Pob5e Solutions Ch09

2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-99 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY:21-02-08:WHQY028/soln:
chapter
DNA-Based Information
Technologies 9
1. Cloning When joining two or more DNA fragments, a researcher can adjust the sequence at the
junction in a variety of subtle ways, as seen in the following exercises.
(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction
digest (include those sequences remaining from the EcoRI recognition sequence).
(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and
the four deoxynucleoside triphosphates (see Fig. 8–33).
(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in
(b) are ligated (see Fig. 25–17).
(d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that
degrades only single-stranded DNA.
(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end
with structure (d).
(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction
digest (include those sequences remaining from the PvuII recognition sequence).
(g) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end
with structure (f).
(h) Suppose you can synthesize a short duplex DNA fragment with any sequence you desire. With
this synthetic fragment and the procedures described in (a) through (g), design a protocol that
would remove an EcoRI restriction site from a DNA molecule and incorporate a new BamHI
restriction site at approximately the same location. (See Fig. 9–2.)
(i) Design four different short synthetic double-stranded DNA fragments that would permit ligation
of structure (a) with a DNA fragment produced by a PstI restriction digest. In one of these
fragments, design the sequence so that the final junction contains the recognition sequences for
both EcoRI and PstI. In the second and third fragments, design the sequence so that the junction
contains only the EcoRI and only the PstI recognition sequence, respectively. Design the
sequence of the fourth fragment so that neither the EcoRI nor the PstI sequence appears in the
junction.
Answer Type II restriction enzymes cleave double-stranded DNA within recognition

sequences to create either blunt-ended or sticky-ended fragments. Blunt-ended DNA frag-
ments can be joined by the action of T4 DNA ligase. Sticky-ended DNA fragments can be
joined by either E. coli or T4 DNA ligases, provided that the sticky ends are complementary.
Sticky-ended fragments without complementary ends can be joined only after the ends are
made blunt, either by exonucleases or by E. coli DNA polymerase I.
(a) The recognition sequence for EcoRI is (5)GAATTC(3), with the cleavage site between
G and A (see Table 9–2). Thus, digestion of a DNA molecule with one EcoRI site
S-99
S-100 Chapter 9 DNA-Based Information Technologies
(5),GAATTC,(3)
(3),CTTAAG,(5)
would yield two fragments:
(5),G(3) and (5)AATTC,(3)

(3),CTTAA(5) (3)G,(5)
(b) DNA polymerase I catalyzes the synthesis of DNA in the 5→ 3 direction in the presence
of the four deoxyribonucleoside triphosphates. Therefore, both fragments generated in
(a) will be made blunt ended:
(5),GAATT(3) and (5)AATTC,(3)

(3),CTTAA(5) (3)TTAAG,(5)
(c) The two fragments generated in (b) can be ligated by T4 DNA ligase to form
(5),GAATTAATTC,(3)
(3),CTTAATTAAG,(5)
(d) The fragments in (a) have sticky ends, with a protruding single-stranded region. Treat-
ment of these DNA fragments with a single-strand-specific nuclease will yield DNA frag-
ments with blunt ends:
(5),G(3) and (5)C,(3)

(3),C(5) (3)G,(5)
(e) The left-hand DNA fragment in (b) can be joined to the right-hand fragment in (d) to
yield
(5),GAATTC,(3)
(3),CTTAAG,(5)
The same recombinant DNA molecule is produced by joining the right-hand fragment in
(b) to the left-hand fragment in (d).
(f) The recognition sequence for PvuII is (5)CAGCTG(3), with the cleavage site between
G and C (see Table 9–2). Thus, a DNA molecule with a PvuII site will yield two frag-
ments when digested with PvuII:
(5),CAG(3) and (5)CTG,(3)

(3),GTC(5) (3)GAC,(5)
(g) The left-hand DNA fragment in (b) can be joined to the right-hand fragment in (f) to
yield
(5),GAATTCTG,(3)
(3),CTTAAGAC,(5)
The same recombinant DNA is produced by joining the right-hand fragment in (b) to the
left-hand fragment in (f):
(5),CAGAATTC,(3)
(3),GTCTTAAG,(5)
(h) There are two ways to convert an EcoRI restriction site to a BamHI restriction site.
Method 1: Digest DNA with EcoRI, and then create blunt ends by using either DNA
polymerase I to fill in the single-stranded region as in (b) or a single-strand-specific nu-
clease to remove the single-stranded region as in (d). Ligate a synthetic linker that con-
tains the BamHI recognition sequence (5)GGATCC(3) (see Table 9–2),
(5)GCGGATCCCG(3)
(3)CGCCTAGGGC(5)
Chapter 9 DNA-Based Information Technologies S-101
between the two blunt-ended DNA fragments to yield, if the EcoRI-digested DNA is
treated as in (b),
(5),GAATTGCGGATCCCGAATTC,(3)
(3),CTTAACGCCTAGGGCTTAAG,(5)
or, if the EcoRI-digested DNA is treated as in (d),
(5),GGCGGATCCCG(3)
(3),CCGCCTAGGGC(5)
Notice that the EcoRI site is not regenerated after ligation of the linker.
Method 2: This method uses a “conversion adaptor” to introduce a BamHI site into
the DNA molecule. A synthetic oligonucleotide with the sequence (5)AATTGGATCC(3)
is partially self-complementary, and it spontaneously forms the structure
(5)AATTGGATCC(3)
(3) CCTAGGTTAA(5)
The sticky ends of this adaptor are complementary to the sticky ends generated by
EcoRI digestion, so the adaptor can be ligated between the two EcoRI fragments to form
(5),GAATTGGATCCAATT,(3)
(3),CTTAACCTAGGTTAA,(5)
Because ligation between DNA molecules with compatible sticky ends is more efficient than
ligation between DNA molecules with blunt ends, Method 2 is preferred over Method 1.
(i) Joining of the DNA fragments in (a) to a fragment generated by PstI digestion requires a
conversion adaptor. This adaptor should contain a single-stranded region complementary
to the sticky end of an EcoRI-generated DNA fragment, and a single-stranded region
complementary to the sticky end generated by PstI digestion. The four adaptor se-
quences that fulfill this requirement are shown below, in order of discussion in the prob-
lem (N any nucleotide):
(5)AATTCNNNNCTGCA(3)
(3)GNNNNG(5)
(5)AATTCNNNNGTGCA(3)
(3)GNNNNC(5)
(5)AATTGNNNNCTGCA(3)
(3)CNNNNG(5)
(5)AATTGNNNNGTGCA(3)
(3)CNNNNC(5)
For the first adaptor: Ligation of the adaptor to the EcoRI-digested DNA molecule
would yield
(5),GAATTCNNNNCTGCA(3)
(3),CTTAAGNNNNG(5)
This product can now be ligated to a DNA fragment produced by a PstI digest, which has
the terminal sequence
(5)G,(3)
(3)ACGTC,(5)
to yield
(5),GAATTCNNNNCTGCAG,(3)
(3),CTTAAGNNNNGACGTC,(5)
Notice that the EcoRI and PstI sites are retained.

In a similar fashion, each of the other three adaptors can be ligated to the EcoRI-
digested DNA molecule, and the ligated molecule joined to a DNA fragment produced by
a PstI digest. The final products are as follows.
For the second adaptor:
(5),GAATTCNNNNGTGCAG,(3)
(3),CTTAAGNNNNCACGTC,(5)
The EcoRI site is retained, but not the PstI site.
For the third adaptor:
(5),GAATTGNNNNCTGCAG,(3)
(3),CTTAACNNNNGACGTC,(5)
The PstI site is retained, but not the EcoRI site.
For the fourth adaptor:
(5),GAATTGNNNNGTGCAG,(3)
(3),CTTAACNNNNCACGTC,(5)
Neither the EcoRI nor the PstI site is retained.
2. Selecting for Recombinant Plasmids When cloning a foreign DNA fragment into a plasmid, it is
often useful to insert the fragment at a site that interrupts a selectable marker (such as the tetracy-
cline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify
clones containing recombinant plasmids with foreign DNA. With a bacteriophage l vector it is not nec-
essary to do this, yet one can easily distinguish vectors that incorporate large foreign DNA fragments
from those that do not. How are these recombinant vectors identified?
Answer Bacteriophage l DNA can be packaged into infectious phage particles only if it is be-
tween 40,000 and 53,000 bp long. The two essential pieces of the bacteriophage l vector have
about 30,000 bp in all, so the vector is not packaged into phage particles unless the additional,
foreign DNA is of sufficient length: 10,000 to 23,000 bp.
3. DNA Cloning The plasmid cloning vector pBR322 (see Fig. 9–3) is cleaved with the restriction
endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage)
is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform
bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline.
(a) In addition to the desired recombinant plasmid, what other types of plasmids might be found
among the transformed bacteria that are tetracycline resistant? How can the types be distin-
guished?
(b) The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three
different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giv-
ing the patterns shown. What does each pattern say about the cloned DNA? Note that in
pBR322, the PstI and EcoRI restriction sites are about 750 bp apart. The entire plasmid with no
cloned insert is 4,361 bp. Size markers in lane 4 have the number of nucleotides noted.
Nucleotide
1 2 3 4
length
5,000
Electrophoresis
3,000
1,500
1,000
750
500
250
Answer
(a) Ligation of the linear pBR322 to regenerate circular pBR322 is a unimolecular process
and thus occurs more efficiently than the ligation of a foreign DNA fragment to the
linear pBR322, which is a bimolecular process (assuming equimolar amounts of linear
pBR322 and foreign DNA in the reaction mixture). The tetracycline-resistant bacteria
would include recombinant plasmids and plasmids in which the original pBR322 was
regenerated without insertion of a foreign DNA fragment. (These would also retain
resistance to ampicillin.) In addition, two or more molecules of pBR322 might be ligated
together with or without insertion of foreign DNA.
(b) The clones giving rise to the patterns in lanes 1 and 2 each have one DNA fragment
inserted, but in different orientations (see the diagrams, which are not drawn to scale;
keep in mind that the products on the gel are from EcoRI cleavage). The clone produc-
ing the pattern in lane 3 has two DNA fragments, ligated such that the EcoRI-site
proximal ends are joined.
PstI EcoRI
EcoRI
EcoRI
PstI PstI
pBR322 Clone in lane 1
EcoRI
PstI EcoRI PstI PstI
EcoRI EcoRI
EcoRI
PstI PstI
Clone in lane 2 Clone in lane 3

4. Identifying the Gene for a Protein with a Known Amino Acid Sequence Using Figure 27–7 to
translate the genetic code, design a DNA probe that would allow you to identify the gene for a protein
with the following amino-terminal amino acid sequence. The probe should be 18 to 20 nucleotides
long, a size that provides adequate specificity if there is sufficient homology between the probe and
the gene.
H3N+–Ala–Pro–Met–Thr–Trp–Tyr–Cys–Met–Asp–Trp–Ile–
Ala–Gly–Gly–Pro–Trp–Phe–Arg–Lys–Asn–Thr–Lys–
Answer Most amino acids are encoded by two or more codons (see Fig. 27–7). To minimize
the ambiguity in codon assignment for a given peptide sequence, we must select a region
of the peptide that contains amino acids specified by the smallest number of codons. Focus on
the amino acids with the fewest codons: Met and Trp (see Fig. 27–7 and Table 27–3). The best
possibility for a probe is a span of DNA from the codon for the first Trp residue to the first
two nucleotides of the codon for Ile. The sequence of the probe would be
(5)UGG UA(U/C) UG(U/C) AUG GA(U/C) UGG AU
The synthesis would be designed to incorporate either U or C where indicated, producing a

mixture of eight 20-nucleotide probes.
5. Designing a Diagnostic Test for a Genetic Disease Huntington’s disease (HD) is an inherited
neurodegenerative disorder, characterized by the gradual, irreversible impairment of psychological,
motor, and cognitive functions. Symptoms typically appear in middle age, but onset can occur at
almost any age. The course of the disease can last 15 to 20 years. The molecular basis of the disease is
becoming better understood. The genetic mutation underlying HD has been traced to a gene encoding
a protein (Mr 350,000) of unknown function. In individuals who will not develop HD, a region of the
gene that encodes the amino terminus of the protein has a sequence of CAG codons (for glutamine)
that is repeated 6 to 39 times in succession. In individuals with adult-onset HD, this codon is typically
repeated 40 to 55 times. In individuals with childhood-onset HD, this codon is repeated more than
70 times. The length of this simple trinucleotide repeat indicates whether an individual will develop
HD, and at approximately what age the first symptoms will occur.
A small portion of the amino-terminal coding sequence of the 3,143-codon HD gene is given below.
The nucleotide sequence of the DNA is shown, with the amino acid sequence corresponding to the
gene below it, and the CAG repeat shaded. Using Figure 27–7 to translate the genetic code, outline a
PCR-based test for HD that could be carried out using a blood sample. Assume the PCR primer must
be 25 nucleotides long. By convention, unless otherwise specified a DNA sequence encoding a protein
is displayed with the coding strand (the sequence identical to the mRNA transcribed from the gene)
on top such that it is read 5 to 3, left to right.
307 ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTC
1 M A T L E K L M K A F E S L K S F
358 CAGCAGTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
18 Q Q F Q Q Q Q Q Q Q Q Q Q Q Q Q Q
409 CAGCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCGCCGCCGCCG
35 Q Q Q Q Q Q Q Q Q P P P P P P P P
460 CCGCCTCCTCAGCTTCCTCAGCCGCCGCCG
52 P P P Q L P Q P P P
Source: The Huntington’s Disease Collaborative Research Group. (1993) A novel gene containing a trinucleotide
repeat that is expanded and unstable on Huntington’s disease chromosomes. Cell 72, 971–983.
Answer Your test would require DNA primers, a heat-stable DNA polymerase, deoxynucleo-
side triphosphates, and a PCR machine (thermal cycler). The primers would be designed to
amplify a DNA segment encompassing the CAG repeat. The DNA strand shown is the coding
strand, oriented 5→ 3 left to right. The primer targeted to DNA to the left of the repeat
would be identical to any 25-nucleotide sequence shown in the region to the left of the CAG
repeat. Such a primer will direct synthesis of DNA across the repeat from left to right. The
primer on the right side must be complementary and antiparallel to a 25-nucleotide
sequence to the right of the CAG repeat. Such a primer will direct 5→ 3 synthesis of DNA
across the repeat from right to left. Choosing unique sequences relatively close to the CAG
repeat will make the amplified region smaller and the test more sensitive to small changes in
size. Using the primers, DNA including the CAG repeat would be amplified by PCR, and its
size would be determined by comparison to size markers after electrophoresis. The length of
the DNA would reflect the length of the CAG repeat, providing a simple test for the disease.
Such a test could be carried out on a blood sample and completed in less than a day.
6. Using PCR to Detect Circular DNA Molecules In a species of ciliated protist, a segment of
genomic DNA is sometimes deleted. The deletion is a genetically programmed reaction associated with
cellular mating. A researcher proposes that the DNA is deleted in a type of recombination called site-
specific recombination, with the DNA on either end of the segment joined together and the deleted
DNA ending up as a circular DNA reaction product.
proposed
reaction
Suggest how the researcher might use the polymerase chain reaction (PCR) to detect the presence of
the circular form of the deleted DNA in an extract of the protist.
Answer Design PCR primers complementary to DNA in the deleted segment, but which
would direct DNA synthesis away from each other. No PCR product will be generated unless
the ends of the deleted segment are joined to create a circle.
7. Glowing Plants When grown in ordinary garden soil and watered normally, a plant engineered to
express green fluorescent protein (see Fig. 9–15a) will glow in the dark, whereas a plant engineered to
express firefly luciferase (see Fig. 9–29) will not. Explain these observations.
Answer The plant expressing firefly luciferase must take up luciferin, the substrate of lu-
ciferase, before it can “glow” (albeit weakly). The plant expressing green fluorescent protein
glows without requiring any other compound.
8. RFLP Analysis for Paternity Testing DNA fingerprinting and RFLP analysis are often used to test
for paternity. A child inherits chromosomes from the mother and the father, so DNA from a child dis-
plays restriction fragments derived from each parent. In the gel shown here, which child, if any, can be
excluded as being the biological offspring of the putative father? Explain your reasoning. Lane M is the
sample from the mother, F from the putative father, and C1, C2, and C3 from the children.
M F C1 C2 C3
Electrophoresis
Answer None of the children can be excluded. Each child has one band that could be derived
from the father.
9. Mapping a Chromosome Segment A group of overlapping clones, designated A through F, is isolated

from one region of a chromosome. Each of the clones is separately cleaved by a restriction enzyme
and the pieces resolved by agarose gel electrophoresis, with the results shown in the figure below.
There are nine different restriction fragments in this chromosomal region, with a subset appearing in
each clone. Using this information, deduce the order of the restriction fragments in the chromosome.
Overlapping clones
A B C D E F
1 Nine
2 restriction
fragments
3
Electrophoresis
4
5
8
9
Answer Solving a restriction fragment map is a logic puzzle. The agarose gel shows which
fragments are part of each clone, but deducing their order on the chromosome takes some
work.
Clone A: fragments 1, 3, 5, 7, and 9
Clone B: fragments 2, 3, 4, 6, 7, and 8
Clone C: fragments 1, 3, 4, 5, and 7
Clone D: fragments 2, 3, 4, 5, and 7
Clone E: fragments 1, 5, and 9
Clone F: fragments 2, 4, 6, and 7
Begin with clone E, which has the fewest fragments. Fragments 1, 5, and 9 must be adjacent,
but may be in any order. However, clone C includes fragments 1 and 5, but not 9, so we can
conclude that fragments 1 and 5 are adjacent; 9 could be adjacent to either 1 or 5, but is not
between them (i.e., the order is 9-1-5 or 1-5-9). Clones C and D are identical except that C
also includes fragment 1, and D also includes fragment 2; from this we can deduce that frag-
ments 1 and 2 must be at opposite ends of the overlapping region, which includes fragments
3, 4, 5, and 7 (in an as yet undetermined order). Because we have already concluded that
fragments 1 and 5 are adjacent, we can propose the following sequence: 1-5-(3,4,7)-2.
To find the order of fragments 3, 4, and 7, look for fragments that contain a subset of
these with a flanking fragment. Clone A includes fragments 5, 3, and 7, but not 4 (thus,
5-(3,7)-4); clone F includes fragments 4, 7, and 2 (thus, (4,7)-2). Combining these possibili-
ties allows us to deduce the order as 1-5-3-7-4-2. We concluded earlier that 9 is adjacent to
either 1 or 5. If it were adjacent to 5, it would be a part of clones C and D; because it is not in
C or D, it must be adjacent to 1.
We can now propose the following sequence: 9-1-5-3-7-4-2. Because clone F includes
these last three fragments and fragment 6, we can append 6 after 2: 9-1-5-3-7-4-2-6. Finally,
clone B is the only one that includes fragment 8, so it must occur at either end of our deduced
sequence. Given the other fragments in clone B, fragment 8 must be adjacent to fragment 6.
Thus, we have the order 9-1-5-3-7-4-2-6-8.
The fragments were numbered based on their migration distance in the gel, which corre-
lates inversely with the size of the fragment. Fragment 1 is the longest; fragment 9 the short-
est. The relative sizes and the positions of the fragments on the chromosome are shown be-
low. Molecular weight markers in the gel would allow a better estimation of the sizes of the
various fragments.
9 1 5 3 7 4 2 6 8
A
B
C
D
E
F
10. Cloning in Plants The strategy outlined in Figure 9–28 employs Agrobacterium cells that contain two
separate plasmids. Suggest why the sequences on the two plasmids are not combined on one plasmid.
Answer Simply for convenience; the 200,000 bp Ti plasmid, even when the T DNA is re-
moved, is too large to isolate in quantity and manipulate in vitro. It is also too large to reintro-
duce into a cell by standard transformation techniques. Single-plasmid systems in which the
T DNA of a Ti plasmid has been replaced by foreign DNA (by low-efficiency recombination in
vivo) have been used successfully, but this approach is very laborious. The vir genes can facil-
itate transfer of any DNA between the T DNA repeats, even if they are on a separate plasmid.
The second plasmid in the two-plasmid system, because it requires only the T DNA repeats
and a few sequences necessary for plasmid selection and propagation, is relatively small, easily
isolated, and easily manipulated (foreign DNA is easily added and/or altered). It can be propa-
gated in E. coli or Agrobacterium and is readily reintroduced into either bacterium.
11. DNA Fingerprinting and RFLP Analysis DNA is extracted from the blood cells of two humans, indi-
viduals 1 and 2. In separate experiments, the DNA from each individual is cleaved by restriction endonu-
cleases A, B, and C, and the fragments separated by electrophoresis. A hypothetical map of a 10,000 bp
segment of a human chromosome is shown (1 kbp 1,000 bp). Individual 2 has point mutations that
eliminate restriction recognition sites B* and C*. You probe the gel with a radioactive oligonucleotide
complementary to the indicated sequence and expose a piece of x-ray film to the gel. Indicate where you
would expect to see bands on the film. The lanes of the gel are marked in the accompanying diagram.
A B C probe B C* B* A C
kbp 0 1 2 3 4 5 6 7 8 9 10
A B C
M 1 2 1 2 1 2
10
9
8
7
6
5
4
M 1 2 1 2 1 2
A B C
Answer Cleaving DNA with restriction enzyme A produces identical fragments in both indi-
viduals: 6.5 kbp and 3.5 kbp fragments. The probe hybridizes to both 6.5 kbp fragments, re-
sulting in two identical bands in column A. Restriction enzyme B produces different cleavage
products: DNA from individual 1 is cleaved into 3, 2, and 4 kbp fragments; that from individual
2 (who has an altered B recognition sequence) into 3 and 6 kbp fragments. However, the
probe binds to the 3 kbp fragments from both individuals and therefore produces the same
pattern of bands on the gel (in column B). Restriction enzyme C cleaves DNA from individual
1 into 2.5 and 4.5 kbp fragments, and the probe labels the 2.5 kbp piece. DNA from individual
2, however, is cleaved to produce a single 7 kbp fragment, which hybridizes with the probe.
Thus, only in column C does a difference in DNA sequence between individuals 1 and 2 be-
come apparent. This exercise points out the importance of the choice of restriction enzymes,
as well as the choice of probes, when performing DNA fingerprinting and RFLP analysis.
A B C
M 1 2 1 2 1 2
10
9
8
7
6
5
4
M 1 2 1 2 1 2
A B C
12. Use of Photolithography to Make a DNA Microarray Figure 9–21 shows the first steps in the
process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining
steps needed to obtain the desired sequences (a different four-nucleotide sequence on each of the
four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide se-
quence attached at each spot.
Answer Cover spot 4, add solution containing activated T, irradiate, and wash. The resulting
sequences are now
1. A-T 2. G-T 3. A-T 4. G-C
Cover spots 2 and 4, add solution containing activated G, irradiate, and wash.
1. A-T-G 2. G-T 3. A-T-G 4. G-C
Cover spot 3, add solution containing activated C, irradiate, and wash.
1. A-T-G-C 2. G-T-C 3. A-T-G 4. G-C-C
Cover spots 1, 3, and 4, add solution containing activated C, irradiate, and wash.
1. A-T-G-C 2. G-T-C-C 3. A-T-G 4. G-C-C
Cover spots 1 and 2, add solution containing activated G, irradiate, and wash.
1. A-T-G-C 2. G-T-C-C 3. A-T-G-C 4. G-C-C-C
13. Cloning in Mammals The retroviral vectors described in Figure 9–32 make possible the efficient
integration of foreign DNA into a mammalian genome. Explain how these vectors, which lack genes for
replication and viral packaging (gag, pol, env), are assembled into infectious viral particles. Suggest
why it is important that these vectors lack the replication and packaging genes.
Answer The retroviral vectors must be introduced into a cell infected with a helper virus that
can provide the necessary replication and packaging functions but cannot itself be packaged.
The vectors packaged into infectious viral particles are then used to introduce the recombi-
nant DNA into a mammalian cell. Once this DNA is integrated into the target cell’s chromo-
some, the absence of replication and packaging functions makes the integration very stable by
preventing deletion or replication of the integrated DNA.
2608T_ch09sm_S99-S111 02/22/2008 2:50 am Page S-110 pinnacle OS9:Desktop Folder:
Data Analysis Problem

14. HincII: The First Restriction Endonuclease Discovery of the first restriction endonuclease to be of
practical use was reported in two papers published in 1970. In the first paper, Smith and Wilcox de-
scribed the isolation of an enzyme that cleaved double-stranded DNA. They initially demonstrated the
enzyme’s nuclease activity by measuring the decrease in viscosity of DNA samples treated with the
enzyme.
(a) Why does treatment with a nuclease decrease the viscosity of a solution of DNA?
The authors determined whether the enzyme was an endo- or an exonuclease by treating 32P-labeled
DNA with the enzyme, then adding trichloroacetic acid (TCA). Under the conditions used in their experi-
ment, single nucleotides would be TCA-soluble and oligonucleotides would precipitate.
(b) No TCA-soluble 32P-labeled material formed on treatment of 32P-labeled DNA with the nuclease.
Based on this finding, is the enzyme an endo- or exonuclease? Explain your reasoning.
When a polynucleotide is cleaved, the phosphate usually is not removed but remains attached to the
5 or 3 end of the resulting DNA fragment. Smith and Wilcox determined the location of the phosphate
on the fragment formed by the nuclease in the following steps:
1. Treat unlabeled DNA with the nuclease.

2. Treat a sample (A) of the product with -32P-labeled ATP and polynucleotide kinase (which
can attach the -phosphate of ATP to a 5 OH but not to a 5 phosphate or to a 3 OH or 3
phosphate). Measure the amount of 32P incorporated into the DNA.
3. Treat another sample (B) of the product of step 1 with alkaline phosphatase (which removes
phosphate groups from free 5 and 3 ends), followed by polynucleotide kinase and
-32P-labeled ATP. Measure the amount of 32P incorporated into the DNA.
(c) Smith and Wilcox found that sample A had 136 counts/min of 32P; sample B had 3,740
counts/min. Did the nuclease cleavage leave the phosphate on the 5 or the 3 end of the DNA
fragments? Explain your reasoning.
(d) Treatment of bacteriophage T7 DNA with the nuclease gave approximately 40 specific fragments
of various lengths. How is this result consistent with the enzyme’s recognizing a specific
sequence in the DNA as opposed to making random double-strand breaks?
At this point, there were two possibilities for the site-specific cleavage: the cleavage occurred either
(1) at the site of recognition or (2) near the site of recognition but not within the sequence recognized.
To address this issue, Kelly and Smith determined the sequence of the 5 ends of the DNA fragments
generated by the nuclease, in the following steps:
1. Treat phage T7 DNA with the enzyme.

2. Treat the resulting fragments with alkaline phosphatase to remove the 5 phosphates.
3. Treat the dephosphorylated fragments with polynucleotide kinase and -32P-labeled ATP to
label the 5 ends.
4. Treat the labeled molecules with DNases to break them into a mixture of mono-, di-, and
trinucleotides.
5. Determine the sequence of the labeled mono-, di-, and trinucleotides by comparing them with
oligonucleotides of known sequence on thin-layer chromatography.
The labeled products were identified as follows: mononucleotides: A and G; dinucleotides:
5-pApA-3 and 5-pGpA-3; trinucleotides: 5-pApApC-3 and 5-pGpApC-3.
(e) Which model of cleavage is consistent with these results? Explain your reasoning.
Kelly and Smith went on to determine the sequence of the 3 ends of the fragments. They found a
mixture of 5-pTpC-3 and 5-pTpT-3. They did not determine the sequence of any trinucleotides at the
3 end.
(f) Based on these data, what is the recognition sequence for the nuclease and where in the
sequence is the DNA backbone cleaved? Use Table 9–2 as a model for your answer.
Answer
(a) DNA solutions are highly viscous because the very long molecules are tangled in solu-
tion. Shorter molecules tend to tangle less and form a less viscous solution, so decreased
viscosity corresponds to shortening of the polymers—as caused by nuclease activity.
(b) An endonuclease. An exonuclease removes single nucleotides from the 5 or 3 end and
would produce TCA-soluble 32P-labeled nucleotides. An endonuclease cuts DNA into
oligonucleotide fragments and produces little or no TCA-soluble 32P-labeled material.
(c) The 5 end. If the phosphate were left on the 3 end, the kinase would incorporate signif-
icant 32P as it added phosphate to the 5 end; treatment with the phosphatase would
have no effect on this. In this case, samples A and B would incorporate significant
amounts of 32P. When the phosphate is left on the 5 end, the kinase does not incorpo-
rate any 32P: it cannot add a phosphate if one is already present. Treatment with the
phosphatase removes 5 phosphate, and the kinase then incorporates significant
amounts of 32P. Sample A will have little or no 32P, and B will show substantial 32P
incorporation—as was observed.
(d) Random breaks would produce a distribution of fragments of random size. The produc-
tion of specific fragments indicates that the enzyme is site-specific.
(e) Cleavage at the site of recognition. This produces a specific sequence at the 5 end of
the fragments. If cleavage occurred near but not within the recognition site, the se-
quence at the 5 end of the fragments would be random.
(f) The results are consistent with two recognition sequences, as shown below, cleaved
where shown by the arrows:
g
(5),GTT AAC,(3)
(3),CAA TTG,(5)
h
which gives the (5)pApApC and (3)TpTp fragments; and
g
(5),GTC GAC,(3)
(3),CAG CTG,(5)
h
which gives the (5)pGpApC and (3)CpTp fragments.
References
Kelly, T.J. & Smith, H.O. (1970) A restriction enzyme from Haemophilus influenzae: II. Base sequence of the recognition site.
J. Mol. Biol. 51, 393– 409.
Smith, H.O. & Wilcox, K.W. (1970) A restriction enzyme from Haemophilus influenzae: I. Purification and general properties.
J. Mol. Biol. 51, 379–391.

Pob5e Solutions Ch09

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Pob5e Solutions Ch09

Uploaded by

Copyright:

Available Formats

2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-99 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY:21-02-08:WHQY028/soln:

Answer Type II restriction enzymes cleave double-stranded DNA within recognition

S-100 Chapter 9 DNA-Based Information Technologies

(5),G(3) and (5)AATTC,(3)

(5),GAATT(3) and (5)AATTC,(3)

(5),G(3) and (5)C,(3)

(5),CAG(3) and (5)CTG,(3)

Chapter 9 DNA-Based Information Technologies S-101

S-102 Chapter 9 DNA-Based Information Technologies

Notice that the EcoRI and PstI sites are retained.

Chapter 9 DNA-Based Information Technologies S-103

pBR322 Clone in lane 1

Clone in lane 2 Clone in lane 3

S-104 Chapter 9 DNA-Based Information Technologies

The synthesis would be designed to incorporate either U or C where indicated, producing a

Chapter 9 DNA-Based Information Technologies S-105

S-106 Chapter 9 DNA-Based Information Technologies

9. Mapping a Chromosome Segment A group of overlapping clones, designated A through F, is isolated

Chapter 9 DNA-Based Information Technologies S-107

S-108 Chapter 9 DNA-Based Information Technologies

Chapter 9 DNA-Based Information Technologies S-109

S-110 Chapter 9 DNA-Based Information Technologies

Data Analysis Problem

1. Treat unlabeled DNA with the nuclease.

1. Treat phage T7 DNA with the enzyme.

Chapter 9 DNA-Based Information Technologies S-111

You might also like