Lehninger Principles of Biochemistry

6th Edition Nelson Solutions Manual

Visit to download the full and correct content document: https://testbankdeal.com/dow
nload/lehninger-principles-of-biochemistry-6th-edition-nelson-solutions-manual/
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:25 PM Page S-98

chapter

9 DNA-Based Information
Technologies

1. Engineering Cloned DNA When joining two or more DNA fragments, a researcher can adjust the
sequence at the junction in a variety of subtle ways, as seen in the following exercises.
(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction
digest (include those sequences remaining from the EcoRI recognition sequence).
(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and
the four deoxynucleoside triphosphates (see Fig. 8–33).
(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in
(b) are ligated (see Fig. 25–16).
(d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that
degrades only single-stranded DNA.
(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end
with structure (d).
(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction
digest (include those sequences remaining from the PvuII recognition sequence).
(g) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end
with structure (f).
(h) Suppose you can synthesize a short duplex DNA fragment with any sequence you desire. With
this synthetic fragment and the procedures described in (a) through (g), design a protocol that
would remove an EcoRI restriction site from a DNA molecule and incorporate a new BamHI
restriction site at approximately the same location. (See Fig. 9–2.)
(i) Design four different short synthetic double-stranded DNA fragments that would permit ligation
of structure (a) with a DNA fragment produced by a PstI restriction digest. In one of these
fragments, design the sequence so that the final junction contains the recognition sequences for
both EcoRI and PstI. In the second and third fragments, design the sequence so that the junction
contains only the EcoRI and only the PstI recognition sequence, respectively. Design the
sequence of the fourth fragment so that neither the EcoRI nor the PstI sequence appears in the
junction.

Answer Type II restriction enzymes cleave double-stranded DNA within recognition

sequences to create either blunt-ended or sticky-ended fragments. Blunt-ended DNA frag-
ments can be joined by the action of T4 DNA ligase. Sticky-ended DNA fragments can be
joined by either E. coli or T4 DNA ligases, provided that the sticky ends are complementary.
Sticky-ended fragments without complementary ends can be joined only after the ends are
made blunt, either by exonucleases or by E. coli DNA polymerase I.
(a) The recognition sequence for EcoRI is (5⬘)GAATTC(3⬘), with the cleavage site between
G and A (see Table 9–2). Thus, digestion of a DNA molecule with one EcoRI site

S-98
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:25 PM Page S-99

Chapter 9 DNA-Based Information Technologies S-99

(5⬘),GAATTC,(3⬘)
(3⬘),CTTAAG,(5⬘)
would yield two fragments:

(5⬘),G(3⬘) and (5⬘)AATTC,(3⬘)

(3⬘),CTTAA(5⬘) (3⬘)G,(5⬘)
(b) DNA polymerase I catalyzes the synthesis of DNA in the 5⬘→ 3⬘ direction in the presence
of the four deoxyribonucleoside triphosphates. Therefore, both fragments generated in
(a) will be made blunt ended:

(5⬘),GAATT(3⬘) and (5⬘)AATTC,(3⬘)

(3⬘),CTTAA(5⬘) (3⬘)TTAAG,(5⬘)
(c) The two fragments generated in (b) can be ligated by T4 DNA ligase to form

(5⬘),GAATTAATTC,(3⬘)
(3⬘),CTTAATTAAG,(5⬘)
(d) The fragments in (a) have sticky ends, with a protruding single-stranded region. Treat-
ment of these DNA fragments with a single-strand-specific nuclease will yield DNA frag-
ments with blunt ends:

(5⬘),G(3⬘) and (5⬘)C,(3⬘)

(3⬘),C(5⬘) (3⬘)G,(5⬘)
(e) The left-hand DNA fragment in (b) can be joined to the right-hand fragment in (d) to
yield

(5⬘),GAATTC,(3⬘)
(3⬘),CTTAAG,(5⬘)
The same recombinant DNA molecule is produced by joining the right-hand fragment in
(b) to the left-hand fragment in (d).
(f) The recognition sequence for PvuII is (5⬘)CAGCTG(3⬘), with the cleavage site between
G and C (see Table 9–2). Thus, a DNA molecule with a PvuII site will yield two frag-
ments when digested with PvuII:

(5⬘),CAG(3⬘) and (5⬘)CTG,(3⬘)

(3⬘),GTC(5⬘) (3⬘)GAC,(5⬘)
(g) The left-hand DNA fragment in (b) can be joined to the right-hand fragment in (f) to
yield

(5⬘),GAATTCTG,(3⬘)
(3⬘),CTTAAGAC,(5⬘)
The same recombinant DNA is produced by joining the right-hand fragment in (b) to the
left-hand fragment in (f):

(5⬘),CAGAATTC,(3⬘)
(3⬘),GTCTTAAG,(5⬘)
(h) There are two ways to convert an EcoRI restriction site to a BamHI restriction site.
Method 1: Digest DNA with EcoRI, and then create blunt ends by using either DNA
polymerase I to fill in the single-stranded region as in (b) or a single-strand-specific nu-
clease to remove the single-stranded region as in (d). Ligate a synthetic linker that con-
tains the BamHI recognition sequence (5⬘)GGATCC(3⬘) (see Table 9–2),

(5⬘)GCGGATCCCG(3⬘)
(3⬘)CGCCTAGGGC(5⬘)
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:25 PM Page S-100

S-100 Chapter 9 DNA-Based Information Technologies

between the two blunt-ended DNA fragments to yield, if the EcoRI-digested DNA is
treated as in (b),

(5⬘),GAATTGCGGATCCCGAATTC,(3⬘)
(3⬘),CTTAACGCCTAGGGCTTAAG,(5⬘)
or, if the EcoRI-digested DNA is treated as in (d),

(5⬘),GGCGGATCCCG(3⬘)
(3⬘),CCGCCTAGGGC(5⬘)
Notice that the EcoRI site is not regenerated after ligation of the linker.
Method 2: This method uses a “conversion adaptor” to introduce a BamHI site into
the DNA molecule. A synthetic oligonucleotide with the sequence (5⬘)AATTGGATCC(3⬘)
is partially self-complementary, and it spontaneously forms the structure

(5⬘)AATTGGATCC(3⬘)
(3⬘) CCTAGGTTAA(5⬘)
The sticky ends of this adaptor are complementary to the sticky ends generated by
EcoRI digestion, so the adaptor can be ligated between the two EcoRI fragments to form

(5⬘),GAATTGGATCCAATT,(3⬘)
(3⬘),CTTAACCTAGGTTAA,(5⬘)
Because ligation between DNA molecules with compatible sticky ends is more efficient than
ligation between DNA molecules with blunt ends, Method 2 is preferred over Method 1.
(i) Joining of the DNA fragments in (a) to a fragment generated by PstI digestion requires a
conversion adaptor. This adaptor should contain a single-stranded region complementary
to the sticky end of an EcoRI-generated DNA fragment, and a single-stranded region
complementary to the sticky end generated by PstI digestion. The four adaptor se-
quences that fulfill this requirement are shown below, in order of discussion in the prob-
lem (N ⫽ any nucleotide):

(5⬘)AATTCNNNNCTGCA(3⬘)
(3⬘)GNNNNG(5⬘)
(5⬘)AATTCNNNNGTGCA(3⬘)
(3⬘)GNNNNC(5⬘)
(5⬘)AATTGNNNNCTGCA(3⬘)
(3⬘)CNNNNG(5⬘)
(5⬘)AATTGNNNNGTGCA(3⬘)
(3⬘)CNNNNC(5⬘)
For the first adaptor: Ligation of the adaptor to the EcoRI-digested DNA molecule
would yield

(5⬘),GAATTCNNNNCTGCA(3⬘)
(3⬘),CTTAAGNNNNG(5⬘)
This product can now be ligated to a DNA fragment produced by a PstI digest, which has
the terminal sequence

(5⬘)G,(3⬘)
(3⬘)ACGTC,(5⬘)
to yield

(5⬘),GAATTCNNNNCTGCAG,(3⬘)
(3⬘),CTTAAGNNNNGACGTC,(5⬘)
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:25 PM Page S-101

Chapter 9 DNA-Based Information Technologies S-101

Notice that the EcoRI and PstI sites are retained.

In a similar fashion, each of the other three adaptors can be ligated to the EcoRI-
digested DNA molecule, and the ligated molecule joined to a DNA fragment produced by
a PstI digest. The final products are as follows.
For the second adaptor:

(5⬘),GAATTCNNNNGTGCAG,(3⬘)
(3⬘),CTTAAGNNNNCACGTC,(5⬘)
The EcoRI site is retained, but not the PstI site.
For the third adaptor:

(5⬘),GAATTGNNNNCTGCAG,(3⬘)
(3⬘),CTTAACNNNNGACGTC,(5⬘)
The PstI site is retained, but not the EcoRI site.
For the fourth adaptor:

(5⬘),GAATTGNNNNGTGCAG,(3⬘)
(3⬘),CTTAACNNNNCACGTC,(5⬘)
Neither the EcoRI nor the PstI site is retained.

2. Selecting for Recombinant Plasmids When cloning a foreign DNA fragment into a plasmid, it is
often useful to insert the fragment at a site that interrupts a selectable marker (such as the tetracy-
cline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify
clones containing recombinant plasmids with foreign DNA. With a bacteriophage l vector it is not nec-
essary to do this, yet one can easily distinguish vectors that incorporate large foreign DNA fragments
from those that do not. How are these recombinant vectors identified?

Answer Bacteriophage l DNA can be packaged into infectious phage particles only if it is be-
tween 40,000 and 53,000 bp long. The two essential pieces of the bacteriophage l vector have
about 30,000 bp in all, so the vector is not packaged into phage particles unless the additional,
foreign DNA is of sufficient length: 10,000 to 23,000 bp.

3. DNA Cloning The plasmid cloning vector pBR322 (see Fig. 9–3) is cleaved with the restriction
endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage)
is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform
bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline.
(a) In addition to the desired recombinant plasmid, what other types of plasmids might be found
among the transformed bacteria that are tetracycline resistant? How can the types be distin-
guished?
(b) The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three
different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giv-
ing the patterns shown below. What does each pattern say about the cloned DNA? Note that in
pBR322, the PstI and EcoRI restriction sites are about 750 bp apart. The entire plasmid with no
cloned insert is 4,361 bp. Size markers in lane 4 have the number of nucleotides noted.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:25 PM Page S-102

S-102 Chapter 9 DNA-Based Information Technologies

Nucleotide
1 2 3 4
length

5,000

Electrophoresis
3,000

1,500

1,000
750
500
250

Answer
(a) Ligation of the linear pBR322 to regenerate circular pBR322 is a unimolecular process
and thus occurs more efficiently than the ligation of a foreign DNA fragment to the
linear pBR322, which is a bimolecular process (assuming equimolar amounts of linear
pBR322 and foreign DNA in the reaction mixture). The tetracycline-resistant bacteria
would include recombinant plasmids and plasmids in which the original pBR322 was
regenerated without insertion of a foreign DNA fragment. (These would also retain
resistance to ampicillin.) In addition, two or more molecules of pBR322 might be ligated
together with or without insertion of foreign DNA.
(b) The clones giving rise to the patterns in lanes 1 and 2 each have one DNA fragment
inserted, but in different orientations (see the diagrams, which are not drawn to scale;
keep in mind that the products on the gel are from EcoRI cleavage). The clone produc-
ing the pattern in lane 3 has two DNA fragments, ligated such that the EcoRI-site
proximal ends are joined.

PstI EcoRI
EcoRI

EcoRI
PstI PstI

pBR322 Clone in lane 1

EcoRI
PstI EcoRI PstI PstI
EcoRI EcoRI

EcoRI
PstI PstI

Clone in lane 2 Clone in lane 3

c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:25 PM Page S-103

Chapter 9 DNA-Based Information Technologies S-103

4. Restriction Enzymes The partial sequence of one strand of a double-stranded DNA molecule is
5⬘---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG---3⬘
The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.

EcoRI PstI
g g
* *
(5 ) GAATTC (3 ) (5 ) CTGCAG (3 )
CTTAAG GACGTC
*g *
g

Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with
both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand
sequence given above.

Answer Begin by writing the sequence of the double-stranded molecule and identifying any
restriction sites for EcoRI and PstI.

PstI EcoRI
g g
* *
(5 )---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG---(3 )
(3 )---CTGCTTCACGACGTCTTTCAGGCGCAATTACCGTACTTAAGGACACC---(5 )
*g * g

If the molecule is cleaved by the enzymes at the sites shown, the fragment will be reduced to

(5 )GAAAGTCCGCGTTATAGGCATG(3 )
(3 )ACGTCTTTCAGGCGCAATTACCGTACTTAA(5 )

with these additional fragments from the ends

(3 )---GACGAAGTGCTGCA AATTCCTGAGG---(3 )
(5 )---CTGCTTCACG GGACACC---(5 )

5. Designing a Diagnostic Test for a Genetic Disease Huntington disease (HD) is an inherited neu-
rodegenerative disorder, characterized by the gradual, irreversible impairment of psychological, motor,
and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any
age. The course of the disease can last 15 to 20 years. The molecular basis of the disease is becoming
better understood. The genetic mutation underlying HD has been traced to a gene encoding a protein
(Mr 350,000) of unknown function. In individuals who will not develop HD, a region of the gene that
encodes the amino terminus of the protein has a sequence of CAG codons (for glutamine) that is re-
peated 6 to 39 times in succession. In individuals with adult-onset HD, this codon is typically repeated
40 to 55 times. In individuals with childhood-onset HD, this codon is repeated more than 70 times. The
length of this simple trinucleotide repeat indicates whether an individual will develop HD, and at ap-
proximately what age the first symptoms will occur.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-104

S-104 Chapter 9 DNA-Based Information Technologies

A small portion of the amino-terminal coding sequence of the 3,143-codon HD gene is given below.
The nucleotide sequence of the DNA is shown, with the amino acid sequence corresponding to the
gene below it, and the CAG repeat is shaded. Using Figure 27–7 to translate the genetic code, outline a
PCR-based test for HD that could be carried out using a blood sample. Assume the PCR primer must
be 25 nucleotides long. By convention, unless otherwise specified a DNA sequence encoding a protein
is displayed with the coding strand (the sequence identical to the mRNA transcribed from the gene)
on top such that it is read 5⬘ to 3⬘, left to right.

307 ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTC
1 M A T L E K L M K A F E S L K S F

358 CAGCAGTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
18 Q Q F Q Q Q Q Q Q Q Q Q Q Q Q Q Q

409 CAGCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCGCCGCCGCCG
35 Q Q Q Q Q Q Q Q Q P P P P P P P P

460 CCGCCTCCTCAGCTTCCTCAGCCGCCGCCG
52 P P P Q L P Q P P P

Source: The Huntington’s Disease Collaborative Research Group. (1993) A novel gene containing a trinucleotide
repeat that is expanded and unstable on Huntington’s disease chromosomes. Cell 72, 971–983.

Answer Your test would require DNA primers, a heat-stable DNA polymerase, deoxynucleo-
side triphosphates, and a PCR machine (thermal cycler). The primers would be designed to
amplify a DNA segment encompassing the CAG repeat. The DNA strand shown is the coding
strand, oriented 5⬘→ 3⬘ left to right. The primer targeted to DNA to the left of the repeat
would be identical to any 25-nucleotide sequence shown in the region to the left of the CAG
repeat. Such a primer will direct synthesis of DNA across the repeat from left to right. The
primer on the right side must be complementary and antiparallel to a 25-nucleotide
sequence to the right of the CAG repeat. Such a primer will direct 5⬘→ 3⬘ synthesis of DNA
across the repeat from right to left. Choosing unique sequences relatively close to the CAG
repeat will make the amplified region smaller and the test more sensitive to small changes in
size. Using the primers, DNA including the CAG repeat would be amplified by PCR, and its
size would be determined by comparison to size markers after electrophoresis. The length of
the DNA would reflect the length of the CAG repeat, providing a simple test for the disease.
Such a test could be carried out on a blood sample and completed in less than a day.

6. Using PCR to Detect Circular DNA Molecules In a species of ciliated protist, a segment of
genomic DNA is sometimes deleted. The deletion is a genetically programmed reaction associated with
cellular mating. A researcher proposes that the DNA is deleted in a type of recombination called site-
specific recombination, with the DNA on either end of the segment joined together and the deleted
DNA ending up as a circular DNA reaction product.

proposed
reaction

Suggest how the researcher might use the polymerase chain reaction (PCR) to detect the presence of
the circular form of the deleted DNA in an extract of the protist.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-105

Chapter 9 DNA-Based Information Technologies S-105

Answer Design PCR primers complementary to DNA in the deleted segment, but which
would direct DNA synthesis away from each other. No PCR product will be generated unless
the ends of the deleted segment are joined to create a circle.

7. Glowing Plants When grown in ordinary garden soil and watered normally, a plant engineered to
express green fluorescent protein (see Fig. 9–16) will glow in the dark, whereas a plant engineered to
express firefly luciferase will not. Explain these observations.

Answer The plant expressing firefly luciferase must take up luciferin, the substrate of lu-
ciferase, before it can “glow” (albeit weakly). The plant expressing green fluorescent protein
glows without requiring any other compound.

8. Designing PCR Primers One strand of a chromosomal DNA sequence is shown below. An investiga-
tor wants to amplify and isolate a DNA fragment defined by the shaded segment, using the polymerase
chain reaction. Design two PCR primers, each 20 nucleotides long, that can be used to amplify this
DNA segment.

5 ---AATGCCGTCAGCCGATCTGCCTCGAGTCAATCGATGCTGGTAACTTGGGGTATAAAGCT
TACCCATGGTATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTAGGTTTCTGGTATTGGTT
TAGGGTCTTTGATGCTATTAATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATGTTTTAAGC
CGGGTTTTGTCTGGGATGGTTCGTCTGATGTGCGCGTAGCGTGCGGCG---3

Answer Recall that DNA sequences are always written in the 5⬘ to 3⬘ direction, left to right;
that the two strands of a DNA molecule are antiparallel; and that both PCR primers must tar-
get the end sequences so that their 3⬘ ends are oriented toward the segment to be amplified,
because this is the end that will be extended by the polymerase. In this case, primer 1 should
have the same sequence as the target, beginning at the 5⬘ end. The target sequence is shown
below:

(5 )CCTCGAGTCAATCGATGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAGTTAG
ATTGATTGTTAGGTTCTTAGGTTTAGGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTAATT
GTTTGGTTTTGATTTGGTCTTTATATGGTTTATGTTTTAAGCCGGGTTTTGTCTGGGATGGTTCG
TCTGATGTGCGCG(3 )

Primer 1 simply repeats the first 20 bases in the required sequence:

Primer 1: (5⬘)CCTCGAGTCAATCGATGCTG(3⬘)
Primer 2 will be directing synthesis of the strand complementary to the target from its 5⬘ end.
Looking at the 3⬘ end of the target as drawn (shaded) and writing the sequence of the first 20
bases of the complement in the 5⬘ to 3⬘ direction gives
(3⬘)GCGCGTGTAGTCTGCTTGGT---(5⬘)
(5⬘)CGCGCACATCAGACGAACCA(3⬘)
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-106

S-106 Chapter 9 DNA-Based Information Technologies

Primer 2: (5⬘)CGCGCACATCAGACGAACCA(3⬘)
Possible wrong answers for Primer 1 would include
(5⬘)AATGCCGTCAGCCGATCTGC(3⬘) This primer would work but would amplify too much
DNA because it is primer derived from the region surrounding the target sequence.
(5⬘)CAGCATCGATTGACTCGAGG(3⬘) This primer would not work because it is complemen-
tary to the first 20 bases in the target region. DNA synthesis would proceed away from the
target region.
For Primer 2 a common mistake would be (5⬘)ACCAAGCAGACTACACGCGC(3⬘). This primer
is the correct primer sequence backwards, and would produce no result.
9. Mapping a Chromosome Segment A group of overlapping clones, designated A through F, is isolated
from one region of a chromosome. Each of the clones is separately cleaved by a restriction enzyme and
the pieces resolved by agarose gel electrophoresis, with the results shown below. There are nine differ-
ent restriction fragments in this chromosomal region, with a subset appearing in each clone. Using this
information, deduce the order of the restriction fragments in the chromosome.
Overlapping clones

A B C D E F

1 Nine
2 restriction
fragments
3
Electrophoresis

4
5

8
9

Answer Solving a restriction fragment map is a logic puzzle. The agarose gel shows which
fragments are part of each clone, but deducing their order on the chromosome takes some
work.
Clone A: fragments 1, 3, 5, 7, and 9
Clone B: fragments 2, 3, 4, 6, 7, and 8
Clone C: fragments 1, 3, 4, 5, and 7
Clone D: fragments 2, 3, 4, 5, and 7
Clone E: fragments 1, 5, and 9
Clone F: fragments 2, 4, 6, and 7

Begin with clone E, which has the fewest fragments. Fragments 1, 5, and 9 must be adjacent,
but may be in any order. However, clone C includes fragments 1 and 5, but not 9, so we can
conclude that fragments 1 and 5 are adjacent; 9 could be adjacent to either 1 or 5, but is not
between them (i.e., the order is 9-1-5 or 1-5-9). Clones C and D are identical except that C
also includes fragment 1, and D also includes fragment 2; from this we can deduce that frag-
ments 1 and 2 must be at opposite ends of the overlapping region, which includes fragments
3, 4, 5, and 7 (in an as yet undetermined order). Because we have already concluded that
fragments 1 and 5 are adjacent, we can propose the following sequence: 1-5-(3,4,7)-2.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-107

Chapter 9 DNA-Based Information Technologies S-107

To find the order of fragments 3, 4, and 7, look for fragments that contain a subset of
these with a flanking fragment. Clone A includes fragments 5, 3, and 7, but not 4 (thus,
5-(3,7)-4); clone F includes fragments 4, 7, and 2 (thus, (4,7)-2). Combining these possibili-
ties allows us to deduce the order as 1-5-3-7-4-2. We concluded earlier that 9 is adjacent to
either 1 or 5. If it were adjacent to 5, it would be a part of clones C and D; because it is not in
C or D, it must be adjacent to 1.
We can now propose the following sequence: 9-1-5-3-7-4-2. Because clone F includes
these last three fragments and fragment 6, we can append 6 after 2: 9-1-5-3-7-4-2-6. Finally,
clone B is the only one that includes fragment 8, so it must occur at either end of our deduced
sequence. Given the other fragments in clone B, fragment 8 must be adjacent to fragment 6.
Thus, we have the order 9-1-5-3-7-4-2-6-8.
The fragments were numbered based on their migration distance in the gel, which corre-
lates inversely with the size of the fragment. Fragment 1 is the longest; fragment 9 the short-
est. The relative sizes and the positions of the fragments on the chromosome are shown be-
low. Molecular weight markers in the gel would allow a better estimation of the sizes of the
various fragments.

9 1 5 3 7 4 2 6 8

A
B
C
D
E
F

10. Immunofluorescence In the more common protocol for immunofluorescence detection of cellular
proteins, an investigator uses two antibodies. The first binds specifically to the protein of interest. The
second is labeled with fluorochromes for easy visualization, and it binds to the first antibody. In princi-
ple, one could simply label the first antibody and skip one step. Why use two successive antibodies?

Answer The production of labeled antibodies is difficult and expensive. The labeling of every
antibody to every protein target would be impractical. By labeling one antibody preparation
for binding to all antibodies of a particular class, the same labeled antibody preparation can be
used in many different immunofluorescence experiments.

11. Yeast Two-Hybrid Analysis You are a researcher who has just discovered a new protein in a fungus.
Design a yeast two-hybrid experiment to identify the other proteins in the fungal cell with which your
protein interacts and explain how this could help you determine the function of your protein.

Answer Express the desired protein (Protein X in Fig. 9–21) in yeast strain 1 as a fusion pro-
tein with one of the domains of Gal4p—say, the DNA-binding domain. Using yeast strain 2,
make a library in which essentially every protein of the fungus is expressed as a fusion protein
with the activation domain of Gal4p. If you mate strain 1 with the strain 2 library, some of the
resulting colonies will express both the Protein X–Gal4p DNA-binding domain fusion protein
and a fusion protein with one domain that interacts with Protein X and a Gal4p activation do-
main. Only in these colonies, where the binding of Protein X to Protein Y brings the fused
Gal4p domains in proximity, will there be transcription of the reporter gene that will color the
colonies, making them detectable. Sequencing and identifying all “Y” proteins that X interacts
with can help identify the function of X in the cell.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-108

S-108 Chapter 9 DNA-Based Information Technologies

12. Use of Photolithography to Make a DNA Microarray Figure 9–22 shows the first steps in the
process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining
steps needed to obtain the desired sequences (a different four-nucleotide sequence on each of the
four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide se-
quence attached at each spot.

Answer Cover spot 4, add solution containing activated T, irradiate, and wash. The resulting
sequences are now
1. A-T 2. G-T 3. A-T 4. G-C
Cover spots 2 and 4, add solution containing activated G, irradiate, and wash.
1. A-T-G 2. G-T 3. A-T-G 4. G-C
Cover spot 3, add solution containing activated C, irradiate, and wash.
1. A-T-G-C 2. G-T-C 3. A-T-G 4. G-C-C
Cover spots 1, 3, and 4, add solution containing activated C, irradiate, and wash.
1. A-T-G-C 2. G-T-C-C 3. A-T-G 4. G-C-C
Cover spots 1 and 2, add solution containing activated G, irradiate, and wash.
1. A-T-G-C 2. G-T-C-C 3. A-T-G-C 4. G-C-C-C

13. Genomic Sequencing In large-genome sequencing projects, the initial data usually reveal gaps
where no sequence information has been obtained. To close the gaps, DNA primers complementary to
the 5⬘-ending strand (i.e., identical to the sequence of the 3⬘-ending strand) at the end of each contig
are especially useful. Explain how these primers might be used.

Answer If we wanted to use PCR to make many copies of part of a known section of DNA se-
quence (a contig) we would use the sequence that matches the beginning of the 5⬘ strand.
The complementary sequence (which matches the 3⬘ end of the contig), would direct synthe-
sis away from the known sequence (as described in the solution to Problem 8). Since the ob-
jective is to learn the unknown parts of the sequence, making primers corresponding to all of
the 3⬘ ends of all of the contig sequences can lead to PCR amplification of the unknown gap
sequences, assuming that the known sequences are not too far apart.

14. Use of Outgroups in Comparative Genomics A hypothetical protein is found in orangutans,

chimpanzees, and humans that has the following sequences (bold indicates the amino acid residue
differences):

Human: ATSAAGYDEWEGGKVLIHL– – KLQNRGALLELDIGAV

Orangutan: ATSAAGWDEWEGGKVLIHLDGKLQNRGALLELDIGAV
Chimpanzee: ATSAAGWDEWEGGKILIHLDGKLQNRGALLELDIGAV
(Dashes indicate a deletion—the residues are missing in that sequence.)
What is the most likely sequence of the protein present in the last common ancestor of chim-
panzees and humans?

Answer The Orangutan is the outgroup against which the human and Chimpanzee are being
compared to determine the likely sequence of the protein in their last common ancestor. The
orangutan protein shares the W of the chimpanzee, the V of the human, and has the DG that
is present in the chimpanzee but lacking in the human. Therefore, the sequence of the pro-
tein in the last common ancestor is likely to be:
ATSAAGWDEWEGGKVLIHLDGKLQNRGALLELDIGAV
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-109

Chapter 9 DNA-Based Information Technologies S-109

15. Finding Disease Genes You are a gene hunter, trying to find the genetic basis for a case inherited
disease. Examination of six pedigrees of families affected by the disease provides inconsistent results.
For two of the families, the disease is co-inherited with markers on chromosome 7. For the other four
families, the disease is co-inherited with markers on chromosome 12. Explain how this might occur.

Answer Although an inherited disease can be caused by a defect in a single protein, which
would generally be confined to a single site on one chromosome, a disease may also be caused
by a deficiency in a pathway. In this case a deficiency in any of the enzymes in the pathway
could produce the same phenotype and the same disease. In many cellular processes, two or
more different proteins act in concert to produce a particular outcome (a product or a signal)
so that a deficiency of any of them would cause a disease. Thus, the same disease condition
can be caused by a defect in one of several genes, which may be on different chromosomes.

Data Analysis Problem

16. HincII: The First Restriction Endonuclease Discovery of the first restriction endonuclease to be of
practical use was reported in two papers published in 1970. In the first paper, Smith and Wilcox de-
scribed the isolation of an enzyme that cleaved double-stranded DNA. They initially demonstrated the
enzyme’s nuclease activity by measuring the decrease in viscosity of DNA samples treated with the
enzyme.
(a) Why does treatment with a nuclease decrease the viscosity of a solution of DNA?
The authors determined whether the enzyme was an endo- or an exonuclease by treating 32P-labeled
DNA with the enzyme, then adding trichloroacetic acid (TCA). Under the conditions used in their experi-
ment, single nucleotides would be TCA-soluble and oligonucleotides would precipitate.
(b) No TCA-soluble 32P-labeled material formed on treatment of 32P-labeled DNA with the nuclease.
Based on this finding, is the enzyme an endo- or exonuclease? Explain your reasoning.
When a polynucleotide is cleaved, the phosphate usually is not removed but remains attached to
the 5⬘ or 3⬘ end of the resulting DNA fragment. Smith and Wilcox determined the location of the phos-
phate on the fragment formed by the nuclease in the following steps:

1. Treat unlabeled DNA with the nuclease.

2. Treat a sample (A) of the product with ␥-32P-labeled ATP and polynucleotide kinase (which
can attach the ␥-phosphate of ATP to a 5⬘ OH but not to a 5⬘ phosphate or to a 3⬘ OH or 3⬘
phosphate). Measure the amount of 32P incorporated into the DNA.
3. Treat another sample (B) of the product of step 1 with alkaline phosphatase (which removes
phosphate groups from free 5⬘ and 3⬘ ends), followed by polynucleotide kinase and
␥-32P-labeled ATP. Measure the amount of 32P incorporated into the DNA.
(c) Smith and Wilcox found that sample A had 136 counts/min of 32P; sample B had 3,740
counts/min. Did the nuclease cleavage leave the phosphate on the 5⬘ or the 3⬘ end of the DNA
fragments? Explain your reasoning.
(d) Treatment of bacteriophage T7 DNA with the nuclease gave approximately 40 specific fragments
of various lengths. How is this result consistent with the enzyme’s recognizing a specific
sequence in the DNA as opposed to making random double-strand breaks?
At this point, there were two possibilities for the site-specific cleavage: the cleavage occurred either
(1) at the site of recognition or (2) near the site of recognition but not within the sequence recognized.
To address this issue, Kelly and Smith determined the sequence of the 5⬘ ends of the DNA fragments
generated by the nuclease, in the following steps:

1. Treat phage T7 DNA with the enzyme.

2. Treat the resulting fragments with alkaline phosphatase to remove the 5⬘ phosphates.
3. Treat the dephosphorylated fragments with polynucleotide kinase and ␥-32P-labeled ATP to
label the 5⬘ ends.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-110

S-110 Chapter 9 DNA-Based Information Technologies

4. Treat the labeled molecules with DNases to break them into a mixture of mono-, di-, and
trinucleotides.
5. Determine the sequence of the labeled mono-, di-, and trinucleotides by comparing them with
oligonucleotides of known sequence on thin-layer chromatography.
The labeled products were identified as follows: mononucleotides: A and G; dinucleotides:
(5⬘)ApA-(3⬘) and (5⬘)GpA(3⬘); trinucleotides: (5⬘)ApApC(3⬘) and (5⬘)GpApC(3⬘).
(e) Which model of cleavage is consistent with these results? Explain your reasoning.
Kelly and Smith went on to determine the sequence of the 3⬘ ends of the fragments. They found a
mixture of (5⬘)TpC(3⬘) and (5⬘)TpT(3⬘). They did not determine the sequence of any trinucleotides
at the 3⬘ end.
(f) Based on these data, what is the recognition sequence for the nuclease and where in the
sequence is the DNA backbone cleaved? Use Table 9–2 as a model for your answer.

Answer
(a) DNA solutions are highly viscous because the very long molecules are tangled in solu-
tion. Shorter molecules tend to tangle less and form a less viscous solution, so decreased
viscosity corresponds to shortening of the polymers—as caused by nuclease activity.
(b) An endonuclease. An exonuclease removes single nucleotides from the 5⬘ or 3⬘ end and
would produce TCA-soluble 32P-labeled nucleotides. An endonuclease cuts DNA into
oligonucleotide fragments and produces little or no TCA-soluble 32P-labeled material.
(c) The 5⬘ end. If the phosphate were left on the 3⬘ end, the kinase would incorporate signif-
icant 32P as it added phosphate to the 5⬘ end; treatment with the phosphatase would
have no effect on this. In this case, samples A and B would incorporate significant
amounts of 32P. When the phosphate is left on the 5⬘ end, the kinase does not incorpo-
rate any 32P: it cannot add a phosphate if one is already present. Treatment with the
phosphatase removes 5⬘ phosphate, and the kinase then incorporates significant
amounts of 32P. Sample A will have little or no 32P, and B will show substantial 32P
incorporation—as was observed.
(d) Random breaks would produce a distribution of fragments of random size. The produc-
tion of specific fragments indicates that the enzyme is site-specific.
(e) Cleavage at the site of recognition. This produces a specific sequence at the 5⬘ end of
the fragments. If cleavage occurred near but not within the recognition site, the se-
quence at the 5⬘ end of the fragments would be random.
(f) The results are consistent with two recognition sequences, as shown below, cleaved
where shown by the arrows:

g
(5⬘),GTT AAC,(3⬘)
(3⬘),CAA TTG,(5⬘)
h
which gives the (5⬘)pApApC and (3⬘)TpTp fragments; and

g
(5⬘),GTC GAC,(3⬘)
(3⬘),CAG CTG,(5⬘)
h
which gives the (5⬘)pGpApC and (3⬘)CpTp fragments.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-111

Chapter 9 DNA-Based Information Technologies S-111

References
Kelly, T.J. & Smith, H.O. (1970) A restriction enzyme from Haemophilus influenzae: II. Base sequence of the recognition site.
J. Mol. Biol. 51, 393– 409.
Smith, H.O. & Wilcox, K.W. (1970) A restriction enzyme from Haemophilus influenzae: I. Purification and general properties.
J. Mol. Biol. 51, 379–391.