Genome-wide identification and

evolution of interleukins and their

potential roles in response to GCRV
and Aeromonas hydrophila challenge in
grass carp ( Ctenopharyngodon idella )
Tianbing Xu & Zhensheng Wang & Yang
Gao & Jianguo Su
Visit to download the full and correct content document:
https://ebookmass.com/product/genome-wide-identification-and-evolution-of-interleuki
ns-and-their-potential-roles-in-response-to-gcrv-and-aeromonas-hydrophila-challenge
-in-grass-carp-ctenopharyngodon-idella-tianbing-xu-zhensh/
 Aquaculture 556 (2022) 738266

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Genome-wide identification and evolution of interleukins and their

potential roles in response to GCRV and Aeromonas hydrophila challenge in
grass carp (Ctenopharyngodon idella)
Tianbing Xu a, b, c, Zhensheng Wang a, Yang Gao a, Jianguo Su a, b, c, *
a
Department of Aquatic Animal Medicine, College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China
b
Laboratory for Marine Biology and Biotechnology, Pilot National Laboratory for Marine Science and Technology, Qingdao 266237, China
c
Engineering Research Center of Green development for Conventional Aquatic Biological Industry in the Yangtze River Economic Belt, Ministry of Education, Wuhan
430070, China

A R T I C L E I N F O A B S T R A C T

Keywords: Interleukins (ILs) play important roles in transmitting information, mediating proliferation and differentiation of
Grass carp (Ctenopharyngodon idella) immune cells, and regulating immune responses. However, due to the large variety, number, and complexity of
Interleukins IL genes, complete and systematic studies on ILs remain largely unknown. In the present study, we identified and
Evolution
characterized 39 IL genes in grass carp (Ctenopharyngodon idella) based on genomic and transcriptomic datasets.
Grass carp reovirus
Aeromonas hydrophila
These IL genes were classified into six gene families and others. Gene structures, conserved domains, and motif
analyses indicated that ILs in the same gene family were more conserved. Collinearity analysis showed that the
segmental duplication events played a critical role in the expansion of IL gene families during evolution. RNA-seq
data from different healthy tissues showed that many IL genes were widely expressed in various tissues. Based on
RNA-seq data, we further analyzed the expression profiles of IL genes in tissues post grass carp reovirus (GCRV)
or Aeromonas hydrophila challenge, and the results showed that the expressions of some genes were significantly
upregulated or downregulated post-challenge. Finally, qRT-PCR verified mRNA expressions of the representative
IL genes post GCRV or A. hydrophila challenge. Taken together, these studies provide a theoretical basis for a
comprehensive understanding of ILs and further functional investigation.

1. Introduction cytokines, are proteins produced by a variety of cell types such as T

Cytokines are biologically active modulatory proteins or glycopro­
teins secreted by a variety of cell types that bind their respective re­
ceptors in response to various stimuli, leading to the activation of second
messengers and signal transduction pathways (Smith and Humphries,
2009). Moreover, the cytokine network is a highly regulated system, and
upon removal of the stimulus, cytokine secretion returns to basal levels
to prevent excessive cytokine signaling that may dysregulate the normal
development and function of the immune system (Ilangumaran et al.,
2004). Cytokines play an important role in immune regulation, cell
proliferation, and repair of damaged tissues (Ouyang and O’Garra,
2019). More than 200 cytokines have been identified to date, including
interleukins (ILs), hematopoietic growth factors (HGFs), interferons
(IFNs), tumor necrosis factors (TNFs), and nerve growth factors (NGFs),
among others (Kany et al., 2019). ILs, as are important members of
lymphocytes, B lymphocytes, macrophages, etc., and play an important
role in physiological inflammation and immune processes (Wang et al.,
2020).
The term IL first appeared in 1979 at the Second International
Conference on Lymphokines in Interlaken, Switzerland, where the cy­
tokines that interact between leukocytes during the immune response
were unified under the name ILs (Catalan-Dibene et al., 2018). Although
ILs are now known to be produced by various cell types, the original
name is still used today. The nomenclature is also relatively simple, with
the first discovered being IL-1, the second IL-2, etc. (Secombes et al.,
2011). Subsequently, the newly identified ILs are named sequentially,
with Arabic numerals number after the name to indicate the difference.
Since the initial discoveries of IL-1 and IL-2, more than 60 cytokines
have been designated as ILs (Akdis et al., 2016). However, although they
are extremely important molecules in immunology, their numbers have

* Corresponding author at: Department of Aquatic Animal Medicine, College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China.
E-mail address: sujianguo@mail.hzau.edu.cn (J. Su).

https://doi.org/10.1016/j.aquaculture.2022.738266
Received 22 January 2022; Received in revised form 3 April 2022; Accepted 14 April 2022
Available online 19 April 2022
0044-8486/© 2022 Elsevier B.V. All rights reserved.
T. Xu et al.
made it difficult for immunologists to keep pace with the discovery and
characterization of these cytokines (Catalan-Dibene et al., 2018).
Interleukins can be classified into the following families based on
gene location, amino acid sequence, protein secondary structure, and
similarity or functional properties of the corresponding receptors (Akdis
et al., 2016). IL-1 family (IL-1α, IL-1β, IL-1Ra, IL-18, IL-36Ra, IL-36α, IL-
37, IL-36β, IL-36γ, IL-38, and IL-33) (Dao et al., 1996; Rivers-Auty et al.,
2018; Schmitz et al., 2005), IL-2 family (IL-2, IL-4, IL-7, IL-9, IL-15, and
IL-21) (Leonard et al., 2019), IL-6 family (IL-6, IL-11, IL-31, OSM, LIF,
CT-1, CNTF, and CLCF1) (Murakami et al., 2019), IL-10 family (IL-10,
IL-19, IL-20, IL-22, IL-24, IL-26, IL-28A, IL-28B, and IL-29) (Commins
et al., 2008), IL-12 family (IL-12, IL-23, IL-27, IL-35, and IL-39)
(Catalan-Dibene et al., 2018; Tait Wojno et al., 2019; Wang et al.,
2016), IL-17 family (IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and
IL-17F) (McGeachy et al., 2019), and other IL members (IL-3, IL-5, IL-8,
IL-13, IL-14, IL-16, IL-30/IL-27p28, IL-32, IL-34, and IL-40) (Akdis et al.,
2016; Catalan-Dibene et al., 2018). Among them, IL-28A, IL-28B, and IL-
29 are more commonly classified as type III IFNs and are referred to as
IFN-λ2, IFN-λ3, and IFN-λ1, respectively (Ouyang and O’Garra, 2019).
The IL-12 family members are heterodimers consisting of an α-chain
(p19, p28, and p35) and a β-chain (p40 and EBI3). The α subunits have a
quadruple helix bundle structure and are structurally homologous to the
IL-6 family, whereas the β subunits are structurally similar to the α re­
ceptors of IL-6 (Wang and Husain, 2014). Thus, the IL-6 and IL-12
families are structurally related, forming the IL-6/12 superfamily
(Garbers et al., 2012).
In the past years, many IL genes have been identified and charac­
terized in grass carp, for example, IL-2, IL-4/13B, IL-21, and IL-34,
among others (Lv et al., 2020; Xue et al., 2019; Yang et al., 2016b;
Zhang et al., 2020). Several studies have shown that IL genes in grass
carp played different roles in different tissues. The expressions of IL
genes in grass carp can be induced by various stimuli, such as bacteria
and viruses, which further indicated the important role of ILs in im­
munity. For example, almost all six IL-17 family members (IL-17A/F1,
IL-17A/F, IL-17A/F3, IL-17C, IL-17D, and IL-17N) in grass carp were
expressed at relatively low levels in head-kidney, tail fin, spleen, trunk-
kidney, and intestine, while expression levels were generally higher in
blood, skin, liver, and muscle. In addition, these genes showed different
tissue expression patterns in fish at 24 h after intraperitoneal injection or
anal intubation of A. hydrophila, suggesting a role in the inflammatory
responses (Sun et al., 2020a). Grass carp IL-34 was constitutively
expressed in tissues, with the highest expression in spleen. And the
expression was upregulated in spleen after infection with Flavobacterium
columnare or GCRV II (Xue et al., 2019). Although some IL genes have
been described in grass carp, there are still many ILs that remain
unknown.
Grass carp (C. idella) is considered to be one of the most economically
important freshwater farmed fish in China, with an annual global pro­
duction of more than 4.5 million tons, making it the most consumed
freshwater fish in the world (Yang et al., 2016a). However, diseases
caused by A. hydrophila or GCRV have caused serious losses to the
aquaculture industry (Chen et al., 2021; Liu et al., 2015). Therefore, the
study of immune genes and immune mechanisms in grass carp is
important for the prevention and treatment of various diseases. In recent
years, with the publication of genomic data and the continuous devel­
opment of the application of bioinformatics tools, many possibilities
have been offered to explore the gene family of grass carp. In this study,
we have systematically investigated the IL genes of grass carp intending
to provide theoretical research data and information on the evolution
and gene function of the family and provide better theoretical data and
references for various problems encountered in the fish farming
industry.
2
Aquaculture 556 (2022) 738266
2. Materials and methods
2.1. Genome-wide identification and sequence analysis of ILs
The genome assemblies, coding sequences (CDS), protein sequences,
and general feature format files (GFF3) were downloaded from the grass
carp database (http://bioinfo.ihb.ac.cn/gcgd) (Chen et al., 2017). The
existing IL proteins of human (Homo sapiens), house mouse (Mus mus­
culus), zebrafish (Danio rerio), rainbow trout (Oncorhynchus mykiss), and
Atlantic salmon (Salmo salar) downloaded from the NCBI database
(https://www.ncbi.nlm.nih.gov) were used as query objects, and the
BLASTP alignments were performed in grass carp protein sequences and
the transcriptome (Wan and Su, 2015) to search for homologous IL
proteins with e-value ≤1e-5, and the GenBank accession numbers of the
downloaded proteins were detailed in Table S3. Furthermore, the Hid­
den Markov Model (HMM) files of ILs were also used to identify all
possible IL sequences with HMMER software (HMMER Web version 3.0,
http://hmmer.org/) (Finn et al., 2011). The SMART (http://smart.
embl-heidelberg.de/) (Letunic et al., 2021) and CDD (http://www.
ncbi.nlm.nih.gov/cdd) (Marchler-Bauer et al., 2015) databases were
used to identify the integrity of IL domains in candidate genes. Finally,
these newly identified sequences were deposited to the GenBank data­
base in Table 1.
The biophysical characteristics of the potential ILs in grass carp were
further analyzed, such as amino acid number, molecular weight (MW),
and isoelectric point (pI) using ExPASy ProtParam tool (http://web.exp
asy.org/protparam/) (Gasteiger et al., 2003). Subsequently, the IL pro­
tein sequences were analyzed for the presence of signal peptides using
SignalP (http://www.cbs.dtu.dk/services/SignalP/) (Almagro Armen­
teros et al., 2019) and Phobius (https://phobius.sbc.su.se/) (Käll et al.,
2007) programs; the IL protein sequences were analyzed for the pres­
ence of transmembrane helices using TMHMM-2.0 (http://www.cbs.dtu
.dk/services/TMHMM/) (Krogh et al., 2001) and Phobius programs, and
the BUSCA (http://busca.biocomp.unibo.it) (Savojardo et al., 2018) and
CELLO (http://cello.life.nctu.edu.tw/) (Yu et al., 2006) programs were
also used to predict the subcellular localization of IL protein sequences.
2.2. Phylogenetic analysis
The full-length amino acid sequences of IL proteins from the NCBI
database were used for phylogenetic analysis, which included mammals
(human, house mouse, wild yak, and dog), birds (chicken), amphibians
(tropical clawed frog), and teleosts (grass carp, zebrafish, rainbow trout,
and Atlantic salmon, etc.). The protein sequences of all determined ILs in
the above species were used in multiple sequence alignment using the
default setting of Clustal X2 (Larkin et al., 2007). The unrooted phylo­
genetic trees were constructed using MEGA X (Kumar et al., 2018) with
Neighbor-Joining (NJ) (Saitou and Nei, 1987) methods: Dayhoff model;
pairwise deletion; and 10,000 bootstrap replications. The iTOL (http://it
ol.embl.de/help.cgi) (Letunic and Bork, 2021) online tool was used to
visualize the phylogenetic tree. The protein sequences used to construct
the phylogenetic trees were shown in Table S3.
2.3. Gene structure, conserved domain, and motif analyses
For gene structure analysis, grass carp IL cDNA sequences were
aligned with genomic sequences to determine intron/exon distribution
patterns and displayed graphically using the Gene Structure Display
Server 2.0 (GSDS 2.0) (http://gsds.cbi.pku.edu.cn/) (Hu et al., 2015).
The CDD online tool was used to search for conserved domains. To
identify the conserved motifs presented in the IL proteins, all the grass
carp IL proteins were submitted to an online motif identification tool
MEME (Multiple Expectation Maximization for Motif Elicitation, htt
p://memesuite.org/tools/meme) (Bailey et al., 2009). The parameters
of the motif search were as follows: any number of repetitions; minimum
and maximum motif widths were changed to 6 and 200, respectively,
T. Xu et al. Aquaculture 556 (2022) 738266

Table 1
Sequence characteristics of H. sapiens and C. idella interleukin members.
Gene family H. sapiens aa pI MW(Da) Accession C. idella aa pI MW(Da) Accession

IL-1 family IL-1α 271 5.04 30,606.61 NP_000566 –

IL-1β 269 4.70 30,747.91 NP_000567 IL-1β 270 5.39 30,054.04 AFN02623
IL-1Ra 177 5.82 20,054.99 NP_776214 IL-1Ra 354 5.02 40,330.64 MZ337859*
– IL-1Ral 240 5.43 27,400.18 MZ337858*
IL-18 193 4.52 22,326.23 NP_001553 –
IL-36Ra 155 5.08 16,962.47 NP_775262 –
IL-36α 158 5.89 17,684.42 NP_055255 –
IL-37 218 6.09 24,126.49 NP_055254 –
IL-36β 164 9.60 18,521.59 NP_055253 –
IL-36γ 169 5.04 18,721.32 NP_062564 –
IL-38 152 4.94 16,943.30 NP_775184 –
IL-33 270 8.89 30,759.38 NP_001300974 –
IL-2 family IL-2 153 7.67 17,627.71 NP_000577 IL-2 141 5.86 16,032.50 QHT53620
IL-4 153 9.17 17,492.26 NP_000580 IL-4/13a 133 8.84 15,533.11 QGD14190
– IL-4/13b 135 9.57 15,459.05 ALB06090
IL-7 177 8.87 20,186.64 NP_000871 IL-7 158 10.06 19,102.27 MZ337860*
IL-9 144 8.93 15,908.80 NP_000581 –
IL-15 162 5.13 18,085.85 NP_000576 IL-15 191 7.46 22,343.24 QCE20959
– IL-15l 176 8.95 20,790.45 MZ337861*
IL-21 162 9.54 18,652.51 NP_068575 IL-21 149 8.98 16,870.65 AKC34877
IL-6 family IL-6 212 6.17 23,718.22 NP_000591 IL-6 233 8.27 26,734.52 AHB51767
IL-11 199 10.64 21,429.21 NP_000632 IL-11a 198 9.81 22,663.34 AUN43464
– IL-11b 188 8.72 21,929.52 MZ337862*
IL-31 164 5.28 18,204.89 NP_001014358 –
OSM 252 10.71 28,484.01 NP_065391 M17 223 9.40 25,329.69 MZ337863*
LIF 202 9.44 22,007.74 NP_002300 –
CT-1 201 9.18 21,227.35 NP_001321 –
CNTF 200 6.35 22,931.13 NP_000605 CNTF 197 9.47 22,024.19 MZ337864*
– CNTFL 194 5.27 21,449.09 MZ337865*
CLCF1 225 8.68 25,175.98 NP_037378 CLCF1 378 10.03 42,216.09 MZ337866*
IL-10 family IL-10 178 8.19 20,516.76 NP_000563 IL-10 179 8.60 21,048.50 AFH58708
IL-19 177 7.62 20,451.79 NP_001380420 –
IL-20 176 8.92 20,072.34 NP_001372096 IL-20l 177 8.44 20,410.58 MZ337869*
IL-24 206 8.94 23,824.72 NP_006841 –
IL-22 179 7.65 20,011.32 NP_065386 IL-22 169 8.09 19,921.20 QNO10650
IL-26 171 10.00 19,842.70 NP_060872 IL-26 174 9.07 20,517.28 AQX17675
IL-28A 200 8.15 22,288.01 NP_742150 –
IL-28B 200 8.69 22,193.99 NP_001333866 –
IL-29 200 9.08 21,898.41 NP_742152 –
IL-12 family p19 189 6.02 20,729.74 NP_057668 p19 188 8.68 20,742.15 ATL73178
p28 243 6.18 27,492.78 NP_663634 p28 296 10.42 33,967.45 MZ337867*
p35 253 6.98 28,292.97 NP_000873 p35a 195 6.98 21,368.42 AHK80892
IL-12 family – p35b 193 6.87 21,691.87 MZ337868*
p40 328 5.52 37,168.97 NP_002178 p40a 330 8.99 38,051.59 AHK80893
– p40b 312 7.21 36,136.80 ATL73180
– p40c 298 5.44 34,359.96 ATL73181
EBI3 229 9.41 25,396.35 NP_005746 EBI3 299 7.56 33,232.22 AZT79000
IL-17 family IL-17A 155 8.82 17,504.07 NP_002181 IL-17A/F1 156 7.00 17,370.85 AGT55826
– IL-17A/F2 139 6.88 15,929.38 AKM20921
– IL-17A/F3 157 9.87 17,704.93 AKM20920
– IL-17N 136 5.47 15,409.78 MZ337865*
IL-17B 180 9.46 20,436.91 NP_055258 – MZ337865*
IL-17C 197 8.44 21,764.93 NP_037410 IL-17C 162 7.10 18,451.23 AKM20917
IL-17D 202 9.25 21,893.09 NP_001372153 IL-17D 208 9.97 23,355.00 AGW43284
IL-17E/IL-25 177 8.73 20,330.26 NP_073626 –
IL-17F 163 9.15 18,044.97 NP_443104 –
Other ILs IL-3 152 8.69 17,233.11 NP_000579 –
IL-5 134 7.81 15,237.82 NP_000870 –
IL-8 99 9.10 11,098.12 NP_000575 IL-8 98 8.81 10,952.09 AEM05971
IL-13 146 8.34 15,787.70 NP_002179 –
IL-14 546 6.15 61,891.11 NP_001363786 IL-14 523 5.38 59,840.77 MZ337870*
IL-16 631 5.67 66,646.45 NP_004504 IL-16 907 5.27 97,942.04 MZ337871*
IL-30/IL-27p28 243 6.18 27,492.78 NP_663634 IL-30/p28 296 10.42 33,967.45 MZ337867*
IL-32 234 5.14 26,676.35 NP_001295007 –
IL-34 242 6.82 27,481.70 NP_001380422 IL-34 210 8.74 25,047.81 QCX35396
IL-40 265 8.93 29,091.38 NP_001156547 –

Note: aa, amino acids; MW, molecular weight; Da, Dalton; pI, isoelectric point. “-” indicated that the gene did not exist at that location. * indicated the sequence was
deposited in GenBank by ourselves.

and at least 5 motif sites. The results of MEME were displayed using 2.4. Chromosomal locations and protein-protein interaction (PPI)
TBtool software (Chen et al., 2020). networks

Considering that the assembly of the grass carp genome was still at

3
T. Xu et al.
the “draft” stage, we selected grass carp scaffolds and linkage groups
(LGs) to illustrate the chromosomal localization information of IL genes.
The LG and scaffold locations of grass carp IL genes were identified by
GFF3 and the alignment of cDNA with the whole grass carp genome.
Based on the above information, the IL genes were mapped to corre­
sponding locations on the LGs and scaffolds using MG2C v.2 (http://m
g2c.iask.in/mg2c_v2.0/) (Chao et al., 2015). Furthermore, to deter­
mine the PPI network of ILs in grass carp, the IL protein sequences of
grass carp were imported into the online website STRING (https://strin
g-db.org/) (Szklarczyk et al., 2019). The protein interaction network
was constructed by using zebrafish as the reference sequences to predict
the interaction between the homologous proteins of the grass carp ILs in
zebrafish. The minimum required interaction score was set as 0.7.
2.5. Gene collinearity and Ka/Ks analyses
Syntenic blocks of tandem duplications and segmental duplications
of IL genes within the genomes of C. idella (Wang et al., 2015), D. rerio
(Howe et al., 2013), and Onychostoma macrolepis (Sun et al., 2020b), and
between the genomes of C. idella and D. rerio, C. idella and O. macrolepis
were obtained by using Multiple Collinearity Scan toolkit (MCScanX,
http://chibba.pgml.uga.edu/mcscan2/) (Wang et al., 2012) and visu­
alized using Dual Systeny Plotter software (TBtools, https://github.
com/CJ-Chen/TBtools) (Chen et al., 2020). To further estimate dupli­
cation events of IL genes, the rates of synonymous (Ks), non-synonymous
(Ka) substitutions, and their ratios of each duplicated IL gene were
calculated by the KaKs_Calculator 2.0 program (Wang et al., 2010a).
Positive and purifying selections were justified as a Ka/Ks ratio > 1 and
the Ka/Ks ratio < 1, respectively, while a ratio of 1 indicated neutral
selection (Hurst, 2002).
2.6. Transcriptome data analysis of the expression profiles of IL genes
To explore the tissue distribution of grass carp IL genes in eleven
healthy tissues (brain, muscle, liver, intestine, blood, head-kidney,
kidney, skin, gill, spleen, and heart) (Xu et al., 2019), the RNA-Seq
datasets (Accession No. PRJNA510861) were downloaded from the
NCBI Sequence Read Archive (SRA) (https://www.ncbi.nlm.nih.
gov/sra/). To explore the expression patterns of grass carp IL genes in
different tissues (gill, intestine, hepatopancreas, and spleen) (Shi et al.,
2014) post GCRV challenge or cells (pre-sorting CIK cells: C1, resistant
(to GCRV challenge) pool: R2, and susceptible (to GCRV challenge) pool:
S3) (Shang et al., 2017), the RNA-Seq datasets (Accession No.
PRJNA229923 and Accession No. PRJNA344676) were downloaded
from the SRA. Furthermore, to analyze the expression profiles of grass
carp IL genes in spleen post A. hydrophila challenge (Dang et al., 2016),
the RNA-Seq datasets (Accession No. PRJNA288831) were downloaded
from the SRA.
The above-downloaded transcriptome libraries were quality
controlled using fastp (Chen et al., 2018) software, after which all high-
quality transcriptome libraries were individually mapped to the grass
carp genome using the default parameters of HISAT2 (Kim et al., 2019)
software. Normalized TPM (transcripts per million) values were ob­
tained using the featureCounts (Liao et al., 2014) program. The results
were log2(TPM + 1) transformed and heatmaps were generated using
TBtools software. Details of the specific TPM values were shown in
Table S5.
2.7. Materials and treatments
In this study, the animal experiments were approved by Institutional
Animal Care and Use Committee (IACUC) of Huazhong Agricultural
University (HZAU). Laboratory animal license number: HZAUFI-2021-
0002. Healthy grass carp weighing approximately 20 g were acquired
from the Xingfu Farm (Huanggang, China) and acclimatized in a recir­
culating aquaculture system at 25–26 ◦ C for two weeks before
4
Aquaculture 556 (2022) 738266
experimental manipulation. The A. hydrophila (ATCC 7966) and GCRV
097 strain were from our laboratory stock.
In this experiment, healthy grass carp were divided into three
groups: the control group, the bacterial group (A. hydrophila challenge,
1.0 × 106 CFU), and the viral group (GCRV challenge, 1.0 × 104
TCID50). Each group contained 150 fish and three replicate experiments
were performed (50 × 3). After challenge, we collected visceral organs
(intestine, head-kidney, hepatopancreas, and spleen) at the corre­
sponding examination points (0, 4, 24, 72, and 120 h) according to the
grouping. Three biological replicates were performed for each group.
2.8. RNA isolation and quantitative real-time RT-PCR (qRT-PCR)
The visceral organs were dissected from grass carp, and total RNA
was extracted by TRIzol reagent (Aidlab, Beijing, China) immediately.
The 260 nm and 280 nm absorbance ratios of total RNA were measured
using the NanoDrop 2000 spectrophotometer (Thermo Scientific, Wal­
tham, USA). Meanwhile, the integrities of mRNAs were tested by elec­
trophoresis in the 2% agarose gel (Wang et al., 2022). The cDNA was
synthesized using the HiScript® II Q RT SuperMix for qPCR (+gDNA
wiper) (R223-01, Vazyme Biotech Co., ltd, Nanjing, China) according to
the instruction. All the cDNA samples were adjusted to a concentration
of 50 ng/ml and stored at − 80 ◦ C before the qRT-PCR assays.
The qRT-PCR was performed using the AceQ® qPCR SYBR Green
Master Mix (Q111–02, Vazyme Biotech Co., ltd, Nanjing, China) on a
Roche LightCycle® 480 System (Roche, Basel, Switzerland) according to
the instruction. The qRT-PCR mixture contained 4 μl of cDNA sample,
3.1 μl of nuclease-free water, 7.5 μl of 2 × AceQ® qPCR SYBR Green
Master Mix, and 0.2 μl of each gene-specific primer. Conditions for
amplification were 3 min at 95 ◦ C followed by 40 cycles of 15 s at 95 ◦ C
(denaturation), 15 s at 60 ◦ C (annealing), and 20 s at 72 ◦ C (extension).
Relative mRNA expression levels were calculated by the 2-ΔΔCT method
using 18S rRNA as the housekeeping gene (Su et al., 2011). All experi­
mentations were performed in triplicate. The primers were listed in
Table 2.
2.9. Statistic analysis
The results were presented as means ± standard deviation (SD). The
statistical analyses were performed by the two-tailed unpaired non-
parametric Mann-Whitney U test in vivo experiments. * indicated p ≤
0.05, ** indicated p ≤ 0.01.
3. Results
3.1. Identification and characterization of IL genes in C. idella
In this study, a total of 39 IL genes were identified in grass carp and
their designations were showed Table 1. As shown in Table 1, there were
some IL genes in grass carp that were not present in human, such as IL-
1Ral, IL-15l, IL-11b, CNTFL, and p35b, etc. Of course, there were also
some IL genes present in human that were not present in grass carp. The
amino acid residue length of IL proteins in grass carp ranged from 98 (IL-
8) to 907 (IL-16); the pI ranged from 5.02 (IL-1Ra) to 10.42 (p28), and
the MW ranged from 10,952.09 (IL-8) to 97,942.04 (IL-16) Da. In
addition, we performed subcellular localization predictions for these ILs,
which showed that most IL proteins were localized extracellularly, with
only a small fraction located in the nucleus (IL-1β, CNTF, and CNTFL)
and cytoplasm (IL-1Ra, IL-1Ral, IL-14, and IL-16). Signal peptide pre­
diction analysis showed that most of the ILs had signal peptides; trans­
membrane helix prediction analysis showed that none of the IL members
had transmembrane helices except IL-15l, which had a transmembrane
helix. The details were shown in Table S1.
T. Xu et al. Aquaculture 556 (2022) 738266

Table 2
Primers used for qRT-PCR.
Gene name Primer name Oligonucleotide sequence (5′ -3′ ) Amplified fragment length (bp) GenBank accession number

IL-1β IL-1β-F AAGTTCCCGCTTTGGAGAGTA 127 KX094935

IL-1β-R GCCACATACCAGTCGTTCAGT
IL-6 IL-6-F CTCAACCCTGGTCAACGACA 134 KC535507
IL-6-R GCATCCATGCGGATTTGACC
IL-7 IL-7-F GCCACAATAAAACTCAAATCATCG 115 MZ337860
IL-7-R CTGACATTTCTTATTGTGCAGTTTG
IL-8 IL-8-F CCCTACTGCTCCCTGGGTTA 131 JN255694
IL-8-R CCAAGCAGAATGGTGCAGGT
IL-15l IL-15l-F CAAGTGTCAATCAATGTGCAGC 100 MZ337861
IL-15l-R TGGTGTGTACAGCAAGCAATC
M17 M17-F ATACGAACAAAAAGACGGCAGC 100 MZ337863
M17-R TCTGGAACATTGTCCATTTGCAT
18S rRNA 18F99 ATTTCCGACACGGAGAGG 90 EU047719
18R100 CATGGGTTTAGGATACGCTC

3.2. Phylogenetic analysis and classification of IL genes
To better reveal the family classification of ILs, we first constructed
phylogenetic trees of all interleukins in human, mouse, and some tele­
osts (Fig. S1) and phylogenetic trees of all interleukin members in grass
carp (Fig. S2), and secondly, we constructed phylogenetic trees of the IL-
1 family (Fig. 1A), IL-2 family (Fig. 1B), IL-6 family (Fig. 1C), IL-10
family (Fig. 1D), IL-12 family (Fig. 1E), IL-17 family (Fig. 1F), and
other IL members (Fig. S3). However, there were significant differences
between grass carp and other fishes or mammalian lineages relative to
the phylogenetic trees.
3.2.1. Phylogenetic analysis of IL-1 family
The phylogenetic tree of the IL-1 family showed (Fig. 1A) that the IL-
1 family proteins were mainly divided into eleven groups, namely IL-1α,
IL-1β, IL-1Ra, IL-18, IL-36Ra, IL-36α, IL-37, IL-36β, IL-36γ, IL-38, and IL-
33 groups. The IL-Ra and IL-1β groups had the most members with nine,
and the IL-37 group had the least with only one member, HsIL-37. Most
groups had only two genes, for human and mouse IL genes. Interestingly,
we found that some fish also had IL-18 genes. Notably, a copy of IL-1Ra,
IL-1Ral, was found in grass carp. IL-1Ra was a recently discovered
member of the interleukins that was unique to fish. Although the genetic
characteristics of IL-1Ra, such as genomic location and sequence ho­
mology, differ from those of mammalian IL-1Ra, IL-1Ra did exist in fish
as an IL-1β receptor antagonist (Yao et al., 2015). Furthermore, only
three members of the IL-1 family were identified in grass carp, namely
IL-1β, IL-Ra, and IL-1Ral.
3.2.2. Phylogenetic analysis of IL-2 family
The phylogenetic tree of the IL-2 family showed (Fig. 1B) that the IL-
2 family proteins were divided into six main groups, namely IL-2, IL-4,
IL-7, IL-9, IL-15, and IL-21 groups. The IL-2 group had the largest
number of members, 12, and the IL-9 group had the least number of
members, only 3, and interestingly, no IL-9 was identified in fish. In
addition, grass carp had all members of the IL-2 family except for the
absence of IL-9. Notably, grass carp had two copies of both IL-4 and IL-
15, IL-4/13a and IL-4/13b, and IL-15 and IL-15l, respectively.
3.2.4. Phylogenetic analysis of IL-10 family
The phylogenetic tree of the IL-10 family showed (Fig. 1D) that the
IL-10 family proteins were divided into eight major groups, namely IL-
10, IL-19, IL-20, IL-19l/IL-20l, IL-22, IL-24, IL-26, and IFN-λ groups.
The fish IL-19 like or IL-20 like genes whose classification was more
confusing were treated as a large subfamily named IL-19l/IL-20l.
Notably, the IL-19l/IL-20l in fish was clustered in a large clade con­
taining IL-20, IL-19, and IL-24 of the IL-10 family. While IL-24 and IFN-
λs genes were not found in fish.
3.2.5. Phylogenetic analysis of IL-12 family
In the present study, the phylogenetic tree of the IL-12 family showed
(Fig. 1E) that the IL-12 family members consisting of heterodimeric
proteins were divided into five major groups (p19, p28, p35, p40, and
EBI3). Among them, mammalian p35 and fish p35 were divided into two
branches, and fish p35 was also divided into p35a and p35b. Fish p40
was divided into three branches: p40a, p40b, and p40c. Interestingly, in
fish, there was only one copy of p19, p28, p35a, and p40b, except for
Atlantic salmon and rainbow trout, which had two copies.
3.2.6. Phylogenetic analysis of IL-17 family
In the present study, the phylogenetic tree of the IL-17 family showed
(Fig. 1F) that the members of the IL-17 family were divided into six
major groups, namely IL-17A/F, IL-17B, IL-17C, IL-17D, IL-17E, and IL-
17N. The IL-17A/Fs, IL-17C, IL-17D, and IL-17N of grass carp were
grouped corresponding with their teleost counterparts. IL-17A and IL-
17F clustered into one large branch, of which there were three copies
in the IL-17A/F subfamily in fish, namely IL-17A/F1, IL-17A/F2, and IL-
17A/F3. And the IL-17A/Fs of teleosts were divided into two distinct and
separate branches. IL-17A/F2 formed a common branch, while the
cluster of IL-17A/F1 was closely grouped with the cluster of IL-17A/F3
in the other branch. IL-17A and IL-17F were neighbors with a high de­
gree of homology, suggesting that they were produced by recent gene
duplication events. We found that only some fish (common carp and
channel catfish) had the IL-17B gene, and no IL-17E gene was found in
fish. Notably, IL-17N was an IL gene-specific to fish, and there were two
copies of IL-17C in rainbow trout and torafugu.

3.2.3. Phylogenetic analysis of IL-6 family
The phylogenetic tree of the IL-6 family showed (Fig. 1C) that the IL-
6 family proteins were divided into nine major groups, namely IL-6, IL-
11, OSM, M17, LIF, CT-1, CLCF1, CNTF, and IL-31 groups. The IL-11
group had the most members with 14, while the OSM and CT-1
groups had the least members with only 3. The OSM, LIF, and M17
groups were strongly conserved, with M17 being unique to fish. And
OSM, LIF, CT-1, and IL-31 genes were not found in fish. In addition, we
found two members of both IL-11 and CNTF in grass carp, IL-11a and IL-
11b, and CNTF and CNTFL, respectively.
3.2.7. Phylogenetic analysis of other IL members
As shown in Fig. S3A, proteins from grass carp and zebrafish clus­
tered closely on one branch and then aggregated with proteins from
many other teleosts to form a fish-specific IL-8 clade, which in turn
formed other distinct clades with proteins from birds, mammals, and
amphibians. IL-34 had a similar phylogenetic tree to IL-8. As shown in
Fig. S3B, proteins from grass carp and zebrafish cluster tightly on one
branch and then clustered with proteins from many other teleosts to
form a fish-specific IL-14 clade, which in turn formed other distinct
clades with mammalian proteins. Interestingly, Atlantic salmon
branched out alone. IL-16 had a similar phylogenetic tree to IL-14. The

5
T. Xu et al. Aquaculture 556 (2022) 738266

(caption on next page)

6
T. Xu et al. Aquaculture 556 (2022) 738266

Fig. 1. Phylogenetic relationships of different IL family proteins in C. idella. Multiple sequence alignments of IL proteins were performed by MUSCLE, and the
phylogenetic trees were constructed by MEGA X by the Neighbor-Joining (NJ) method. The trees were bootstrapped 10,000 times. Different subfamilies were labeled
with different colors. Grass carp IL proteins were indicated by red branches. (A)-(F) indicated the phylogenetic trees of IL-1, IL-2, IL-6, IL-10, IL-12, and IL-17 family
members, respectively. Supplementary Table S3 provided the accession numbers of the protein sequences used for phylogenetic analysis. Abbreviations: Hs, Homo
sapiens; Mm, Mus musculus; Gg, Gallus gallus; Ap, Anas poecilorhyncha; Clf, Canis lupus familiaris; Xt, Xenopus tropicalis; Bm, Bos mutus; Om, Oncorhynchus mykiss; Ol,
Oryzias latipes; Orm, Oryzias melastigma; Ss, Salmo salar; Tr, Takifugu rubripes; Tn, Tetraodon nigroviridis; Tf, Tachysurus fulvidraco; Ip, Ictalurus punctatus; Cc, Cyprinus
carpio; Dr., Danio rerio; Ci, Ctenopharyngodon idella. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of
this article.)

different degrees of differentiation among IL-8, IL-14, IL-16, and IL-34 in
mammals, birds, amphibians, and fish might reflect their phylogenetic
differences.
3.3. Gene structure, conserved domain, and motif distribution analyses in
C. idella
To better reveal the gene structural components, protein structures,
and characteristic regions of ILs, we analyzed them separately according
to the classification of gene families. The results showed that the
different IL families of grass carp differed significantly in gene structure,
conserved domains, and motifs.
3.3.1. IL-1 family
As shown in Fig. 2A, the number of exons in IL-1 family genes ranged
from 5 to 7, indicating a relatively high structural diversity of grass carp
IL-1 family genes. The results of conserved domain analysis (Fig. 2B)
showed that all IL-1 family proteins had an IL1 domain. The results of
motif analysis (Fig. 3) showed that a total of 11 conserved motifs were
identified in the IL-1 family and the details of which were shown in
Table S4. Motif 1 and motif 2 were highly conserved in the grass carp IL-
1 family, with all members having one. Motif 8 was present in IL-1Ra
and IL-1Ral, but not in IL-1β.
3.3.2. IL-2 family
As shown in Fig. 2A, members of the IL-2 family shared a similar
exon structure. For example, there were six exons in IL-15 and IL-21,
while all other members had four exons. The exon/intron structures
were highly conserved in the same clade, suggesting that these
conserved features played a key role in the specific functions of the
group. As shown in Fig. 2B, among the IL-2 family proteins, IL-2 and IL-7
had no domains. IL-4/13A and IL-4/13B had an IL4 domain, while IL-15,
IL-15l, and IL-21 had an IL15 domain. As shown in Fig. 3, there were
eight conserved motifs in the IL-2 family, the details of which were
shown in Table S4. Among them, no motifs were predicted in IL-4/13B
and IL-7. Motif 1 was highly conserved in the grass carp IL-2 family, with
all members except IL-4/13A having one.
3.3.3. IL-6 family
In general, members of the IL-6 family had similar exon structures.
For example, IL-6, IL-11a, and IL-11b had five exons, and M17, CNTF,
CNTFL, and CLCF1 were three exons. The exon/intron structures were
highly conserved in the same clade, suggesting that these conserved
features played a key role in the specific functions of the group. Among
the IL-6 family proteins, CNTF, CNTFL, and CLCF1 did not have do­
mains. Other members had different domains; IL-6 had an IL4 domain,
IL-11a and IL-11b had an IL11 domain, and the domain of M17 was
LIF_OSM. A total of eighteen conserved motifs were predicted in the IL-6
family, the details of which were shown in Table S4. Among them,
except for CNTF, which had one more motif 18, CNTF and CNTFL motifs
were identical. Notably, IL-6 had a motif 4 that ran almost the entire
length.
was found in IL-26, and all other members had an IL10 domain. The
prediction of motifs showed that a total of 8 conserved motifs were
detected in the IL-10 family, the details of which were shown in
Table S4. The motifs of all members were very conserved. However,
some motifs were specific to individual genes; for example, motif 5 was
only found in IL-10, motif 7 was only found in IL-26, and motif 8 was
only found in IL-20l. These unique motifs might contribute to functional
divergence. It could be seen that the members of the IL-10 family were
highly conserved in gene structure, domain, and motifs, suggesting that
these conserved features played an important role in the specific func­
tions of this family.
3.3.5. IL-12 family
The number of exons of IL-12 family genes ranged from four to eight,
indicating a relatively high structural diversity of IL-12 family genes in
grass carp. Interestingly, the numbers of exons for both p35a and p35b
were 7, while the numbers of exons for p40a, p40b, and p40c were 8, 7,
and 6, respectively. These results might suggest an association with the
specific functions performed by IL-12 family members. The predicted
domains of IL-12 family proteins showed that no domains were found at
p19 and p28, but both p35a and p35b had an IL12 domain. An
IL12p40_C domain was found in both p40a and p40b, but not in p40c,
which was replaced by the same IG domain as EBI3. The prediction of
motifs showed that a total of 25 conserved motifs were detected in the
IL-12 family, the details of which were shown in Table S4. No motifs
were predicted in p28, but the motifs in p35 and p40 were very
conserved.
3.3.6. IL-17 family
The results of the gene structure showed that all members of the IL-
17 family had 3 exons except IL-17N which had 2 exons. The results of
domain prediction showed that all members of the IL-17 family were
found to have an IL17 domain. The prediction results of motifs showed
that a total of 15 conserved motifs were detected in the IL-17 family, the
details of which were shown in Table S4. Most members had conserved
motifs, among which motif 1, motif 2, motif 3, and motif 4 were highly
conserved and they were detected in all members, suggesting that IL-17
family members might have similar biological functions.
3.3.7. Other IL members
The results of the gene structure showed that the minimum number
of exons was 4 for IL-8, the maximum number of exons was 10 for IL-14,
9 for IL-16, and 6 for IL-34. The predicted results of domains showed that
IL-8 had an IL8 domain, IL-14 had a Taxilin domain, IL-16 had two PDZ
domains, and IL-34 had an IL34 domain that ran for almost the entire
length of IL-34. The predicted results of motifs showed that a total of 22
conserved motifs were detected, the details of which were shown in
Table S4. All the predicted motifs did not appear for the second time,
with a minimum of one motif for IL-8 and a maximum of 10 motifs for IL-
16.
3.4. Chromosomal locations and PPI network analyses in C. idella

3.3.4. IL-10 family As shown in Fig. S4, 29 of the 39 genes in grass carp ILs were located
As shown in Fig. 2A, the gene structures of the members of the IL-10 in 10 LGs, with the remainder located on un-anchored scaffolds. The
family were highly conserved, with the number of exons all being 5. The LG01, LG06, LG12, LG16, and LG19 each contained only one IL gene,
predicted domains of the IL-10 family proteins showed that no domain while LG10 contained up to four IL genes. In all the scaffolds located,

7
T. Xu et al. Aquaculture 556 (2022) 738266

Fig. 2. The gene structures (A) and conserved domains (B) of ILs from C. idella. Exons and introns were represented by purple rectangles and black lines, respectively.
The conserved domains were determined using NCBI-Batch-CDD online tool, where different domains were represented by different colour blocks. (For interpretation
of the references to colour in this figure legend, the reader is referred to the web version of this article.)

8
T. Xu et al. Aquaculture 556 (2022) 738266

Fig. 3. The conserved motifs of IL proteins were identified using the online MEME program, where different motifs were represented by different colour blocks. The
black lines represented the non-conserved sequences. Different families of IL were represented by different colors.

9
T. Xu et al. Aquaculture 556 (2022) 738266

there was only one IL gene on the other scaffolds except that there were
two IL genes on the scaffolds CI01000169.
As shown in Fig. S5, we selected IL-1β, IL-10, EBI3, IL-17A/F3, p40a,
and p40b for PPI network analysis. The results showed that myeloid
differentiation primary response proteins MyD88 (Myd88), tumor ne­
crosis factor b (tnfb), tumor necrosis factor a (tnfa), Janus kinase 1
(jak1), and signal transducer and activator of transcription 3 (stat3)
showed a high association with these IL genes. Notably, stat3 hub nodes
were found in all predicted PPI networks except in p40b.
3.5. Gene duplication and Ka/Ks analyses of ILs in C. idella
To better understand the evolutionary constraints acting on IL genes,
Ka, Ks, and Ka/Ks values were calculated for each IL gene pair (Fig. S6).
The results showed Ka/Ks values of <1 for all segmentally and tandemly
duplicated IL gene pairs, suggesting that IL genes might have undergone
strong purifying selection pressure during evolution. As shown in
Fig. S6C, the vast majority of gene pairs in C. idella and D. rerio had Ka/
Ks values less than their mean value of 0.74, and the vast majority of
gene pairs in C. idella and O. macrolepis had Ka/Ks values less than their
mean value of 0.45. Interestingly, the IL-17N gene pairs in C. idella and
D. rerio and the IL-11a and IL-11b gene pairs in O. macrolepis Ks values
showed NaN, which indicated too much divergence between sequences
and a long evolutionary distance.

As shown in Fig. 4A, only one pair of tandem duplication events (IL-
1Ra, IL-1Ral) and one pair of segmental duplication events (IL-8,
CXCL13) were found in the genome of C. idella. Fig. 4B showed that no IL
gene-related segmental duplication events were found in the genome of
D. rerio, but a pair of tandem duplication events (IL-1Ra, IL-1Ral) were
found. Fig. 4C showed a pair of tandem duplication events (IL-1Ra/IL-
1Ral) and two pairs of segmental duplication events (IL-11a, IL-11b, and
IL-17A/F1, IL-17A/F3) were found in the genome of O. macrolepis. In
addition, Fig. 5A showed that between the C. idella and D. rerio genomes,
all 37 IL genes except CNTFL and p28 were gene duplications generated
by segmental duplication. Fig. 5B showed that between the genomes of
C. idella and O. macrolepis, all 35 IL genes except IL-15l, CLCF1, IL-20l,
and IL-17N were gene duplications generated by segmental duplication.
3.6. Tissue distributions of IL genes
As shown in Fig. 6, IL genes were widely expressed in these tissues
and showed different expression patterns. IL-7, IL-14, IL-1β, IL-8, IL-15,
and IL-34 were highly expressed in almost all of the other 10 tissues
except for brain, with the highest expression levels of IL-1β and IL-8 in
spleen, head-kidney, and kidney. IL-6 and IL-10 were highly expressed
in spleen and IL-11a had relatively high expression levels in heart and
spleen. M17 and IL-16 showed high expression levels in spleen, head-
kidney, and kidney. CNTF was highly expressed in heart, and CNTFL
and IL-17N were highly expressed in brain. EBI3 had relatively high
expression levels in liver. Most IL genes were highly expressed in spleen,

Fig. 4. Schematic representations of segmental and tandem duplications of IL genes in C. idella (A), Danio rerio (B), and O. macrolepis (C) genome. Gene collinearity
relationships were displayed using the Circos program of TBtools software. The gray lines in the background indicated all synteny blocks between each scaffold or
chromosome, the red arcs indicated segmentally duplicated gene pairs and the red straight lines indicated tandem duplicated gene pairs. (For interpretation of the
references to colour in this figure legend, the reader is referred to the web version of this article.)

10
T. Xu et al.
Fig. 5. Collinearity of IL genes between the C. idella scaffolds and the Danio rerio chromosomes (A), and C. idella scaffolds and the O. macrolepis chromosomes (B).
Duplication events were indicated with gray lines in the background, while the colored arcs connected IL gene pairs.
head-kidney, and kidney relative to other tissues, suggesting that ILs
might play a more important role in these tissues. Overall, the expres­
sion patterns of IL genes in different tissues could be used to identify
functional genes in grass carp.
3.7. Expression profiles of IL genes post GCRV or A. hydrophila challenge
The results showed that the expressions of most IL genes were
upregulated in gill post GCRV challenge (Fig. 7A). For example, IL-14
and IL-34 were significantly upregulated at 72 h; IL-7, IL-16, IL-20l,
p40b, IL-22, p40a, and IL-26 were significantly upregulated at 24 h;
IL-1β and IL-8 were significantly upregulated at 2 h. Notably, some
genes showed downregulation, for example, IL-15, IL-15l, and IL-4/13A
were significantly downregulated at 2 h. Interestingly, the expressions of
most IL genes in intestine remained almost unchanged post GCRV
challenge, except for IL-1β, which was significantly downregulated at 2
h of challenge (Fig. 7B). As shown in Fig. 7C, only a small number of IL
genes showed significant changes in expression in hepatopancreas post
GCRV challenge. For example, EBI3 was significantly upregulated at 24
h; IL-7, IL-8, IL-34, and IL-14 were significantly upregulated at 72 h.
Interestingly, IL-17A/F2, IL-17A/F3, IL-17N, IL-20l, and IL-26 were not
expressed from the beginning to the end. As shown in Fig. 7D, the ex­
pressions of some IL genes were significantly upregulated in spleen post
GCRV challenge. IL-22, IL-8, IL-1β, M17, IL-6, IL-11a, and IL-7 were
significantly upregulated at 2 h.
Further, we investigated the expressions of IL genes in CIK cells using
the resistance and susceptibility database (Fig. 8A). The results showed
that IL-34, IL-11a, p28, IL-6, CLCF1, and p35a were highly expressed in
R2, and IL-34, IL-11a, and p28 were highly expressed in S3. Notably, IL-
8 was significantly highly expressed in R2 and significantly low in S3
compared to control C1. As shown in Fig. 8B, the expressions of some IL
genes were significantly upregulated in head-kidney and trunk-kidney
post GCRV challenge. For example, M17, IL-34, and IL-6 were signifi­
cantly upregulated in head-kidney; IL-8, IL-1β, and IL-1Ra were signif­
icantly upregulated in head-kidney and trunk-kidney. To investigate the
expressions of IL genes in response to bacterial infection, we analyzed
the transcriptome of infected spleen post A. hydrophila challenge
(Fig. 8C). The results showed that only a few IL genes were significantly
changed in expression post A. hydrophila challenge. EBI3, IL-11a, IL-6,
IL-1β, IL-8, and IL-17D were significantly upregulated at 4 h, with IL-1β,
IL-8, and EBI3 expressions changed being particularly significant. In
11
Aquaculture 556 (2022) 738266
contrast, IL-16 was significantly downregulated at 4 h. Interestingly, IL-
17A/F1, IL-17A/F2, IL-17A/F3, IL-17N, IL-20l, and IL-4/13B were not
expressed from the beginning to the end.
3.8. qRT-PCR verification of IL gene expressions post A. hydrophila or
GCRV challenge
By the expression analysis of RNA-Seq data (Fig. 7 and Fig. 8), we
selected six candidate IL genes (IL-1β, IL-6, IL-7, IL-8, IL-15l, and M17)
and confirmed their responses to GCRV or A. hydrophila challenge by
qRT-PCR. For the bacterial challenge, we investigated the response
patterns of IL-1β, IL-6, and IL-8 genes in different tissues (gill, hepato­
pancreas, spleen, and head-kidney) at different time points (0, 4, 24, 72,
and 120 h) in grass carp post-challenge with A. hydrophila. The results
were shown in Fig. 9, where the expressions of IL-1β and IL-8 were
significantly upregulated in gill at 72 h (p < 0.05) and 24 h (p < 0.01)
compared to untreated control groups, followed by a gradual return to
basal levels. In contrast, IL-6 expression did not change much post-
challenge. In hepatopancreas, IL-1β and IL-8 were significantly
induced at 24 h (p < 0.05). Compared to untreated control groups, IL-1β
and IL-8 expressions were significantly upregulated in both spleen and
head-kidney at 4 h (p < 0.01). And IL-6 expression was significantly
upregulated at 4 h in hepatopancreas, spleen, and head-kidney (p <
0.05). The above results were largely identical to the expression analysis
of RNA-seq data.
For the viral challenge, we investigated the response patterns of IL-
1β, IL-6, IL-7, IL-8, IL-15l, and M17 in grass carp post GCRV challenge in
different tissues (gill, hepatopancreas, spleen, and head-kidney) at
different time points (0, 4, 24, 72, and 120 h). The results were shown in
Fig. 10, where IL-1β (4 h) and IL-7 (24 h) were significantly induced (P
< 0.01), and IL-8 (72 h) and M17 (4 h) were significantly induced (P <
0.05) compared to the untreated control groups. In contrast, no signif­
icant changes were observed in the IL-6 in gill. In hepatopancreas, IL-1β
(4 h), IL-7 (72 h), IL-8 (72 h), and M17 (4 h) were significantly upre­
gulated (P < 0.01), and IL-6 was significantly upregulated (P < 0.05).
Expressions of IL-1β, IL-6, IL-8, and M17 were all significantly upregu­
lated in spleen at 4 h compared to untreated control groups (P < 0.01),
while IL-7 was significantly upregulated at 4 h (P < 0.05). In head-
kidney, IL-1β, IL-6, IL-7, IL-8, and M17 were significantly upregulated
at 4 h (P < 0.01). Interestingly, IL-15l was the only one of the six
candidate IL genes whose expression was downregulated post GCRV
T. Xu et al. Aquaculture 556 (2022) 738266

Fig. 6. Expression levels of C. idella IL genes in 11 tissues. Fold changes of IL expressions were log2(TPM + 1) transformed and were used to generate heatmap with
TBtools software package. The colour scale on the right side of the heatmap showed the expression level; red indicated high transcript abundance while green
indicated low abundance. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

12
T. Xu et al. Aquaculture 556 (2022) 738266

(caption on next page)

13
T. Xu et al. Aquaculture 556 (2022) 738266

Fig. 7. Expression patterns of IL genes in grass carp in different tissues post GCRV challenge. (A), (B), (C), and (D) represented mRNA expressions of IL genes post
GCRV challenge in gill, intestine, hepatopancreas, and spleen tissues, respectively. Fold changes of IL expressions were log2(TPM + 1) transformed and were used to
generate heatmap with TBtools software package. The colour scale on the right side of the heatmap showed the expression level; red indicated high transcript
abundance while blue indicated low abundance. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of
this article.)

Fig. 8. Expression patterns of IL genes in grass carp in different tissues or cells post GCRV or A. hydrophila challenge. (A) indicated the expressions of IL genes in C1,
R2, and S3 post GCRV challenge. (B) indicated the expressions of IL genes in head-kidney and trunk-kidney tissues post GCRV challenge. (C) indicated the expressions
of IL genes in spleen tissues post A. hydrophila challenge.

challenge. As shown in Fig. 10E, IL-15l expressions were all significantly
downregulated in gill, hepatopancreas, spleen, and head-kidney at 4 h
compared to untreated control groups (p < 0.01).
4. Discussion
Cytokines are a class of pleiotropic molecules that play an important
role in immune regulation, cell proliferation, and repair of damaged
tissues (Xu and Su, 2021). As a class of cytokines that interact between
leukocytes or immune cells, ILs play an important role in transmitting
information, activating and regulating immune cells, mediating the
activation, proliferation, and differentiation of T and B cells, and in­
flammatory responses (Akdis et al., 2011). However, due to the wide
variety and number of IL genes and their complex classification, few
articles have previously conducted a more complete and systematic
study of ILs. In the present work, based on the C. idella genomic and
transcriptomic datasets, we systematically identified all members of the
IL family in grass carp. A total of 39 ILs were identified in grass carp,
most of which remained to be functionally characterized. Subsequently,
multiple phylogenetic trees were constructed by family classification to
assess the evolutionary relationships of ILs among different species to
determine the evolution and possible functions of ILs. To further char­
acterize these ILs, detailed analyses including gene structure, conserved
pattern composition, chromosomal location, and gene duplication
events were performed. In addition, based on transcriptomic data, the
expression profiles of IL genes in different healthy tissues and tissues
post GCRV or A. hydrophila challenge were also analyzed. Finally, qRT-
PCR verification of selected IL genes post A. hydrophila or GCRV chal­
lenge was performed.
In general, members within a subgroup may share a common
evolutionary origin and conserved function (Li et al., 2020). Phyloge­
netic analysis may provide some new insights into the evolution of IL
genes. In the phylogenetic tree of the IL-1 family made by several of our
selected species (Fig. 1A), only a few members of IL-18, IL-1β, and IL-
1Ra were present in most species, except human and mouse. The other
members probably emerged gradually during the evolution of the spe­
cies, as confirmed by previous studies, and the IL-1 gene family was
formed through successive gene duplications (Taylor et al., 2002). The
phylogenetic tree of the IL-2 family showed (Fig. 1B) that IL-9 was not
found in fish and might have emerged gradually during the evolutionary
process. And a second gene copy of IL-15 had been found in the genome
of some fish. In some cases, this might be due to duplication of the IL-15

14
T. Xu et al.
Fig. 9. The transcripts of grass carp IL-1β (A), IL-6 (B), and IL-8 (C) genes in gill, hepatopancreas, spleen, and head-kidney post A. hydrophila challenge by qRT-PCR.
18S rRNA gene was employed as an internal reference (n = 5). Asterisks indicated significant differences between the treatment samples and the corresponding
control samples. (*p ≤ 0.05, **p ≤ 0.01).
locus, which seemed to have occurred several times during fish evolu­
tion (Buonocore et al., 2020). The phylogenetic tree of the IL-6 family
showed (Fig. 1C) that M17 was specific to fish and was grouped with the
mammalian LIF and OSM clades. The possible reason for this was that
the ancestor of M17 evolved as fish M17, which was expanded by gene
duplication in mammals to give rise to mammalian LIF and OSM.
Another ancestral gene evolved as CNTF-like in fish but might have
undergone two rounds of gene duplication after divergence from the
main vertebrate lineage in fish, giving rise to mammalian CNTF, CLCF1,
and CT-1 (Wang and Secombes, 2009). A second gene copy of CNTF and
IL-11 had also been found in some fish genomes, which might be due to
fish-wide genome duplication and tandem gene duplication events
(Huising et al., 2006; Huising et al., 2005; Wang et al., 2008). The
phylogenetic tree of the IL-10 family showed (Fig. 1D) that the IL-19l/IL-
20l gene in fish, which belonged to the same clade as IL-19, IL-20, and
IL-24. It has been suggested that the fish IL-19l/IL-20l gene might have
arisen from an ancestral gene that gave rise to IL-19, IL-20, and IL24 in
higher vertebrates, rather than the fish IL-19l/IL-20l gene was an
ortholog of mammalian IL-19/IL-20 (Wang et al., 2010b). The phylo­
genetic tree of the IL-12 family showed (Fig. 1E) that at least two copies
of the p35 gene and at least three copies of the p40 gene were present in
fish compared to mammals, which might be due to genome-wide
replication events in fish (Wang and Husain, 2014). The phylogenetic
tree of the IL-17 family showed (Fig. 1F) that the orthologous genes of
the teleost clustered in a single branch, indicating that the IL-17 family
genes were highly conserved, a result that was consistent with previous
15
Aquaculture 556 (2022) 738266
findings (Gunimaladevi et al., 2006; Wang et al., 2014b). Since IL-17N,
which was unique to teleost, was closely related to IL-17C, it was hy­
pothesized that the so-called teleost IL17N gene might have evolved
from an ancestral IL-17C gene that subsequently gave rise to IL-17N and
IL-17D (Dong et al., 2019).
The ordinal position and intron-exon distribution pattern of genomic
regions can often be used as supportive evidence of gene family
expansion patterns and their evolutionary relationship to ancestors
(Mach, 2009). In the present study, there were some differences in gene
structure among members of the same family while maintaining con­
servation (Fig. 2A). These differences were particularly evident in
members of the IL-1 family. The numbers of exons in the IL-1 family
genes were 5, 6, and 7, and there was significant structural variation in
the tandem duplication pair of IL-1Ra (7 exons) and IL-1Ral (5 exons),
which was also consistent with their larger values of Ka/Ks (0.52, 0.63,
and 0.59). This suggested that the loss and gain of IL gene exons during
genetic evolution might be responsible for the functional diversity of IL
family members (Jiang et al., 2015; Wang and Husain, 2014). In addi­
tion, the structures of the IL genes in fish were very close to that of other
higher vertebrates, with almost the same number of introns and exons,
and even some exon sizes that did not vary across all species (Bei et al.,
2006; Huising et al., 2004; Husain et al., 2012; Jiang et al., 2015; Tang
et al., 2019; Wang and Secombes, 2009; Wang and Husain, 2014; Wang
et al., 2010b; Yao et al., 2015). Conservative domain and motif analyses
showed that not all ILs contained typical IL domains and that there was
high variability in their motifs across families. Despite this, the domains
T. Xu et al. Aquaculture 556 (2022) 738266

Fig. 10. mRNA expressions of grass carp IL-1β (A), IL-6 (B), IL-7 (C), IL-8 (D), IL-15l (E), and M17 (F) genes in gill, hepatopancreas, spleen, and head-kidney post
GCRV challenge by qRT-PCR. 18S rRNA gene was employed as an internal reference (n = 5). Asterisks indicated significant differences between the treatment
samples and the corresponding control samples. (*p ≤ 0.05, **p ≤ 0.01).

16
T. Xu et al.
and motifs were very conserved in members of the IL-10 family and IL-
17 family. These observations suggested that variations in the gene
structure, deletions, and mutations of conserved motifs were also
important for the functional diversity of grass carp IL family members
and provide a reliable basis for the functional analysis of related genes in
the corresponding families (Wang et al., 2014a).
Gene families typically evolve with whole-genome duplication
(WGD), tandem duplication, and segmental duplication, resulting in a
significant increase in the number of genes in the genome (Maere et al.,
2005). In turn, larger genomes may lead to a diversification of gene
functions, resulting in larger gene families, which in turn allow for more
complex interactions and the evolution of gene networks (Aburomia
et al., 2003; Cusack and Wolfe, 2007). We found that there were mul­
tiple copies of some IL genes, but these gene copies were not generated
by tandem duplication, but potentially by segmental duplication or
WGD. It was now generally accepted that vertebrate genomes under­
went two rounds (2R) of massive gene duplication after the emergence
of urochordates and before the radiation of jawed vertebrates (Flajnik
and Kasahara, 2010; Van de Peer et al., 2009). Furthermore, most extant
teleosts underwent an additional WGD (3R) during their early evolution
compared to other vertebrates (Kassahn et al., 2009; Postlethwait,
2007). Therefore, mammalian genes might have two homologs in some
teleost. For example, IL-11 and p35 were present in some teleost as IL-
11a, IL-11b, and p35a, p35b. Interestingly, the p40 gene in mammals
had three copies in some teleost, p40a, p40b, and p40c. Studies have
shown that the p40a and p40b genes in teleost were indeed homologs of
vertebrate p40, probably due to 3R WGD, while teleost p40c perhaps
occurred in a different manner (Wang and Husain, 2014). In addition,
salmonids underwent further WGD (4R) based on 3R (Macqueen and
Johnston, 2014). Thus, mammalian genes might have two homologs in
some teleost and four homologs in salmonids. For example, the p35 gene
was identified in salmonids with four loci (Wang and Husain, 2014). The
mammalian IL-1β gene, although only one copy was identified in tele­
osts such as grass carp and zebrafish, two IL-1β genes were identified in
tilapia and medaka from Perciformes and Belloniformes, and four IL-1β
genes were identified in salmonids (Husain et al., 2012). Theoretically,
the p40 gene should have identified six in salmonids, but the fact that
only three were identified (p40b1, p40b2, and p40c) might since these
3R IL genes were all copied into salmonids by subsequent 4R WGD,
generating additional copies, but some copies of the IL genes might have
been lost or inactivated in some salmonids (Wang and Husain, 2014).
Notably, the p19 and p28 genes in mammals had only one copy in some
teleost, whereas in salmonids there were 2 copies (p19a, p19b, and
p28a, p28b) (Husain et al., 2014; Jiang et al., 2015).
Previous studies have shown that IL-1β was expressed to varying
degrees in most of the tissues examined, especially showing high
expression in gill and head-kidney (Yang et al., 2017). Grass carp IL-1Ra
was widely expressed in selected tissues, with relatively high abundance
in head-kidney, kidney, and spleen (Yao et al., 2015). It has been re­
ported that IL-1β and IL-6 were significantly upregulated in head-
kidney, spleen, and liver of Siberian sturgeon (Acipenser baeri) in
response to A. hydrophila infection (Wang et al., 2021; Wang et al.,
2020). The expression levels of IL-8 were significantly upregulated in
trunk-kidney and head-kidney when mandarin fish (Siniperca chuasti)
were challenged by the pathogenic bacterium F. columnare G4 (Wang
et al., 2017). These results were consistent with the findings of our ex­
periments. The expression level of IL-1β was reported to be significantly
elevated in the orange-spotted grouper metamorphosis-stage post ner­
vous necrosis virus (NNV) challenge and was positively correlated with
viral content (Wu et al., 2012). The expression of the IL-8 gene was
significantly upregulated after a large outbreak of NNV in Pacific cod,
suggesting that the expression of IL-8 genes could enhance the immune
system of Pacific cod larvae and improve survival post-viral challenge
(Mao et al., 2015). In conclusion, all these IL genes play an extremely
important role in the immune response.
17
Aquaculture 556 (2022) 738266
5. Conclusions
In the present study, we identified all members of the grass carp IL
and performed a systematic and comprehensive analysis. Based on the
grass carp genomic and transcriptomic datasets, we identified a total of
39 ILs in grass carp, and they were unevenly distributed across 15 LGs
and 9 scaffolds in grass carp. Subsequently, multiple phylogenetic trees
were constructed by family classification to assess the evolutionary re­
lationships of IL genes among different species. Gene structure,
conserved domains, and motif analyses indicated that ILs were relatively
conserved in the same gene family. Gene duplication and Ka and Ks
substitution rate analyses indicated that segmental duplication events
played a key role in the expansion of the IL gene family and underwent
strong purifying selection pressure during evolution. Analysis of RNA-
seq data from different healthy tissues revealed that many IL genes
were widely expressed in different tissues of grass carp. In addition, we
further analyzed tissue RNA-seq data post GCRV or A. hydrophila chal­
lenge and found that the expressions of some IL genes were significantly
upregulated or downregulated post-challenge. Finally, we performed
the qRT-PCR verification of these genes, and the results showed that the
expressions of IL-1β, IL-6, IL-7, IL-8, IL-15l, and M17 genes changed
significantly in all four tissues examined post-challenge, suggesting that
they played an important role in the immune responses to bacterial or
viral infection. In conclusion, we performed a systematic study of all
interleukin genes in grass carp, to advance the understanding of inter­
leukin evolution and gene function in grass carp, especially the immune
function involving GCRV or A. hydrophila challenge.
CRediT authorship contribution statement
Tianbing Xu: Methodology, Validation, Writing – original draft.
Zhensheng Wang: Data curation and Validation. Yang Gao: Data
curation and Validation. Jianguo Su: Conceptualization, Methodology,
Project administration, Supervision, Writing – review & editing.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgements
This work was supported by National Key Research and Develop­
ment Program of China (2018YFD0900504) and Fundamental Research
Funds for the Central Universities (2662021SCPY006).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.aquaculture.2022.738266.
References
Aburomia, R., Khaner, O., Sidow, A., 2003. Functional evolution in the ancestral lineage
of vertebrates or when genomic complexity was wagging its morphological tail.
J. Struct. Funct. Genom. 3, 45–52.
Akdis, M., Burgler, S., Crameri, R., Eiwegger, T., Fujita, H., Gomez, E., Akdis, C.A., 2011.
Interleukins, from 1 to 37, and interferon-γ: receptors, functions, and roles in
diseases. J. Allergy Clin. Immunol. 127, 701–721.
Akdis, M., Aab, A., Altunbulakli, C., Azkur, K., Costa, R.A., Crameri, R., Akdis, C.A.,
2016. Interleukins (from IL-1 to IL-38), interferons, transforming growth factor β,
and TNF-α: receptors, functions, and roles in diseases. J. Allergy Clin. Immunol. 138,
984–1010.
Almagro Armenteros, J.J., Tsirigos, K.D., Sønderby, C.K., Petersen, T.N., Winther, O.,
Brunak, S., Nielsen, H., 2019. SignalP 5.0 improves signal peptide predictions using
deep neural networks. Nat. Biotechnol. 37, 420–423.
T. Xu et al.
Bailey, T.L., Boden, M., Buske, F.A., Frith, M., Grant, C.E., Clementi, L., Noble, W.S.,
2009. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res. 37,
W202–W208.
Bei, J.X., Suetake, H., Araki, K., Kikuchi, K., Yoshiura, Y., Lin, H.R., Suzuki, Y., 2006.
Two interleukin (IL)-15 homologues in fish from two distinct origins. Mol. Immunol.
43, 860–869.
Buonocore, F., Gerdol, M., Pallavicini, A., Stocchi, V., Randelli, E., Belardinelli, M.C.,
Wang, T.H., 2020. Identification, molecular characterization and functional analysis
of interleukin (IL)-2 and IL-2like (IL-2L) cytokines in sea bass (Dicentrarchus labrax
L.). Cytokine. 126, 154898.
Catalan-Dibene, J., McIntyre, L.L., Zlotnik, A., 2018. Interleukin 30 to Interleukin 40.
J. Interf. Cytokine Res. 38, 423–439.
Chao, J.T., Kong, Y.Z., Wang, Q., Sun, Y.H., Gong, D.P., Lv, J., Liu, G.S., 2015.
MapGene2Chrom, a tool to draw gene physical map based on Perl and SVG
languages. Yi chuan=Hereditas. 37, 91–97.
Chen, Y.X., Shi, M.J., Zhang, W.T., Cheng, Y.Y., Wang, Y.P., Xia, X.Q., 2017. The Grass
Carp Genome Database (GCGD): an online platform for genome features and
annotations. Database 2017, bax051.
Chen, S.F., Zhou, Y.Q., Chen, Y.R., Gu, J., 2018. fastp: an ultra-fast all-in-one FASTQ
preprocessor. Bioinformatics. 34, i884–i890.
Chen, C.J., Chen, H., Zhang, Y., Thomas, H.R., Frank, M.H., He, Y.H., Xia, R., 2020.
TBtools: an integrative toolkit developed for interactive analyses of big biological
data. Mol. Plant 13, 1194–1202.
Chen, L., Huang, R., Li, Y., Li, Y., Li, Y., Liao, L., Wang, Y., 2021. Genome-wide
identification, evolution of Krüppel-like factors (klfs) and their expressions during
GCRV challenge in grass carp (Ctenopharyngodon idella). Dev. Comp. Immunol. 120,
104062.
Commins, S., Steinke, J.W., Borish, L., 2008. The extended IL-10 superfamily: IL-10, IL-
19, IL-20, IL-22, IL-24, IL-26, IL-28, and IL-29. J. Allergy Clin. Immunol. 121,
1108–1111.
Cusack, B.P., Wolfe, K.H., 2007. When gene marriages don’t work out: divorce by
subfunctionalization. Trends Genet. 23, 270–272.
Dang, Y.F., Xu, X.Y., Shen, Y.B., Hu, M.Y., Zhang, M., Li, L.S., Li, J.L., 2016.
Transcriptome analysis of the innate immunity-related complement system in spleen
tissue of Ctenopharyngodon idella infected with Aeromonas hydrophila. PLoS One 11,
e0157413.
Dao, T., Ohashi, K., Kayano, T., Kurimoto, M., Okamura, H., 1996. Interferon-γ-inducing
factor, a novel cytokine, enhances Fas ligand-mediated cytotoxicity of murine T
helper 1 cells. Cell. Immunol. 173, 230–235.
Dong, C.J., Kong, S.N., Zheng, X.H., Zhang, J.F., Nie, G.X., Li, X.J., Xu, P., 2019. Genome-
wide identification of interleukin-17 (IL17) in common carp (Cyprinus carpio) and its
expression following Aeromonas hydrophila infection. Gene. 686, 68–75.
Finn, R.D., Clements, J., Eddy, S.R., 2011. HMMER web server: interactive sequence
similarity searching. Nucleic Acids Res. 39, W29–W37.
Flajnik, M.F., Kasahara, M., 2010. Origin and evolution of the adaptive immune system:
genetic events and selective pressures. Nat. Rev. Genet. 11, 47–59.
Garbers, C., Hermanns, H.M., Schaper, F., Müller-Newen, G., Grötzinger, J., Rose-
John, S., Scheller, J., 2012. Plasticity and cross-talk of interleukin 6-type cytokines.
Cytokine Growth Factor Rev. 23, 85–97.
Gasteiger, E., Gattiker, A., Hoogland, C., Ivanyi, I., Appel, R.D., Bairoch, A., 2003.
ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic
Acids Res. 31, 3784–3788.
Gunimaladevi, I., Savan, R., Sakai, M., 2006. Identification, cloning and characterization
of interleukin-17 and its family from zebrafish. Fish Shellfish Immunol. 21, 393–403.
Howe, K., Clark, M.D., Torroja, C.F., Torrance, J., Berthelot, C., Muffato, M., Stemple, D.
L., 2013. The zebrafish reference genome sequence and its relationship to the human
genome. Nature. 496, 498–503.
Hu, B., Jin, J.P., Guo, A.Y., Zhang, H., Luo, J.C., Gao, G., 2015. GSDS 2.0: an upgraded
gene feature visualization server. Bioinformatics. 31, 1296–1297.
Huising, M.O., Stet, R.J.M., Savelkoul, H.F.J., Verburg-van Kemenade, B.M.L., 2004. The
molecular evolution of the interleukin-1 family of cytokines; IL-18 in teleost fish.
Dev. Comp. Immunol. 28, 395–413.
Huising, M.O., Kruiswijk, C.P., van Schijndel, J.E., Savelkoul, H.F.J., Flik, G., Verburg-
van Kemenade, B.M.L., 2005. Multiple and highly divergent IL-11 genes in teleost
fish. Immunogenetics. 57, 432–443.
Huising, M.O., Kruiswijk, C.P., Flik, G., 2006. Phylogeny and evolution of class-I helical
cytokines. J. Endocrinol. 189, 1–25.
Hurst, L.D., 2002. The Ka/Ks ratio: diagnosing the form of sequence evolution. Trends
Genet. 18, 486.
Husain, M., Bird, S., Zwieten, R.v., Secombes, C.J., Wang, T.H., 2012. Cloning of the IL-
1β3 gene and IL-1β4 pseudogene in salmonids uncovers a second type of IL-1β gene
in teleost fish. Dev. Comp. Immunol. 38, 431–446.
Husain, M., Martin, S.A.M., Wang, T.H., 2014. Identification and characterisation of the
IL-27 p28 subunits in fish: cloning and comparative expression analysis of two p28
paralogues in Atlantic salmon Salmo salar. Fish Shellfish Immunol. 41, 102–112.
Ilangumaran, S., Ramanathan, S., Rottapel, R., 2004. Regulation of the immune system
by SOCS family adaptor proteins. Semin. Immunol. 16, 351–365.
Jiang, Y.S., Husain, M., Qi, Z.T., Bird, S., Wang, T.H., 2015. Identification and expression
analysis of two interleukin-23α (p19) isoforms, in rainbow trout Oncorhynchus mykiss
and Atlantic salmon Salmo salar. Mol. Immunol. 66, 216–228.
Käll, L., Krogh, A., Sonnhammer, E.L.L., 2007. Advantages of combined transmembrane
topology and signal peptide prediction—the Phobius web server. Nucleic Acids Res.
35, W429–W432.
Kany, S., Vollrath, J.T., Relja, B., 2019. Cytokines in inflammatory disease. Int. J. Mol.
Sci. 20, 6008.
18
Aquaculture 556 (2022) 738266
Kassahn, K.S., Dang, V.T., Wilkins, S.J., Perkins, A.C., Ragan, M.A., 2009. Evolution of
gene function and regulatory control after whole-genome duplication: comparative
analyses in vertebrates. Genome Res. 19, 1404–1418.
Kim, D., Paggi, J.M., Park, C., Bennett, C., Salzberg, S.L., 2019. Graph-based genome
alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 37,
907–915.
Krogh, A., Larsson, B., von Heijne, G., Sonnhammer, E.L.L., 2001. Predicting
transmembrane protein topology with a hidden markov model: application to
complete genomes. J. Mol. Biol. 305, 567–580.
Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. MEGA X: molecular
evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35,
1547–1549.
Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A.,
McWilliam, H., Higgins, D.G., 2007. Clustal W and Clustal X version 2.0.
Bioinformatics. 23, 2947–2948.
Leonard, W.J., Lin, J.X., O’Shea, J.J., 2019. The γc family of cytokines: basic biology to
therapeutic ramifications. Immunity. 50, 832–850.
Letunic, I., Bork, P., 2021. Interactive Tree Of Life (iTOL) v5: an online tool for
phylogenetic tree display and annotation. Nucleic Acids Res. 49, W293–W296.
Letunic, I., Khedkar, S., Bork, P., 2021. SMART: recent updates, new developments and
status in 2020. Nucleic Acids Res. 49, D458–D460.
Li, Y.M., Lin-Wang, K., Liu, Z., Allan, A.C., Qin, S.H., Zhang, J.L., Liu, Y.H., 2020.
Genome-wide analysis and expression profiles of the StR2R3-MYB transcription
factor superfamily in potato (Solanum tuberosum L.). Int. J. Biol. Macromol. 148,
817–832.
Liao, Y., Smyth, G.K., Shi, W., 2014. featureCounts: an efficient general purpose program
for assigning sequence reads to genomic features. Bioinformatics. 30, 923–930.
Liu, L., Gong, Y.X., Zhu, B., Liu, G.L., Wang, G.X., Ling, F., 2015. Effect of a new
recombinant Aeromonas hydrophila vaccine on the grass carp intestinal microbiota
and correlations with immunological responses. Fish Shellfish Immunol. 45,
175–183.
Lv, M.Y., Wang, X.Y., Qiu, X.Y., Zeng, T.T., Feng, S.Y., Yin, L.C., Yang, K., 2020.
Functional characterization of grass carp (Ctenopharyngodon idella) interleukin-2 in
head kidney leukocytes. Fish Shellfish Immunol. 97, 500–508.
Mach, J., 2009. Alternative splicing produces a JAZ protein that is not broken down in
response to jasmonic acid. Plant Cell 21, 14.
Macqueen, D.J., Johnston, I.A., 2014. A well-constrained estimate for the timing of the
salmonid whole genome duplication reveals major decoupling from species
diversification. Proc. R. Soc. B 281, 20132881.
Maere, S., De Bodt, S., Raes, J., Casneuf, T., Van Montagu, M., Kuiper, M., Van de
Peer, Y., 2005. Modeling gene and genome duplications in eukaryotes. Proc. Natl.
Acad. Sci. U. S. A. 102, 5454–5459.
Mao, M.G., Wen, S.H., Perálvarez-Marín, A., Li, H., Jiang, J.L., Jiang, Z.Q., Lü, H.Q.,
2015. Evidence for and characterization of nervous necrosis virus infection in Pacific
cod (Gadus macrocephalus). Arch. Virol. 160, 2237–2248.
Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S.N., Chitsaz, F., Geer, L.Y.,
Bryant, S.H., 2015. CDD: NCBI’s conserved domain database. Nucleic Acids Res. 43,
D222–D226.
McGeachy, M.J., Cua, D.J., Gaffen, S.L., 2019. The IL-17 family of cytokines in health
and disease. Immunity. 50, 892–906.
Murakami, M., Kamimura, D., Hirano, T., 2019. Pleiotropy and specificity: insights from
the interleukin 6 family of cytokines. Immunity. 50, 812–831.
Ouyang, W., O’Garra, A., 2019. IL-10 family cytokines IL-10 and IL-22: from basic
science to clinical translation. Immunity. 50, 871–891.
Postlethwait, J.H., 2007. The zebrafish genome in context: ohnologs gone missing.
J. Exp. Zool. (Mol. Dev. Evol.) 308B, 563–577.
Rivers-Auty, J., Daniels, M.J.D., Colliver, I., Robertson, D.L., Brough, D., 2018.
Redefining the ancestral origins of the interleukin-1 superfamily. Nat. Commun. 9,
1156.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Savojardo, C., Martelli, P.L., Fariselli, P., Profiti, G., Casadio, R., 2018. BUSCA: an
integrative web server to predict subcellular localization of proteins. Nucleic Acids
Res. 46, W459–W466.
Schmitz, J., Owyang, A., Oldham, E., Song, Y., Murphy, E., McClanahan, T.K.,
Kastelein, R.A., 2005. IL-33, an Interleukin-1-like cytokine that signals via the IL-1
receptor-related protein ST2 and induces T helper type 2-associated cytokines.
Immunity. 23, 479–490.
Secombes, C.J., Wang, T., Bird, S., 2011. The interleukins of fish. Dev. Comp. Immunol.
35, 1336–1345.
Shang, X.Y., Yang, C.R., Wan, Q.Y., Rao, Y.L., Su, J.G., 2017. The destiny of the
resistance/susceptibility against GCRV is controlled by epigenetic mechanisms in
CIK cells. Sci. Rep. 7, 4551.
Shi, M.J., Huang, R., Du, F.K., Pei, Y.Y., Liao, L.J., Zhu, Z.Y., Wang, Y.P., 2014. RNA-seq
profiles from grass carp tissues after reovirus (GCRV) infection based on singular and
modular enrichment analyses. Mol. Immunol. 61, 44–53.
Smith, A.J.P., Humphries, S.E., 2009. Cytokine and cytokine receptor gene
polymorphisms and their functionality. Cytokine Growth Factor Rev. 20, 43–59.
Su, J.G., Zhang, R.F., Dong, J., Yang, C.R., 2011. Evaluation of internal control genes for
qRT-PCR normalization in tissues and cell culture for antiviral studies of grass carp
(Ctenopharyngodon idella). Fish Shellfish Immunol. 30, 830–835.
Sun, B.Y., Xiao, L.Y., Kou, H.Y., Yang, C.G., Guo, P.H., He, W., Song, X.H., 2020a.
Different routes of Aeromonas hydrophila infection lead to differential grass carp
interleukin-17 family gene expression patterns during intestinal inflammation.
Aquaculture. 529, 735607.
T. Xu et al.
Sun, L.N., Gao, T., Wang, F.L., Qin, Z.L., Yan, L.X., Tao, W.J., Wang, D.S., 2020b.
Chromosome-level genome assembly of a cyprinid fish Onychostoma macrolepis by
integration of nanopore sequencing, Bionano and Hi-C technology. Mol. Ecol.
Resour. 20, 1361–1371.
Szklarczyk, D., Gable, A.L., Lyon, D., Junge, A., Wyder, S., Huerta-Cepas, J., Mering, C.v.,
2019. STRING v11: protein-protein association networks with increased coverage,
supporting functional discovery in genome-wide experimental datasets. Nucleic
Acids Res. 47, D607–D613.
Tait Wojno, E.D., Hunter, C.A., Stumhofer, J.S., 2019. The immunobiology of the
interleukin-12 family: room for discovery. Immunity. 50, 851–870.
Tang, D.D., Wu, S.P., Luo, K., Yuan, H.W., Gao, W.H., Zhu, D.S., Xu, Q.Q., 2019.
Sequence characterization and expression pattern analysis of six kinds of IL-17
family genes in the Asian swamp eel (Monopterus albus). Fish Shellfish Immunol. 89,
257–270.
Taylor, S.L., Renshaw, B.R., Garka, K.E., Smith, D.E., Sims, J.E., 2002. Genomic
organization of the Interleukin-1 locus. Genomics. 79, 726–733.
Van de Peer, Y., Maere, S., Meyer, A., 2009. The evolutionary significance of ancient
genome duplications. Nat. Rev. Genet. 10, 725–732.
Wan, Q.Y., Su, J.G., 2015. Transcriptome analysis provides insights into the regulatory
function of alternative splicing in antiviral immunity in grass carp
(Ctenopharyngodon idella). Sci. Rep. 5, 12946.
Wang, T.H., Husain, M., 2014. The expanding repertoire of the IL-12 cytokine family in
teleost fish: identification of three paralogues each of the p35 and p40 genes in
salmonids, and comparative analysis of their expression and modulation in Atlantic
salmon Salmo salar. Dev. Comp. Immunol. 46, 194–207.
Wang, T.H., Secombes, C.J., 2009. Identification and expression analysis of two fish-
specific IL-6 cytokine family members, the ciliary neurotrophic factor (CNTF)-like
and M17 genes, in rainbow trout Oncorhynchus mykiss. Mol. Immunol. 46,
2290–2298.
Wang, T.H., Hanington, P.C., Belosevic, M., Secombes, C.J., 2008. Two macrophage
colony-stimulating factor genes exist in fish that differ in gene organization and are
differentially expressed. J. Immunol. 181, 3310.
Wang, D.P., Zhang, Y.B., Zhang, Z., Zhu, J., Yu, J., 2010a. KaKs_Calculator 2.0: a toolkit
incorporating gamma-series methods and sliding window strategies. Genom.
Proteom. Bioinf. 8, 77–80.
Wang, T.H., Díaz-Rosales, P., Martin, S.A.M., Secombes, C.J., 2010b. Cloning of a novel
interleukin (IL)-20-like gene in rainbow trout Oncorhynchus mykiss gives an insight
into the evolution of the IL-10 family. Dev. Comp. Immunol. 34, 158–167.
Wang, Y.P., Tang, H.B., Debarry, J.D., Tan, X., Li, J.P., Wang, X.Y., Paterson, A.H., 2012.
MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and
collinearity. Nucleic Acids Res. 40, e49.
Wang, H.L., Yang, J., Boykin, L.M., Zhao, Q.Y., Wang, Y.J., Liu, S.S., Wang, X.W., 2014a.
Developing conversed microsatellite markers and their implications in evolutionary
analysis of the Bemisia tabaci complex. Sci. Rep. 4, 6351.
Wang, X.Q., Li, C., Thongda, W., Luo, Y.P., Beck, B., Peatman, E., 2014b.
Characterization and mucosal responses of interleukin 17 family ligand and receptor
genes in channel catfish Ictalurus punctatus. Fish Shellfish Immunol. 38, 47–55.
Wang, Y., Lu, Y., Zhang, Y., Ning, Z., Li, Y., Zhao, Q., Zhu, Z., 2015. The draft genome of
the grass carp (Ctenopharyngodon idellus) provides insights into its evolution and
vegetarian adaptation. Nat. Genet. 47, 625–631.
19
Aquaculture 556 (2022) 738266
Wang, X., Wei, Y., Xiao, H., Liu, X., Zhang, Y., Han, G., Wang, R., 2016. A novel IL-
23p19/Ebi3 (IL-39) cytokine mediates inflammation in lupus-like mice. Eur. J.
Immunol. 46, 1343–1350.
Wang, G.L., Wang, M.C., Zhang, X.W., Chang, M.X., Xie, H.X., Nie, P., 2017. Molecular
cloning, biological effect, and tissue distribution of interleukin-8 protein in mandarin
fish (Siniperca chuasti) upon Flavobacterium columnare infection. Fish Shellfish
Immunol. 66, 112–119.
Wang, X.W., Chen, J.Y., Zhang, R., Liu, L.L., Ma, G.Q., Zhu, H., 2020. Interleukin-6 in
Siberian sturgeon (Acipenser baeri): molecular characterization and immune
functional activity. Fish Shellfish Immunol. 102, 296–306.
Wang, X.W., Zhang, R., Liu, L.L., Ma, G.Q., Zhu, H., 2021. An IL-1β homologue induced
inflammation and antibacterial immune defense in Siberian sturgeon (Acipenser
baeri). Fish Shellfish Immunol. 118, 283–293.
Wang, Z.S., Huo, X.C., Zhang, Y.Q., Gao, Y., Su, J.G., 2022. Carboxymethyl chitosan
nanoparticles loaded with bioactive protein CiCXCL20a effectively prevent bacterial
disease in grass carp (Ctenopharyngodon idella). Aquaculture. 549, 737745.
Wu, M.S., Chen, C.W., Lin, C.H., Tzeng, C.S., Chang, C.Y., 2012. Differential expression
profiling of orange-spotted grouper larvae, Epinephelus coioides (Hamilton), that
survived a betanodavirus outbreak. J. Fish Dis. 35, 215–225.
Xu, T.B., Su, J.G., 2021. Genome-wide identification, evolution, and transcriptome-based
expression profiling analysis of suppressors of cytokine signaling (SOCS) in grass
carp (Ctenopharyngodon idella). Aquaculture. 536, 736484.
Xu, P., Xu, J., Liu, G.J., Chen, L., Zhou, Z.X., Peng, W.Z., Sun, X.W., 2019. The
allotetraploid origin and asymmetrical genome evolution of the common carp
Cyprinus carpio. Nat. Commun. 10, 4625.
Xue, Y.J., Jiang, X.Y., Gao, J.D., Li, X., Xu, J.W., Wang, J.Y., Zou, J., 2019. Functional
characterisation of interleukin 34 in grass carp Ctenopharyngodon idella. Fish
Shellfish Immunol. 92, 91–100.
Yang, Y., Yu, H., Li, H., Wang, A.L., 2016a. Transcriptome profiling of grass carp
(Ctenopharyngodon idellus) infected with Aeromonas hydrophila. Fish Shellfish
Immunol. 51, 329–336.
Yang, Z.J., Li, C.H., Chen, J., Zhang, H., Li, M.Y., Chen, J., 2016b. Molecular
characterization of an interleukin-4/13B homolog in grass carp (Ctenopharyngodon
idella) and its role in fish against Aeromonas hydrophila infection. Fish Shellfish
Immunol. 57, 136–147.
Yang, Q., Chu, Q., Zhao, X.Y., Xu, T.J., 2017. Characterization of IL-1β and two types of
IL-1 receptors in miiuy croaker and evolution analysis of IL-1 family. Fish Shellfish
Immunol. 63, 165–172.
Yao, F.L., Yang, X., Wang, X.Y., Wei, H., Zhang, A.Y., Zhou, H., 2015. Molecular and
functional characterization of an IL-1β receptor antagonist in grass carp
(Ctenopharyngodon idella). Dev. Comp. Immunol. 49, 207–216.
Yu, C.S., Chen, Y.C., Lu, C.H., Hwang, J.K., 2006. Prediction of protein subcellular
localization. Proteins Struct. Funct. Bioinf. 64, 643–651.
Zhang, A., Jian, X., Wang, D., Ren, J., Wang, X., Zhou, H., 2020. Characterization and
bioactivity of grass carp (Ctenopharyngodon idella) interleukin-21: inducible
production and involvement in inflammatory regulation. Fish Shellfish Immunol. 99,
19–26.
Another random document with
no related content on Scribd:
will not signify a witch of Endor, when it must necessarily signify a
necromancer, which is as much against his tooth as the other? Nay
indeed this necromancer is also a witch or wizzard, according to the
definition produced above.
“The rest of the chapter being so inconsiderable, and I having been
so long already upon it, I shall pass to the next, after I have desired
you to take notice how weak and childish, or wild and impudent, Mr.
Webster has been in the interpretation of Scripture hitherto, in the
belief of his sage dames, to fence off the reproach of being termed
witches; whereas there is scarce one word in this place of
Deuteronomy that does not imply a witch or wizzard, according to
the real definition thereof. And truly he seems himself to be
conscious of the weakness of his own performance, when after all
this ado, the sum at last amounts but to this, that there are no names
in all the Old Testament that signifies such a witch that destroy men
or beasts, that make a visible compact with the devil, or on whose
body he sucketh, or with whom he hath carnal copulation, or that is
really changed into a cat, hare, dog, or such like. And to shew it
amounts to no more than so, was the task we undertook in this
chapter.
“But assure yourself, if you peruse his book carefully, you shall
plainly find that the main drift thereof is to prove, as I above noted,
that there is no such witch as with whom the devil has any thing
more to do than with any other sinner, which, notwithstanding this
conclusion of his a little before recited, comes infinitely short of: and
therefore this sixth chapter, consisting of about thirty pages in folio,
is a meer piece of impertinency. And there will be witches for all this,
whether these particulars be noted in them or no; for it was sufficient
for Moses to name those ill sounding terms in general, which imply a
witch according to that general notion I have above delivered; which
if it be prohibited, namely, the having any thing to do with evil
spirits, their being suckt by them, or their having any lustful or
venerous transactions with them, is much more prohibited.
“But for some of these particularities also they may seem to be in
some manner hinted at in some of the words, especially as they are
rendered sometimes by skilful interpreters: for ‫( מכשף‬Mecasseph,) is
translated by Vatablus, and the vulgar Latin Maleficus, by the
Septuagint φαρμακός, that is Veneficus: which word signifies
mischievously enough both to man and beast. Besides that
Mecasseph carries along with it the signification of transformation
also; and haply this may be the difference betwixt ‫ מכשף‬Mecasseph,
and ‫ מעונן‬Megnonen, that the former uses prestigious
transformations to some great mischief, as where Olaus Magnus tells
of those that have transformed themselves into wolves, to men’s
thinking, and have presently fallen upon worrying of sheep. Others
transformed in their astral spirit, into various shapes, get into houses
and do mischief to men and children, as I remember Remegius
reports. And therefore it is less wonder that that sharp law of Moses
is against the ‫ מכשפה‬Mecassephah; such a witch as this is, ‘Thou
shalt not suffer a witch to live;’ this may be a more peculiar
signification of that word. And now for making a compact with the
devil, how naturally does that name ‫ חובר חבר‬Chobber Chebber,
signifie that feat also? But for sucking and copulation, though rightly
stated it may be true, yet I confess there is nothing hinted towards
that so far as I see, as indeed it was neither necessary that the other
should be. But these are the very dregs, the fex magorum et
sagarum, that sink in those abominations, against which a sufficient
bar is put already by this prohibition in general by so many names.
And the other is filthy, base, and nasty, that the mention thereof was
neither fit for the sacred style of Moses’s law, nor for the years of the
people.
In my passing to the eight chapter I will only take notice by the
way of the shameless impudence of J. Webster, who in favour to his
beloved hags, that they may be never thought to do any thing by the
assistance of the devil, makes the victory of Moses, with whom the
mighty hand of God was, or of Christ, (who was the angel that
appeared first to Moses in the bush, and conducted the children of
Israel out of Egypt to the promised land) to be the victory only over
so many hocus-pocusses, so many jugglers that were, as it seems, old
and excellent at the tricks of Legerdemain; which is the basest
derogation to the glory of that victory, and the vilest reproach against
the God of Israel, and the person of Moses, that either the malicious
wit of any devil can invent, or the dulness of any sunk soul can
stumble upon. Assuredly there was a real conflict here betwixt the
kingdom of light and the kingdom of darkness and the evil spirits
thereof, which assisted the ‫ חרטמים‬Hartummim, the Magicians of
Egypt; who before that name is named, that no man may mistake,
are called ‫מכשפים‬, Mecassaphim, such kind of magicians as can
exhibit to the sight manifold prestigious transformations through
diabolical assistance, and are rendered Malificia by good
interpreters, as I noted above; that is, they were wizzards, or he-
witches. The self same word being used in that severe law of Moses,
‘Thou shalt not suffer a witch to live.’ Are not these magicians then
examples plain enough that there are witches; that is to say, such
wretched wights as do strange miraculous things by the assistance or
consociation of the evil spirits?
“O no, says Mr. Webster, these are only ‫ חכמים‬Chacamim, wise
men and great naturalists, who all what they did, they did ‫בלהטיהם‬,
by their bright glittering laminæ, for so ‫ להטם‬forsooth must signifie.
But what necessity thereof that ‫ להט‬should signifie lamina? there is
only the presence of that one place, Gen. iii, 24. ‫להט חרב‬, where it is
‫ חרב‬only that signifies the lamina, and that of a long form, scarce
usual in those magical laminæ with signatures celestial upon them,
which J. Webster would be at; but ‫ הטם‬signifies merely flamma; so
that ‫ בלהטיהם‬by this account must signifie by their flames, if it be
from ‫ להט‬ardere, flammare: and therefore Buxtorfius judiciously
places the word under ‫ בלהטיהם‬abscondit, obvolvit, reading not
‫ בלאטיהם‬but ‫בלאטיהם‬, which is as much as to say, occultis suis
rationibus Magicis, which is briefly rendered in English, ‘by their
enchantments;’ which agrees marvellously well with ‫מכשפים‬
Mecassephim, which is as much as Præstigiatores Magici, or such as
do strange wonderous things in an hidden way, by the help of evil
spirits. But that the Egyptian magicians should do those things that
are there recorded of them in Exodus, by virtue of any lamels, or
plates of metals, with certain sculptures or figures, under such or
such a constellation, is a thing so sottish and foolish that no man that
is not himself bewitched by some old hag or hobgobling, can ever
take sanctuary here to save himself or his old dames from being in a
capacity, from this history in Exodus, of being accounted witches.
For if there may be he-witches, that is magicians, such as these of
Egypt were, I leave J. Webster to scratch his head to find out any
reason why there may not be she-witches also.
“And indeed that of the witch of Endor, to pass at length to the
eighth chapter, is as plain a proof thereof as can be desired by any
man whose mind is not blinded with prejudices. But here J. Webster,
not impertinently, I confess, for the general, (abating him the many
tedious particular impertinences that he has clogg’d his discourse
with) betakes himself to these two ways, to shew there was nothing of
a witch in all that whole narration. First, by pretending that all the
transaction on the woman of Endor’s part was nothing but collusion
and a cheat, Saul not being in the same room with her, or at least
seeing nothing if he was. And then in the next place, that Samuel that
is said to appear, could neither be Samuel appearing in his body out
of the grave, nor in his soul; nor that it was a devil that appeared;
and therefore it must be some colluding knave, suborned by the
witch. For the discovering the weakness of his former allegation, we
need but appeal to the text, which is this, 1 Sam. xxviii, v. 8.
‘And Saul said, I pray thee, divine unto me by the familiar spirit,
and bring me up whom I shall name unto thee,’ ‫ קסומי־נא לי‬that is, do
the office of a divineress, or a wise woman, ‘I pray thee unto me, ‫באוב‬
Beobh, by virtue of the familiar spirit, whose assistance thou hast,
not by virtue of the bottle, as Mr. Webster would have it. Does he
think that damsel in the Acts, which is said to have had πνεῦμα
πύθωνος, that is to have had ‫ אוב‬Obh, carried an aqua-vitæ bottle
about with her, hung at her girdle, whereby she might divine and
mutter, chirp, or peep out of it, as a chicken out of an egg-shell, or
put her neb into it to cry like a bittern, or take a dram of the bottle, to
make her wits more quick and divinatory. Who but one who had
taken too many drams of the bottle could ever fall into such a fond
conceit? Wherefore ‫ אוב‬Obh, in this place does not, as indeed no
where else, signifie an oracular bottle, or μαντεῖον, into which Saul
might desire the woman of Endor to retire into, and himself expect
answers in the next room; but signifies that familiar spirits by virtue
of whose assistance she was conceived to perform all those
wond’rous offices of a wise woman. But we proceed to verse 11.
“‘Then said the woman, whom shall I bring up unto thee? And he
said, bring me up Samuel.’ Surely as yet Saul and the woman are in
the same room, seeing the woman askt, ‘Whom shall I bring up unto
thee?’ and he answering, ‘Bring up unto me Samuel,’ it implies, that
Samuel was so brought up that Saul might see him, and not the witch
only. But we go on, verse 12.
 “‘And when the woman saw Samuel, she cryed with a loud voice;
and the woman spake to Saul, saying, why hast thou deceived, for
thou art Saul? Tho’ the woman might have some suspicions before
that it was Saul, yet she now seeing Samuel did appear, and in
another kind of way than her spirits used to do, and in another hue,
as it is most likely so holy a soul did, she presently cryed out with a
loud voice, ‘not muttered, chirpt, and peept as a chicken coming out
of the shell,’ that now she was sure it was Saul, for she was not such a
fool, as to think her art could call up real Samuel, but that the
presence of Saul was the cause thereof: and Josephus writes
expressly, Ὅτι θεασάμενον τὸ γύναιον ἄνδρα σεμνὸν καὶ
θεοπρεπῆ ταράττεται, καὶ πρὸς την ὄψίν οὐπλαγέν, οὐ σύ, φησὶν,
ὁ Βασιλεὺς Σαοῦλος; i. e. ‘The woman seeing a grave god-like man
is startled at it, and thus astonished at the vision, turned herself to
the king, and said, art not thou king Saul?’ Verse 13.
“‘And the king said unto her, be not afraid; for what sawest thou?
And the woman said unto Saul, I saw Gods ascending out of the
earth.’ The king here assures the woman, that tho’ he was Saul, yet
no hurt should come to her, and therefore bids her not be afraid. But
she turning her face to Saul as she spake to him, and he to her, and
so her sight being off from the object, Saul asked her, ‘What sawest
thou?’ and she in like manner answered, ‘I saw Gods,’ &c. For Gods, I
suppose any free translator in Greek, Latin, and English, would say,
δαίμονας, genios, spirits. And ‫ אלהים‬signifies Angels as well as Gods;
and it is likely these wise women take the spirits they converse with
to be good angels, as Ann Bodenham the witch told a worthy and
learned friend of mine, that these spirits, such as she had, were good
spirits, and would do a man all good offices all the days of his life;
and ’tis likely this woman of Endor had the same opinion of hers, and
therefore we need not wonder that she calls them ‫ אלהים‬Elohim,
especially Samuel appearing among them, to say nothing of the
presence of Saul. And that more than one spirit appears at a time,
there are repeated examples in Ann Bodenham’s magical evocations
of them, whose history, I must confess, I take to be very true.
“The case stands therefore thus: The woman and Saul being in the
same room, she turning her face from Saul, mutters to herself some
magical form of evocation of spirits; where upon they beginning to
appear and rise up, seemingly out of the earth, upon the sight of
Samuel’s countenance, she cryed out to Saul, and turning her face
towards him, spoke to him. Now that Saul hitherto saw nothing,
though in the same room, might be either because the body of the
woman was interposed betwixt his eyes and them, or the vehicles of
those spirits were not yet attempered to that conspissation that they
would strike the eyes of Saul, tho’ they did of the witch. And that
some may see an object, others not seeing it, you have an instance in
the child upon Walker’s shoulders, appearing to Mr. Fairhair, and it
may be to the judge, but invisible to the rest of the Court; and many
such examples there are. But I proceed to verse 14.
“‘And he said unto her, what form is he of? and she said, an old
man cometh up, and is covered with a mantle.’ He asks here in the
singular number, because, his mind was only fixt on Samuel. And the
woman’s answer is exactly according to what the spirit appeared to
her, when her eye was upon it, viz. ‫‘ איש זקן עלה‬an old man coming
up;’ for he was but coming up when she looked upon him, and
accordingly describes him: For ‫ עלה‬there, is a particle of the present
tense, and the woman describes Saul from his age, habit, and motion
he was in, while her eye was upon him. So that the genuine and
grammatical sense in this answer to ‘what form is he of?’ is this, an
old man coming up, and the same covered with a mantle, this is his
form and condition I saw him in. Wherefore Saul being so much
concerned herein, either the woman or he changing their postures or
standings, or Samuel by this having sufficiently conspissated his
vehicle, and fitted it to Saul’s sight also, it follows in the text: ‘And
Saul perceived it was Samuel, and he stooped with his face to the
ground and bowed himself.’
“O the impudent profaneness and sottishness of perverse shufflers
and whifflers! that upon the hearing of this passage can have the face
to deny that Saul saw any thing, and meerly because the word
‘perceived’ is used, and not ‘saw,’ when the word ‘perceived,’ plainly
implies that he saw Samuel, and something more, namely, that by his
former familiar converse with him, he was assured it was he. So
exquisitely did he appear, and over-comingly to his senses, that he
could not but acknowledge (for so the Hebrew word ‫ ידע‬signifies)
that it was he, or else why did he stoop with his face to the very
ground to do him honour?
 “No, no, says J. Webster, he saw nothing himself, but stood
waiting like a drowned puppet (see of what a base rude spirit this
squire of hags is, to use such language of a prince in his distress,) in
another room to hear what would be the issue; for all that he
understood, was from her cunning and lying relations. That this
gallant of witches should dare to abuse a prince thus, and feign him
as much foolisher and sottisher in his intellectuals, as he was taller in
stature than the rest of the people, even by head and shoulders, and
merely forsooth, to secure his old wives from being so much as in a
capacity of ever being suspected for witches, is a thing extremely
coarse and intolerably sordid. And indeed, upon the consideration of
Saul’s being said to bow himself to Samuel, (which plainly implies,
that there was there a Samuel that was the object of his sight, and of
the reverence he made) his own heart misgives him in this mad
adventure, and he shifts off from thence to a conceit that it was a
confederate knave, that the woman of Endor turned out into the
room where Saul was, to act the part of Samuel, having first put on
him her own short cloak, which she used with her maund under her
arm to ride to fairs or markets in. To this countryslouch in the
woman’s mantle, must king Saul, stooping with his face to the very
ground, make his profound obeysance. What was a market-woman’s
cloak and Samuel’s mantle, which Josephus calls διπλοΐδα ἱερατικήν,
a ‘sacerdotal habit,’ so like one another? Or if not, how came this
woman, being so surpriz’d of a sudden, to provide herself of such a
sacerdotal habit to cloak her confederate knave in? Was Saul as well
a blind as a drowned puppet, that he could not discern so gross and
bold an impostor as this? Was it possible that he should not perceive
that it was not Samuel, when they came to confer together, as they
did? How could that confederate knave change his own face into the
same figure, look, and mien that Samuel had, which was exactly
known to Saul? How could he imitate his voice thus of a sudden, and
they discoursed a very considerable time together?
“Besides, knaves do not use to speak what things are true, but what
things are pleasing. And moreover, this woman of Endor, though a
Pythoness, yet she was of a very good nature and benign, which
Josephus takes notice of, and extols her mightily for it, and therefore
she could take no delight to lay further weight on the oppressed spirit
of distressed king Saul; which is another sign that this scene was
acted bonâ fide, and that there was no cozening in it. As also that it is
another, that she spoke so magnificently of what appeared to her,
that she saw Gods ascending. Could she then possibly adventure to
turn out a countryslouch with a maund-woman’s cloak to act the part
of so God-like and divine a personage of Samuel, who was Θεῷ τὴν
μορφὴν ὅμοιος, as the woman describes him in Josephus Antiq.
Judaic. lib. vii. c. 15, unto all which you may add, that the Scripture
itself, which was written by inspiration, says expressly, verse 20, that
it was Samuel. And the son of Sirach, chap xlvi. that Samuel himself
prophesied after his death, referring to this story of the woman of
Endor. But for our new inspired seers, or saints, S. Scot, S. Adie, and
if you will, S. Webster, sworn advocate of the witches, who thus
madly and boldly, against all sense and reason, against all antiquity,
all interpreters, and against the inspired scripture itself, will have no
Samuel in this scene, but a cunning confederate knave, whether the
inspired scripture, or these inblown buffoons, puffed up with nothing
but ignorance, vanity and stupid infidelity, are to be believed, let any
one judge.
“We come now to his other allegation, wherein we shall be brief,
we having exceeded the measure of a postscript already. ‘It was
neither Samuel’s soul,’ says he, ‘joined with his body, nor his soul out
of his body, nor the devil; and therefore it must be some confederate
knave suborned by that cunning, cheating quean of Endor.’ But I
briefly answer, it was the soul of Samuel himself; and that it is the
fruitfulness of the great ignorance of J. Webster in the sound
principles of theosophy and true divinity, that has enabled him to
heap together no less than ten arguments to disprove this assertion,
and all little to the purpose: so little indeed, that I think it little to the
purpose particularly to answer them, but shall hint only some few
truths which will rout the whole band of them.
“I say therefore that departed souls, as other spirits, have an
ἀυτεξούσιον in them, such as souls have in this life; and have both a
faculty and a right to move of themselves, provided there be no
express law against such or such a design to which their motion
tends.
“Again, that they have a power of appearing in their own personal
shapes to whom there is occasion, as Anne Walker’s soul did to the
miller; and that this being a faculty of theirs either natural or
acquirable, the doing so is no miracle. And,
 “Thirdly, That it was the strong piercing desire, and deep distress
and agony of mind in Saul, in his perplexed circumstances, and the
great compassion and goodness of spirit in the holy soul of Samuel,
that was the effectual magick that drew him to condescend to
converse with Saul in the woman’s house at Endor, as a keen sense of
justice and revenge made Anne Walker’s soul appear to the miller
with her five wounds in her head.
“The ridged and harsh severity that Webster fancies Samuel’s
ghost would have used against the woman, or sharp reproofs to Saul;
as for the latter, it is somewhat expressed in the text, and Saul had
his excuse in readiness, and the good soul of Samuel was sensible of
his perplexed condition. And as for the former, sith the soul of
Samuel might indeed have terrified the poor woman, and so
unhinging her, that she had been fit for nothing after it, but not
converted her, it is no wonder if he passed her by; goodness and
forbearance more befitting an holy angelical soul than bluster and
fury, such as is fancied by that rude goblin that actuates the body and
pen of Webster.
“As for departed souls, that they never have any care or regard to
any of their fellow souls here upon earth, is expressly against the
known example of that great soul, and universal pastor of all good
souls, who appeared to Stephen at his stoning, and to St. Paul before
his conversion, though then in his glorified body; which is a greater
condescension than this of the soul of Samuel, which was also to a
prince, upon whose shoulders lay the great affairs of the people of
Israel: To omit that other notable example of the angel Raphael so
called (from his office at that time, or from the angelical order he was
adopted into after his death) but was indeed the soul of Azarias, the
son of Ananias the Great, and of Tobit’s brethren, Tobit, v. 12. Nor
does that which occurs, Tob. xii. 15, at all clash with what we have
said, if rightly understood: for his saying, ‘I am Raphael one of the
seven holy angels which present the prayers of the saints, and which
go in and out before the glory of the holy one,’ in the Cabbalistical
sense signifies no more than thus, that he was one of the universal
society of the holy angels, (and a Raphael in the order of the
Raphaels) which minister to the saints, and reinforce the prayers of
good and holy men by joining thereto their own; and as they are
moved by God, minister to their necessities, unprayed to themselves,
which would be an abomination to them, but extreme prone to
second the petitions of holy sincere souls, and forward to engage in
the accomplishing of them, as a truly good man would sooner relieve
an indigent creature, over-hearing him making his moan to God in
prayer, than if he begged alms of himself, though he might do that
without sin. This Cabbalistical account, I think, is infinitely more
probable, than that Raphael told a downright lye to Tobit, in saying
he was the son of Ananias when he was not. And be it so, will J.
Webster say, what is all this to the purpose, when the book of Tobit is
apocryphal, and consequently of no authority? What of no authority?
Certainly of infinitely more authority than Mr. Wagstaff, Mr. Scot,
and Mr. Adie, that Mr. Webster so frequently and reverently quoteth.
“I but, will he farther add, these apparitions were made to good
and holy men, or to elect vessels; but King Saul was a wretched
reprobate. This is the third liberal badge of honour that this ill-bred
advocate of the witches has bestowed on a distressed prince. First, a
‘drowned puppet,’ p. 170, then a ‘distracted bedlam,’ in the same
page, which I passed by before; and now a ‘wretched reprobate.’ But
assuredly Saul was a brave prince and commander, as Josephus
justly describes him, and reprobate only in type, as Ismael and Esau;
which is a mystery it seems, that J. Webster was not aware of. And
therefore no such wonder that the soul of Samuel had such a
kindness for him, as to appear to him in the depth of his distress, to
settle his mind, by telling him plainly the upshot of the whole
business, that he should lose the battel, and he and his sons be slain,
that so he might give a specimen of the bravest valour that ever was
atchieved by any commander, in that he would not suffer his country
to be overrun by the enemy while he was alive without resistance;
but though he knew certainly he should fail of success, and he and
his sons dye in the fight, yet in so just and honourable a cause as the
defence of his crown and his country, would give the enemy battel in
the field, and sacrifice his own life for the safety of his people. Out of
the knowledge of which noble spirit in Saul, and his resolved valour
in this point, those words haply may come from Samuel, ‘To morrow
shalt thou and thy sons be with me,’ (as an auspicious insinuation of
their favourable reception into the other world,) in ‫סחיצחצדקימ‬, in
thalamo justorum, as Munster has noted out of the Rabbins.
 “Lastly, as for that weak imputation, that this opinion of its being
Samuel’s soul that appeared is Popish, that is very plebeianly and
idiotically spoken, as if every thing that the Popish party are for, were
Popish. We divide our zeal against so many things that we fancy
Popish, that we scarce reserve a just share of detestation against
what is truly so: Such as are that gross, rank and scandalous
impossibility of ‘transubstantiation,’ the various modes of fulsome
idolatry and lying impostures, the uncertainty of their loyalty to their
lawful sovereigns by their superstitious adhesion to the spiritual
tyranny of the Pope, and that barbarous and ferine cruelty against
those that are not either such fools as to be persuaded to believe such
things as they would obtrude upon men, or are not so false to God
and their own consciences, as knowing better, yet to profess them.
“As for that other opinion, that the greater part of the reformed
divines hold, that it was the devil that appeared in Samuel’s shape;
and though Grotius also seems to be inclined thereto, alleging that
passage of Porphyrius de abstinentia Animalium, where he
describes one kind of spirit to be Γένος ἀπατηλῆς φύσεως,
παντόμορφόν τε καὶ πολύτροπον, ὑποκρινόμενον καὶ θεοὺς καὶ
δαίμονας καὶ ψυχὰς τεθνηκότων. (which is, I confess, very
apposite to this story; nor do I doubt but that in many of these
necromantick apparitions, they are ludicrous spirits, not the souls of
the deceased that appear,) yet I am clear for the appearing of the soul
of Samuel in this story, from the reasons above alleged, and as clear
that in other necromancies, it may be the devil or such kind of
spirits, as Porphyrius above describes, ‘that change themselves into
omnifarious forms and shapes, and one while act the parts of
dæmons, another while of angels or gods, and another while of the
souls of the deceased.’ And I confess such a spirit as this might
personate Samuel here, for any thing Webster has alleged to the
contrary, for his arguments indeed are wonderfully weak and
wooden, as may be understood out of what I have hinted concerning
the former opinion, but I cannot further particularize now.
“For I have made my postscript much longer than my letter, before
I was aware; and I need not enlarge to you, who are so well versed in
these things already, and can by the quickness of your parts presently
collect the whole measures of Hercules by his foot, and sufficiently
understand by this time it is no rash censure of mine in my letter,
that Webster’s book is but a weak impertinent piece of work, the very
master-piece thereof being so weak and impertinent, and falling so
short of the scope he aims at, which was really to prove that there
was no such thing as a witch or wizard, that is not any mention
thereof in Scripture, by any name ‘of one that had more to do with
the devil, or the devil with him, than with other wicked men;’ that is
to say, of one who in virtue of covenant, either implicit or explicit,
did strange things by the help of evil spirits, but that ‘there are many
sorts of deceivers and impostures, and divers persons under a
passive delusion of melancholy and fancy,’ which is part of his very
title-page.
“Whereby he does plainly insinuate, that there is nothing but
couzenage or melancholy in the whole business of the fears of
witches. But a little to mitigate or smother the greatness of this false
assertion, he adds, ‘And that there is no corporeal league betwixt the
devil and the witch; and that he does not suck on the witches body,
nor has carnal copulation with her, nor the witches turned into dogs
or cats,’ &c. All which things as you may see in his book, he
understands in the grossest imaginable, as if the imps of witches had
mouths of flesh to suck them, and bodies of flesh to lie with them,
and at this rate he may understand a corporeal league, as if it were
no league or covenant, unless some lawyer drew the instrument, and
engrossed it in vellum or thick parchment, and there were so many
witnesses with the hand and seal of the party. Nor any
transformation into dogs or cats, unless it were real and corporeal, or
grossly carnal; which none of his witch-mongers, as he rudely and
slovenly calls that learned and serious person, Dr. Casaubon and the
rest, do believe. Only it is a disputable case of their bodily
transformation, betwixt bodinus and remigius; of which more in my
Scholia. But that without this carnal transmutation, a woman might
not be accounted a witch, is so foolish a supposition, that Webster
himself certainly must be ashamed of it.
“Wherefore if his book be writ only to prove there is no such thing
as a witch that covenants in parchment with the Devil by the advice
of a lawyer, and is really and carnally turned into a dog, cat, or hare,
&c. and with carnal lips sucked by the devil, and is one with whom
the devil lies carnally; the scope thereof is manifestly impertinent,
when neither Dr. Casaubon, nor any one else holds any such thing.
But as for the true and adequate notion of a witch or wizard, such as
at first I described, his arguments all of them are too weak and
impertinent, as to the disproving the existence of such a witch as
this, who betwixt his deceivers, impostors, and melancholists on one
hand, and those gross witches he describes on the other hand, goes
away sheer as a hair in a green balk betwixt two lands of corn, none
of his arguments reaching her, or getting the sight of her, himself in
the mean time standing on one side amongst the deceivers and
impostors, his book, as to the main design he drives at, being a meer
cheat and impostor.
“C. C. C. May, 25, 1678.”
 The Confessions of certain Scotch Witches,
taken out of an authentic copy of their trial
at the Assizes held at Paisley, in Scotland,
Feb. 15, 1678, touching the bewitching of Sir
George Maxwel.
The tenour of the confessions as taken before justices. As first of
Annabil Stuart, of the age of 14 years, or thereby; who declared that
she was brought in the presence of the justices for the crime of
witchcraft; and declared, that one harvest last, the devil, in the shape
of a black man, came to her mother’s house, and required the
declarant to give herself up to him; and that the devil promised her
she should not want any thing that was good.—Declares that she,
being enticed by her mother, Jennet Mathie, and Bessie Wen, who
was officer to their several meetings, she put her hand to the crown
of her head, and the other to the sole of her foot, and did give herself
up to the devil. Declares that her mother promised her a new coat for
doing it. Declares that her spirit’s name was Ennipa, and that the
devil took her by the hand and nipt her arm, which continued to be
sore for half an hour. Declares that the devil, in the shape of a black
man, lay with her in the bed, under the clothes, and that she found
him cold. Declares, that thereafter, he placed her nearest himself,
and declares she was present in her mother’s house when the effigy
of wax was made, and that it was made to represent Sir George
Maxwel. Declares, that the black man, Jannet Mathie, the declarant’s
mother, (whose spirit’s name was Lemdlady; Bessie Weir, whose
spirit’s name was Sopha; Margaret Craige, whose spirit’s name is
Regerum, and Margaret Jackson, whose spirit’s name is Locas) were
all present at the making of the said effigy; and that they bound it on
a spit, and turned it before the fire; and that it was turned by Bessie
Weir, saying, as they turned it, Sir George Maxwel, Sir George
Maxwel, and that this was expressed by all of them, and by the
declarant. Declares that this picture was made in October last. And
further declares that upon the third day of January instant, Bessie
Weir came to her mother’s house, and advertised her to come to her
brother John Stuart’s upon the night following; and that accordingly
she came to the place, where she found Bessie Weir, Margery Craige,
Margaret Jackson, and her brother John Stuart, and a man with
black cloaths, and a blue band, and white handcuffs, with hogers,
and that his feet were cloven: that declarant sat down by the fire with
them when they made a picture of clay, in which they placed pins in
the breasts and sides; that they placed one in every side, and one in
the breast; that the black man did put the pins in the picture of wax;
but is not sure who put the pins in the picture of clay; that the effigies
produced are those she saw made; that the black man’s name is
Ejsal.
This declaration was emitted before James Dunlop, of Husil, and
William Gremlage, &c. Jan. 27, 1677, ita est Robertus Park,
Notarius Publicus.
“The second confession is of John Stuart, who being interrogate
anent the crime of witchcraft, declared that upon Wednesday, the
third day of January instant, Bessie Weir, in Pollocton, came to the
declarant late at night, who being without doors near to his own
house, the said Bessie Weir did intimate to him that there was a
meeting to be at his house, the next day; and that the devil under the
shape of a black man, Margaret Jackson, Margery Craige, and the
said Bessie Weir were to be present; and that Bessie Weir required
declarant to be there, which he promised; and that the next night,
after declarant had gone to bed, the black man came in, and called
the declarant quietly by his name, upon which he arose from his bed,
put on his clothes and lighted a candle. Declare, that Margaret
Jackson, Bessie Weir, and Margery Craige, did enter in at a window
in the cavil of declarant’s house; and that the first thing the black
man required, was, that the declarant should renounce his baptism,
and deliver himself wholly to him; which the declarant did, by
putting one hand on the crown of his head, and the other on the sole
of his foot; and that he was tempted to it by the devil promising him
that he should not want any pleasure, and that he should get his
heart filled on all that should do him wrong. Declares, that he gave
him the name of Jonat for his spirit’s name; that thereafter the devil
required every one of their consents for the making of the effigies of
clay, for the taking away the life of Sir George Maxwel, of Pollock, to
revenge the taking of declarant’s mother, Jannet Mathie, that every
one of the persons above named, gave their consent to the making of
the said effigy, and that they wrought the clay; that the black man did
make the figure of the head and face, and two arms, to the said
effigy; that the devil set three pins in the same, on one each side and
one in the breast; and that the declarant did hold the candle to them,
all the time the picture was making. And that he observed one of the
black man’s feet to be cloven—that his apparel was black—that he
had a blueish band and handcuffs—that he had hogers on his legs,
without shoes; and that the black man’s voice was hough and
goustie: and farther declares that after they had begun the framing of
the effigies, his sister, Annabil Stuart, a child of 13 or 14 years of age,
came knocking at the door, and being let in by the declarant, she
staid with them a considerable time, but that she went away before
the rest, he having opened the door for her—that the rest went out at
the window at which they entered—that the effigies was placed by
Bessie Weir in his bed-straw. He farther declares he himself did envy
against Sir George Maxwel, for apprehending Jannet Mathie, his
mother; and that Bessie Weir had great malice against this Sir
George Maxwel, and that her quarrel was, as the declarant conceived,
because the said Sir George had not entered her husband to his
harvest service; also that the said effigies was made upon the fourth
day of January instant, and that the devil’s name was Ejoal; that
declarant’s spirit’s name was Jonas, and Bessie Weir’s spirit’s name,
who was officer, was Sopha; and that Margaret Jackson’s spirit’s
name was Locas; and that Annabil Stuart’s spirit’s name, the
declarant’s sister, was Enippa; but does not remember what
Margery Craige’s spirit’s name was. Declares that he cannot write.
This confession was emitted in the presence of the witnesses to the
other confession, and on the same day.—Ita est. Robertus Park,
Notarius Publicus.
The next confession is that of Margaret, relict of Thomas Shaws,
who being examined by the justices, anent her being guilty of
witchcraft, declares that she was present at the making of the first
effigies and picture that were made in Jannet Mathie’s house, in
October; and that the devil, in the shape of a black man, Jannet
Mathie, Bessie Weir, Margery Craige, and Annabil Stuart, were
present at the making of them, and that they were made to represent
Sir George Maxwel, of Pollock, for the taking away his life. Declares,
that 40 years ago, or thereabout, she was at Pollockshaw Croft, with
some few sticks on her back, that the black man came to her, and
that she did give up herself unto him, from the top of her head to the
sole of her foot; and that this was after declarant had renounced her
baptism, and that the spirit’s name which he designed her was Locas:
and that about the third or fourth of January instant, or thereby, in
the night-time, when she awaked, she found a man to be in bed with
her, whom she supposed to be her husband, though her husband had
been dead twenty years or thereby, and that the said man
immediately disappeared; that this man who disappeared was the
devil. Declares, that upon Thursday the fourth of January instant,
she was present in the house of John Stuart, at night, when the
effigies of clay was made, and that she saw the black man there,
sometimes sitting, sometimes standing with John Stuart; and that
the black man’s cloaths were black, and that he had white handcuffs;
and that Bessie Weir, in Pollocton, and Annabil Stuart, in Shaws, and
Margery Craigie, were at the aforesaid time and place at making the
said effigies of clay; and declares that she gave her consent to the
making of the same, and that the devil’s name who compeered in the
black man’s shape was Ejoll.
Sic Subscribitur, ita est, Robertus Park, Notatius Publicus, &c.
 Then follows the depositions of certain
persons, agreeing with confessions of the
above-said witches.
“Andr. Martin, Servitour to the Lord of Pollock, of the age of thirty
years, or thereby, deposes, that he was present in the house of Jannet
Mathie, Pannel, when the picture of wax produced was found in a
little hole in the wall at the back of the fire—that Sir George, his
sickness did fall upon him about the eighteenth of October, or
thereby—that the picture of wax was found on the —— of December,
and that Sir George his sickness did abate and relent about the time
the picture of wax was found and discovered in Jannet Mathie’s
house—that the pins were placed in the right and left sides; and that
Sir George Maxwel, of Pollock, his pains, lay most in his right and left
sides. Depones, that Sir George’s pains did abate and relent after the
finding of the said picture of wax, and taking out the pins as is said—
that the pannel, Jannet Mathie, has been by fame and bruite a
reputed witch these several years past. And this is the truth, as he
shall answer to God.—Sic Subscribitur, Andr. Martin.”
“Lawrence Pollock, Secretary to the Lord of Pollock, sworn and
purged of partial counsel, depones that on the —— day of December
he was in the Pannel Jannet Mathie’s house when the picture was
found; and that he did not see it before it was brought to the Pannel’s
door—that Sir George Maxwel of Pollock’s sickness did seize upon
him about the 14th of October, or thereabouts, and he did continue
in his sickness or distemper for six weeks, or thereby—that Sir
George’s sickness did abate and relent after the finding of the said
picture of wax, and taking out of the pins that were in the effigies—
that by open bruit and common fame, Jannet Mathie, and Bessie
Weir, and Margery Craige, are brandit to be witches. Depones, that
the truth is this, as he shall answer to God.—Sic Subscrib. Lawrence
Pollock.”
“Lodawic’ Stuart, of Auckenhead, being sworn and purged of
partial counsel, depones, that Sir George’s sickness fell upon him the
14th or 13th day of October—that he was not present at the finding of
the picture of wax; but that he had seen Sir George Maxwel, of
Pollock, after it was found; and having seen him in his sickness
oftentimes before, he did perceive that Sir George had sensibly
recovered after the time that the said picture was said to have been
found, which was upon the 11th or 12th of December—that Jannet
Mathie and Margery Craigie, two of the Pannel, are by report of the
country said to be witches—that he having come to Pollock, he did
see Sir George Maxwel, whose pains did recur, and that his pains and
torments were greatly increased in respect of what they were before
the finding of the picture of wax—that upon the eighth of January,
when they left the said Sir George Maxwel, of Pollock, the deponent
James Dunlop, of Housil, Allan Douglass, and several others, did go
to the house of John Stuart, Warlock, on Pollockshaw, and there he
found a picture of clay in the said John Stuart’s bed-straw—that
there were three pins in the said picture of clay, and that there was
one on each side, and one in the breast—and further depones, that
being returned to Sir George’s house, Sir George told the deponent
that he found great ease of his pains, and that it was before the
deponent Hounsil, and the rest, did reveal to him that they had
found the said picture of clay, and further, that this is the truth, as he
shall answer to God.—Sic. Subscrib. Lodowick Stuart.”

There are more depositions of a similar nature whence these were

extracted, but these are enough to discover that the confession of
those witches are neither fables nor dreams. It belongs us, therefore,
in this enlightened age, when superstition has fled before the rays of
science and the influence of religion, to account for the then
prevalent notion, which appears so far to be authenticated, of the
existence of witches. It is not enough to say that people are
barbarous, ignorant, or unenlightened, to exculpate them from
charges involving such strong points as supernatural with human
agency. In this stage of investigation, nothing is more natural than to
ask, did witches ever exist? Yes.—Upon what authority? Sacred Writ.
—Are there such beings as witches now? We hear of none.—Then the
last grand question, to which a secret of some importance is attached
—What has become of them? have they vanished into viewless air,
without leaving a wreck behind; or are they consigned to the “bottom
of the bottomless pit?” Of this we may say something hereafter; while
in the meantime we lay before our readers