DNA BARCODING AND MOLECULAR IDENTIFICATION OF GNETUM

SPECIES (AFANG UFOK) FOUND IN IKOT AKPADEN IN AKWA IBOM

STATE USING GENETIC MARKER matK

BY

UDO, OTOBONG GODWIN

AK18/BGS/BOT/042

SUBMITTED TO

DEPARTMENT OF BOTANY
FACULTY OF BIOLOGICAL SCIENCES
AKWA IBOM STATE UNIVERSITY
IKOT AKPADEN, MKPAT ENIN L.G.A

MARCH, 2023
DNA BARCODING AND MOLECULAR IDENTIFICATION OF GNETUM
SPECIES (AFANG UFOK) FOUND IN IKOT AKPADEN IN AKWA IBOM
STATE USING GENETIC MARKER matK

RESEARCH PROJECT

BY

UDO, OTOBONG GODWIN

AK18/BGS/BOT/042

SUBMITTED TO

DEPARTMENT OF BOTANY
FACULTY OF BIOLOGICAL SCIENCES
AKWA IBOM STATE UNIVERSITY
IKOT AKPADEN, MKPAT ENIN L.G.A

IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE

AWARD OF BACHELOR OF SCIENCE (B.SC) IN BOTANY

MARCH, 2023

1
 DECLARATION

I declare that this project on the “DNA BARCODING AND MOLECULAR

IDENTIFICATION OF GNETUM AFRICANUM (AFANG UFOK) FOUND

IN IKOT AKPADEN IN AKWA IBOM STATE USING GENETIC MARKER

matK”, is an original research work written by me under the supervision of Dr.

Lovina I. Udoh, Department of Botany, Faculty of Biological Sciences, Akwa

Ibom State University, Ikot Akpaden. The information derived from the literature

has been duly sited in the text and references are provided.

2
 CERTIFICATION
This is to certify that this research project titled DNA BARCODING AND

MOLECULAR IDENTIFICATION OF GNETUM AFRICANUM (AFANG

UFOK) FOUND IN IKOT AKPADEN IN AKWA IBOM STATE USING

GENETIC MARKER matK, is an authentic record of the worked carried out by

UDO, OTOBONG GODWIN, AK18/BGS/BOT/042 under the supervision and

guidance of Dr. Lovina I. Udo, in partial fulfilment of Bachelor of Science Degree

in the Department of Botany Akwa Ibom State University Nigeria.

_____________________ __________________
UDO, OTOBONG GODWIN Signature/Date
(student)

_____________________ __________________
Dr. Joseph E. Okon Signature/Date
(HOD)

_____________________ __________________
Dr. Lovina I. Udoh Signature/Date
Supervisor

_____________________ __________________
External supervisor Signature/Date

3
 DEDICATION

This research work is dedicated with deep affection and gratitude to God Almighty

for this infinite love, grace and protection throughout the period of this work, and

also to my dearest parents Mr./Mrs Godwin Udombre whom through her advice,

love, care and financial assistance has brought me where I am today, I pray that the

good Lord will continue to keep her in good health. Amen.

4
 ACKNOWLEDGEMENT

I, sincerely expressed my profound gratitude to the Almighty God for His love,

wisdom, strength and enablement to achieve the necessary requirement needed for

the accomplishment of this project work. I will forever remain grateful to my Head

of Department, Dr. Joseph E. Okon, my able supervisor, Dr. Lovina I. Udoh for her

effort, advice, and support in ensuring proper conduct of this research work. I also

appreciate the candid effort of my lecturers in the Department of Botany and

Faculty of Biological Sciences in general.

My deepest appreciation goes to my humble, loving and supporting parents, Mr.

and Mrs. Godwin Udombre, siblings, Boniface Godwin, Ability Godwin and my

son, Edikan Imoh Sunday for their prayers, love, support and encouragement

towards achieving this academic pursuit and who have proven to be worth more

than a million gold.

I cannot fail to recognize the contribution of my colleagues and friends, Imo,

Sunday James, Udoatai, Nkpouto Augustine, Theresa, Cletus Ndodo, Essien,

Sifonobong Nse, Imoh Brandy, Justus Nseobong and Udofia, Oto-obong Ekop for

their support throughout my studentship and I pray may the good Lord bless and

reward you all in your endeavours.

5
 ABSTRACT
Gnetum africana from the family of Gnetaceae commonly known as Okazi (Igbo)
and Afang (Efik) in Nigeria, grows naturally in humid forest. It is widely
distributed in the forest zones from Nigeria through Cameroon, Central African
Republic and Gabon to Angola. This aims of this research are to carry out
systematic study on Gnetum africanum and carry out molecular and DNA barcodes
using matK with a view to sharing the DNA barcode sequence in a public database.
The taxonomy of the family was re-examined using classical approaches;
essentially, the phylogeny of the family was expounded. They are geographically
distributed in the temperate and tropical regions of the West african and their
distribution is mostly affected temperature. The development and validation of a
DNA barcode specific to key Gnetum africanum would aid in plant
identification. The use of molecular marker for plant identification has been
considered to be a most authentic method. Total genomic DNA was isolated from
young leaves of the Gnetum africanum and PCR analytical approach was used to
amplify matK genes resulting in an amplicon size of about 500bp and 700bp,
respectively. The amplicons were sequenced and authenticated using BLASTn
algorithm in NCBI, this retrieved similar gene regions of different species of
Gnetum. According to the best match in BLAST, matK identified them as Gnetum
africanum. The matK had query coverage of 80% for the G. africanum studied.
Overall, the research objective is to provide a molecular approach to identify and
differentiate Gnetum species found in Ikot Akpaden in Akwa Ibom State. The study
will contribute to the understanding of the genetic diversity and conservation of
Gnetum africanum in the region.

6
 TABLE OF CONTENTS

Title i

Declaration ii

Certification iii

Dedication iv

Acknowledgement v

Table of contents vii

List of tables xii

List of figures xiii

Lists of plants xiv

Abstract xv

CHAPTER ONE

1.0 Introduction 1

1.1 Background of the Study 1

1.2 Botanic description 4

1.3 Ecology 5

1.4 Aim and objectives 5

7
1.5 Objectives of the study 5

1.6 Statement of problem 6

1.7 Significance of the study 7

CHAPTER TWO

2.0 Literature review 8

2.1 Classification of family Gnetaceae 8

2.2 DNA barcoding as the basic unit of identification 8

2.3 Maturase K gene (matK) 11

2.4 Internal Transcribed Spacer (ITS) 12

2.5 Ribulose Biphosphate Carboxylase (RBCL) 15

2.6 Importance of DNA barcoding 16

2.7 Steps involves in species identification 17

CHAPTER THREE

3.0 Materials and methods 18

3.1 Study Area 18

3.2 Materials 18

3.3 Sample Collection and DNA Extraction 19

3.4 DNA Qualitative and Quantitative Analysis 21

3.5 Polymerase Chain Reaction 21

8
3.6 Sequence Editing, Alignment and Phylogeny Analysis 22

CHAPTER FOUR

4.0 Results and Discussion 22

4.1 DNA Extraction and PCR Analysis 23

4.2 PCR Analysis 23

4.3 Sequence Editing and BLAST Analysis 25

4.4 Phylogenetic Analysis 29

4.5 Discussion 31

CHAPTER FIVE

5.0 Conclusion and recommendations 37

5.1 Conclusion 33

5.2 Recommendation 35

REFERENCES 36

9
 LIST OF TABLES

Table Description Page No.

1.1 Scientific classification of Gnetum africanum 16

4.1 Sequence Editing and BLAST Analysis of Gnetum africanum 39

10
 LIST FIGURES

Figures Description Page No.

2.2 DNA barcoding work flow 30

4.1 DNA and PCR product of matK gene of G. africanum 38

4.1 Distribution of the top 100 BLAST hits in the genebank

showed good quality alignments greater than 200 nucleotides 41

4.4 Evolutionary relationships of taxa for matK Gene 43

11
 LISTS OF PLATES

Plate Description Page No.

1.2 Map of Africa showing the distribution of G. africanum 15

1.1 G. africanum plant (Romanus, et al., 2020) 16

2.1 DNA barcoding – Part of a series (Wikipedia, 2021) 22

3.1 Gnetum africanum (Stefan, 2019) 33

4.2 Sequences of matK gene from G. africanum (5’ – 3’) 42

12
 NOMENCLATURE

DNA Deoxyribonucleic acid

ITS: Internal transcribed space

matK Maturase K

rbcL Ribulose 1,5 - biphosphate carboxylase

trnL noncoding introns

CBOL Consortium for the Barcoding of Life

PCR Polymerase Chain Reaction

13
 CHAPTER ONE

INTRODUCTION

1.1 Background of the Study

Gnetum africana from the family of Gnetaceae commonly known as Okazi (Igbo)

and Afang (Efik) in Nigeria, grows naturally in humid forest. It is widely

distributed in the forest zones from Nigeria through Cameroon, Central African

Republic and Gabon to Angola (Ekpo, et al., 2011). Gnetum africanum is an

evergreen climbing shrub producing twining, woody stems that can be 12 metres or

more long from a tuberous rootstock (Tropical Plants Database, 2023). The seeds

of this plant are eaten cooked and its edible leaves are sold in markets. The leaves

form a very popular and highly valued vegetable in many parts of Africa - they are

widely harvested from the wild and commonly sold in local markets, where they

are often a major item of trade (Burkil, 2004). Somewhat thinner than the leaves of

the closely related G. Buchholzianum, they fetch a lower price in the markets than

that species (Tropical Plants Database, 2023). The morphological difference

between the two specie is that the leaves of G. africanum are shorter and narrow,

ovate in shape with an acuminate apex on an obtuse base, dull green in colour and

not fresh looking with a higher percentage of chlorophyll (Anthony, et al., 2014).

14
The leaves are also exported to ethnic markets in various countries around the

world.

Figure 1.2: Map of Africa showing the distribution of G. africanum

In Africa, two different species of Gnetum are found: G. africanum and Gnetum

bucholzianum. This species is similar that it is difficult to distinguish them except

by the shape of their leaves and the characteristics of the male reproductive organs

(Lowe, 1984).

G. africanum and Gnetum bucholzianum are of great importance to may forest

communities and have many different vernacular and commercial names. They

grow abundantly in may different habitats such as fallows, abandoned farmland,

secondary forest, and dense forest. Their leaves are an important commercials

15
foods commodity in Africa, where gathering Gnetum leaves for sale at local and

regional markets is a daily activity. Because the two species of Gnetum are

evergreens, their leaves can be harvested throughout the year, which has

considerable increased the volume exported in recent years (Fadi, et al., 2011).

Table 1.1: Scientific classification of Gnetum africanum (Wikipedia, 2022)

Kingdom Plantae
Clade Tracheophytes
Clade: Gymnosperms
Division Gnetophyta
Order Gnetales
Family Gnetaceae
Genus Gnetum
Species G. africanum

Cameroon exports Gnetum to Nigeria, Gabon and Congo through the two ports of

Ideanu and Kribi. In order to meet the high demand, harvesting of Gnetum has

extended into the most remote regions. Each year, an estimated 600 tons of this

product, valued at NGN1.8 billion on the local market, pass through only the port

of Idenau (Bokwe & Ngatoum, 1994).

16
 Plate 1.1: G. africanum plant (Romanus, et al., 2020) 16
1.2 Botanic description

The seeds are an orange-coloured fleshy fruit when ripe, which size ranges from

10-15mm x 4-8mm (World Agroforestry Database, 2009). It is a plant that grows in

a humid, lowland rainforests, and it found at elevations from sea level to 1,200

meters. It grows best in areas where the annual rainfall is around 3,000mm,

succeeds in dappled shade in the woodland. Plants growing in full sun produce

thinner leaves which are not so well liked by consumers. Cultivated plants need to

be given some support, such as a tree, to grow on (Romanus, et al., 2020).

Gnetum africanum leaves are often decussate in opposite direction, sometimes

whorls of 3, simple, stipules absent, petiole up to 1cm long, canaliculated above,

blade ovate-oblong to elliptical-oblong, rarely lanceolate, 5-14cm x2-5cm, base

attenuate, apex abruptly acuminate, entire margin, thick-papery, glabrous, pale

green above, paler beneath, with 3-6 pairs of strongly curved lateral veins looped

near the margin. Inflorescence is an unbranched catkin, axillary or terminal on a

short branch, solitary but male inflorescences occur at apex of branches often

ingroups of 3 up to 8cm long, jointed, peduncle 1-1.5m long, with a pair of scale-

like triangular bracts male inflorescence with slender internodes and whorls of

flowers at nodes. Flowers small, 2mm long, with moniliform hairs at base and an

17
envelope, male flowers with a tubular envelope and exerted stamina column

(Romanus, et al., 2020).

1.3 Ecology

G. africanum is an endangered liane normally found in humid tropical forest. It is

usually found with other climbers on middle- and under-storey trees, frequently

forming thickets. It can also be found in riverine forest in areas that are otherwise

too dry for the species. Gnetum africanum is mostly found at the periphery of

primary forest and in secondary forest. It extends in distribution from South East

(SE) Nigeria, to Congo and as far as Angola in the south (World Agroforestry

Database, 2009).

1.4 Aim and objectives

The aims of this research are to carry out matK DNA barcoding of the Gnetum

africanum otherwise known as the Afang Ufok for easy identification.

1.5 Objectives of the study

The objectives of the study are to:

a) Collect plant samples of Gnetum africanum from Ikot Akpaden in Akwa Ibom

State.

18
b) Extract DNA from the collected plant samples using standard molecular

techniques.

c) Amplify and sequence the DNA regions of interest (e.g., matK) using PCR

sequencing.

d) Generate a molecular database of Gnetum africanum found in Ikot Akpaden for

future reference and conservation efforts.

1.6 Statement of problem

In the family of Gnetum, there are very many species but the common species are

the G. africanum and G. bucholzianum. These species are very difficult to

differentiate with the physical eyes as their morphology, anatomy and other feature

are identical. Therefore, sources that were insufficiently investigated in the past are

now utilized in revising the taxonomy of the group so as to ease adequate

identification of the various taxa due to their intrinsic values. Moreover, the family

has problems of synonymy, taxa misidentification, doubtful specific status and

grouping dissimilar taxa in the same higher taxonomic rank.

In addition, the amplification of molecular markers in G. africanum. is made

difficult by several mutations occurring in flanking regions of widely used plastid

and nuclear regions such as matK (Harrington et al., 2005) and ITS (Edwards and

19
Gadek, 2001). Those mutations complicate the compilation of multilocus data sets

without missing data (Buerki et al., 2009).

1.7 Significance of the study

Authentication of medicinal species such as purslane would prevent incorrect

species usage, which may have adverse health effects. Thus, species need a fast

and efficient method of identification. Therefore, molecular markers have been

authenticated for species identification of plants, including matK, plant ITS2, rbcl

and trnH-psbA genes. Different studies have reported high and or low success rate

in identifying various plant species. Thus, there is a need to use more than one

barcode marker for species authentication.

20
 CHAPTER TWO

LITERATTURE REVIEW

2.1 Classification of family Gnetaceae

Gnetum africanum known as Afang, is a Gnetaceae plant and is traditionally

considered to be a wild vegetable. Eru has many common names and is grown in

various countries across Africa, including: Cameroon (Eru, okok, m’fumbua, or

fumbua), Angola (KoKo), Nigeria (ukase or afang), Gabon (KoKo), Central

African Republic (KoKo), Congo (KoKo), and the Democratic Republic of Congo

(m’fumbua or fumbua). It is used as antidote to some forms of poison and

snakebite, as antiseptic, antipains, diuretic, fungicide, and as wounds antiseptic

(Tamokou, et al., 2017). Species of Gnetum of the Gnetaceae are tropical vines

(rarely trees or shrubs) with opposite (decussate), simple leaves, looking like an

angiosperm but, of course, lacking true flowers Welwitschia mirabilis of the

Welwitschiaceae is a strange plant native to deserts of Namibia in southwestern

Africa (Michael, 2019).

2.2 DNA barcoding as the basic unit of identification

For accurate identification of species, the technology of DNA barcoding was

proposed by Hebert, et al., (2003) in Canada. In utilizing this technology, a short

21
DNA sequence is used as a marker known as DNA barcode for rapid, accurate and

automatic species identification (Herbert & Gregory, 2005).

Plate 2.1: DNA barcoding – Part of a series (Wikipedia, 2021) 22

Kress, et al, (2010), describes DNA barcoding a new method of quick

identification of species of both plant and animal based on the extraction of DNA

sequence from a tiny tissue sample of the organism. DNA barcoding helps in the

identification by expanding the ability to diagnose species by including all life

history stages of an organism, helps to flag species that are potentially new to

science an address fundamental ecological and evolutionary question (Kress, et al.,

2009). The concept of utilizing DNA for large-scale identification purposes was

first proposed by Hebert, et al, (2003) who considered DNA barcoding (hereafter

“barcoding”) to be the only serious option for widespread taxonomic identification

and description in the face of collapsing taxonomic expertise and the dramatic rate

of biodiversity loss. Plants DNA barcoding plays an important role in the evolution

of biodiversity and to keep an eye on the international trades in may rare species

22
(Goldstein & DeSalle, 2019). Savolainen, et al, (2005), opines that the DNA

barcodes consist of a standardized short sequence of DNA between 400 and 800 bp

long that can be easily isolated and characterized. Amaral, et al, (2016), reveals

that this approach is based on the analysis of the variability within a standard DNA

barcode region, which is useful to sequencing of fragments of 400-800bp by the

use of consensus primer. An ideal DNA barcode should clearly enable a greater

interspecies than intraspecies variability, allowing fast, reliable, automatable, and

cost-effective species identification (Amaral, et al, 2016).

Researcher has seen several potentials of DNA barcoding which represents a

promising approach for food authentication. Both eukaryotes (plants and animals)

species can be identified using specialized DNA barcoding tools (Sachithanandam,

et al., 2015). Li, et al (2021), utilizes the DNA barcoding of 4 chloroplat genes

(matK, rbcL, ndhF and ycf1) to provide a theoretical basis for species

identification, germplasm conservation and innovative utilization of orchids. The

Linnaean Society of London in 2010 carried out a large-scale analysis of matK.

They compared the available primer to get the match of generated sequence of

matK, to propose the possible modification in barcode and also to simplify the

barcode complications (Selvaraj, et al., 2008). The researcher further utilizes the

COI gene sequence which was very effective for unambiguous species

discrimination. In the view of Collins & Cruickshank, (2013), there is a need for

23
barcoding initiatives to be built on strong and dynamic taxonomic foundations in

order to provide reliable identification capabilities. Zahariev, et al, (2009)

developed an algorithm that will aid the discovering of DNA barcodes that are

available in sequence database. At present, two DNA barcode loci,

namely, maturase K (matK) and ribulose 1,5-biphosphate carboxylase (rbcL), are

intensively utilized for plant identification (Ho, et al., 2021).

2.3 Maturase K gene (matK)

The Consortium for the barcode of life (CBOL) plant-working group

recommended the 2-locus combination or rbcl and matK as the standard plant

barcodes based on assessments of recoverability, sequence quality and levels of

species discrimination. The matK has two unique features that emphasizes its

importance in molecular biology and evolution (Kar, et al., 2015). Maturase K

(matK) previously known as orfk has recently aroused the interest of researchers as

a gene which has potential in plant molecular systematics and evolution due to the

genes’ rapid evolution at nucleotide and corresponding amino acid level (Udensi, et

al., 2017). The maturase like protein was encoded by the gene of chloroplast called

matK, which is involved in the Group II splicing of introns. The intron region of

the trnK accommodates about 1500 base pairs of matK. The two exon regions of

trnK flanked by the matK were chopped down during splicing thus leaving the

whole matK gene intact during splicing. Within species this gene has high

24
substitution rates that’s why it is promising as one of the capable gene that can be

used in the studies of evolution and also molecular systematic (Andújar, et al.,

2018). For most land plants, the matK gene is nested between the two exons of

trnK, tRNA-lysine (Kar, et al., 2015).

For the family Zingiberaceae matK is approved DNA barcode. The analysis of

matK gene was performed on the large scale by the Linnaean society of London in

the year 2010. They compare the available primer to get the match of generated

sequence of matK, to purpose the possible modification in barcode and also to

simplify the barcode complications (Selvaraj, et al., 2008).

2.4 Internal Transcribed Spacer (ITS)

The ITS or internal transcribed spacer belong to the nuclear genome. It is a

nonfunctional RNA sequence that is located between the coding region of 18S and

25S rRNA coding region. The ITS1 located between the 18S and 5.8S rRNA and

ITS2 present between 5.8S and 25S rRNA. During rRNA maturation the ITS that is

a transcriptional subunit present between the structural ribosomal RNA. As these

ITS spacers are actually the product of maturation that are nonfunctional so they

are readily degraded. When studies were conducted on yeast it was shown that if

deletion in certain regions of ITS1 was promoted it cause the inhibition of

production of mature small and large subunits of rRNAs, while on the other hand

25
the mutations in the ITS2 effect the processing of larger subunit of Rrna. In all

flowering plants the length of ITS1 and ITS2 is variable but it is always less than

300bp for ITS1 and about 250 bp for ITS2. While the total length of ITS region is

about 700 bp that includes the region of 5.8S rRNA, which has the constant length

of 163 or164 bp (Gonzalez, et al., 1990).

In multiple chromosomal loci the nuclear region of ITS, occurs as tandem repeats

(Li, et al., 2015). The high copy number of the region of ITS encourage the

cloning, detection, sequencing and amplification of DNA. As compared to other

barcode candidate the ITS region gives better and clear result in PCR, that’s why it

can further be put into restriction digestion which results into diagnostic bands.

These bands are helpful in identification of plants at their specie level (Selvaraj, et

al., 2013).

The purpose of DNA barcoding research was to identify the better candidate genes

to identify all the species of plants by utilizing both the coding and noncoding

regions (Telfer, et al., 2015). With the help of DNA barcoding a person who even

don’t have enough taxonomic training can easily identify the plant specimen

(Santos, et al., 2016). DNA barcode also have important role in the evolutionary

studies. In the differentiation of plant species of family fabaceae ITS2 was proven

very helpful. By using ITS2 as a barcode gene about 893 species in 96 diverse

genera from family Rosaceae were easily evaluated.

26
ITS have specie discrimination success rate of 78% and 100% at the specie and

genus level respectively. To know the authentication of Chinese herbal medicines

ITS2 region is most commonly used barcode (Song, et al., 2009).

To discriminate between plant species of Asteraceae ITS2 was used as barcode and

got the success rate of about 80%. ITS2 was also utilized in the identification of

two morphologically same species such as Swartzia grandifolia and S. longicarpa

and also to classify the species Caranga rosea and C. sinica of the plant Fabaceae.

The important feature of ITS2 is that it can also be used for the identification of

system Paneukaryote and Eukaryota, that’s why it is used as a universal barcode

for both plants and animals. The chloroplast inter-generic region psbA-trnH was

also reported as the excellent candidate of DNA barcode because it is utilized for

the identification of Dendrobium species (Kress, et al, 2015). DNA barcoding was

applied to identify the distribution of criptic species in India Velliangiri hills, this

provides useful information in both traditional and scientific fields. Similar

technique was utilized to identify the Berberis species in India and also for the

endangered species of Paphiopedilum (Parveen, et al., 2012). The morphologically

similar species has also been distinguished by using ITS2 barcode. For the

identification of contaminants present in the North American herbal products was

done through the ITS2 when it is used in combination with rbcL.

27
The phylogenetic analysis and also studies of molecular evolution of species of

Panax was done by using chloroplast intergenic spacer (IGS) like trnEtrnT, trnT-

psbD, ndhF-rpl32 and rpl14-rpl16. To discriminate the species of Korean

Orchidaceae the IGS like atpF-atpH, psbK-psbI and trnH-psbA in addition to the

coding region of rbcL and matK were used as barcodes (Kim, et al., 2014).

2.5 Ribulose Biphosphate Carboxylase (RBCL)

There is only one copy of rbcL gene in each chloroplast genome, but many copies

chloroplast genome can be seen in every plastid. So, the actual copy number of

rbcL per chloroplast can be quite high. rbcL consists only on exons and encode the

polypeptide of about 475 amino acids. The chloroplast genes including rbcL can be

expressed in Escherichia coli because the resemblances between the two genomes

were found at transcriptional and translational identified sequence.

When one promoter was removed or the space between two promoters was

increased it eradicate that mutual interference, that can be used as a control

mechanism for the regulation of different levels of expression in genome of

chloroplasts. While the non-synonymous substation occurs when substitution is

done between rbcL of parent species. Even the CO2 and O2 specificity of ribulose

28
1, 5 bisphosphate carboxylase/oxygenase (RuBisCO) can be altered by

replacement of a single amino acid in rbcL (Galmes, et al., 2005).

A contingency study was conducted to assess the rbcL+matK barcode between

major taxonomic groups, including non-angiosperms vs. angiosperms and mono-

vs. polytypic-genera a contingency study was conducted (Burgess, et al., 2011).

rbcL was proved a better barcode than matK for the conifers of welsh flora and the

native flowering plants when the comparison of two DNA barcodes marker rbcL

and matK was done for studies (de Vere, et al., 2012).

2.6 Importance of DNA barcoding

The success of DNA barcoding is solely dependent on the pure and high-quality

DNA isolated from different sources under extremely sterilized conditions. DNA

barcoding has accelerated the process of recognizing novel genes and comparing

gene function as well as speeding up the discovery of species yet to be found in

nature. DNA barcoding aims to use the information of one or a few gene regions to

identify all species of life (John & David, 2008). However, DNA barcoding shares

an emphasis on large-scale genetic data acquisition that offers new answer to

questions previously beyond the reach of traditional disciplines. Lahaye R, et al.,

(2008), has pointed out that plant DNA barcodes can be used to assess species

identification in conservation biodiversity hotspots as well as hypothetically

29
applied to monitoring the international trade in endangered species of orchids.

Other application of DNA barcodings are in the identification of plants leaves even

when flowers or fruits are not available, identification of pollen collected on the

bodes of pollinating animals, identification of inserts larvae which may have fewer

diagnostic characters than adults, or investigating the diet of an animal based on its

stomach content, saliva or faeces (Wikipedia, 2021).

2.7 Steps involves in species identification

DNA barcoding has three main steps which consists of DNA extraction, PCR

amplification, and DNA sequencing and analysis. The DNA isolation is considered

the key steps without which the PCR amplification will not be optimal (Jacque, et

al., 2014).

Figure 2.2: DNA barcoding work flow (Jacque, et al., 2014) 30

30
31
 CHAPTER THREE
MATERIALS AND METHODS
3.1. Study Area

The study was undertaken in the Department of Botany, Akwa Ibom State

University. The plant was collected from the local community of Mkpat Enin

L.G.A. (Figure3.1). The plant was identified at the department’s herbarium as

Gnetum africanum, the herbarium number issued is AKSUH /G0002. The

molecular analysis was carried out at Genomics Training Center and Laboratory,

No.1 Atiku Abubaka Rd., Uyo, Akwa Ibom State.

3.2 Materials

 Liquid nitrogen

 Mortar and pestle

 2 mL microcentrifuge tubes

 1.5 mL microcentrifuge tubes

 Microcentrifuge

 70% ethanol

 CTAB buffer (2% CTAB, 1.4 M NaCl, 20 mM EDTA, 100 mM Tris-HCl pH

8.0, 1% PVP-40)

 Chloroform

32
 Isoamyl alcohol

 Ethanol (absolute and 70%)

 Procedure:

3.3 Sample Collection and DNA Extraction

Young Leaf of Gnetum africanum was harvested from the mother plant and was

taken to the laboratory where 600mg was weighed out, using a sensitive scale for

DNA isolation. DNA extraction was carried out using DNA extraction kit

(Genomic DNA Mini kit by Geneaid). The leaves were lysed using laboratory

mortar and pestle in 400μl of extraction buffer. It was transferred into 1.5ml

microcentrifuge tubes,400μl of the same buffer and 5μl RNase was added to it and

was mixed vortex. The mixture was incubated at 60 oC for 10 minutes. Gp2 buffer

was added and was mixed by vortex and was incubate again on ice for 30minutes.

The mixture was then transfer to a filter column in a 2ml collection tube and the

mixture was transfers to the column. This mixture was centrifuge for 1minute at

100xg then the filter column was discharged. The supernatant was carefully

transferred from the 2ml collection tube to a new 1.5ml microcentrifuge tube 1.5

volume of GP3 buffer was added and then vortex immediately for 5 second. The

GB column was placed to a 2ml collection tube. 700ul of the mixture was transfer

to the GD column and was centrifuge at 14-16000xg for 20 minutes. The flow-

33
through was discarded and the GD column was placed back to the 2ml collection

tube and the remaining mixture to the GD column was transfer and then centrifuge

at 14-16000×g for 2 minutes. The flow through was discarded and the GD column

placed back t the 2ml collection tube. 400ul of WL buffer was added to the GD

column and centrifuge at 14-16,000×g. The flow-through was discarded and the

GD column placed back to the 2ml collection tube. 600ul of wash buffer was

added to the GD column and was centrifuge at 14-16,000×g. The flow-through was

discarded and then it was centrifuge for 3 minutes at 14-16,000×g to dry the

column matrix. The dried GD column was transfer to a clean 1.5ml

microcentrifuge tube and 100ul of pre-heated elution buffer or TE buffer to the

center of the GD column matrix was added. It was allowed to stand for 3-5minutes

to ensure the elution buffer is completely absorbed, then it was finally centrifuge at

14-16,000xg for 30seconds to elude the purified DNA.

34
 Plant 3.1: Gnetum africanum (Stefan, 2019) 33

3.4 DNA Qualitative and Quantitative Analysis

A spectrometer (Gene Quant pro) was used to measure the amount of DNA.

Agarose gel electrophoresis was also used to assess the quantity and caliber of the

DNA. DNA was measured on a 1.5% agarose gel, and electrophoresis was carried

out at 120 volts for 20 minutes using an I X TAE gel buffer. 8 l of safe view dye

were used to stain the gel. The TAE buffer was removed from the gel after 20

minutes of gel electrophoresis had taken place. After then, the gel was seen under a

UV transilluminator.

3.5 Polymerase Chain Reaction

Primers from matK gene used for PCR amplification include matK IF (5'

ATGTCACCACAAACAGAAAC 3') and matK 724 R (5'

TCGCATGTACCTGCAGTAGCATTCAAGT 3’) (Khan et al., 2020). The PCR

master mix included Taq polymerase, DNTPs, MgCl, DMSO, and PCR

amplification buffer for amplifying the targeted loci. The final volume of the PCR

reaction was 25𝜇l, and it contained 9.5𝜇l of nuclease-free water, 0.5𝜇l of Figure

DNA, 0.5𝜇l of forward primers, and 0.5𝜇l of reverse primer. The following PCR

35
reaction settings were used in a BIO-RAD thermocycler: 30 seconds of initial

denaturation at 940OC, 30 cycles of denaturation at 94 OC, 30 seconds of annealing

at 530 OC, 1 minute of start elongation at 680 C, and 5 minutes of final elongation

at 680OC. Using 1.5% agarose gel electrophoresis, amplicons were separated for 20

minutes at 120 volts. As a benchmark for molecular weight, a 100 bp DNA ladder

was used.

3.6 Sequence Editing, Alignment and Phylogeny Analysis

The forward and reverse primers from the matK gene were used to purify and

sequence the amplified PCR product. ABI Sequence Analyzer (Applied

Biosystems) was used for the sequencing, and BioEdit software (V7.3.5)

(Hall1999) was used for the sequence, editing, and sequence alignment. Using the

Blastn options, sequences were compared with other homologs in the NCBI

database (http://www.ncbi.ih.gov/blast) (Altschul et al., 1997). The sequences from

the Genebank that had the greatest significant matches were regarded as the

Putation homologs of our plant, and Phylogenetic analysis was carried out using

MEGA X Software (Kumar et al., 2018).

36
 CHAPTER FOUR

RESULTS AND DISCUSSION

4.1 DNA Extraction and PCR Analysis

After the DNA from Gnetum africanum was extracted and placed in a 1.5 ml micro

centrifuge tube, it was measured using a spectrophotometer and run on a 1.5%

agarose gel under a UV transilluminator. The results showed excellent quality

DNA with distinct bands (Figure 4.1).

4.2 PCR Analysis

The polymerase chain reaction (PCR) is a procedure that is commonly used to

quickly develop millions to billions of copies (complete copies or partial copies) of

a particular DNA sample. This method enables scientists to take a very small

sample of DNA and amplify it (or a part of it) to a large enough amount to study it

in detail. Through a series of temperature-changing cycles, PCR quickly amplifies

copies of extremely tiny quantities of DNA sequences.

The PCR product for matK was roughly 700 bp, according to the PCR

electrophoresis result that could be seen on a UV-trans illuminator (Figure. 4.2).

With the use of the widely utilized Polymerase Chain Reaction (PCR) technique,

37
scientists may quickly create millions to billions of copies (full copies or partial

copies) of a given DNA sample, enabling them to analyze it in depth using a

relatively tiny quantity of DNA (Saiki, 1985). In a series of temperature-changing

cycles, copies of extremely tiny quantities of DNA sequences are quickly amplified

using PCR.

The procedures for PCR process as stated below:

 Denaturation: The double-stranded DNA template is heated to a high

temperature (usually 94-96°C), which causes the two strands to separate, or

denature.

 Annealing: The temperature is then lowered to a specific temperature (usually

50-65°C), which allows the primers (short DNA sequences that are

complementary to the target DNA) to anneal, or bind, to the complementary

regions on the template DNA.

 Extension: A heat-stable DNA polymerase enzyme (such as Taq polymerase) is

then added along with nucleotides (A, C, G, and T) to extend the primers and

synthesize new DNA strands, complementary to the template DNA.

 Repeating cycles: Steps 1-3 are repeated for a certain number of cycles

(usually 25-35 cycles), resulting in an exponential increase in the amount of

DNA, with each cycle doubling the amount of DNA synthesized.

38
In the case of Gnetum africanum, PCR can be used to amplify the matK gene,

which is a conserved gene region found in chloroplasts. The amplified DNA was

then sequenced and compared to other matK sequences to identify and classify

different Gnetum africanum specimens.

M 1 2 3 4 5 6 B
A

* M=100bp DNA ladder

Figure 4.1: DNA and PCR product of matK gene of G. africanum 38

(M = DNA ladder; I = DNA; 2 = PCR product)

4.3 Sequence Editing and BLAST Analysis

Distribution of the top 100 BLAST hits in the genebank showed good quality

alignments greater than 200 nucleotides for matK (Figure 4.1). The sequencing of

Gnetum africanum returned a clear sequence chromatogram (Figure 4.2). The

BLAST search with sequenced matK genes of Gnetum africanum under study,

resulted in high sequence similarity of 100% identity and a query coverage of 100

% with already available G. africanum sequences in the genebank (Table4.1).

39
BLAST computes a pair wise analysis between a query sequence and the data base

sequences searched. Implicit alignment between the database sequences is

constructed based upon the alignment of those (database) sequences to the query

sequence.

Table 4.1: Sequence Editing and BLAST Analysis of Gnetum africanum

Query E- Per.
Description Cover value Iden. Accession
Gnetum africanum tRNA-Thr (trnT) gene, partial
sequence; trnT-trnL intergenic spacer, tRNA-Leu
(trnL) gene, and trnL-trnF intergenic spacer,
complete sequence; and tRNA-Phe (trnF) gene,
partial sequence; chloroplast 100% 0.049 100 AY296487.1
Gnetum africanum tRNA-Thr (trnT) gene, partial
sequence; trnT-trnL intergenic spacer, tRNA-Leu
(trnL) gene, and trnL-trnF intergenic spacer,
complete sequence; and tRNA-Phe (trnF) gene,
partial sequence; chloroplast 100% 0.049 100 AY296486.1
Gnetum africanum voucher Luke 10375Z (BR)
trnK gene, partial sequence; and maturase K
(matK) gene, partial cds; chloroplast 90% 0.19 100 KP256681.1
Gnetum africanum NADH dehydrogenase
subunit 1 (nad1) gene, partial cds; mitochondrial
gene for mitochondrial product 90% 0.19 100 AY230286.1
Gnetum africanum voucher Niangadouma &
Walters 194 (BR) trnK gene, partial sequence;
and maturase K (matK) gene, partial cds;
chloroplast 90% 0.76 100 KP256680.1
Gnetum africanum voucher McPherson et al. 100% 0.76 100 AY449630.1

40
16261 (MO) maturase K gene, complete cds; and
tRNA-Lys gene, partial sequence; chloroplast
Gnetum africanum ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit gene, partial
cds; chloroplast 70% 3 100 MN521391.1
Gnetum africanum voucher Tadjouteu 608 (BR)
ribulose-1,5-bisphosphate carboxylase/oxygenase
large subunit (rbcL) gene, partial cds; chloroplast 90% 3 100 KP256719.1
Gnetum africanum voucher Luke 10375Z (BR)
ribulose-1,5-bisphosphate carboxylase/oxygenase
large subunit (rbcL) gene, partial cds; chloroplast 70% 3 100 KP256718.1
Gnetum africanum voucher Niangadouma &
Walters 194 (BR) ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit (rbcL) gene,
partial cds; chloroplast 70% 3 100 KP256717.1
Gnetum africanum voucher Tadjouteu 608 (BR)
trnK gene, partial sequence; and maturase K
(matK) gene, partial cds; chloroplast 80% 3 100 KP256682.1
Gnetum africanum voucher Luke 10375Z (BR)
18S small subunit ribosomal RNA gene, partial
sequence 70% 3 100 KP256567.1
Gnetum africanum ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit (rbcL) gene,
partial cds; chloroplast gene for chloroplast
product 70% 3 100 AY296527.1
Gnetum africanum ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit (rbcL) gene,
partial cds; chloroplast gene for chloroplast
product 70% 3 100 AY296526.1
Gnetum africanum 18S small subunit nuclear
ribosomal RNA gene 70% 3 100 U43012.1

41
42
Figure 4.1: Distribution of the top 100 BLAST hits in the genebank showed good
quality alignments greater than 200 nucleotides. 41

43
 Plate 4.2: Sequences of matK gene from G. africanum (5’ – 3’) 42

4.4 Phylogenetic Analysis

The corresponding taxonomic clustering percentage tree is displayed next to the

branches. It was discovered that the sequences of G. africanum analyzed grouped

with G. africanum from the genebank (Figure 4.4). The ideal tree is displayed with

a branch length total of 0.6253230. The study covered 16 nucleotides, with the

codon locations 1st+2nd+3rd+No included. Positions with holes and incomplete

data were all removed. The final dataset had 645 locations altogether.

44
In molecular biology, phylogenetic analysis has emerged as a crucial tool for

comparing data on genes, individuals, populations, and species. Phylogenetic

analysis is used to estimate the historical link of genes or species and to represent

this relationship in the form of a branching diagram known as a phylogenetic tree.

This information is typically in the form of morphological, behavioral, or

molecular data.
37 KJ594017.1:101-371 Sabicea villosa
37
JQ589060.1:94-364 Sabicea panamensis
49 MN370120.1:89-359 Sabicea discolor

79
MN370119.1:123-393 Sabicea vogeli
97 MN370118.1:152-422 Sabicea harleyae
99
KC627658.1:83-353 Stipularia africana

HM119541.1:106-376 Hekistocarpa minutiflora

MK435783.1:131-398 Amaranthus blitum

MK509400.1:130-397 Amaranthus hypochondriacus

99
MG685165.1:1357-1624 Amaranthus quitensis
99
MG685129.1:1357-1624 Amaranthus dubius
100
MF159529.1:465-732 Amaranthus spinosus
100

100
JF953160.1:70-337 Amaranthus tricolo
100 AY042544.1:181-448 Amaranthus acutilobus
AY538420.1:939-1061 Sabicea aspera

MG836507.1:2539-2806 Amaranthus cruentus

99

99
Afang Ufok
69 KY378671.1:2546-2816 Sabicea diversifolia

Figure 4.4: Evolutionary relationships of taxa for matK Gene 43

45
4.5 Discussion

DNA barcoding of Gnetum africanum was mainly focused on molecular

identification, nucleotide sequencing, and percentage similarities between

sequences and gene characterization. The gene characterization was done by

generating a DNA barcode using the matK gene in the chloroplast of the leaf

sample. The Isolation of DNA from the plant Gnetum africanum was carried out

using Genomic DNA mini kit, Gene aid. The result showed good quality DNA on

1.5% agarose gel. The PCR amplicons for matK gene obtained afterwards was

about 700bp. Gene sequencing resulted in readable sequences with clear

chromatogram (Figure 4.2). The NCBI BLAST result returned aligned sequence

that is 100% similar to the query sequence.

Gel electrophoresis is a technique used to separate DNA fragments based on their

size and charge. It is an essential tool in molecular biology and is commonly used

in DNA barcoding to confirm the presence and size of the amplified DNA

fragments. In the case of Gnetum africanum DNA barcoding with the matK

marker, gel electrophoresis can be used to visualize the amplified DNA fragments

and confirm their size. The specific genomic fragments of the Gnetum africanum

were successfully amplified by using both matK primers with an average read

length of 750bp and 950 bp (Figs. 4.1).

46
Similarly, DNA sequencing for matK amplicons generated high quality sequences.

Nucleotide composition of amplicons from Gnetum africanum revealed variability

in AT and GC contents.

Moreover, for sequence data analysis, the obtained sequences were subjected to

BLAST (Basic local alignment search tool) in the NCBI nucleotide database,

which showed maximum similarity range from 92 - 98% for matK as shown in

Table. In addition, NCBI database sequences with maximum similarity to the

queries were downloaded for comparison to the experimental species. For

comparison of matK sequences, the reference sequences, accession numbers and

gene bank name for the Gnetum africanum was (KY378671).

47
 CHAPTER FIVE
CONCLUSION AND RECOMMENDATIONS

5.1 Conclusion

In this research work, Gnetum africanum DNA barcoding with the matK marker,

the gel electrophoresis confirmed the presence and size of the amplified matK

DNA fragments. The size of the amplified DNA fragments was estimated by

comparing their migration distance in the gel to known DNA size standards. This

information was used confirm the identity of the Gnetum africanum specimen

based on the presence and size of the matK DNA fragment.

In the case of Gnetum africanum using the matK marker, DNA sequencing can be

used to identify and compare the nucleotide sequences of the matK gene in

different Gnetum africanum specimens. The matK gene region is a highly

conserved region found in chloroplasts, making it an ideal marker for DNA

barcoding. The matK sequences of different Gnetum africanum specimens can be

compared to identify genetic differences and similarities between specimens,

which can be used to classify and differentiate different Gnetum africanum taxa.

Additionally, DNA sequencing can provide valuable information on the genetic

diversity and population structure of Gnetum africanum. The matK sequences of

multiple specimens was compared to identify unique nucleotide variations, which

48
was used to construct phylogenetic trees as shown in figure 4.4 and infer the

evolutionary relationships between different Gnetum africanum populations. This

information can be used to assess the genetic diversity and conservation status of

Gnetum africanum populations and inform conservation strategies. Moreover,

DNA sequencing can also be used to identify and detect adulterants or

contaminants in Gnetum africanum products.

Phylogenetic analysis was used to provide valuable insights into the evolutionary

relationships, biogeography, and taxonomy of Gnetum africanum populations. By

combining phylogenetic analysis with DNA barcoding using the matK marker, a

comprehensive and accurate data on the identity, genetic diversity, and

phylogenetic relationships of Gnetum africanum populations was obtained, which

can inform conservation and management strategies for this important the plant.

Overall, DNA sequencing is a powerful tool that can provide valuable insights into

the genetics, evolution, and conservation of Gnetum africanum. By combining

DNA barcoding with DNA sequencing, researchers can obtain comprehensive and

accurate data on the identity, genetic diversity, and phylogenetic relationships of

Gnetum africanum populations, which can inform conservation and management

strategies for this important medicinal plant.

49
5.2 Recommendation

According to the findings of this research, the Gnetum africanum was identified as

belonging to the Gnetum and other barcode markers like rbcL and plant ITS2 can

be utilized to further clarify this issue. To be used as a reference in subsequent

research, the sequences obtained in this work will be placed in the gene bank.

50
 REFERENCES
Amaral, J., Meira, L., Oliveira, M., & Mafra, I. (2016). Advances in Authenticity
Testing for Meat Speciation. In J. Amaral, L. Meira, M. Oliveira, & I. Mafra,
Advances in Food Authenticity Testing (pp. 369-414). Woodhead Publishing.
Andújar, C., Arribas, P., Gray, C., Bruce, C., Woodward, G., Yu, D., & Vogler, A.
(2018). Metabarcoding of freshwater invertebrates to detect the effects of a
pesticide spill. Molecular Ecology, 146-166.
Anthony, A., Saviour, N., & Fidela, E. (2014). Seedlings production in Gnetum
africanum as influenced by propagatory organs. Journal of Education and
Practice .
Besong, M., Samalang, P., & Abia, C. (2001). Commercialisation as an incentive
and threat for Gnetum spp (eru) in Cameroon. Proceeding of A Workshop on
Incentive Measures for Sustainable Use and Conservation of Agro-
Biodiversity, (pp. pp. 69–72.). Lusaka, Zambia.
Bokwe, A., & Ngatoum, D. (1994). Effectue´e Autour du Mont Cameroun
(Province du Sud-Ouest) relatif au Recensement de Certaines. Yaounde,
Cameroon: MINEF.
Burgess, K., Fazekas, A., Kesanakurti, P., Graham, S., Husband, B., Newmaster, S.,
& Barrett, S. (2011). Discriminating plant species in a local temperate flora
using the rbcL+ matK DNA barcode. Methods in Ecology and Evolution,
333-340.
Burkil, M. (2004). The Useful Plants of West Tropical Africa. Retrieved from
http://www.aluka.org/
Caspa, R., Biloso, A., Akalakou, C., Mafolo, J., Tsobeng, A., Kouodiekong, L., &
Tchoundjeu, Z. (2017). Nursery substrates and provenances influence
rooting performance of juvenile, single-node vine cuttings of Gnetum
africanum Welw. (Gnetaceae). Afrika Focus. doi:https://doi.org/10.21825/
AF.V27I3.4907
Collins, R., & Cruickshank, R. (2013). The seven deadly sins of DNA barcoding.
Mol. Ecol. Resour., 969–975.

51
de Vere, N., Rich, T., Ford, C., Trinder, S., Long, C., Moore, C., & Tatarinova, T.
(2012). DNA barcoding the native flowering plants and conifers of Wales.
PloS one.
Ekpo, E., Asuquo, M., & Uwanta, J. (2011). Comparative study of nutrient and
anti-nutrient content of Gnetum Africanum (Afang) and Heinsia Crinita
(Atama). Global journal of pure and applied sciences.
Fadi, A., Mafu, A., & Carole, R. (2011). Gnetum africanum: A Wild Food Plant
from the African Forest with Many Nutritional and Medicinal Properties.
Journal of Medicinal Food, 1-9.
Galmes, J., Flexas, J., Keys, A., Cifre, J., Mitchell, R., Madgwick, P., & Parry, M.
(2005). Rubisco specificity factor tends to be larger in plant species from
drier habitats and in species with persistent leaves. Plant, Cell &
Environment, 571-579.
Goldstein, P., & DeSalle, R. (2019). Review and interpretation of trends in DNA
barcoding. Frontiers in Ecology and Evolution, 302.
Gonzalez, I., Chambers, C., Gorski, J., Stambolian, D., Schmickel, R., & Sylvester,
J. (1990). Sequence and structure correlation of human ribosomal
transcribed spacers. Journal of molecular biology, 27-35.
Hebert, D., Cywinska, A., & Ball, S. (2003). Biological identifications through
DNA barcodes. Proc. Biol. Sci, 313–321.
Hebert, P., C. A., Ball, S., & DeWaard, J. (2003). Biological identifications through
DNA barcodes. Proceedings of the Royal Society of London. Series B:
Biological Sciences, 313-321.
Herbert, P., & Gregory, T. (2005). The promise of DNA barcoding for taxonomy.
Systematic biology, 253-258.
Ho, V., Tran, T., & Vu, T. (2021). Comparison of matK and rbcL DNA barcodes for
genetic classification of jewel orchid accessions in Vietnam. J Genet Eng
Biotechnol, 93.
Jacque, K., Jamie, C., Sherri, F., & Denise, H. (2014). Identification of Unknown
Organisms by DNA Barcoding: A Molecular Method for Species
Classification.

52
John, W., & David, L. (2008). Proceedings of the National academy of sciences
(Vol. Vol. 105).
Kar, P., Goyal, A., & Sen, A. (2015). Maturase K gene in plants DNA barcoding
and phylogenetics. Plant DNA Barcoding and phylogenetics, 79-90.
Kim, H., Oh, S., Bhandari, G., Kim, C., & & Park, C. (2014). DNA barcoding of
Orchidaceae in Korea. Molecular Ecology Resources, 499-507.
Kress, W., Erickson, D., & Swenson, N. (2010). Advances in the use of DNA
barcodes to build a community phylogeny for tropical trees in a Puerto
Rican forest dynamics plot.
Kress, W., Erickson, D., Jones, F., Swenson, N., Perez, R., Sanjun, O., &
Bermingham, E. (2009). Plant DNA barcodes and community phylogeny of
a tropical forest dynamics plot in panama. Proc Natl ACad Sci USA, 18621 -
18626.
Kress, W., García-Robledo, C., Uriarte, M., & Erickson, D. (2015). DNA barcodes
for ecology, evolution, and conservation. Trends in ecology & evolution, 25-
35.
Lahaye R, v. d., Pupulin, F., Gigot, G., Maurin, O., Duthoit, S., Barraclough, T., &
Savolainen, V. (2008). DNA barcoding the floras of biodiversity hotspots.
Proceedings of the National Academy of Sciences, (pp. 2923-2928). USA.
Li, H., Xiao, W., & Tong, T. e. (2021). he specific DNA barcodes based on
chloroplast genes for species identification of Orchidaceae plants. Sci. Rep,
1424. doi:https://doi.org/10.1038/s41598-021-81087-w
Li, X., Yang, Y., Henry, R., Rossetto, M., Wang, Y., & Chen, S. (2015). Plant DNA
barcoding: from gene to genome. Biological Review, 157-166.
Lowe, J. (1984). Gnetum in West Africa. Nigerian Field, 99–104.
Michael, G. (2019). Evolution and Diversity of Woody and Seed Plants. In G.
Michael, Plant Systematics (pp. 131-165). Academic Press.
Parveen, I., Singh, H., Raghuvanshi, S., Pradhan, U., & Babbar, S. (2012). DNA
barcoding of endangered Indian Paphiopedilum species. Molecular Ecology
Resources, 82-90.

53
Romanus, A., Uwemedimo, F., Imoh, I., Omodot, T., Victor, U., Anwanabasi, E., . .
. Etido, A. (2020). Phytopharmacognostic Evaluation of the Leaves of
Gnetum africanum Welw (Gnetaceae). Journal of Complementary and
Alternative Medical Research, 32-41.
Sachithanandam, V., Mohan, P., & Muruganandam, N. (2015). DNA Barcoding of
Marine Venomous and Poisonous Fish of Families Scorpaenidae and
Tetraodontidae from Andaman Waters. In V. Sachithanandam, P. Mohan, &
N. Muruganandam, Marine Faunal Diversity in India (pp. 351-372).
Academic Press.
Santos, C., Amorim, D., Klassa, B., Fachin, D., Nihei, S., De Carvalho, C., &
Silva, V. (2016). On typeless species and the perils of fast taxonomy.
Systematic Entomology.
Savolainen, V., Cowan, R., & Vogler, A. (2005). Towards writing the encyclopedia
of life: an introduction to DNA barcoding. Philos Trans. Series B., 1850 –
1811.
Selvaraj, D., Park, J., Chung, M., & Cho, Y. (2013). Utility of DNA barcoding for
plant biodiversity conservation. Plant Breeding and Biotechnology, 320-332.
Selvaraj, D., Sarma, K., & Sathishkumar, R. (2008). Phylogenetic analysis of
chloroplast matK gene from Zingiberaceae for plant DNA barcoding.
Bioinformation, 24.
Selvaraj, D., Sarma, R., & Sathishkumar, R. (2008). Phylogenetic analysis of
chloroplast matK gene from Zingiberaceae for plant DNA barcoding.
Bioinformation, 24.
Song, J., Yao, H., Li, Y., Li, X., Lin, Y., Liu, C., & Chen, S. (2009). Authentication
of the family Polygonaceae in Chinese pharmacopoeia by DNA barcoding
technique. Journal of Ethnopharmacology, 434-439.
Stefan, P. (2019, March 23). West african plants. Retrieved from West african
plants: http://www.westafricanplants.senckenberg.de/root/index.php?
page_id=14&id=2275#
Telfer, A., Young, M., Quinn, J., Perez, K., Sobel, C., Sones, J., & Thevanayagam,
A. (2015). Biodiversity inventories in high gear: DNA barcoding facilitates a
rapid biotic survey of a temperate nature reserve. Biodiversity data journal.

54
Tropical Plants Database. (2023, January 30). Ken Fern. tropical.theferns.info.
Retrieved from Tropical Plants Database:
https://tropical.theferns.info/viewtropical.php?id=Gnetum+africanum
Udensi, O., Ita, E., Ikpeme, V., Ubi, G., & Emeagi, L. (2017). Sequence analysis of
maturase K (matK): A chloroplast-encoding gene in some selected pulses.
Global journal of pure and applied sciences, 213-230 .
Wikipedia. (2021). DNA barcoding. Retrieved February 02, 2023, from
https://en.wikipedia.org/wiki/DNA_barcoding
Wikipedia. (2022). Gnetum africanum. Retrieved from Wikipedia:
https://en.wikipedia.org/wiki/Gnetum_africanum
World Agroforestry Database. (2009). Gnetum africanum: Welw, Gnetaceae.
Retrieved from World Agroforestry Database:
http:s//wwws.Worldagroforestry.org/treed b2/AFTPDFS/
Zahariev, M., Veronica, D., Chen, W., & Levesque, A. (2009). Efficient algorithms
for the discovery of DNA oligonucleotide barcodes from sequence data.
Molecular Ecology Resources, 58-64.

55