
Kusumoto D, Nakata H, Tohyama S,
Methods in Molecular Biology (2016) 1353: 13-23
DOI 10.1007/7651_2014_179
© Springer Science+Business Media New York 2014
Published online: 29 January 2015
A Doxycycline-Inducible System for Genetic Correction

of iPSC Disease Models
Xiuli Sim*, Fabian L. Cardenas-Diaz*, Deborah L. French, and Paul Gadue
Abstract
Patient-derived induced pluripotent stem cells (iPSCs) are valuable tools for the study of developmental
biology and disease modeling. In both applications, genetic correction of patient iPSCs is a powerful
method to understand the specific contribution of a gene(s) in development or diseased state(s). Here, we
describe a protocol for the targeted integration of a doxycycline-inducible transgene expression system in a
safe harbor site in iPSCs. Our gene targeting strategy uses zinc finger nucleases (ZFNs) to enhance
homologous recombination at the AAVS1 safe harbor locus, thus increasing the efficiency of the
site-specific integration of the two targeting vectors that make up the doxycycline-inducible system.
Importantly, the use of dual-drug selection in our system increases the efficiency of positive selection for
double-targeted clones to >50 %, permitting a less laborious screening process. If desired, this protocol can
also be adapted to allow the use of tissue-specific promoters to drive gene expression instead of the
doxycycline-inducible promoter (TRE). Additionally, this protocol is also compatible with the use of
Transcription-Activator-Like Effector Nucleases (TALENs) or Clustered Regularly Interspaced Short
Palindromic Repeats (CRISPR)-Cas9 system in place of ZFNs.
Keywords: Genetic correction, Disease modeling, Homologous recombination, Doxycycline-

inducible expression, Gene targeting, Zinc finger nucleases
1 Introduction
In the characterization of iPSC disease models, a commonly used

strategy is to genetically manipulate the patient-derived iPSCs to
correct the disease phenotype, thus ascertaining the role of a spe-
cific gene in the disease. One way to genetically correct defects in
iPSC-based disease models is by the site-specific targeting of trans-
genes into a safe harbor locus. In human iPSCs, the AAVS1 gene
has been identified as a putative safe harbor locus (1–4), where we
have expressed a number of transgenes (5, 6).
This chapter describes a protocol for the generation of iPSC
lines with a doxycycline-inducible transgene expression system tar-
geted into both alleles of the AAVS1 safe harbor locus. To enhance
*Author contributed equally with all other contributors.

13
14 Xiuli Sim et al.
Donor plasmid SV40

CAG-rtTA NEO CAG rtTA PolyA
PolyA
Screening Primer Set2
SphI
1920bp
6.5Kb
AAVS1 SphI
Probe
SphI Screening Primer
Set 2-3
locus Zn Finger Nuclease site
Screening Primers
Set1 1380bp
SphI
Screening Primer Set3
Donor plasmid Rabbit Glob
TRE-GFP
PURO TRE GFP PolyA
Fig. 1 Design of targeting vectors. ZFNs specific to the AAVS1 locus will cut the DNA in intron 1 of AAVS1.
Integration of both targeting vectors will confer dual drug resistance to ESCs/iPSCs. The location of PCR
screening primers and Southern blot probe is indicated
Table 1
Percentage of selected clones that are correctly double-targeted from
three independent transfections
Number of Percentage of
Transfection Number of double-targeted double-targeted
attempt clones screened clones clones (%)
1 12 8 67
2 6 5 83
3 10 5 50
Overall 28 18 64
homologous recombination (7, 8), a pair of ZFNs are used to

induce a double-stranded break specifically in the AAVS1 locus.
The two targeting vectors with arms of homology to AAVS1
express reverse tet activator (rtTA) driven by a constitutive
promoter and a tet-response element (TRE) driving the gene of
interest (Fig. 1). If knock down of a gene is desired, short hairpins
directed against the gene of interest can be cloned downstream of
the TRE in the targeting construct. The two targeting vectors are
designed to confer dual-drug resistance to double-targeted clones.
Clones are screened using PCR to confirm the integration of the
targeting vectors and Southern blotting to identify the presence of
off-target integration. With the use of dual drug selection, on
average >50 % of selected clones are correctly double-targeted
(Table 1). The entire process takes about 3 weeks, excluding the
time needed for the clones to expand (Fig. 2). This protocol can
Doxycycline-Inducible Transgene Expression in iPSCs 15
DAY
-2 -1 0 2 6 18
Plate Matrigel1/3 Plate ES Cells Transfection Start puro Start G418 Pick colonies
+ DR4 MEFS selection for 48h selection for 10d and
(Puro 0.5ug/ml) (G418 40ug/ml) PCR screening
Puro G418
Fig. 2 Schematic outlining the processes involved in the generation of a doxycycline-inducible transgene
expression system in hESCs/iPSCs
a b
1400
1200
intensity of GFP
1000
% of cells
No dox 800
2 days in dox 600
Mean
8 days in dox 400
200
0
0 0.25 0.5 1 2
GFP
doxycycline ( g/ml)
Fig. 3 GFP expression in hematopoietic progenitors differentiated from hESC line with doxycycline-inducible
GFP expression under different conditions. (a) GFP expression in hematopoietic progenitors treated with
doxycycline for different lengths of time. Untreated hematopoietic progenitors (red ) do not express GFP.
Treatment with doxycycline for 2 days during differentiation is sufficient to induce GFP expression in
hematopoietic progenitors (blue). When doxycycline was given for 8 days, the induction of GFP expression
is stronger (black), suggesting that transgene expression does not get silenced when hESCs undergo
hematopoietic differentiation. (b) The level of GFP expression in hematopoietic progenitors increases with
the concentration of doxycycline added
also be adapted to accommodate the use of TALENs (8, 9) or

(CRISPR)-Cas9 system (8, 10–12) in place of ZFNs.
As a proof of concept, we have generated a doxycycline-
inducible human embryonic stem cell (hESC) line expressing
GFP. This line was generated using an earlier version of this proto-
col, which utilized single drug selection. We have differentiated this
line into hematopoietic progenitors or pancreatic beta cells and
observed that GFP expression is visible 2 days after the addition
of doxycycline and is maintained as long as doxycycline is present in
the system. Importantly, the expression of GFP is proportional to
the amount of doxycycline added and the length of time doxycy-
cline is present in the medium (Fig. 3). This implies that we can
induce a suitable, physiological level of transgene expression by
16 Xiuli Sim et al.
titrating different doses of doxycycline. Since then, we have devel-

oped an improved protocol described here, which uses dual drug
selection to increase the specificity of selection and decrease the
need to screen large numbers of clones.
2 Materials
2.1 Reagents and 1. PGK-AAVS1-ZFN-Left (addgene cat. no. #60915).

Supplies 2. PGK-AAVS1-ZFN-right (addgene cat. no. #60916).
2.1.1 Vectors Encoding
Zinc Finger Nucleases
Specific to the AAVS1
Locus
2.1.2 Targeting Vectors 1. AAVS1-SA-2A-NEO-CAG-RTTA3 (addgene cat. no. #60431).

To Be Integrated into the 2. AAVS1-SA-2A-PURO-TRE-eGFP (addgene cat. no. #22074)
AAVS1 Locus (GFP can be replaced by any gene of interest).
2.1.3 Transfection 1. Lipid transfection reagent: X-tremeGENE 9 DNA transfection

Reagent reagent (Roche Cat. no. 06 365 787 001).
2.1.4 Cell Culture Media 1. Dulbecco’s Modified Eagle’s Medium/Ham’s F12 50/50
and Reagents mix (DMEM/F12 50/50) (Corning Cellgro Cat. no.
10-092-CV).
2. Knockout™ Serum Replacement (Knockout™ SR) (Life Tech-
nologies Cat. no. 10828-028).
3. Penicillin Streptomycin Solution (Pen-Strep), 100 (Corning
Cellgro Cat. no. 30-002-Cl).
4. L-Glutamine Solution, 100 (Corning Cellgro Cat. no.
25-005-Cl).
5. MEM Nonessential Amino Acids (NEAA), 100 (Life Tech-
nologies Cat. no. 11140-050).
6. 2-Mercaptoethanol (55 mM) (Life Technologies Cat. no.
21985-023).
7. Iscove’s Modification of DMEM (IMDM) (Corning Cellgro
Cat. no. 10-016-CV).
8. PES Sterilizing 0.22 μm Filter System, Low Protein binding
(250 ml) (Corning Cat. no. 431096).
9. Dimethyl sulfoxide (DMSO) (Sigma Cat. no. D2650).
10. Fetal Bovine Serum (Tissue Culture Biologicals Cat. no. 101).
11. TrypLE™ Express (1), phenol red (Life Technologies Cat.
no. 12605-010).
Another random document with
no related content on Scribd:
10,000. One hundred and fifty-four of these were for families whose homes were
in the districts surveyed, but who were not at home at the time of the first survey.
These were omitted during the second survey, irrespective of whether individuals
were at home. In this group are also included a few in which children were at
home, but were unable to give reliable information. Fifteen of the 194 families
gave insufficient information, and 25 refused to co-operate. The small number in
this last group speaks well for the efficiency and methods of the inspectors. All
families accepted for tabulation co-operated to the best of their ability, and we
believe that the records are as accurate as this type of work may be made.
Dr. Niven, in the work referred to by Carnwath, made an inquiry covering
1,021 houses, with a population of 4,721. Five hundred and three households or
almost exactly one-half, were invaded in either the summer 1918, or the autumn-
winter 1918 epidemic. This proportion of families is quite similar to our own, but
it must be pointed out that Niven was not studying the same two epidemics that
we are discussing. Two hundred and sixty-six of his total households, or 26.05
per cent. were invaded in the autumn epidemic.
Previous to the present time the author has been unable to find records of
investigators having used this method of studying influenza to any appreciable
extent. Certainly there has been nothing done on the subject previous to the last
pandemic. Since then Frost has studied, as indicated in his report, family
incidence to the extent of determining the relationship to overcrowding and to
economic status, and Niven has studied family incidence with special reference
to immunity.
Thomas Sydenham, speaking of the epidemic of 1675, says that: “No one
escaped them whatever might be his age or temperament, and they ran through
whole families at once.”
According to Waldschmidt, during the epidemic of 1712, in Kiel, ten or more
persons were frequently taken ill in one house.
In 1732, Huxam tells us that, “not a house was free from it, the beggar’s hut
and the nobleman’s palace were alike subject to its attack, scarce a person
escaping either in town or country, old and young, strong and infirm, shared the
same fate.”
Metzger says that the influenza was so universal in March, 1782, that in very
many houses all of the inmates were attacked. On the other hand, Mertens did
not believe the influenza a contagion during the same epidemic for the reason
that according to his observations now only one, and again all, of the members of
a family, were stricken.
In 1833, in Königsberg, according to Hufeland, parents, children, and servants
were frequently smitten with the disease at the same time, so that strange help
had to be obtained for the family.
Parkes taught that, “Persons in overcrowded habitations have, particularly in
some epidemics, especially suffered, and several instances are on record of a
large school or a barrack for soldiers being first attacked, and of the disease
prevailing there for some days before it began to prevail in the town around.
Sometimes, on the other hand, schools and prisons have escaped. A low, damp,
ill-ventilated and unhealthy situation appears to predispose to it, and in some
instances, in hospital patients, it has assumed a malignant character. In other
cases again, hospital patients have escaped; for example, the old people in the
Salpêtrière in 1837, when the younger attendants were attacked.”
Effect of overcrowding.—The family or household forms a social unit in which
human intercourse is very close, and in which the opportunities for contact
infection either direct or indirect are manifold. In addition to all of the
opportunities which each individual has for contracting the disease outside of the
family every case in the family exposes every other member many times during
the day. One of the first questions arising in a study of the disease in the family
is, therefore, whether the size of the family in and of itself exerts any
predisposing influence on the total incidence in any one family. Are large
families more likely to have a greater percentage of cases than small families? We
have endeavored to answer this question by grouping together all families
containing only one individual, all of those with two, three, four, etc., and
determining the percentage of individuals contracting influenza in each of the
groups. The standard for comparison is the percentage of the total 10,000 who
contracted the disease in either year, or in both. 19.71 per cent. of all persons
canvassed contracted influenza in 1918–19. Reference to Table IV shows that of
persons living in families of one, 17.95 per cent. developed the disease; of those
in families of two, 18.46 per cent.; in families of three, 19.96 per cent.; in families
of four, 20.10 per cent.; and in families of from five to seven, between 22 and 23
per cent. Families of over seven all showed lower, but varying incidence of the
disease. As is seen by the table, they comprise only a small number of families.
TABLE IV.
The incidence of influenza in families of different sizes.
(Influence of size of family).
Total No. of Number of these individuals who
No. of individuals developed influenza.
No. of such
individuals included in 1918. 1920. Total.
families.
in family. all such Per Per Per
families. No. No. No.
cent. cent. cent.
1 39 39 7 17.95 3 7.69 10 24.42
2 260 520 96 18.46 55 10.58 151 29.04
3 359 1077 215 19.96 128 11.88 343 31.85
4 396 1584 319 20.10 169 10.67 488 30.81
5 375 1875 423 22.56 203 10.83 626 33.39
6 264 1584 361 22.79 151 9.53 512 32.32
7 179 1253 279 22.27 109 8.70 388 30.96
8 103 824 156 18.93 55 6.67 211 25.61
9 57 513 85 16.57 21 4.09 106 20.66
10 28 280 40 14.14 26 9.29 66 23.57
11 15 165 10 6.06 7 4.24 17 10.30
12 4 48 0 0.0 5 10.42 5 10.42
13 2 26 5 19.23 3 11.54 8 30.77
14 1 14 0 0.0 0 0.0 0 0.0
In 1920, 9.55 per cent. of the entire canvassed population contracted the
disease. The table shows that 7.69 per cent. of all individuals in families of one
contracted influenza, and between 10 and 12 per cent. in families of from two to
five individuals. Above the family of five the incidence rates again are lower and
varying within wide limits. The last column shows the percentage of individuals
by size of family contracting the disease in either or both epidemics.
The average size of all families was 4.7 individuals.
If we consider only those family groups having over 1,000 individuals as being
sufficiently large to be representative, we may conclude that families of from
three to seven individuals show no progressive increase in influenza incidence
with increase in size of the family. But all the available evidence indicates that
other things being equal, the age incidence is a very important factor. Its
influence will be felt in the subject under consideration, and it will modify the
results. Thus, families of one or two are almost invariably adults; families of
three are very frequently made up of two adults and a child or infant, while
families of from five to seven will be more likely to have a high proportion of
young adults—the age period more seriously affected.
The next question arising is whether those families, large or small, which are
living in crowded circumstances, are more likely to develop the disease. Arbitrary
standards must be chosen as indices of crowding. We have chosen two in order
that they may check each other. The first is based upon the number of
individuals sleeping in a bedroom. Families are classified as follows: Maximum
sleeping in a single bedroom, 1; maximum sleeping in a single bedroom, 2;
maximum per bedroom, 3, 4, etc.
The second standard of crowding is based upon the ratio of the number of
individuals in the family and the number of rooms occupied. One person living in
one room is not crowded; two in two rooms, three in three rooms, four in four
rooms, eight in eight rooms, twelve in twelve rooms, are not crowded. Two
people living in one room four in two rooms, six in three rooms, twelve in six
rooms, are decidedly more crowded. On the contrary, one individual in two
rooms, two in four, three in six, four in eight, five in ten, etc. have an unusual
amount of room.
The ratios P⁄R are then throughout, ¹⁄₁, ²⁄₁, ½. These are used as dividing lines.
All families with ratios higher than ²⁄₁ are classed as very crowded. Families with
ratios above ¹⁄₁ up to and including ²⁄₁ are classed as crowded. Families with
ratios above ½ up to and including ¹⁄₁ are classed as roomy, and those with ratio
of ½ or lower are classified as very roomy.
Classifying all families in all six districts according to these last four degrees of
crowding, we find, as is shown by Table V, that there is a progressive increase in
the proportion of families with one or more cases of the disease, with increase in
the extent of crowding.
According to the standard first described we find as is shown in Table VI that
families with three, four and five individuals sleeping in a single room show a
progressive increase of incidence over those families with but one or two per
bedroom. This again is shown best in the total for all families, but is borne out in
a study of each district. These statistics are however of little value for the study of
the effect of overcrowding, because crowded families are usually large families.
With an influenza incidence of 20 per cent. we would theoretically expect every
family of five or larger to have one or more cases. This would amount to 100 per
cent. infected families and such a state would not only influence, but dominate
the statistics regarding overcrowding.
TABLE V.
Effect of crowding on development of influenza in families.
(A higher proportion of crowded households than roomy are invaded).
(Standard used: ratio of number individuals to number rooms).
Proportion of these families visited by influenza.
In both
Total
No. of In 1918– epidemics
Living In 1920. families
such 19. (Recurrent)
conditions. invaded.
families. .
Per Per Per Per
No. No. No. No.
cent. cent. cent. cent.
District I.
V. Cr. 53 30 56.61 15 28.31 12 22.64 31 58.49
Cr. 195 107 54.87 59 30.26 43 22.05 123 63.08
R. 79 36 45.57 24 30.38 18 22.78 42 53.16
V. R. 16 7 43.75 1 6.6 0 0.0 8 50.00
District II.
V. Cr. 4 1 25.00 1 25.00 1 25.00 1 25.00
Cr. 137 70 51.09 31 22.63 2 8.76 89 64.96
R. 208 70 33.65 39 18.75 7 8.17 92 44.23
V. R. 103 20 19.42 7 6.80 2 1.94 25 24.27
District III.
V. Cr. 13 9 69.23 2 15.38 1 7.69 10 76.92
Cr. 213 99 46.48 65 30.52 40 18.78 124 58.22
R. 143 62 43.36 35 24.48 15 10.49 82 57.34
V. R. 21 8 27.59 2 6.89 2 6.89 8 38.09
District IV.
V. Cr. 0 0 0 0 0
Cr. 27 18 66.67 8 29.63 5 18.52 21 77.77
R. 137 72 52.55 50 36.49 21 15.33 101 73.72
V. R. 95 38 40.00 27 28.42 12 12.63 53 55.79
District V.
V. Cr. 6 2 33.33 4 66.67 2 33.33 4 66.67
Cr. 110 67 60.91 37 33.64 25 22.73 79 71.82
R. 209 104 49.76 70 33.49 38 18.18 146 69.86
V. R. 14 3 21.42 3 21.42 0 6 42.84
District VI.
V. Cr. 0 0 0 0 0
Cr. 2 1 50.00 0 0.0 0 0.0 1 50.00
R. 92 57 61.96 23 25.00 14 15.22 66 71.74
V. R. 189 65 34.39 46 24.34 19 10.05 92 48.68
Per Per Per
Living No. of No. No. No. Per
cent. cent. cent. Total.
conditions. families. 1918. 1920. both. cent.
1918. 1920. both.
Very
80 43 53.75 25 31.25 18 22.50 50 62.50
crowded
Crowded 693 372 53.68 201 29.00 126 18.18 447 64.50
Roomy 865 394 45.55 244 28.21 125 14.45 513 59.31
Very Roomy 443 143 32.28 87 19.64 36 8.13 194 43.79
Per Per Per Per
All Total 1918 1920 Both Total
2081 952 45.75 557 26.77 305 14.66 1204 57.86
TABLE VI.
Effect of crowding.
(Standard used: maximum number sleeping in one bed room.)
Proportion of these families with cases of
influenza.
Maximum No. No. of Total
In 1918– In both
sleeping per such In 1920. families
19. epidemics.
room. families. invaded.
Per Per Per Per
No. No. No. No.
District I.
1 16 6 37.50 4 25.00 3 18.75 7 93.75
2 93 52 55.91 31 33.33 20 21.51 63 67.74
3 145 65 44.83 47 32.41 27 18.62 85 58.62
4 79 43 54.43 25 31.65 17 21.52 51 64.56
5 24 11 45.83 11 45.83 6 25.00 16 66.67
6 10 3 30.00 3 30.00 1 10.00 5 50.00
District II.
1 90 15 16.67 7 7.77 2 2.22 20 22.22
2 211 68 32.23 36 17.06 14 6.64 90 42.65
3 115 59 51.30 23 20.00 10 8.69 72 66.61
4 33 20 60.60 11 33.33 6 18.18 25 75.76
5 3 1 33.33 2 66.67 1 33.33 2 66.67
6 0 0 0 0 0
District III.
1 26 10 38.46 3 11.54 2 7.69 11 42.31
2 179 73 40.78 47 26.26 23 12.85 97 54.19
3 145 72 49.66 37 25.52 23 15.86 86 59.31
4 39 20 51.28 15 38.46 8 20.51 27 69.23
5 8 5 62.50 2 25.00 1 12.50 6 75.00
6 0 0 0 0 0
District IV.
1 53 15 28.30 15 28.30 6 11.32 24 45.28
2 165 80 48.48 56 33.94 22 13.33 114 69.09
3 42 29 69.05 15 35.71 10 23.81 34 80.95
4 5 4 80.00 0 0.0 0 0.0 4 80.00
5 0 0 0 0.0 0 0
6 0 0 0 0 0
District V.
1 23 8 34.77 6 26.08 1 4.35 13 56.52
2 156 70 44.37 48 30.77 24 15.38 94 60.26
3 130 81 62.31 44 33.84 27 20.77 98 75.38
4 27 18 66.66 14 51.85 12 44.44 20 74.07
5 6 3 50.00 4 66.67 3 50.00 4 66.67
6 1 0 0.00 0 0.00 0 0.00 0 0.00
District VI.
1 120 42 35.00 24 20.00 10 8.33 56 46.67
2 146 77 52.74 34 23.29 22 15.07 89 60.96
3 10 5 50.00 5 50.00 1 10.00 6 60.00
4 0 0 0 0 0
5 0 0 0 0 0
6 0 0 0 0 0
Total
1 328 96 29.27 59 17.99 24 7.32 131 39.94
2 450 420 44.21 252 26.53 125 13.16 547 57.57
3 587 311 52.98 171 29.13 98 16.69 381 64.91
4 183 105 57.38 65 35.52 43 23.50 127 69.39
5 41 20 48.78 19 46.34 11 26.83 28 68.29
6 11 3 27.27 3 27.27 1 9.09 5 45.45
An objection will be raised, and justly so, that we have up to this point been
studying influenza in families irrespective of how many cases there are in each
family. Until now the family with one case was classified exactly the same as the
family with eight cases. In the following classification we have taken first all
families with a maximum of one sleeping in one room, and sub-divided these
into families with no influenza, those with one case, two cases, etc. We have
likewise classified families with maxima from two to six per bedroom. For the
sake of brevity we will consider only the last column of Table VII, influenza
incidence among the individuals of the various classes of families for both
epidemics. Study of the table will show a correspondence in the other columns.
Solitary cases were more numerous in families with but one or two per bedroom
(27 per cent.) and less frequent in families with three, four and five per bedroom,
(23 per cent., 18 per cent., and 20 per cent., respectively). The families of six per
bedroom form such a small group that here again they should not be considered.
Multiple cases become progressively more numerous as the number of
individuals per bedroom increases (14 per cent. in families of one per bedroom,
29 per cent. in two per bedroom, 41 per cent. in three, 51 to 52 per cent. in four,
and 45 per cent. in five). Fifty-eight per cent. of families with a maximum of one
per bedroom, 43 per cent. with two per bedroom, 35 per cent. with three, 31 per
cent. with four and 35 per cent. with five had no influenza at all.
But here again, the fact that crowded families are usually large families
interferes with drawing any conclusions. A family with four per bed room would
generally be larger than one with two per bed room.
Frost observed that, considering the ratio of incidence in total white
populations irrespective of housing as 100, and after adjusting all groups to a
uniform sex and age distribution, the ratio where there were more than 1.5
rooms per person was 77, from 1 to 1.5 rooms per person the ratio was 94, and
for individuals averaging less than one room per person it was 117. The attack
rate showed a consistent increase as the number of rooms per person
decreased.
Woolley observed, “Housing, if one includes in the term overcrowding, has
surely been an important factor in spreading the epidemic. Whether it has had
any appreciable effect upon the incidence of complications is a question. The
epidemic has certainly gone faster and was over sooner because of the crowding;
the hospital was filled sooner than it should have been as a result of the rapidity
of spread of the disease, and overcrowding of the hospital occurred when with a
less rapid spread it would not have occurred; but whether the number of
fatalities or the number of pneumonias was greater than they should have been
with less crowded conditions may be doubted.”
TABLE VII.
Relationship between crowding and number of cases in the family.
(Influenza appeared more frequently in crowded households and such families
more frequently had multiple cases.)
Families with maximum per bed room of one.
(58.23 per cent. of these had no influenza.)
Two
Invaded Invaded in Total
Invaded or
Cases Total in 1918– both families
in 1920. more
developing such 19. epidemics. invaded.
cases.
in family. families.
Per Per Per Per Per
No. No. No. No.
cent. cent. cent. cent. cent.
1 85 55 17.68 37 11.89 7 2.25 311 27.33
2 32 26 8.36 16 5.14 10 3.22 10.28
3 9 8 2.57 2 0.64 1 0.32 2.88 } 14.44
4 4 3 0.96 4 1.28 3 0.96 1.28
5 0 0
6 0
7 0
8 0
2 per bed room.
1 254 169 18.27 112 12.11 27 2.92 925 27.46
2 135 112 12.11 64 6.92 41 4.43 14.59
3 79 65 7.03 38 4.11 24 2.59 8.54
4 40 35 3.78 16 1.73 11 1.18 4.32
} 29.17
5 11 9 0.97 8 0.81 6 0.64 1.18
6 3 3 0.32 0 0.0 0 0.0 0.32
7 2 2 0.22 1 0.11 1 0.11 0.22
8 0 0
3 per bed room.
1 136 104 17.84 50 8.58 18 3.08 583 23.33
2 103 77 13.21 55 9.43 29 4.97 17.67
3 59 51 8.75 29 4.97 21 3.60 10.12
4 43 40 6.86 16 2.76 13 2.23 7.37
} 41.33
5 22 22 3.77 9 1.54 9 1.54 3.77
6 12 12 2.06 5 0.86 5 0.86 2.06
7 2 2 0.34 0 0 0.34
8 0
4 per bed room.
1 31 24 13.64 10 5.68 3 1.70 176 17.61
2 22 19 10.80 13 7.39 10 5.68 12.50 } 51.60
3 37 32 18.18 25 14.20 20 11.36 20.92
4 14 11 6.25 6 3.41 3 1.70 9.09
5 9 9 5.12 4 2.27 4 2.27 5.12
6 4 3 1.70 2 1.19 1 0.59 2.27
7 3 3 1.70 0 0 1.70
8 0
5 per bed room.
(35 per cent. had none.)
1 8 6 15.00 4 10.00 2 5.00 40 20.00
2 6 5 12.50 4 10.00 3 7.25 15.00
3 3 2 5.00 2 5.00 1 2.50 7.50
4 2 1 2.50 2 5.00 1 2.50 5.00
}
5 4 2 5.00 3 7.50 1 2.50 10.00
45.00
6 2 2 5.00 2 5.00 2 5.00 5.00
7 0
8 1 0 0.0 1 2.50 0 0.0 2.50
6 per bed room.
(50 per cent. had none.)
1 2 1 10.00 1 10.00 0 0.0 10 20.00
2 1 1 10.00 1 10.00 1 10.00 10.00 }
3 2 1 10.00 1 10.00 0 0.0 20.00 30.00
4 0
5 0
6 0
7 0
8 0
The housing methods in the cantonments and even in the tent camps resulted
in a degree of congestion and close physical contact among individuals that was
attained in no civil communities with the possible exception of some institutions.
In cantonments the number of men in individual rooms ranged from 30 to 100
and even under the best circumstances there was very evident close crowding. An
individual in any of these large rooms contracting a contagious disease had
opportunities to spread it by contact and by droplet infection not only to one or
two others, as in the case of the average family, but to a large group of the men in
the same room. A vicious circle was thus formed which tended to propagate the
disease throughout any camp with utmost rapidity. Brewer has compared the
influenza incidence rate in the principal white organizations at Camp
Humphreys with the floor space allowed each man in the respective
organizations, and concludes that, “It is not proper or just to attribute the
differences shown, alone to the amount of floor space allowed each organization,
but it certainly points very strongly to the fact that the incidence of the disease
varied with the density of the population, although not with mathematical
regularity.” Brewer cites regiments which although housed alike showed definite
variation in the influenza incidence. This merely shows that other factors also
play a part. Thus, in one instance, the difference in the two regiments was in
length of service. Brewer also found that among the white troops the incidence of
pneumonia appears to vary with the density of the population.
V. C. Vaughan has reported on the relationship between incidence in tents and
in barracks at Camp Custer. From this one observation it would appear that the
incidence is little changed under the two conditions.
“During September and October, 1918, a study was made on the relationship, if
any, of influenza to methods of living. Of the command, 3,633 were in tents. The
morbidity per thousand in these was 129. There were in barracks 36,055. The
morbidity per thousand among those was 275. At first glance the lower morbidity
of those in tents is striking, but going further into the matter it was found that
the entire morbidity of the Quartermaster Corps was very low. Of the Depot
Brigade 2,881 were in tents, with a morbidity of 128 per thousand, while 3,824
were in barracks, with a morbidity of 134 per thousand.”
Howard and Love offer three reasons why during the last four months of 1918
the deaths from influenza and pneumonia in the Army in the United States ran at
a rate nearly three times as high as that among our troops in France: First, that
the troops in the United States were recent recruits and therefore more
susceptible to disease; second, that probably many of the troops in France who
had seen much longer service had had the disease in mild form in the early
spring; and, third, that the method of housing was entirely different in France.
There the men were spread over a wide territory and whenever in rest area they
were billeted in houses rather than crowded into barracks. Furthermore, they
were living much more in the open. It was found that in commands of the Service
of Supply, where troops were housed in barracks with a large number of men to a
single room, the epidemic ran much the same course with high mortality, as it
did in the cantonments in the United States. The percentage of infection and the
fatalities from influenza and pneumonia in France were much greater among
troops of the S. O. S. than among troops at the front.
Domestic cleanliness.—We have studied the relationship between influenza
incidence and the cleanliness of the household by the same method used in
studying overcrowding. In Table VIII we have classified according to cleanliness
and according to the number of cases developing in each family. We have had
four subdivisions, “very clean,” “clean,” “dirty,” and “very dirty.” There is greater
opportunity for erroneous results in this table than in the one preceding because
the standards of cleanliness are difficult to define. As a matter of fact we are
guided entirely by the inspector’s own impression of each household, as she
examined it during her visits. The following is an excerpt from the instructions
given each inspector on this subject:
“A few words on this subject may describe much. State of cleanliness of the
individual, slovenly condition, dust and dirt, foulness of air noticed on first
entering, condition of children, of kitchen sink, etc., should be noticed, and
good or bad features recorded. In the poorer districts not a few families will be
found in which the cleanliness, considering the surroundings, is quite
laudable. Of particular importance are amount of daylight, ventilation, care of
bathroom and toilet, garbage, whether windows are kept open at night.”
On the basis of these returns we have classified the families as indicated, but
each inspector was governed to a certain extent by the average cleanliness of her
district, and it is difficult to compare the cleanest tenement with any of the
districts of well-to-do individuals. We will therefore probably find it more
profitable and more nearly accurate to combine the groups and classify them
only as “clean” and “dirty.”
TABLE VIII.
Relationship between cleanliness and number of cases in family.
(Clean families were invaded less frequently and had solitary cases more often than
did dirty households.)
Very clean.
(47.62 per cent. had none.)
Cases in Total Per Per Per
’18. ’20. Both. Total. Per cent.
families. families. cent. cent. cent.
1 124 72 15.65 50 10.87 8 1.74 460 26.96
2 53 41 8.91 27 5.87 15 3.25 11.52
3 37 33 7.17 13 2.82 9 1.95 8.04
4 18 16 3.48 8 1.74 6 1.30 3.91 }
5 4 3 0.65 2 0.43 1 0.21 0.87 25.42
6 3 3 0.65 0 0.0 0 0.0 0.65
7 2 2 0.43 1 0.21 1 0.21 0.43
8 0 0 0 0
Clean.
Per Per Per
Cases. Families. ’18. ’20. Both. Total. Per cent.
cent. cent. cent.
1 301 212 18.45 120 10.44 31 2.70 1149 26.19
2 177 143 12.45 91 7.92 57 4.96 15.40
3 101 83 7.22 52 4.53 34 2.96 8.79
4 52 47 4.09 20 1.74 15 1.26 4.53 }
5 30 29 2.52 17 1.48 16 1.22 2.61 32.29
6 8 7 0.61 3 0.26 2 0.17 0.70
7 3 3 0.26 0 0.0 0 0.0 0.26
8 0 0 0 0
Dirty.
Cases in Total Per Per Per
’18. ’20. Both. Total. Per cent.
families. families. cent. cent. cent.
1 79 59 17.40 36 10.62 16 4.72 339 23.30
2 58 48 14.16 29 8.55 19 5.61 17.11
3 37 31 9.14 22 6.49 17 5.01 10.91
4 26 22 6.49 12 3.54 8 2.36 7.67
}
5 6 5 1.79 4 1.18 3 0.94 1.77
39.81
6 7 7 2.06 4 1.18 4 1.18 2.06
7 0 0 0 0
8 1 0 0.0 1 0.29 0 0.0 0.29
Very dirty.
1 22 16 14.95 8 7.47 2 1.85 107 20.56
2 11 8 7.47 6 5.10 3 2.80 10.28 }
3 14 12 11.21 10 9.35 7 6.54 13.08 40.18
4 7 5 4.67 4 3.73 2 1.85 6.54
5 6 6 5.10 1 0.93 0 0.0 5.61
6 3 3 2.80 2 1.85 2 1.85 2.80
7 2 2 1.85 0 0.0 0 0.0 1.87
8 0 0 0 0
But even without combining in this way, the table shows us that for both years
27 per cent. of the very clean families, 26 per cent. of the clean, 23 per cent. of
the dirty and 21 per cent. of the very dirty, had but one case, while 25 per cent. of
the very clean, 32 per cent. of the clean, 40 per cent. of the dirty, and 40 per cent.
of the very dirty, had multiple cases.
The cleaner the family the less is the likelihood of multiple cases.
It is rather difficult to find concrete examples of the influence of domestic
habits and environment in the 1918 pandemic. The remarkably high incidence
among the natives of India and among the American Indians might by some be
attributed to unfavorable environment. Lynch and Cumming obtained records
from a large number of institutions and from business concerns having their own
records, and discovered that the influenza incidence was higher in those
institutions where dish washing was done manually than in those in which
mechanical washing was performed. They appear to conclude that the difference
in the two methods of washing dishes was the cause for the greater incidence in
influenza, thus bearing out their theory of the propagation of influenza chiefly
through eating utensils. On the contrary it is possible that the presence of the
mechanical washer is an indication of advanced methods, greater care in the
kitchen, and better hygiene probably not only in the kitchen and dining room,
but throughout the institution.
Economic status.—Although in our survey information has been obtained
regarding the economic status of the various families we would not stress this
phase of our subject. Obviously the amount of money an individual has in his
bank will not directly influence the amount of influenza he will have in his home.
As nearly an accurate classification by wealth is by the separation into the
districts, Districts I and III being very poor, District II poor, Districts IV and V
moderate, and VI well-to-do. From Chart XXVI we see no definite relationship
between influenza incidence and economic status.
Dr. Niven has had similar experiences. He remarks that the disease does not
appear to have affected especially any class or section of the community. Rich
and poor suffered alike. Inquiry in some towns shows that the epidemic not
infrequently started in the well-to-do districts and only later involved the poorer
and less prosperous areas.
We cannot state with any degree of accuracy in what section of Boston the
1920 recurrence first began. The sections studied are for relatively small portions
of the city, and it is possible or probable that the original increase was in some
area outside of our districts. In the districts studied the earliest increase in
reported cases was from the section of the city known as Dorchester (Districts IV
and V), where there was some increase in December, 1919. The latest definite
increase was in the Irish district of South Boston. Geographically these two areas
are quite near. The relative insusceptibility of the Irish population is probably a
much more important factor in the difference.
Frost found after classifying the white population canvassed in Little Rock and
San Antonio according to economic status, and adjusting the incidence rate in
each group to a uniform sex and age distribution, that the ratios of incidence in
each economic group to incidence in total white population did show an increase
with increasing poverty. “Notwithstanding that the classification according to
economic status is a very loose one, based solely on the judgment of inspectors
with widely different standards, a considerably higher incidence is shown in the
lower as compared to the higher economic group.”
Parsons, in 1891, discussed the influence of poverty, but believed that it is the
concomitants of poverty which were the cause of the higher incidence among the
poor.
“Sanitary conditions do not seem to have had any influence in determining the
occurrence of influenza, and what share they have had in determining its extent
or fatality cannot yet be decided. On the occasion of the last great epidemic, Dr.
Peacock concluded, ‘The more common predisponents to disease, e.g., defective
drainage, want of cleanliness, overcrowding, impure air, deficient clothing,
innutritious or too scanty food, powerfully conduce to the prevalence and fatality
of influenza.’ And Dr. Farr showed that in the last six weeks of 1847, while in the
least unhealthy districts of London the annual rate of mortality was raised from a
mean rate of twenty per 1,000 to thirty-eight, in the unhealthiest districts it was
raised from a mean rate of twenty-seven to sixty-one.
“That overcrowding and impure air must have a powerful influence in aiding
the development of the epidemic follows from what we have seen of its greater
prevalence among persons associated together in a confined space; and though
rich and poor have alike been sufferers from the epidemic, and even royal
personages have been fatally attacked by it, it cannot be doubted that poverty
must have in many cases conduced to a fatal issue in persons, who, if placed
under more favorable circumstances, might have recovered, seeing that it often
involves not only inferior conditions of lodgment, but also want of appropriate
food, of sufficient warmth and clothing, and of ability to take the needed rest.”
Distribution of the disease through the household.—During the autumn and
winter epidemic of 1918 there was considerable discussion, and particularly were
there popular newspaper reports of entire families being taken ill with influenza,
sometimes all on the same day. This was less true of 1920. But few of us are
personally acquainted with such instances and at best they must have been
relatively rare.
Among 1,236 families with influenza in either epidemic we found only 94 or
7.6 per cent. in which the entire family contracted the disease. No family
consisting of over seven individuals was reported as having all the members of
the family sick in either epidemic. Over two-thirds of the families with even
numbers of individuals (464 out of 605) suffered the illness of less than half of
the household. One quarter of all families of more than one (539 out of 2,107)
had but one case per family. Over a third of all families of over two individuals
(745 out of 2,006) had two or less cases per household. As a rule there were at
least one and usually several individuals in each household who did not
contract influenza.
That as a rule the disease did not appear explosively in a family; but that cases
developed successively, is indicated by the fact that out of 577 families
contracting influenza in the epidemic of 1920 the cases were all of simultaneous
development in but fifteen. In thirteen of these, two individuals fell ill on the
same day and no subsequent cases developed. In the other two families three
individuals came down on the first day and no other cases developed. In addition
there were, out of the 577 families, fourteen in which there were two or more
cases developing on the first day of the invasion, but which were followed on
subsequent days by later cases in the same family. Again, there were eleven
families in which two or more cases occurred simultaneously at an interval of
one or more days after the development of a single prior case.
We may say that as a rule in the 1920 epidemic, cases of influenza developed
in families successively and not simultaneously. In only 29, or 5 per cent. of the
families contracting the disease in 1920, did more than one case develop on the
first day of the appearance of the disease in the family.
A certain difficulty in determining the date of onset is that we must rely upon
the patient’s statement. One individual may have been sick for hours or days
before a second member coming down with the disease called forth recognition
of the fact that they both had it.
Unfortunately we are not able to give similar statistics for the 1918–19
epidemic. Our investigation occurred so long after the epidemic that specific
dates of onset of the disease would have been entirely unreliable. The nearest
date we have attempted to obtain was the month of the attack.
Dr. A. L. Mason states that 63 cases came under his observation in the
epidemic of 1889 as occurring in groups in families. In but six instances were two
persons attacked on the same day. The average interval between cases in the
same household was four days. Sometimes a week or more elapsed. Whole
families were never stricken at once.
Parsons in 1891 concluded from the results of questionaires sent to physicians
that in the first spread, 1889–90, there was an interval between cases in
individual households just as we have described. Among the replies to his
questionaires nine described intervals of one day and under, six described
intervals of two days, three of three days, three of four days, and four replies
described intervals of more than four days.
Leichtenstern observed likewise: “In large families the contagious character of
influenza is evidenced by the fact that the other members of the family become
sick one after the other following the first case. This rule of succession is most
easily seen in the early or late period of an epidemic and is less noticeable at the
height, where the opportunity for all the members of the family to acquire the
influenza outside the home is enormous. This latter fact explains why, when all
sicken at once, the disease appears to be miasmatic in origin. There are many
examples where other members of a family living with a sick individual remained
unaffected. Parsons reports such cases, and this was so frequently the case that
some British physicians state that it is the rule that there is but one case in a
family or that the cases are widely separated in time. This was only partly true
during the period of the pandemic and was very frequent in the epidemic
following it. In this respect influenza acts like the common contagious diseases,
diphtheria, scarlet fever, measles, etc., while the difference lies in the short
incubation period and the very high contagiousness of the disease.”
That West, in England, had observed the same phenomenon is indicated by
the following quotation: “How is it, for instance, that one member of a household
may be picked out and the others escape, though they are susceptible, as is
shown by their acquiring the disease shortly after in some other way?”
Again Leichtenstern wrote: “It is noteworthy that influenza on ships usually
did not occur explosively, but spread gradually, and on ships usually lasted
several weeks, as on the Bellerophon, from the 27th of March to the 30th of
April; on the Canada from the 11th of April to the 24th of May; on the Comus
from the 10th of April to the 3d of May.
“The German Marine Report states, ‘Everywhere on the ships the disease
began not suddenly but gradually.’ The frigate Schwalbe first had a large number
of cases only on the 6th day after the beginning of the epidemic. There are,
however, some exceptions, where the disease has begun suddenly with the
greatest violence on ships as on land. Such was true of the frigate Stag which on
the 3d of April, 1833, neared the influenza infected coast of Devonshire, and as it
came under the land wind the epidemic suddenly broke out with great violence.
Within two hours forty men took sick. Within six hours the number had
increased to sixty. Within twenty-four hours 160 men were sick. As Parkes has
remarked the evidence is insufficient that there had been no communication
with the coast. There have been other examples of sudden outbreaks on ships, as
on a Dutch frigate in the harbor of Mangkassar, where 144 men out of 340 took
sick in a few days (1856); on the Canopus (1837) in the harbor of Plymouth,
where on the 15th of February three-fourths of the men took sick with influenza.”
Garvie, in reporting his personal experiences with influenza in 1918 in an
industrial area in England, experiences not based on statistical study, concludes
that there are two types of cases, the sporadic case which occurs mainly among
the wage-earning members of the family and has little tendency to affect other
members of the household, and second, the type of case where a large number of
individuals in the household are affected. He called this the “household wave.” If
we interpret him aright he really means that there are either single or multiple
cases, and that the single cases are more apt to occur in the wage-earner, the
individual who is more exposed on the outside of the household. He also believes
that the household wave is more severe in character than the so-called sporadic
case, and is accompanied by a greater number of complications.
Armstrong, in his survey in Framingham, examined influenza convalescents.
He found that of these 10 per cent. were in families in which no other cases had
developed, and 87 per cent. were in families where one or more additional cases
had occurred. In three per cent. information was lacking.
It is important in studying the literature on this subject to distinguish between
definitely established fact and less definite description. Thus one is still left in
some doubt when one reads in a London letter in the Journal of the American
Medical Association for 1915 concerning the epidemic in London at that time
that, “whenever it has seized an individual it has usually run through the entire
household. Whole offices have succumbed.”
The first case in the family.—Chart XXVII shows clearly that in both
epidemics in our experience the wage-earner was much more frequently the first
case in a family than was any other occupation. The individuals whose
occupations kept them at home were second. Infants, as was to be expected, were
recorded as being “first case” in the smallest number of instances.
In 1889 the distribution was practically the same. Parsons found that out of
125 households the first case was a bread-winner in 96; a housekeeper in nine; a
child at school in thirteen; a child not at school in two families. In the last five
families the first case was in adults, occupation not given. This order is identical
with our own. Neither our own observations nor those of Parsons consider the
relative proportions of wage earners in the population as a whole. The results are
nevertheless suggestive.
H. F. Vaughan reached comparable results for the 1920 epidemic in Detroit.
During the first few weeks the age groups from 20 to 29 showed a relatively
much more frequent influenza incidence than did children up to ten years. In
later weeks of the epidemic there was a relative increase in the incidence among
children and decrease among young adults. He concluded that the disease first
attacks the young adult and from this group it extends into the home.
In the Local Government Board Report for 1891, H. H. Murphy distinguishes
three groups or ways in which the disease may be brought into the family. The
examples will be found to be characteristic for any epidemic and for any country:
Group A.—Cases of single exposure.
“Household 1.—Mr. Q. goes to London daily. Was ill with influenza on
December 25th. No other case in this house till January 15th.
“Household 2.—Mrs. A. called on Mr. Q. on December 31st, and had a few
minutes’ conversation with him. She was taken ill on January 3d. There was a
Christmas family gathering at this house, and this is how the other members
were affected: Mr. B., January 6th; Miss C., Mrs. D., and Master D., January 8th;
Mr. J., January 10th; Mr. H., January 11th.
CHART XXVII.
“Household 3.—Miss M. went to a party January 3d. She had a few

minutes’ conversation with a young lady who said she was suffering
from influenza. Miss M. had a characteristic attack on the 6th of
January.
“Household 4.—Mr. G. goes to London daily; taken ill January 5th.
Mrs. N. visited him for a short time on January 5th, and was taken ill
January 10th.”
Group B.—Where disease was brought from a distance into a
previously healthy household.
“Household 8.—Mrs. R. G., living in the north of London, came
here on a visit December 17th. On the 19th she was taken ill with
influenza, the first case that I knew of in this neighborhood. Mr. C.
G., on the 23d, servant on the 26th, Mrs. G. 31st, and Mr. G. January
9th.
“Household 9.—Mr. I. lives at his business place in London, taken
ill December 20th with influenza. His family reside here. Boy C.
visited his father for a few days, and came back ill on January 4th.

Textbook Patient Specific Induced Pluripotent Stem Cell Models Generation and Characterization 1St Edition Andras Nagy Ebook All Chapter PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Textbook Patient Specific Induced Pluripotent Stem Cell Models Generation and Characterization 1St Edition Andras Nagy Ebook All Chapter PDF

Uploaded by

Copyright:

Available Formats

Patient Specific Induced Pluripotent

Stem Cell Models Generation and

Pluripotent Stem Cell Therapy for Diabetes 1st Edition

Studies of Pluripotency in Embryonic Stem Cells and

Stem Cell Derived Models in Toxicology 1st Edition Mike

Stem Cell Proliferation and Differentiation 1st Edition

Human stem cell toxicology 1st Edition James L Sherley

Stem Cell Research : Hope or Hype? 1st Edition Alt

Stem Cell Renewal and Cell Cell Communication Methods

Computational Stem Cell Biology Methods and Protocols

For further volumes: http://www.springer.com/series/7651

Generation and Characterization

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Springer New York Heidelberg Dordrecht London

Printed on acid-free paper

Humana Press is a brand of Springer

Toronto, ON, Canada Andras Nagy

Differentiation of Human Pluripotent Stem Cells to Cardiomyocytes

LYLE ARMSTRONG Institute of Genetic Medicine, Newcastle University,

XUAN ZHANG Institute of Genetics, College of Life Sciences, Zhejiang University,

Generation of Patient-Speciﬁc induced Pluripotent Stem

The generation of induced pluripotent stem cells (iPSC) described

These patient-speciﬁc iPSCs show self-renewal and pluripotency

All the procedures described here are based on our feeder-

2.1 General 1. Biohazard safety cabinet certiﬁed for handling of biological

17. Tissue culture treated p150 plates.

2.3 SeV 1. StemSpan™ SFEM (STEMCELL Technologies, Vancouver,

2.4 Human-Induced 1. Dulbecco’s Modiﬁed Eagle Medium (DMEM, Life

5. GlutaMAX™ supplement (Life Technologies).

All procedures for cell processing should be performed using sterile

8. Take off thoroughly with the tip of a pipette 5 mL any cell

6. Collect the cells in 50 mL conical tube and centrifuge. Resus-

3.4 Generation of 1. Culture PB-MNC up to 5 105 cells per mL in PB-MNC

9. Mix SeV from CytoTune®-iPS Sendai Reprogramming Kit in a

6. The rest of each PB-MNC iPSC clone will be expanded by

1. Ficoll-Paque Plus should be warmed to room temperature

This work was supported by the following grants: Dirección

1. Takahashi K, Yamanaka S (2006) Induction of Hashimoto H, Kodaira M et al (2010) Genera-

A Doxycycline-Inducible System for Genetic Correction

Keywords: Genetic correction, Disease modeling, Homologous recombination, Doxycycline-

In the characterization of iPSC disease models, a commonly used

*Author contributed equally with all other contributors.

Donor plasmid SV40

homologous recombination (7, 8), a pair of ZFNs are used to

8 days in dox 400

also be adapted to accommodate the use of TALENs (8, 9) or

titrating different doses of doxycycline. Since then, we have devel-

2.1 Reagents and 1. PGK-AAVS1-ZFN-Left (addgene cat. no. #60915).

2.1.2 Targeting Vectors 1. AAVS1-SA-2A-NEO-CAG-RTTA3 (addgene cat. no. #60431).

2.1.3 Transfection 1. Lipid transfection reagent: X-tremeGENE 9 DNA transfection

“Household 3.—Miss M. went to a party January 3d. She had a few

You might also like