BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

Workshop 5 Assignment
Full Name: ___
All work submitted must be completed individually. It is important that you do not copy from the
course materials, internet pages or from each other. DO NOT plagiarize! All answers must be typed
clearly in this document using complete sentences, paragraph style. Show all of your work. Upload to
Brightspace (under Laboratory Workshop Assignment Submissions topic) in PDF format. Refer to
Appendix 4 for the online submission guidelines.
Part 1 – Information Transfer and Cellular Reproduction

The Workshop 5 Assignment consists of 2 parts. The first part will be short answer questions delivered
through the testing (quiz) function on Brightspace. The second part consists of the questions contained
in Workshop Assignment 5 (Parts 2-4) that you will complete and submit electronically via the
assignment submission link for Workshop 5 on Brightspace as normal. Part 1 will be autograded on
Brightspace; Parts 2-4 will be marked by your TA. 

General Format: While delivered via the quiz function, Part 1 will "behave" as a normal assignment.
This section is still due alongside the others on Sunday, November 28 at 11:59 PM however, there is no
time limit once the attempt has started (only 1 attempt). You will be able to freely navigate between
questions, flag questions, and as long as you have not submitted your attempt, be able to return to
your attempt across the 2-week period.
 
Questions: Please direct any questions regarding Part 1, W5 to the Lab Coordinators. Questions
regarding Parts 2-4 can be directed to both the TAs and Lab Coordinators, as normal.

VERY IMPORTANT: For Part 1, spelling will count. This means that any spelling/format errors for
answers you submit will be marked as incorrect. For example, if you were required to enter the 3-letter
abbreviation for the amino acid aspartic acid, the only correct response is Asp (Asa, ASP, AsP or other
variants will be marked as incorrect). This applies to all questions in Part 1.

For questions where you are asked to provide amino acid sequences, the following format is required:

● Give the polypeptide sequence in this form: Met-Thr-Trp-Tyr-Val

● At the end of the peptide, DO NOT insert a period, comma, extra spaces, or linkage marker. For
example, these will be marked as incorrect: 

Met-Thr-Trp-Tyr-Val.

Met-Thr-Trp-Tyr-Val,

Met-Thr-Trp-Tyr-Val-

1
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

Note: The above applies only to the questions on Brightspace (Part 1). For Parts 2-4 you are expected
to present all answers in proper assignment format (typed clearly in this document and
submitted in PDF format).
Part 2 – Cellular Reproduction
1. Determine the number of cells in each of the stages of the cell cycle in the following root tip squash
image (Figures 1 and 2). Include only whole cells where the nucleus/chromosomes is/are visible in
your count; combine telophase and cytokinesis as these stages occur concurrently.
Note: The cells in Figures 1 and 2 are not stained with aceto-orcein.

Figure 1: Plant root tip squash preparation.

2
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

Figure 2: Plant root tip squash preparation.

a. Prepare a table, in proper scientific form, for the cell count data. (2 marks)
Table 1: This table indicates the stages, number of cells, percentage of cells (%), and duration of the
stage (minutes) for Figure 1: Plant root tip squash preparation and for Figure 2: Plant root tip squash
preparation:

Stages: # of Cells: # of Cells: Percentage of cells: (%) Duration of Stage (minutes):

Figure #1: Figure 2: Formula: n/N x 100 DoS= Percentage of cells x

1320 minutes
N= Total no of cells
n= no of cells in each phase (convert percentage into a
decimal first)

Interphase 86 37 F#1: 86/123 x 100= F#1: 70% x 1320=

70% 924

F#2: 37/57 x 100%= F#2: 65% x 1320=

65% 858

Prophase 15 12 F#1: 15/123 x 100= F#1: 12% x 1320=

12% 158.4

F#2: 12/57 x 100%= F#2: 21% x 1320=

21% 277

3
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

Metaphase 12 3 F#1: 12/123 x 100= F#1: 10% x 1320=

10% 132

F#2: 3/57 x 100%= F#2: 5% x 1320=

5%
66

Anaphase 5 2 F#1: 5/123 x 100= F#1: 4% x 1320=

4% 53

F#2: 2/57 x 100%= F#2: 5% x 1320=

5% 66

Telophase/ 5 3 F#1: 5/123 x 100= F#1: 4% x 1320=

Cytokinesis 4% 53

F#2: 3/57 x 100%= F#2: 5% x 1320=

5% 66

The total 123 cells 57 cells Figure 1: 100% Figure 1: 1320 minutes
number of
cells, Figure 2: 101.94% Figure 2: 1333 minutes
percentage
of cells,
minutes:
(Biology Department, 2021)
b. Use Equation 1 (Workshop 5 Manual) to determine the time of each stage. Enter these values
in your table. (2 marks)
Founded in Table 1
c. Calculate the total time of the cell cycle for garlic root tip cells. Enter this value on your table. Is
the total calculated time the same as the expected cell cycle time? (2 marks)
As shown in figure 1, the total cycle time was exactly 1320 minutes, which is the exact value for the
expected value of 1320 minutes. For figure 2, a total of 1333 minutes was spent on the cell cycle, which
is a bit longer than the expected value which was 1320 minutes. (Biology Department, 2021)

4
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

d. Identify the cell cycle stage that has the longest duration. Explain why this stage is the longest
(maximum of three (3) lines or 60 words). (3 marks)
The longest phase of the cell cycle is the interphase. The fact that this stage of development is divided
into three phases enables the cell to prepare for division. The G1 phase marks the beginning of the
growth of the cell as it begins to synthesize and process all of the genetic material and duplicates itself,
resulting in the distribution of cells equally. Cells continue their growth during the G2 phase so the cells
could prepare for mitotic division. Considering the process and genetic materials involved in the
interphase, it is one of the most complex stages in the cell cycle. (Biology Department, 2021)

5
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

Part 3: Genetics
2. Hemophilia is an X-linked recessive disorder characterized by the inability to produce blood clots,
which inhibits an individual’s ability to stop bleeding. Sickle cell disease, or sickle cell anemia, is an
autosomal recessive disorder characterized by the production of abnormal hemoglobin. The
resulting red blood cell is rigid and sickle-shaped. Tamara, a female, has severe sickle cell anemia
and is a carrier for hemophilia. Tamara’s mother and father are carriers of sickle cell anemia.
Tamara’s father is a hemophiliac but her mother is homozygous for normal clotting factors. Roland,
a male, is a carrier for sickle cell disease and has hemophilia. Roland’s mother is homozygous for
normal red blood cells but is a carrier for hemophilia. Roland’s father is a carrier for sickle cell
disease but has normal clotting factors. Assume the following question that Tamara and Roland
reproduce.

Use the following notation to answer the questions below: Individuals with hemophilia are delineated
by Xh, whereas XH is used for individuals without hemophilia. Individuals with sickle cell anemia are
delineated by a, while those without sickle cell anemia are delineated by A.

a. What are the genotypes of Tamara and Roland’s parents? (4 marks)

The genotypes of Tamara and Roland’s parents:
Tamara’s Mother: is a carrier for sickle cell anemia and homozygous for normal clotting factors
𝐻 𝐻
The genotype of Tamara’s Mother- 𝑋 𝑋 𝐴𝑎
Tamara’s Father: is a carrier for sickle cell anemia and is hemophilia
ℎ
The genotype of Tamara’s Father- 𝑋 𝑌𝐴𝑎
Roland’s Mother: is a carrier for hemophilia and homozygous for normal RBCs
𝐻 ℎ
The genotype of Roland’s Mother- 𝑋 𝑋 𝐴𝐴
Roland’s Father: is a carrier for sickle cell disease and has normal clotting factors
𝐻
The genotype of Roland’s Father- 𝑋 𝑌𝐴𝑎
b. Determine the genotypes of Tamara and Roland. (2 marks)
The genotypes of Tamara and Roland:
Tamara (Female): is a carrier for hemophilia and has sickle cell anemia

𝐻 ℎ
The genotype of Tamara- 𝑋 𝑋 𝑎𝑎

6
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

Roland (male): is a carrier for sickle cell disease and has hemophilia
ℎ
The genotype of Roland- 𝑋 𝑌𝐴𝑎
c. Construct a dihybrid cross showing the possible genotypes of Tamara and Roland’s offspring.
Specify male and female. (4 marks)
Table 2: This table indicates the dihybrid crossing that shows the possible genotypes of Tamara and
Roland’s offspring:

Gametes: 𝐻 ℎ 𝐻 ℎ
𝑋 𝑎 𝑋𝑎 𝑋 𝑎 𝑋𝑎
Tamara ♀

♂Roland

ℎ 𝐻 ℎ ℎ ℎ 𝐻 ℎ ℎ ℎ
𝑋 𝐴 𝑋 𝑋 𝐴𝑎 (F) 𝑋 𝑋 𝐴𝑎(F) 𝑋 𝑋 𝐴𝑎(F) 𝑋 𝑋 𝐴𝑎(F)

ℎ 𝐻 ℎ ℎ ℎ 𝐻 ℎ ℎ ℎ
𝑋 𝑎 𝑋 𝑋 𝑎𝑎(F) 𝑋 𝑋 𝑎𝑎(F) 𝑋 𝑋 𝑎𝑎(F) 𝑋 𝑋 𝑎𝑎(F)

𝐻 ℎ 𝐻 ℎ
𝑌𝐴 𝑋 𝑌𝐴𝑎 (M) 𝑋 𝑌𝐴𝑎 (M) 𝑋 𝑌𝐴𝑎(M) 𝑋 𝑌𝐴𝑎(M)

𝐻 ℎ 𝐻 ℎ
𝑌𝑎 𝑋 𝑌𝑎𝑎 (M) 𝑋 𝑌𝑎𝑎(M) 𝑋 𝑌𝑎𝑎(M) 𝑋 𝑌𝑎𝑎(M)
(Biology Department, 2021)
d. State the probabilities (as a percentage) of Tamara and Roland having children with the
phenotypes below. (6 marks)
i. Individuals are homozygous for normal blood.
Individuals homozygous for normal blood/ Total number of Individuals
𝐻 𝐻
=no genotype found (𝑋 𝑋 𝐴𝐴)
=0% is the likelihood

ii. Males with hemophilia and sickle cell anemia.

Number of males with hemophilia and sickle cell anemia/ Total number of males
ℎ
=2 Genotype found (𝑋 𝑌𝑎𝑎)
=2/16 x 100%
=12.5%
iii. Males who are carriers of sickle cell anemia and have normal clotting factors.

7
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

Number of males carrier for sickle cell anemia & without hemophilia/ Total
number of males
𝐻
=2 Genotype found (𝑋 𝑌𝐴𝑎)
=2/16 x 100%
=12.5%
iv. Female with hemophilia and sickle cell anemia.
Number of females who have sickle cell anemia and hemophilia/ Total number of
females
ℎ ℎ
=2 Genotype found (𝑋 𝑋 𝐴𝑎)
=2/16 x 100%
=12.5%
v. Females who are carriers for hemophilia and sickle cell anemia.
Number of females who are carriers for sickle cell anemia and hemophilia/ Total
number of females
𝐻 ℎ
=2 Genotype found (𝑋 𝑋 𝐴𝑎)

=2/16 x100%

=12.5%

vi. Males who are heterozygous for sickle cell anemia.

Number of males who are heterozygous for sickle cell anemia/ Total number of
males
=4 Genotype found (𝑋𝑌𝐴𝑎)
=4/16 x 100%
=25%
vii. Females who are heterozygous for sickle cell anemia.
Number of females who are heterozygous for sickle cell anemia/ Total number of
females
=4 Genotype found (𝑋𝑋𝐴𝑎)
=4/16 x 100%

8
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

=25%

viii. Females with hemophilia.

Number of females with hemophilia/ Total number of females
ℎ ℎ
=4 Genotype found (𝑋 𝑋 𝐴𝑎)
=4/16 x 100%
=25%
ix. Males with hemophilia.
Number of males with hemophilia/Total number of males
ℎ
=4 Genotypes found (𝑋 𝑌)
=4/16 x 100%
=25%
x. Females who are carriers for hemophilia.
Number of females who are carriers for hemophilia/ Total number of females
𝐻 ℎ
=4 Genotypes found (𝑋 𝑋 )
=4/16 x 100%
=25%
xi. Individuals with hemophilia.
Number of individuals with hemophilia/ Total number of individuals
ℎ ℎ ℎ
=8 Genotypes found (𝑋 𝑋 + 𝑋 𝑌)
=8/16 x 100%
=50%
xii. Individuals with sickle cell anemia.
Number of individuals with sickle cell anemia/ Total number of individuals
=8 Genotypes found (𝑋𝑋𝑎𝑎 + 𝑋𝑌𝑎𝑎)
=8/16 x 100%
=50%

9
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

Part 4: Information Transfer

3. The numbers given to DNA sequences are human inventions used to help us to understand the
process. It also makes it easier for us to communicate information about genes when we have a
convention to work with (e.g., the transcription start site is +1). In real DNA, enzymes that are
involved in transcription, RNA processing and translation do not recognize this numbering system.
Instead, enzymes recognize consensus sequences. For this question, in prokaryotic genes, the
promoter region that is recognized by the σ70 subunit of RNA polymerase has two consensus
sequences called the “-28 region” and the “-11 region,” respectively. The -28 and -11 region
consensus sequences help RNA polymerase bind to the DNA in such a way that transcription
commences at the transcription start site (+1). For an enzyme to recognize a consensus sequence,
both sequences must be present, with the exact spacing between the two sequences. Specifically,
● The -28 region consensus sequence is 5’-TTGACA-3’. For this gene, the first T in the consensus
sequence is at the -28 position.
● The -11 region consensus sequence is 5’-TATAAT-3’. For this gene, the first T in this consensus
sequence is at the -11 position.
Within the prokaryotic mRNA, ribosomal binding occurs at a consensus sequence called the
Shine-Dalgarno sequence. This consensus sequence is 5’-AAGGAG-3’. The first A in this sequence is
usually between 9 and 14 bases upstream (i.e., toward the 5’ end) from the initiating AUG. With
this information, you should be able to determine the sequence for the protein coded for by the
following DNA molecule (given in groups of 10 nucleotides). Protein X is a small peptide of less than
10 amino acids.
5’- TTGACATGCG ATGTCGTAGG GATATATAAT CCACACAGTC GACAATTGAC
ATCCCGGTCA CCTATAATCG TGAACACATA TAAGGAGTCT GACTATGGTA AGTAAATATG
GTCATTAGTT ATGTGAACAG CCATTGGAGT CCACACTGAC TGAGATTAAG AGATGCCGAT
AAAGTGGATA GCATTTTAAC TTGACAATGG ACGATCGATC GTAATTACCA ATGTGAATCG
TAGTTGCGCA TTTCGGACGT -3’

10
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

a. Counting from the first nucleotide (A) of the Shine-Dalgarno consensus sequence, show the
sequence of the first 20 nucleotides in the mRNA encoded by this piece of DNA (specify 5’ & 3’
ends). (2 marks)

When counting the first nucleotide (A) of the Shine-Dalgarno consensus sequence the first 20
nucleotides would be in mRNA is:

5’ ATGGTAAGTAAATATGGTCATTAG 3’

↓ Translation ↓

(mRNA) 5’AUGGUAAGUAAAUAUGGUCAUUAG3’

b. What is the sequence of protein X (specify the amino and carboxyl termini)? (4 marks)

(mRNA sequence code):

5’AUG GUA AGU AAA UAU GGU CAU UAG 3’

↓ Translation ↓
+ −
𝑁𝐻3 -Met-Val-Ser-Lys-Tyr-Gly-His-𝐶𝑂2

c. A mutation occurs in the original DNA strand for protein X such that the adenosine nucleotide at
position +35 is deleted. What is the effect of this mutation? (2 marks)

When a mutation occurs in the original DNA strand for protein X strand and that the adenosine
nucleotide at position +35 is deleted, this will leave an effect on the sequence code. The mutation may
change the adenosine to thymine, cytosine, and guanine which a missense mutation which could
change the reading frame and shift the sequence code once the base is deleted and another amino
acid is substituted into the mutation.

d. A mutation occurs in the original DNA for protein X strand such that the adenosine nucleotide at
position +48 is changed to thymine. What is the effect of this mutation? (2 marks)

The mutation that occurs after the stop codon in the original protein X DNA does not have any effect on
the protein as it happens after the adenosine has been changed to thymine.

Note: The following table is provided for your information, only. Marks, mark totals and comments will be
provided on the Assignment 5 marking rubric on Brightspace and not entered in this table.

11
BIOL 1103 Workshop 5 – Information Transfer & Cellular Reproduction Fall 2021

Workshop 5 Assignment Evaluation  

Part 1 Part 2 Part 3 Part 4
This assignment is worth 7% of
Marks are as Q1a /2 Q2a /4 Q3a /2 your final grade in the course. For
stated in Q1b /2 Q2b /2 Q3b /4 questions about this assignment,
Brightspace Q1c /2 Q2c /4 Q3c /2 please contact the TA who marked
questions. Q1c /3 Q2d /6 Q3d /2 your assignment (their name is
Total /13             listed on the bottom of the
marking rubric).
               
Format Deduction: Total Mark:
Assignment Total: /48 Final Mark: /7
/5 /48

Refrence:

Biology Department. 2021. Biology 1103 Foundations of Biology Laboratory Manual

12