Chapter 2

Sankalp Bharat
Biological Classification

1. Which of the following statements is (d) Mitochondria are the powerhouse of the
correct? (2021) cell in all kingdoms except Monera
(a) Fusion of protosplams between two 7. After karyogamy followed by meiosis, spores
motile or non-motile gemeters is called are produced exogenously in (2018)
paslmogamy. (a) Neurospora
(b) Organisms that depend on living plants (b) Alternaria
are called saprophytes. (c) Agaricus
(c) Some of the organisms can fix (d) Saccharomyces
atmospheric nitrogen in specialized cells 8. Oxygen is not produced during
called sheath cells. photosynthesis by (2018)
(d) Fusion of two cells is called Karyogamy. (a) Nostoc
2. Which of the following is correct about (b) Green sulphur bacteria
viroids? (2020) (c) Cycas
(a) They have free RNA without protein coat. (d) Chara
(b) They have DNA with protein coat. 9. Which of the following organisms are known
(c) They have free DNA without protein coat. as chief producers in the oceans? (2018)
(d) They have RNA with protein coat. (a) Dinoflagellates

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
3. Which of the following is incorrect about (b) Diatoms
Cyanobacteria? (2020 Covid Re-NEET) (c) Cyanobacteria
(a) They lack heterocysts (d) Euglenoids
(b) They often form blooms in polluted water 10. Ciliates differ from all other protozoans in
bodies (2018)
(c) They have chlorophyll ‘a’ similar to green (a) Using flagella for locomotion
plants (b) Having a contractile vacuole for
(d) They are photoautotrophs removing excess water
4. Which of the following statement is (c) Using pseudopodia for capturing prey
incorrect? (2019) (d) Having two types of nuclei
(a) Viroids lack a protein coat.
(b) Viruses are obligate parasites. 11. Which of the following are found in extreme
(c) Infective constituent in viruses is the saline conditions? (2017)
protein coat. (a) Archaebacteria
(d) Prions consist of abnormally folded (b) Eubacteria
proteins. (c) Cyanobacteria
5. Which of the following statements is (d) Mycobacteria
incorrect? (2019) 12. Which among the following are the smallest
(a) Morels and truffles are edible delicacies. living cells, known without a definite cell
(b) Claviceps is a source of many alkaloids wall, pathogenic to plants as well as
and LSD. animals and can survive without oxygen?
(c) Conidia are produced exogenously and (2017)
Ascospores endogenously. (a) Bacillus
(d) Yeasts have filamentous bodies with long (b) Pseudomonas
thread-like hyphae. (c) Mycoplasma
6. Select the wrong statement (2018) (d) Nostoc
(a) Cell wall is present in members of Fungi
and Plantae 13. Viroids differ from viruses in having: (2017)
(b) Mushrooms belong to Basidiomycetes (a) DNA molecules with protein coat
(c) Pseudopodia are locomotory and feeding (b) DNA molecules without protein coat
structures in Sporozoans (c) RNA molecules with protein coat
387 CHANNEL
JOIN TELEGRAM
 (d) RNA molecules without protein coat (b) Thermoacidophiles
14. An example of flagellate protozoan is: (c) Methanogens
(2017) (d) Eubacteria
(a) Paramoecium 22. Chrysophytes, Euglenoids, Dinoflagellates
(b) Trypanosoma and Slime moulds are included in the
(c) Entamoeba kingdom: (2016 - I)
(d) Plasmodium (a) Animalia
15. Which of the following is not true of (b) Monera
organisms in the kingdom Monera? (2017) (c) Protista
(a) They originated at least 3.5 billion years (d) Fungi
ago 23. Which one of the following statements is
(b) They have prokaryotic cellular wrong? (2016 - I)
organisation (a) Cyanobacteria are also called blue-green
(c) They may be autotrophic or algae
heterotrophic in nature (b) Golden algae are also called desmids
(d) They reproduce by mitosis (c) Eubacteria are also called false bacteria
16. Select the sac fungus: (2017) (d) Phycomycetes are also called algal fungi
(a) Albugo 24. One of the major components of cell wall of
(b) Agaricus most fungi is: (2016 - I)
(c) Neurospora (a) Chitin
(d) Mucor (b) Peptidoglycan
17. The protein coat around a virus is called: (c) Cellulose
(2017) (d) Hemicellulose

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) Capsule 25. Which of the following statements is wrong
(b) Core for viroids? (2016 - I)
(c) Capsid (a) They lack a protein coat
(d) Trichome (b) They are smaller than viruses
18. Select the wrong statement: (2016 - II) (c) They causes infections
(a) Diatoms are chief producers in the (d) Their RNA is of high molecular weight
oceans 26. Which one of the following matches is
(b) Diatoms are microscopic and float correct? (2015)
passively in water (a) Mucor Reproductio Ascomyce
(c) The walls of diatoms are easily n tes
destructible
(d) ‘Diatomaceous earth’ is formed by the by
cell wall of diatoms. Conjugation
19. Methanogens belong to: (2016 - II) (b) Agaricus Parasitic Basidiom
(a) Dinoflagellates ycetes
fungus
(b) Slime moulds
(c) Phytopht Aseptate Basidiom
(c) Eubacteria
hora ycetes
(d) Archaebacteria mycelium
20. Which one of the following is wrong for Alternari Deuterom
(d) Sexual
fungi? (2016 - II) a ycetes
(a) They are heterotrophic reproductio
(b) They are both unicellular and n
multicellular absent
(c) They are eukaryotic
(d) All fungi possess a purely cellulosic cell 27. The gut of cow and buffalo possess: (2015)
Wall (a) Methanogens
21. The primitive prokaryotes responsible for (b) Cyanobacteria
the production of biogas from the dung of (c) Fucus
ruminant animals, include the: (2016 - I) (d) Chlorella
(a) Halophiles

388 CHANNEL
JOIN TELEGRAM
28. True nucleus is absent in: (2015) (c) Nuclear membrane is present in Monera
(a) Vaucheria (d) Cell wall is absent in Animalia
(b) Volvox 36. Viruses have: (2014)
(c) Anabaena (a) Both DNA and RNA
(d) Mucor (b) DNA enclosed in a protein coat
29. Choose the wrong statements: (2015 Re) (c) Prokaryotic nucleus
(a) Neurospora is used in the study of (d) Single chromosome
biochemical genetics 37. Which one of the following living organisms
(b) Morels and truffles are poisonous completely lacks a cell wall? (2014)
mushrooms (a) Blue - green algae
(c) Yeast is unicellular and useful in (b) Cyanobacteria
fermentation (c) Sea - fan (Gorgonia)
(d) Penicillium is multicellular and (d) Saccharomyces
produces antibiotics 38. A location with luxuriant growth of lichens
30. In which group of organisms the cell walls on the trees indicates that the: (2014)
form two thin overlapping shells which fit (a) Location is not polluted
together? (2015 Re) (b) Trees are very healthy
(a) Euglenoids (c) Trees are heavily infested
(b) Dinoflagellates (d) Location is highly polluted
(c) Slime moulds 39. Five kingdom system of classification
(d) Chrysophytes suggested by R.H. Whittaker is not based on
31. Which of the following are most suitable (2014)
indicators of SO2 pollution in the (a) Complexity of body organisation

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
environment? (2015 Re) (b) Presence or absence of a well defined
(a) Conifers nucleus
(b) Algae (c) Mode of reproduction
(c) Fungi (d) Mode of nutrition
(d) Lichens 40. Which one of the following fungi contains
32. Cell wall is absent in: (2015 Re) hallucinogens? (2014)
(a) Funaria (a) Ustilago sp.
(b) Mycoplasma (b) Morchella esculenta
(c) Nostoc (c) Amanita muscaria
(d) Aspergillus (d) Neurospora sp.
33. Select the wrong statements: (2015 Re) 41. Archaebacteria differ from Eubacteria in:
(a) W.M. Stanley showed that viruses could (2014)
be crystallised (a) Mode of reproduction
(b) The term ‘Contagium vivum fluidum’ (b) Cell membrane structure
was coined by M.W. Beijerinek (c) Mode of nutrition
(c) Mosaic disease in tobacco and AIDS in (d) Cell shape
human being are caused by viruses 42. Which of the following shows coiled RNA
(d) The viroids were discovered by D.J. strand and capsomeres? (2014)
Ivanowsky (a) Retrovirus
34. The imperfect fungi which are decomposer (b) Polio virus
of litter and help in mineral cycling belong (c) Tobacco mosaic virus
to: (2015 Re) (d) Measles virus
(a) Basidiomycetes 43. Pigment-containing membranous
(b) Phycomycetes extensions in some cyanobacteria are:
(c) Ascomycetes (2013)
(d) Deuteromycetes (a) Chromatophores
35. Pick up the wrong statement: (2015 Re) (b) Heterocyst’s
(a) Protista has photosynthetic and (c) Basal bodies
heterotrophic modes of nutrition (d) Pneumatophores
(b) Some fungi are edible

389 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (a) S23. Ans. (c)

S2. Ans. (a) S24. Ans. (a)

S3. Ans. (a) S25. Ans. (d)

S4. Ans. (c) S26. Ans. (d)

S5. Ans. (d) S27. Ans. (a)

S6. Ans. (c) S28. Ans. (c)

S7. Ans. (c) S29. Ans. (b)

S8. Ans. (b) S30. Ans. (d)

S9. Ans. (b) S31. Ans. (d)

S10. Ans. (d) S32. Ans. (d)

S11. Ans. (a) S33. Ans. (d)

S12. Ans. (c) S34. Ans. (d)

S13. Ans. (d) S35. Ans. (c)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (b) S36. Ans. (d)

S15. Ans. (d) S37. Ans. (c)

S16. Ans. (c) S38. Ans. (a)

S17. Ans. (c) S39. Ans. (b)

S18. Ans. (c) S40. Ans. (c)

S19. Ans. (d) S41. Ans. (b)

S20. Ans. (d) S42. Ans. (c)

S21. Ans. (c) S43. Ans. (a)

S22. Ans. (c)

390 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(a)
Fusion of protoplams between two
motile or non- motile gameters is
called paslmogamy.
S2. Ans.(a)
Viroid is a new infectious agent that
was smaller than viruses and caused
potato spindle tuber disease. It
was found to be a free RNA and it
lacked the protein coat.
S3. Ans.(a)
Cyanobacteria (also referred to as
blue-green algae) have chlorophyll a
similar to green plants and are
photosynthetic autotrophs. Some of
these organisms can fix atmospheric
nitrogen in specialised cells called
heterocysts, e.g., Nostoc and
Anabaena
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S4. Ans.(c)
Infective constituent in viruses is the
genetic material either DNA or RNA,
not protein.
S5. Ans.(d)
Yeast is an unicellular sac fungus. It
lacks filamentous structure or
hyphae.
S6. Ans.(c)
Protozoans like sporozoa have no
movement and they do not possess
pseudopods, flagella or cilia.
S7. Ans.(c)
In Agaricus, the basidiospores (or
meiotic spores) are produced on
probasidial cells exogenously or
externally.
S8. Ans.(b)
Green sulphur bacteria perform
anoxygenic photosynthesis. They
mainly use sulfide ions as electron
donors.
S9. Ans.(b)
Diatoms are the most common
phytoplankton in the ocean. They
utilise inorganic nutrients to form
391 CHANNEL
JOIN TELEGRAM
proteins, fats and provide food for
various sea creatures.
S10. Ans.(d)
Ciliates contain two types of nuclei –
somatic macronucleus and germline
micronucleus.
S11. Ans.(a)
Archaebacteria are special since they
live in some of the most harsh
habitats such as extreme salty areas
(Halophiles), hot springs
(Thermoacidophiles) and marshy
areas (Methanogens).
S12. Ans.(c)
Mycoplasmas are organisms without a
cell wall. They are the smallest living
cells known. They can survive without
oxygen. Many are pathogenic in
animals and plants.
S13. Ans.(d)
Viroids are sub-viral agents as
infectious RNA particles, without
protein coat.
S14. Ans.(b)
Flagellated protozoans: They are
either free-living or parasitic. They
have flagella. The parasitic forms
cause diseases such as sleeping
sickness. E.g., Trypanosoma.
S15. Ans.(d)
Bacteria reproduce mainly by fission.
S16. Ans.(c)
Ascomycetes are commonly known as
sac-fungi, the ascomycetes are mostly
multicellular, e.g., Penicillium,
Claviceps and Neurospora.
S17. Ans.(c)
The protein coat of virus is called
capsid; made of small subunits called
capsomeres, protects the nucleic acid.
S18. Ans.(c)
The walls of diatoms are embedded
with silica and thus the walls are
indestructible.
S19. Ans.(d)
 Methanogens belong to Phytophthora Septate mycelium
Archaebacteria and are present in the
gut of several ruminant animals such Alternaria Absence of sexual
reproduction
as cows and buffaloes and they are
responsible for the production of (Deuteromycetes)
methane (biogas) from the dung of
these animals.
S27. Ans.(a)
S20. Ans.(d)
Some of the methanogens
The cell walls of fungi are composed of
(archaebacteria) live as symbionts
chitin and polysaccharides. The green
(e.g., Methanobacterium) inside
plants had a cellulosic cell wall.
rumen of cow, buffaloes and helpful to
S21. Ans.(c) the ruminants in fermentation of
Methanogens are present in the gut of cellulose.
several ruminant animals such as S28. Ans.(c)
cows and buffaloes and they are
Vaucheria and Volvox are eukaryotes
responsible for the production of
(Plant kingdom) while Mucor is a
methane (biogas) from the dung of
fungi (phycomycetes) and eukaryote
these animals.
but Anabaena is a prokaryote.
S22. Ans.(c)
Prokaryotes lack nucleus.
All single-celled eukaryotes are placed
S29. Ans.(b)
under Protista. Chrysophytes,

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Euglenoids, Dinoflagellates and Slime Many members of Ascomycetes like
morels and truffles are edible and are
moulds are included in the kingdom
considered delicacies.
Protista.
S30. Ans.(d)
S23. Ans.(c)
Chrysophytes: Groups under Protista
Eubacteria are also known as true
includes diatoms and Golden algae
bacteria. They are characterised by
(desmids). They are found in fresh as
the presence of a rigid cell wall, and
well as marine environments in
if motile, a flagellum. diatoms. The cell wall form two thin
S24. Ans.(a) overlapping shells which fit together
The cell walls of fungi are composed of like soap box.
chitin (N-acetyl glucosamine) and S31. Ans.(d)
polysaccharides. Lichens serve as indicator of air
S25. Ans.(d) pollution, as they are very sensitive to
In 1971, T.O. Diener discovered a new air pollution, especially SO2 pollution.
infectious agent that was smaller than S32. Ans.(b)
viruses and caused potato spindle Mycoplasma are organisms that
tuber disease. It was found to be a completely lack cell wall.
free RNA; it lacked the protein coat
They are the smallest living cells
that is found in viruses, hence the
known and can survive without
name viroid. The RNA of the viroid is
oxygen.
of low molecular weight.
S33. Ans.(d)
S26. Ans.(d)
In 1971, T.O Diener discovered a new
Mucor Phycomycetes
infectious agent namely viroid which
Agaricus Non - parasitic is smaller than virus.
fungus

392 CHANNEL
JOIN TELEGRAM
S34. Ans.(d)
Deuteromycetes is an artificial class of
fungi which includes all those fungi in
which sexual stage is not known.
They are commonly known as
imperfect fungi.
S35. Ans.(c)
Animal cells do not have cell wall.
Agaricus (mushroom) is an edible
fungi. Prokaryotic cells lack nuclear
membrane envelope.
S36. Ans.(b)
Genetic material of virus is enclosed
by the protein coat.
S37. Ans.(c)
Sea fan (Gorgonia) belongs to kingdom
- Animalia, as it is a animal so it lacks
cell wall. BGA (Blue Green Algae),
cyanobacteria and Saccharomyces
have cell wall.
S39. Ans.(b)
Main criteria for classification used by
R.H. Whittakar includes cell
structure, thallus organization, mode
of nutrition, reproduction and
phylogenetic relationship.
S40. Ans.(c)
Amanita muscaria has hallucinogenic
property.
S41. Ans.(b)
Archaebacteria differ from other
bateria in having a different cell wall
structure.
S42. Ans.(c)
S43. Ans.(a)
Chroma (coloured/pigmented) +
phores (cells). These are light -
reflecting, pigment containing cells or
group of cells. In cyanobacteria,
chlorophyll a is present but unlike
plants, these chlorophylls are found

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S38. Ans.(a)
in chromatophores instead of cell
Lichens are good air pollution organelle chloroplast.
indicator.

393 CHANNEL
JOIN TELEGRAM
 Chapter 3
Sankalp Bharat
Plant Kingdom

1. Identify the pair of heterosporous (b) Phaeophyceae and Rhodophyceae

pteridophytes among the following : (2023) (c) Chlorophyces and Rhodophycea
(a) Equisetum and Salvinia (d) Rhodophyceae and Phaeophycea
(b) Lycopodium and Selaginella 6. Colostrum, the yellowish fluid, secreted by
(c) Selaginella and Salvia mother during the initial days of lactation is
(d) Psilotum and Salvinia very essential to impart immunity to the
2. Assertion A:- The first stage of gametophyte new born infants because it contains (2022)
in the life cycle of moss is protonema stage. List – I List – II
Reason R :- Protonema develops directly Chlamydomonas (i) Moss
from spores produced in capsule. (2023) a
(a) A is not correct but R is correct. b Cycas (ii) Pteridophyte
(b) Both A and R are correct and R is the c Selaginella (iii) Alga
correct explanation of A
(c) Both A and R are correct but R is NOT d Sphagnum (iv) Gymnosperm

the correct explanation of A Choose the correct answer from the options
(d) A is correct but R is not correct given below
3. Assertion A :- In gymnosperm the pollen (a) (a)-(ii), (b)-(ii), (c)-(i), (d)-(iv)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
grains are released from the (b) (a)-(iii), (b)-(i), (c)-(ii), (d)-(iv)
microsporanigium and carried by air (c) (a)-(iii), (b)-(iv), (c)-(ii), (d)- (i)
currents. (d) (a)-(iii), (b)-(ii), (c)-(1), (d) (iv)
Reason R :- Air currents carry that pollen 7. Read the following statements and identify
grains to the mouth of the archegonia where the characters related to the alga shown in
the male gametes are discharged and pollen the diagram: (2022)
tube is not formed. (2023)
(a) A is false but R is true
(b) Both A and R are true and R is the
correct explanation of A
(c) Both A and R are true but R is NOT the
currect explanation of A
(d) A is the true but R is false
4. Match List - I with List - II. (2023)
List – I List – II

A Pteropsida (i) Psilotum

(a) It is a member of Chlorophyceae
B Lycopsida (ii) Equisetum
Psilpsida (iii) Adiantum (b) Food is stored in the form of starch
C
D Sphenopsida (iv) Selaginella (c) It is monoecious plant showing
Choose the correct answer from the options oogonium and antheridium
given below:
(d) Food is stored in the form of laminarin
(a) (A)-(II), (B)-(III), (C)-(I), (D)-(IV)
(b) (A)-(III), (B)-(1), (C)-(IV), (D)-(II) or mannitol
(c) (A)-(II), (B)-(III), (C)-(IV), (D)-(I)
(d) (A)-(III), (B)-(IV), (C)-(1), (D)-(II) (e) It shows dominance of pigments
5. Which classes of algae possess pigment Chlorophyll a, c and Fucoxanthin
fucoxanthin and pigment phycoerythrin,
respectively? (Manipur 2023) Choose the correct answer from the options
(a) Phaeophyceae and Chlorophyceae given below:

394 CHANNEL
JOIN TELEGRAM
 (a) (c), (d) and (e) only (b) Red algae
(b) (a), and (b) only (c) Blue-green algae
(c) (a), (b) and (c) only (d) Green algae
(d) (a), (c) and (d) only 12. Genera like Selaginella and Salvinia
8. Hydrocolloid carrageen is obtained form: produce two kinds of spores. Such plants
(2022) are known as: (2021)
(a) Chlorophyceae and Phaeophyceae (a) Heterosorus
(b) Phaeophyceae and Rhodophyceae (b) Homosporous
(c) Rhodophyceae only (c) Heterosporous
(d) Phaeophyceae only (d) Homosorus
9. Which of the following is incorrectly 13. Which of the following algae contains
matched? (2022) mannitol as reserve food material? (2021)
(a) Ectocarpus-Fucoxanthin (a) Gracilaria
(b) Ulothrix-Mannitol (b) Volvox
(c) Porphyra-Floridian Starch (c) Ulothrix
(d) Volvox-Starch (d) Ectocarpus
10. Match the plant with the kind of life cycle it 14. Gemmae are present in: (2021)
exhibits: (2022) (a) Pteriodophytes
List – I LIst – II (b) Some Gymnosperms
Spirogyra (i) Dominant diploid (c) Some Liverworts
A (d) Mosses
sporophyte
vascular plant, 15. Which of the following pairs is of unicellular
algae? (2020)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
with highly
reduced male or (a) Gelidium and Gracilaria
female (b) Anabaena and Volvox
gametophyte (c) Chlorella and Spirulina
(d) Laminaria and Sargassum
B Fern (ii) Dominant haploid 16. Floridean starch has structure similar to:
free-living (2020)
qametophyte (a) Amylopectin and glycogen
C Funaria (iii) Dominant diploid (b) Mannitol and algin
sporophyte (c) Laminarin and cellulose
alternating with (d) Starch cellulose
reduced 17. Strobili or cones are found in: (2020)
gametophyte (a) Pteris
called prothallus (b) Marchantia
(c) Equisetum
D Cycas (iv) Dominant haploid
(d) Salvinia
leafy gametophyte
alternating with 18. Male and female gametophytes do not have
partially an independent free living existence in:
dependent (2020 Covid Re-NEET)
multicellular (a) Algae
sporophyte (b) Angiosperms
(c) Bryophytes
Choose the correct answer from the options (d) Pteridophytes
given below: 19. Phycoerythrin is the major pigment in:
(a) (a)-(iv), (b)-(i), (c)-(ii), (d)-(iii) (2020 Covid Re-NEET)
(b) (a)-(ii), (b)-(i), (c)-(iv), (d)-(i) (a) Blue green algae
(c) (a)-(iii), (b)-(iv), (c)-(i), (d)-(ii) (b) Green algae
(d) (a)-(ii), (b)-(iv), (c)-(i), (d)-(iii) (c) Brown algae
11. Which of the following algae produce (d) Red algae
Carrageen? (2021)
(a) Brown algae

395 CHANNEL
JOIN TELEGRAM
20. Which of the following statements is (c) Salvinia – Heterosporous
incorrect about gymnosperms? (d) Equisetum – Homosporous
(2020 Covid Re-NEET) 28. Life cycle of Ectocarpus and Fucus
(a) Male and female gametophytes are free respectively are: (2017)
living (a) Haplontic, Diplontic
(b) Most of them have narrow leaves with (b) Diplontic, Haplodiplontic
thick cuticle (c) Haplo-diplontic, Diplontic
(c) Their seeds are not covered (d) Haplo-diplontic, Haplontic
(d) They are heterosporous 29. Zygotic meiosis is characteristic of: (2017)
21. From evolutionary point of view, retention of (a) Marchantia
the female gametophyte with developing (b) Fucus
young embryo on the parent sporophyte for (c) Funaria
some time, is first observed in (2019) (d) Chlamydomonas
(a) Liverworts 30. An example of colonial alga is (2017)
(b) Mosses (a) Chlorella
(c) Pteridophytes (b) Volvox
(d) Gymnosperms (c) Ulothrix
22. Pinus seed cannot germinate and (d) Spirogyra
established without fungal association. This 31. Identify and select the wrong statement out
is because : (2019) of the following: (2017)
(a) Its embryo is immature. (a) In conifers the needle like leaves are well
(b) It has obligate association with adapted to extremes of temperature,
mycorrhizae. moisture conservation and onslaught of

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) It has very hard seed coat. wind
(d) Its seeds contain inhibitors that prevent (b) Roots of pines enter into a symbiotic
germination. relationship with higher fungi
23. Which of the following statement is correct? (c) The coralloid roots in Cycas have
(2018) nitrogen fixing cyanobacteria
(a) Ovules are not enclosed by ovary wall in (d) The giant redwood tree Sequoia, one of
gymnosperms the tallest trees in an angiosperm.
(b) Selaginella is heterosporous, while 32. What is not true for an angiospermic
Salvinia is homosporous embryo sac? (2017)
(c) Horsetails are gymnosperms (a) One male gamete is discharged into it
(d) Stems are usually unbranched in both during ferilisation
Cycas and Cedrus (b) It is present within an ovule
24. Which one is wrongly matched? (2018) (c) It represents female gametophyte
(a) Uniflagellate gametes - Polysiphonia (d) Its formation is preceded by meiosis
(b) Biflagellate zoospores - Brown algae 33. Which one of the following statements is
(c) Gemma cups - Marchantia wrong? (2016 - II)
(d) Unicellular organism – Chlorella (a) Agar-agar is obtained from Gelidium and
25. Winged pollen grains are present in (2018) Gracilaria
(a) Mustard (b) Laminaria and Sargassum are used as
(b) Cycas food
(c) Mango (c) Algae increase the level of dissolved
(d) Pinus oxygen in the immediate environment
26. Double fertilisation is exhibited by (2017) (d) Algin is obtained from red algae, and
(a) Gymnosperms carrageen from brown algae.
(b) Algae 34. Conifers are adapted to tolerate extreme
(c) Fungi environmental conditions because of:
(d) Angiosperms (2016 - II)
27. Select the mismatch: (2017) (a) Thick cuticle
(a) Pinus – Dioecious (b) Presence of vessels
(b) Cycas – Dioecious (c) Broad hardy leaves

396 CHANNEL
JOIN TELEGRAM
 (d) Superficial stomata C. Sexual reproduction in Fucus, Volvox
35. Select the correct statement (2016 - I) and Albugo is oogamous
(a) Gymnosperms are both homosporous D. The sporophyte in liverworts is more
and heterosporous elaborate than that in mosses
(b) Salvinia, Ginkgo and Pinus all are E. Both Pinus and Marchantia are
gymnosperms dioecious.
(c) Sequoia is one of the tallest trees How many of the above statements are
(d) The leaves of gymnosperms are not well correct?
adapted to extremes of climate (a) Four
36. Which one is wrong statement? (2015) (b) One
(a) Mucor has biflagellate zoospores (c) Two
(b) Haploid endosperm is typical feature of (d) Three
gymnosperms 39. Isogamous condition with non-flagellated
(c) Brown algae have chlorophyll a and c gametes is found in: (2013)
and fucoxanthin (a) Fucus
(d) Archegonia are found in Bryophyta, (b) Chlamydomonas
Pteridophyta and Gymnosperms. (c) Spirogyra
(d) Volvox
37. Male gametes are flagellated in: (2015)
40. Select the wrong statement: (2013)
(a) Ectocarpus
(a) Chlamydomonas exhibits both isogamy
(b) Spirogyra
and anisogamy and Fucus shows
(c) Polysiphonia
oogamy
(d) Anabaena
(b) Isogametes are similar in structure,

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
38. Read the following statements (A-E) and
function and behaviour
answer the question which follows them:
(c) Anisogametes differ either in structure,
(2013)
function or behaviour
A. In liverworts, mosses, and ferns
(d) In oogamous reproduction, female
gametophytes are free-living
gamete is smaller and motile, while male
B. Gymnosperms and some ferns are
gamete is larger and non motile
Heterosporous

397 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (c) S21. Ans. (c)

S2. Ans. (b) S22. Ans. (b)

S3. Ans. (d) S23. Ans. (a)

S4. Ans. (d) S24. Ans. (a)

S5. Ans. (b) S25. Ans. (d)

S6. Ans. (c) S26. Ans. (d)

S7. Ans. (c) S27. Ans. (a)

S8. Ans. (c) S28. Ans. (c)

S9. Ans. (b) S29. Ans. (d)

S10. Ans. (b) S30. Ans. (b)

S11. Ans. (d) S31. Ans. (d)

S12. Ans. (c) S32. Ans. (a)

S13. Ans. (d) S33. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (c) S34. Ans. (a)

S15. Ans. (c) S35. Ans. (c)

S16. Ans. (a) S36. Ans. (a)

S17. Ans. (c) S37. Ans. (a)

S18. Ans. (b) S38. Ans. (d)

S19. Ans. (d) S39. Ans. (c)

S20. Ans. (a) S40. Ans. (d)

398 CHANNEL
JOIN TELEGRAM

S1. Ans.(c)
Selaginella and Salvinia are Salvinia
are heterosporous pteridophytes. They
products two different king of spores
Psilotum. Lycopodium And Equisetum
are Homosporous pteridophytes.
S2. Ans.(b)
The predominant stage of the life cycle
of a moss is the gametophyte which
consists of two stages. The first stage
is the protonema stage, which
develops directly from a spore.
Capsule of the sporophyte contains
spore which gives rise to protonema.
Thus, reason correctly explains the
assertion.
S3. Ans.(b)
Assertion is correct but reason is false
as in gymnosperms the pollen grains
are released from the
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
microsporangium and they are carried
in air currents. They come in contact
with the opening of the ovules borne
on megasporophylls. The pollen tube
carrying the male gametes grows
towards archegonia in the ovules and
discharge their contents neat the
mouth of the archegonia.
S4. Ans.(d)
The correct answer is Option D:
(A)-(III), (B)-(IV), (C)-(1), (D)-(I)
S5. Ans.(b)
Phaeophyceae-brown or olive color to
the pigment fucoxanthin.
Rhodophyceae-pigment
phycoerythrin.
S6. Ans.(c)
Chlamydomonas is a unicellular alga.
Cycas is a gymnosperm. Selaginella is
a heterosporous pteridophyte and
Sphagnum is a moss.
S7. Ans.(C).
Explanation Alga shown in the
diagram is Chara. It is a member of
Chlorophyceae. Food is stored in the
form of starch.
399 CHANNEL
JOIN TELEGRAM
Solutions
Chara is monecious plant showing
oogonium and antheridium on the
same plant body.
S8. Ans.(c)
Hydrocolloids are water holding
substances for e.g. carrageen obtained
from red algae (Rhodophyceae).
S9. Ans.(b)
Ulothrix is a member of Chlorophyceae
(green algae), with reserve food
material, starch. Mannitol is stored
food material of Phaeophyceae (brown
algae).
S10. Ans.(b)
Spirogyra is an alga. It shows
haplontic life-cycle.
Fern is pteridophyte. The dominant
phase of life-cycle is diploid
sporophyte. Its gametophyte is called
prothallus.
Funaria is a bryophyte. Its
gametophyte is a leafy stage.
Cycas is a gymnosperm. The main
plant body in gymnosperm is
sporophyte. They have highly reduced
gametophyte stage.
S11. Ans.(b)
Carrageen is produced by red algae.
S12. Ans.(c)
The megaspores and microspores
germinate and give rise to female and
male gametophytes, respectively.
r- S13. Ans.(d)
Ectocarpus (brown algae) has
mannitol as reserve food material.
S14. Ans.(c)
Gemmae are present in some
liverworts like Marchantia.
S15. Ans.(c)
Spirulina and chlorella are unicellular
algae.
S16. Ans.(a)
The food element floridean starch is
preserved in red algae. Its structure is
 extremely similar to that of
amylopectin.
S17. Ans.(c)
Sporophylls are compactly arranged
in Equisetum.
S18. Ans.(b)
Male and female gymnosperms and
angiosperm. Female gametophytes
lack a self-contained reproductive
system.
S19. Ans.(d)
Rhodophyceae members are
frequently referred to as red algae.
They contain r-phycoerythrin, a red
pigment.
S20. Ans.(a)
Plants with ovules are known as
gymnosperms. They are not
surrounded by any ovary wall and are
hence exposed. The male and female
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
gametophytes of gymnosperms not
have a self-sufficient, free-living
existence.
S21. Ans.(c)
The female gametophyte with the
developing young embryo is retained
on the sporophyte plant body, for
a variable period of time in
Pteridophytes.
S22. Ans.(b)
Minerals are increased by fungus
linked with Pinus rootsby boosting the
plant’s surface area and water
absorption.
Plants provide nourishment for the
fungus, which in turn provides food
for the fungus. Therefore, For
Pinus seed, mycorrhizal connection is
required.
S23. Ans.(a)
Ovules in gymnosperms are bare, that
is, they have no protective covering.
S24. Ans.(a)
Anisogamy, or uneven gametes, is
seen in Polysiphonia.
400 CHANNEL
JOIN TELEGRAM
S25. Ans.(d)
Pinus pollen grains are extremely
buoyant due to presence of sacs, they
float in the fluid. As a result,
winged Pinus pollen grains are a
distinctive feature.
S26. Ans.(d)
The event of double fertilisation is
unique to flowering plants.
S27. Ans.(a)
Pinus is a monoecious plant, meaning
it has both male and female flowers.
S28. Ans.(c)
Polysiphonia, and Ectocarpus are
some of the algal genera. Haplo-
diplontic kelps are a type of kelp.
Fucus is a diplontic alga.
S29. Ans.(d)
• Meiosis in the zygote results in the
haplontic life cycle.
• The production of haploid spores.
The haploid spores divide into two
types.
• The gametophyte is formed through
mitosis.
• In such plants, the photosynthetic
phase is the free- living phase. Algae
like Volvox, Spirogyra, and others
certain Chlamydomonas specie.
S30. Ans.(b)
Algae come in a wide range of shapes
and sizes. They consists of
microscopic unicellular organisms
such as Chlamydomonas, Volvox, and
other colonial forms. Ulothrix and
Spirogyra are filamentous forms.
S31. Ans.(d)
Sequoia, the redwood tree, is a
gymnosperm.
S32. Ans.(a)
The female gametophyte is found
within the ovule of angiosperms.
Pollen is a male gamete is found in
the tube inserted into the embryo-sac,
which contains two male gametes.
S33. Ans.(d) S37. Ans.(a)
Large amounts of brown and red algae Pyriform (pear-shaped) gametes have
are produced by certain marine brown two chromosomes. Flagella in
and red algae. phaeophyceae with laterally attached
Algin (brown algae) and carrageen (red flagella (Brown algae). For example
algae) are two examples. Ectocarpus, Dictyota, Laminaria, and
S34. Ans.(a) Sargassum.
• The needle-like leaves of conifers S38. Ans.(d)
minimise the surface area. Statements D and E both are false.
• Their thick cuticle and recessed Male or female cones, sometimes
known as strobili, can be found.
stomata also aid in the reduction of
water loss. Pinus as a result, in the instance of
monoecious.
S35. Ans.(c)
Moss has a more complex sporophyte
• Sequoia, a large redwood tree, is a
than other
gymnosperm.
plants.
One of the tallest tree species on the
S39. Ans.(c)
planet.
Spirogyra: Non-motile gametes
• Gymnosperms include Cycas, Pinus,
Volvox: motile / ♀ non-motile
and Ginkgo.

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Fucus: motile / ♀ non-motile
• Gymnosperms are heterosporous,
S40. Ans.(d)
meaning they produce spores.
The female has a considerable size in
• Microspores and megaspores are oogamous reproduction.
Haploid microspores and
megaspores, respectively.
• Gymnosperm leaves are well-
adapted to tolerate harsh conditions.
S36. Ans.(a)
Mucor spores (also known as
sporangiospores) can be simple or
complex.
The sporangia are branched and
produce apical,
spherical sporangia that are
supported by the
columella is shaped like a column.

401 CHANNEL
JOIN TELEGRAM
 Chapter 4
Sankalp Bharat
Animal Kingdom

1. Match List-I with List-II. (2023) 5. Which of the following animals has three
List -I List – II chambered heart? (2022)
Contractile (I) Astenas (a) Pteropus
(A) (b) Scoliodon
vacuole
Water (II) Amoeba (c) Hippocampus
(B) (d) Chelone
vascular
system 6. Match List-I with List-II (2022)
Lits -I List -II
(C) Canal system (III) Spongilla
Flame cells (IV) Taenia (A) Chlamydomonas I Conidia
(D)
(B) Penicillium II Zoospores

Choose the correct answer from the options (C) Hydra III Gemmules
given below : (D) Sponge IV Buds
(a) A-IV, B-II, c-I, D-III
Choose the correct answer from the options
(b) A-I, B-IIII, C-II, D-IV
given below :
(c) A-III, B-II, C-I, D-IV
(a) A-IV, B-III, C-II, D-I
(d) A-II, B-I, C-III, D-IV

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) A-I, B-IV, C-III, D-II
2. Radial symmetry is NOT found in adults of
(c) A-II, B-I, C-IV, D-III
phylum ______. (2023)
(d) A-III, B-ii, C-I, D-IV
(a) Hemichordata
7. Select the incorrect statements with respect
(b) Coelenterata
to Cyclostomes: (2022)
(c) Echinodermata
(A) They lack scales and paired fins.
(d) Ctenophora
(B) They have circular mouth with jaws.
3. Select the correct statements with reference
(C) They bear 6-15 pairs of gills.
to chordates.
(D) They migrate to deep sea for spawning.
A. Presence of a mid-dorsal, solid and
Choose the most appropriate answer from
double nerve cord.
the options given below:
B. Presence of closed circulatory system.
(a) (a) and (d) only
C. Presence of paired pharyngeal gill slits.
(b) (a) and (b) only
D. Presence of dorsal heart
(c) (b) and (c) only
E. Triploblastic pseudocoelomate animals.
(d) (b) and (d) only
Choose the correct answer from the options
8. Exoskeleton of arthropods is composed of:
given below:
(2022)
(a) B and C only
(a) Cutin
(b) B, D and E only
(b) Cellulose
(c) C, D and E only
(c) Chitin
(d) A, C and D only
(d) Glucosamine
4. The unique mammalian characteristics are:
9. Assertion (A) : All vertebrates are chordates
(2023)
but all chordates are not vertebrates.
(a) Hairs, pinna and mammary glands
Reason (R) : Notochord is replaced by
(b) Hairs, pinna and indirect development
vertebral column in the adult vertebrates.
(c) Pinna, monocondylic skull and
(2022)
mammary glands
(a) Both A and R are correct and R is the
(d) Hairs, tympanic membrane and
correct explanation of A
mammary glands
(b) Both A and R are correct but R is not
the correct explanation of A

402 CHANNEL
JOIN TELEGRAM
 (c) A is the correct but R is not correct (a) In urochordata, notochord extends from
(d) A is not correct but R is correct. head to tail and it is present throughout
10. Match List-I with List-II (2021) their life
List-I List-II (b) In vertebrata, notochord is present
Metamerism (i) Coelenterata during the embryonic period only
A. (c) Central nervous system is dorsal and
B. Canal system (ii) Ctenophora hollow
C. Comb plates (iii) Annelida (d) Chordata is divided into 3 subphyla:
Cnidoblasts (iv) Porifera Hemichordata, Tunicata and
D. Cephalochordata
Choose the correct answer from the options 15. Bilaterally symmetrical and acoelomate
given below animals are exemplified by (2020)
(a) A-(iii) B-(iv) C-(i) D-(ii) (a) Platyhelminthes
(b) A-(ii) B-(iv) C-(ii) D-(i) (b) Aschelminthes
(c) A-(iv) B-(i) C-(ii) D-(iii) (c) Annelida
(d) A-(iv) B-(iii) C-(i) D-(ii) (d) Ctenophora
11. Which one of the following organisms bears 16. Match the following columns and select the
hollow and pneumatic long bones? (2021) correct option (2020)
(a) Hemidactylus Column I Column II
(b) Macropus
(1) 6 - 15 pairs of (i) Trygon
(c) Ornithorhynchus
gill slits
(d) Neophron
(2) Heterocercal (ii) Cyclostomesr
12. Match the following (2021)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
caudal fin
List-I List-II
(3) Air bladder (iii) Chondrichthyes
A. Physalia (i) Pearl oyster
(4) Poison sting (iv) Osteichthyes
B. Limulus (ii) Portuguese
Man of War (1) (2) (3) (4)
(a) (iii) (iv) (i) (ii)
C. Ancylostoma (iii) Living fossil
(b) (iv) (ii) (iii) (i)
D. Pinctada (iv) Hookworm (c) (i) (iv) (iii) (ii)
(d) (ii) (iii) (iv) (i)
(a) A-(iv) B-(i) C-(iii) D-(ii)
17. Match the following columns and select the
(b) A-(ii) B-(iii) C-(iv) D-(i)
correct option (2020)
(c) A-(i) B-(iv) C-(iii) D-(ii)
Column I Column II
(d) A-(ii) B-(iii) C-(i) D-(iv)
13. Read the following statements (2021) (1) Gregarious, (i) Asterias
A. Metagenesis is observed in helminths polyphagous
B. Echinoderms are triploblastic and pest
coelomate animals (2) Adult with radial (ii) Scorpion
C. Round worms have organ-system level of symmetry and
Body organisation
larva with
D. Comb plates present in ctenophores help
bilateral
in digestion
symmetry
E. Water vascular system is a characteristic
(3) Book lungs (iii) Ctenoplan
of echinoderms
a
Choose the correct answer from the options
given below (4) Bioluminescence (iv) Locusta
(a) A, B and C are correct
1 2 3 4
(b) A, D and E are correct
(a) (iv) (i) (ii) (iii)
(c) B, C and E are correct
(b) (iii) (ii) (i) (iv)
(d) C, D and E are correct
(c) (ii) (i) (iii) (iv)
14. Which of the following statements are true
(d) (i) (iii) (ii) (iv)
for the phylum-Chordata? (2020)

403 CHANNEL
JOIN TELEGRAM
18. Match the following columns and select the (d) Triploblastic, unsegmented body and
correct option (2020 Covid Re-NEET) bilaterally symmetrical
Column I Column II 21. All vertebrates are chordates but all
Aptenodytes (i) Flying fox chordates are not vertebrates, why? (
(1) 2020 Covid Re-NEET)
(2) Pteropus (ii) Angel fish (a) Ventral hollow nerve cord remains
(3) Pterophyllum (iii) Lamprey throughout life in some chordates
Petromyzon (iv) Penguin (b) All chordates possess vertebral column
(4) (c) All chordates possess notochord
(1) (2) (3) (4) throughout their life
(a) (iii) (iv) (i) (ii) (d) Notochord is replaced by vertebral
(b) (iv) (i) (ii) (iii) column in adult of some chordates
(c) (ii) (i) (iv) (iii) 22. Match the following organisms with their
(d) (iii) (iv) (ii) (i) respective characteristics (2019)
19. Match the following group of organisms A. Pila (i) Flame cells
with their respective distinctive
B. Bombyx (ii) Comb
characteristics and select the correct option
plates
(2020 Covid Re-NEET)
Organisms Characteristics C. Pleurobrachia (iii) Radula

Platyhelmi (i) D. Taenia (iv) Malpighian

(1) Cylindrical body
nthes tubules
with no
segmentation Select the correct option from the following

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Echinoder (ii) A B C D
(2) Warm blooded
ms (a) (iii) (ii) (i) (iv)
animals with
(b) (iii) (iv) (ii) (i)
direct
(c) (ii) (iv) (iii) (i)
development
(d) (iii) (ii) (iv) (i)
(3) Hemichord (iii) Bilateral 23. Consider following features
ates symmetry with A. Organ system level of organisation
B. Bilateral symmetry
incomplete
C. True coelomates with segmentation of
digestive
body
system Select the correct option of animal groups
(4) Aves (iv) Radial which possess all the above characteristics
symmetry with (2019)
indirect (a) Annelida, Arthropoda and Chordata
development (b) Annelida, Arthropoda and Mollusca
(c) Arthropoda, Mollusca and Chordata
(1) (2) (3) (4) (d) Annelida, Mollusca and Chordata
(a) (ii) (iii) (iv) (i) 24. Which of the following animal does not
(b) (iv) (i) (ii) (iii) undergo metamorphosis? (2018)
(c) (i) (ii) (iii) (iv) (a) Earthworm
(d) (iii) (iv) (i) (ii) (b) Tunicate
20. Which of the following option does correctly (c) Moth
represent the characteristic features of (d) Starfish
phylum Annelida? 25. Which one of these animals is not a
(2020 Covid Re-NEET) homeotherm? (2018)
(a) Triploblastic, segmented body and (a) Macropus
Bilaterally symmetrical (b) Chelone
(b) Triploblastic, flattened body and (c) Camelus
acoelomate condition (d) Psittacula
(c) Diploblastic, mostly marine and radially
symmetrical

404 CHANNEL
JOIN TELEGRAM
26. Identify the vertebrate group of animals (b) Respiratory - Cockroach,
characterised by crop and gizzard in its system
digestive system (2018) Tapeworm,
(a) Amphibia Starfish
(b) Reptilia (c) Bilateral - Hydra,
(c) Aves symmetry Tapeworm,
(d) Osteichthyes
Sea urchin
27. In case of poriferans, the spongocoel is lined
with flagellated cells called (2017) (d) Jointed - Prawn,
(a) Ostia appendages Centipede,
(b) Oscula
Grasshopper
(c) Choanocytes
(d) Mesenchymal cells 34. Choose the correct statement (2016 - II)
28. Which among these is the correct (a) All reptiles have a three–chambered
combination of aquatic mammals? (2017) heart
(a) Seals, Dolphins, Sharks (b) All pisces have gills covered by an
(b) Dolphins, Seals, Trygon operculum
(c) Whales, Dolphins, Seals (c) All mammals are viviparous
(d) Trygon, Whales, Seals (d) All cyclostomes do not possess jaws and
29. Which of the following represents order of paired fins
Horse? (2017) 35. Which one of the following characteristic is
(a) Equidae not shared by birds and mammals?
(b) Perissodactyla (2016 - I)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) Caballus (a) Ossified endoskeleton
(d) Ferus (b) Breathing using lungs
30. An important characteristic that (c) Viviparity
Hemichordates share with Chordates is (d) Warm blooded nature
(2017) 36. Which of the following characteristic
(a) Absence of notochord features always holds true for the
(b) Ventral tubular nerve cord corresponding group of animals? (2016 - I)
(c) Pharynx with gill slits (a) Cartilaginous - Chondrichthyes
(d) Pharynx without gill slits endoskeleton
31. Choose the false statement regarding (b) Viviparous - Mammalia
Petromyzon (2017)
(c) Possess a - Chordata
(a) The circulatory system is closed
mouth with
(b) The body is devoid of scales
an
(c) Mouth is circular and lacks jaws
(d) 3-chambered - Reptilia
(d) It migrates to the ocean for spawning
32. Which of the following symmetry is heart with
exhibited by echinoderm larvae? (2017) one
(a) Bilateral incompletely
(b) Radial divided
(c) Asymmetrical ventricle
(d) Biradial
33. Which of the following represents correct 37. Which is the national aquatic animal of
match of feature with the given set of India? (2016 - I)
animals? (2017) (a) Gangetic shark
(b) River dolphin
Feature Animals
(c) Blue whale
(a) Metameric - Earthworm, (d) Sea-horse
segmentation Leech,
Liver fluke

405 CHANNEL
JOIN TELEGRAM
38. Which of the following feature is not present 42. Which of the following endoparasites of
in the phylum-arthropoda? (2016 - I) humans does show viviparity? (2015)
(a) Chitinous exoskeleton (a) Trichinella spiralis
(b) Metameric segmentation (b) Ascaris lumbricoides
(c) Parapodia (c) Ancylostoma duodenale
(d) Jointed appendages (d) Enterobius vermicularis
39. Which of the following characteristics is 43. Body having mesh work of cell, internal
mainly responsible for diversification of cavities lined with food filtering flagellated
insects on land? (2015) cells and indirect development are the
(a) Exoskeleton characteristics of phylum (2015 Re)
(b) Eyes (a) Porifera
(c) Segmentation (b) Mollusca
(d) Bilateral symmetry (c) Protozoa
40. Which of the following animal is not (d) Coelenterate
viviparous? (2015) 44. A jawless fish, which lays eggs in freshwater
(a) Platypus and whose ammocoetes larvae after
(b) Whale metamorphosis return to the ocean is
(c) Flying fox (bat) (2015 Re)
(d) Elephant (a) Myxine
41. Which of the following represents the (b) Neomyxine
correct combination without any exception? (c) Petromyzon
(2015) (d) Eptatretus

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Characteristics Class 45. Metagenesis refers to

(a) Sucking and Cyclostomata (2015 Re)

circular mouth; (a) Alternation of generation between
jaws absent, asexual and sexual phases of organisms
integument (b) Occurrence of a drastic change in form
without during post- embryonic development
(c) Presence of a segmented body and
scales; paired parthenogenetic mode of reproduction
appendages (d) Presence of different morphic forms
(b) Body covered Aves 46. Planaria possess high capacity of (2014)
with feathers; (a) Bioluminescence
skin moist and (b) Metamorphosis
glandular; fore- (c) Regeneration
limbs (d) Alternation of generation
form wings; 47. Select the taxon mentioned that represents
lungs with air both marine and fresh water species (2014)
sacs (a) Cnidaria
Mammalia (b) Echinoderms
(c) Mammary
(c) Ctenophora
glands; hair on
(d) Cephalochordata
body;
48. A marine cartilaginous fish that can
pinnae; two pairs produce electric current is (2014)
of limbs (a) Scoliodon
(d) Mouth ventral; Chondrichyes (b) Pristis
gills without (c) Torpedo
(d) Trygon
operculum; skin
49. One of the representatives of phylum
with placoid
arthropoda is (2013)
scales, persistent (a) Flying fish
notochord (b) Cuttlefish
406 CHANNEL
JOIN TELEGRAM
 (c) Silverfish 51. Which of the following are correctly
(d) Pufferfish matched with respect to their taxonomic
50. Match the name of the animal (Column-I) classification? (2013)
with one characteristics (Column-II) and the (a) Spiny anteater, Sea urchin, sea
phylum/class (column-III) to which it cucumber – Echinodermata
belongs (2013) (b) Flying fish, cuttlefish, silverfish – Pisces
(c) Centipede, millipede, spider, scorpion –
Column-I Column-II Column-III Insecta
Adamsia Porifera (d) House fly, butterfly, tsetsefly, silverfish –
(a Radially Insecta
) symmetric 52. Which group of animals belongs to the same
al phylum? (2013)
(b Petromyzo Ectoparasi Cyclostoma (a) Sponge, Sea anemone, Starfish
) n te ta (b) Malarial parasite, Amoeba, Mosquito
Ichthyoph Terrestrial Reptilia (c) Earthworm, Pinworm, Tapeworm
(c
is (d) Prawn, Scorpion, Locusta
)
(d Limulus Body Pisces
) covered
by
chitinous
exoskeleto

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
n

407 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (d) S28. Ans. (c)

S2. Ans. (a) S29. Ans. (a)

S3. Ans. (a) S30. Ans. (c)

S4. Ans. (a) S31. Ans. (d)

S5. Ans. (d) S32. Ans. (a)

S6. Ans. (c) S33. Ans. (d)

S7. Ans. (d) S34. Ans. (d)

S8. Ans. (c) S35. Ans. (c)

S9. Ans. (a) S36. Ans. (a)

S10. Ans. (a) S37. Ans. (b)

S11. Ans. (d) S38. Ans. (c)

S!2. Ans. (b) S39. Ans. (a)

S13. Ans. (c) S40. Ans. (a)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (c) S41. Ans. (d)

S15. Ans. (a) S42. Ans. (a)

S16. Ans. (d) S43. Ans. (a)

S17. Ans. (a) S44. Ans. (c)

S18. Ans. (b) S45. Ans. (a)

S19. Ans. (d) S46. Ans. (c)

S20. Ans. (a) S47. Ans. (a)

S21. Ans. (d) S48. Ans. (c)

S22. Ans. (b) S49. Ans. (c)

S23. Ans. (a) S50. Ans. (b)

S24. Ans. (a) S51. Ans. (d)

S25. Ans. (b) S52. Ans. (d)

S26. Ans. (c)

S27. Ans. (c)

408 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(d)
(A) Contractile vacuoles are found in
single-celled organisms like Amoeba
(II). They help in osmoregulation by
expelling excess water out of the cell.
(B) A water vascular system is a
unique characteristic of echinoderms
such as Asterias (I), a genus of
starfish. This system is involved in
locomotion, feeding, respiration, and
excretion.
(C) The canal system is characteristic
of sponges such as Spongilla (III). It
aids in the circulation of water for
feeding, respiration, and excretion.
(D) Flame cells are part of the
excretory system in platyhelminthes
like Taenia (IV), commonly known as
tapeworm. These cells function in
osmoregulation and excretion.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S2. Ans.(a)
Radial symmetry is a type of
symmetry where an organism can be
divided into similar halves by more
than two planes passing through the
central axis. This type of symmetry is
found in organisms that tend to meet
their environment in all directions,
such as aquatic animals.
S3. Ans.(a)
Chordates are defined by having
certain specific anatomical features at
some point during their development.
The correct attributes of chordates
are:
1. Presence of a dorsal, hollow nerve
cord (not a mid-dorsal, solid and
double nerve cord as mentioned in
statement A)
2. Presence of a closed circulatory
system.
3. Presence of paired pharyngeal gill
slits.
4. Presence of a post-anal tail.
5. Presence of a notochord.
409 CHANNEL
JOIN TELEGRAM
S4. Ans.(a)
1. Hair or fur: Mammals are the only
animals that have hair. This hair
helps to insulate the body to maintain
a constant body temperature.
2. Mammary glands: These are glands
that, in females, produce milk for the
nourishment of young ones. This is a
characteristic feature of all mammals
and is, in fact, the feature that gives
this group its name.
3. The presence of pinnae (external
ears): Most mammals have pinnae
that help to collect and direct sound
waves into the ear.
S5. Ans.(d)
Only (d) is correct
S6. Ans.(d)
∙ Penicillium asexually reproduces by
conidia formation
∙ Chlamydomonas asexually
reproduces by zoospores Hydra
reproduces by budding whereas
sponges produce gemmules for
asexual reproduction
S7. Ans.(d)
Only (d) correct.
S8. Ans.(c)
Is the correct answer as chitin forms
the exoskeleton is arthropods and is
found in fungal cell wall. N-acetyl
glucosamine is the monomeric unit.
Cellulose is a polysaccharide. Cutin is
a derived lipid.
S9. Ans.(a)
Is the correct answer because all
chordates are divided into three
subphyla - Urochordata,
Cephalochordata and Vertebrata. In
subphylum Vertebrata, notochord is
replaced by bony or cartilaginous
vertebral column in adults. Therefore,
all vertebrates are chordates but all
chordates are not vertebrates.
S10. Ans.(a)
Metamerism-Annelida; Canal system-
Porifera; Comb Plates-Ctenophora;
Cnidoblasts- Coelen- terata
S11. Ans.(d)
Neophron (Aves) has hollow and
pneumatic bones.
S12. Ans.(b)
Physalia-Portuguese man of war;
Limulus-Living
Fossil; Ancylostoma-Hookworm;
Pinctada-Pearl oyster
S13. Ans.(c)
Echinodermata are triploblastic and
coelomate animal; Round worms have
organ system level; water vascular
system is a characterstics of
echinodermata
S14. Ans.(c)
• The notochord is exclusively found
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
in the larval tail of urochordata.
• The notochord in cephalochordata
stretches from head to tail and is
present throughout life.
• Vertebrata, Tunicata and
Cephalochordata are the three
subphyla of Chordata.
• Central nervous system (CNS) is
dorsal and hollow.
15. Ans.(a)
Platyhelminthes are organ-level
animals that are bilaterally
symmetrical, triploblastic and
acoelomate.
S16. Ans.(d)
• Cyclostomes have an extended body
with 6-15 pairs of respiration gill
slits.
• Air is found in the bones of fish
belonging to the class Osteichthyes.
• Air bladder controls buoyancy.
• The sting of Trygon, a cartilaginous
fish, is poisonous.
• The tail of chondrichthyes members
410 CHANNEL
JOIN TELEGRAM
is elongated with a heterocercal
caudal fin
S17. Ans.(a)
• Locusta is a polyphagous,
gregarious pest.
• Adult echinoderms (Asterias) have
Radial symmetry while larvae have
bilateral symmetry.
• Scorpions - Breathe via their book
lungs.
• Bioluminescence is a prominent
feature of ctenophores (Ctenoplana).
S18. Ans.(b)
• Petromyzon - Lamprey
• Pteropus - Flying fox
• Penguin- Aptenodytes
• Angel fish – Pterophyllum
S19. Ans.(d)
Platyhelminthes are organ-level
animals that are bilaterally
symmetrical, triploblastic and
acoelomate.
Echinoderm larvae are bilaterally
symmetrical, whereas adult
echinoderms are radially symmetrical.
The development of free-swimming
larva is indirect.
Hemichordates have a cylindrical
body with an anterior proboscis, a
collar and a lengthy trunk.
Aves are warm-blooded, direct-
development creatures.
S20. Ans.(a)
Annelida have bilateral symmetry and
organ-system level body organisation.
They are coelomate animals that are
triploblastic, metamerically
segmented.
S21. Ans.(d)
During the embryonic period,
members of the vertebrata subphylum
have a notochord. In adulthood,
the notochord is replaced by a
cartilaginous or bony vertebral
column. Thus, all vertebrates are
 chordates, but all chordates are not
vertebrates.
S22. Ans.(b)
• Pila is a type of mollusca. A file –
similar to rasping - is contained in
the mouth.
• The radula is a feeding organ.
• Bombyx is a symbiotic arthropoda.
Bombyx excretes through tubules
called malpighian tubules.
• Pleurobrachia is a ctenophore. Their
body has eight rows of ciliated comb
plates on the outside that aid in
movement.
• Taenia is a platyhelminth, a
parasitic worm. It contains
specialised cells known as flame
cells.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
• Osmoregulation and excretion are
aided by flame cells.
S23. Ans.(a)
The phyla Annelida, Arthropoda, and
Chordata all have true segmentation.
They are also true coelomates, with
organ system level of organisation,
bilateral symmetry.
S24. Ans.(a)
Annelids develop directly so,
earthworms do not have a larval
stage.
S25. Ans.(b)
Reptilians, like Chelone, are
poikilothermic, meaning their body
temperature fluctuates depending on
the climate.
S26. Ans.(c)
Food is swallowed by birds and stored
in their crop. The meal subsequently
goes through the stomach and into
the gizzard, where it might be ground
with previously eaten stones.
S27. Ans.(c)
Choanocytes (collar cells) line the
spongocoel (body cavity) and canals.
411 CHANNEL
JOIN TELEGRAM
S28. Ans.(c)
Sharks and sting rays belong to the
Chondrichthyes (cartilaginous fish)
class whereas whales, dolphins
and seals are aquatic mammals that
belong to the mammalia class.
S29. Ans.(a)
Horse – Equidae
S30. Ans.(c)
• Slits in the pharyngeal gills can be
found in both hemichordates and
chordates.
• Chordates are the only animals that
have a notochord.
• Non-chordates have a distinguishing
Feature called the ventral tubular
nerve cord.
S31. Ans.(d)
The circulation is closed. Cyclostomes
are marine creatures that travel to
fresh water to procreate.
They die within a few days of
spawning. After metamorphosis, their
larvae return to the sea.
S32. Ans.(a)
Adult echinoderms have radial
symmetry but their larvae have
bilateral symmetry.
S33. Ans.(d)
The appendages of the prawn,
centipede and grasshopper are joined.
S34. Ans.(d)
Cyclostomes have a sucking mouth
with a circular shape jaws. Scales are
missing from their bodies and they
have paired fins.
Except for crocodiles (4 chambered),
all reptiles have a three–chambered
heart.
Except for platypus, all mammals are
viviparous.
S35. Ans.(c)
Birds are oviparous, which means
they develop directly.
 Except for the oviparous
Ornithorhynchus, all mammals are
viviparous.
S36. Ans.(a)
Chondrichthyes are streamlined
marine organisms with a cartilaginous
endoskeleton.
Ornithorhynchus (Platypus)-
Oviparous-Mammal
S37. Ans.(b)
The river dolphin is India’s national
aquatic animal; it can only be found
in freshwater or brackish water.
S38. Ans.(c)
Except for parapodia, phylum-
arthropoda has all three traits.
Nereis (an Annelid) has lateral
appendages called parapodia that
help them swim.
S39. Ans.(a)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
The exoskeleton of arthropods which
contains chitin and
mucopolysaccrides, is one of their
most distinguishing features.
Arthropods’ success is linked to their
hard exoskeleton which serves as an
armour against predators and a
barrier against desiccation in a variety
of environments.
S40. Ans.(a)
Platypus (Ornithorhynchus) is an
oviparous mammal.
S41. Ans.(d)
Mouth ventral; gills without
operculum; skin with placoid scales,
persistent notochord are the features
of cartilaginous fishes.
S42. Ans.(a)
Trichinella spiralis is a human
endoparasitic worm that lives in the
intestine. It is a viviparous creature.
Trichinella spiralis causes a condition
known as trichinosis. Diarrhoea,
nausea, abdominal pain, muscular
pain and other symptoms can occur.
412 CHANNEL
JOIN TELEGRAM
S43. Ans.(a)
The skeleton of sponges is usually
made up of spicules (calcareous or
silicious) or spongin fibres.
The spongocoel, or paragastric cavity,
is shared by all sponges and is lined
by flagellated choanocytes.
S44. Ans.(c)
Jawless vertebrates belong to the
Cyclostomata class. They are
saltwater animals that travel to fresh
water to procreate. Petromyzon, for
example.
S45. Ans.(a)
Alternation of generation is seen in
several cnidarians that have both
polyp and medusa forms
(metagenesis).
S46. Ans.(c)
Planaria have a strong regeneration
capability.
S47. Ans.(a)
Ctenophora, Echinoderms, and
Cephalochordata are all marine
animals but cnidaria are both fresh
water and marine..
S48. Ans.(c)
Torpedo have electric organs that
generate electricity.
S49. Ans.(c)
The phylum arthropoda includes
silverfish.
S50. Ans.(b)
Petromyzon is an ectoparasite
belonging to the cyclostomata class.
S51. Ans.(d)
The housefly, butterfly, tsetse fly and
silverfish are all members of this
class.
Arthropoda is a phylum of arthropods
while Insecta is a class of insects.
S52. Ans.(d)
The phylum arthropods includes
prawns, scorpions and locusts.
 Chapter 5
Sankalp Bharat
Morphology of Flowering Plants

1. Family fabaceae differs from Solanaceae (b) Rhizome is a condensed form of stem
and Lilliaceae. With respect to the stamens, (c) The apical bud in rhizome always
Pick out the characteristics specific to remains above the ground
family Fabaceae but not found in (d) The rhizome is aerial with no distinct
Solanaceae or Liliaceae. nodes and internodes
(2023) 7. The type of tissue commonly found in the
(a) Epiphyllous and Dithecous anthers fruit wall of nuts is: (2022)
(b) Diadelphous and Dithecous anthers (a) Sclereid
(c) Polyadelphous and epipetalous stamens (b) Parenchyma
(d) Monoadelphous and Monothecocus (c) Collenchyma
anthers (d) Sclerenchyma
2. Axile placentation is observed in 8. Match List - I with List - II: (2022)
(2023) List – I List – II
(a) China rose, Petunia and Lemon Imbricate (i) Calotropis
(b) Mustard, cucumber and Primrose A
(c) China rose, Beans and Lupin B Valvate (ii) Cassia
(d) Tomato, Dianthus and pea C Vexillary (iii) Cotton

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
3. Assertion A :- A flower is defined as
modified shoot wherein the shoot apical D Twisted (iv) Bean

meristem changes to floral meristem.
Reason R :- Internode of the shoot gets
condensed to produce different floral
appendages laterally at successive node
instead of leaves. (2023)
(a) A is false but R is true
(b) Both A and R are true and R is the
correct explanation of A
(c) Both A and R true but R is NOT the
correct explanation of A
(d) A is true but R is false.
4. In Calotropis, aestivation is: (2023)
(a) Valvate
(b) Vexillary
(c) imbricate
(d) Twisted
5. In a pea flower, five petals are arranged in a
specialized manner with one posterior, two
lateral and two anterior. These are named
as and respectively. (2023)
(a) Keel Wings and Standard
(b) Vexillum, Keel and Standard
(c) Keel Standard and Canna
(d) Standard, Wings and Keel
6. Which of the following statement is not
correct? (2022)
(a) The rhizome is thick, prostrate and
branched
Choose the correct answer from the options
given below
(a) (a)-(i), (b)(iii), (c)-(iv), (d)-(ii)
(b) (a)-(ii), (b)-(i), (c) (iii), (d)-(iv)
(c) (a)-(i), (b)-(i), (c)-(iv), (d) - (iii)
(d) (a)-(ii), (b)-(iv), (c)-(iii), (d)-(i)
9. The Floral Diagram represents which one of
the following families? (2022)
(a) Liliaceae
(b) Fabaceae
(c) Brassicaceae
(d) Solanaceae
10. Identify the correct set of statements:
(a) The leaflets are modified into pointed
hard thorns in Citrus and Bougainvillea
(b) Axillary buds form slender and spirally
coiled tendrils in cucumber and
pumpkin
(c) Stem is flattened and fleshy in Opuntia
and modified to perform the function of
leaves

413 CHANNEL
JOIN TELEGRAM
 (d) Rhizophora shows vertically upward D. (iv) Sola
growing roots that help to get oxygen for nace
respiration ae
(e) Subaerially growing stems in grasses
and strawberry help in vegetative Select the correct answer from the options
propagation given below.
Choose the correct answer from the options (a) A-(i) B-(ii) C-(iii) D-(iv)
given below: (2022) (b) A-(ii) B-(iii) C-(iv) D-(i)
(a) (b) and (c) only (c) A-(iv) B-(ii) C-(i) D-(iii)
(b) (a) and (d) only (d) A-(iii) B-(iv) C-(ii) D-(i)
(c) (b), (c), (d) and (e) only 15. Ray florets have: (2020)
(d) (a), (b), (d) and (e) only (a) Superior ovary
11. Which one of the following plants shows (b) Hypogynous ovary
vexillary aestivation and diadelphous (c) Half inferior ovary
stamens? (2022) (d) Inferior ovary
(a) Colchicum autumnale 16. The roots that originate from the base of the
(b) Pisum sativum stem are: (2020)
(c) Allium cepa (a) Primary roots
(d) Solanum nigrum (b) Prop roots
12. The flowers are Zygomorphic in: (2022) (c) Lateral roots
(a) Mustard (d) Fibrous roots
(b) Gulmohar 17. The ovary is half inferior in: (2020)
(c) Cassia (a) Mustard

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) Datura (b) Sunflower
(e) Chilly (c) Plum
(a) (a), (b) and (c) only (d) Brinjal
(b) (b), (c) only 18. Correct position of floral parts over
(c) (d), (e) only thalamus in mustard plant is-
(d) (c), (d), (e) only (2020 Covid Re-NEET)
13. Which part of the fruit, labelled in the given (a) Margin of the thalamus grows upward,
figure makes it a false fruit? (2022) enclosing the ovary completely, and
other parts arise below the ovary
(b) Gynoecium is present in the centre and
other partscover it partially
(c) Gynoecium is situated in the centre, and
other parts of the flower are located at
the rim of the thalamus,at the same level
(d) Gynoecium occupies the highest
(a) A →Mesocarp position, while the other parts are
(b) B →Endocarp situated below it
(c) C →Thalamus 19. Which of the following is the correct floral
(d) D →Seed formula of Liliaceae?
14. Match Column-I with Column-II (2021) (2020 Covid Re-NEET)
Column I Column II (a)

A. (i) Bras
sicac
eae (b)
B. (ii) Lilia
ceae
(iii) Faba (c)
C.
ceae

414 CHANNEL
JOIN TELEGRAM
 (d) 27. The morphological nature of the edible part
of coconut is: (2017)
(a) Perisperm
(b) Cotyledon
(c) Endosperm
20. Identify the correct features of Mango and
(d) Pericarp
Coconut fruits. (2020 Covid Re-NEET)
28. Opposite type of phyllotaxy is not present
(i) In both fruit is a drupe
in: (2017)
(ii) Endocarp is edible in both
(a) Mango
(iii) Mesocarp in Coconut is fibrous, and in
(b) Guava
Mango it is fleshy
(c) Calotropis
(iv) In both, fruit develops from
(d) Mint
monocarpellary ovary
29. An inflorescence with younger flowers at the
Select the correct option from below:
base and the older one at its apex is known
(a) (i), (ii) and (iii) only
as: (2017)
(b) (i) and (iv) only
(a) Hypanthodium
(c) (i) and (ii) only
(b) Head
(d) (i), (iii) and (iv) only
(c) Racemose
21. Placentation in which ovules develop on the
(d) Cymose
inner wall of the ovary or in peripheral part,
30. Tetradynamous stamens are characteristic
is (2019)
of: (2017)
(a) Basal
(a) Brassicaceae
(b) Axile
(b) Solanaceae

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) Parietal
(c) Fabaceae
(d) Free central
(d) Liliaceae
22. Pneumatophores occur in (2018)
31. In roots, absorption of water and minerals
(a) Halophytes
mostly occurs in the: (2017)
(b) Free-floating hydrophytes
(a) Root cap
(c) Carnivorous plants
(b) Region of elongation
(d) Submerged hydrophytes
(c) Region of maturation
23. Sweet potato is a modified (2018)
(d) Meristematic region
(a) Stem
32. Free-central placentation is found in:
(b) Adventitious root
(2016 - II)
(c) Tap root
(a) Brassica
(d) Rhizome
(b) Citrus
24. Root hairs develop from the region of:
(c) Dianthus
(2017)
(d) Argemone
(a) Maturation
33. Radial symmetry is found in the flowers of:
(b) Elongation
(2016 - II)
(c) Root cap
(a) Pisum
(d) Meristematic activity
(b) Cassia
25. Coconut fruit is a: (2017)
(c) Brassica
(a) Drupe
(d) Trifolium
(b) Berry
34. How many plants among Indigofera,
(c) Nut
Sesbania, Salvia, Allium, Aloe, mustard,
(d) Capsule
groundnut, radish, gram and
26. In Bougainvillea, thorns are the
turnip have stamens with different lengths
modifications of: (2017)
in their flowers? (2016 - II)
(a) Stipules
(a) Five
(b) Adventitious root
(b) Six
(c) Stem
(c) Three
(d) Leaf
(d) Four

415 CHANNEL
JOIN TELEGRAM
35. The term ‘Polyadelphous’ is related to: 44. Flowers are unisexual in: (2015 Re)
(2016 - II) (a) Cucumber
(a) Corolla (b) China rose
(b) Calyx (c) Onion
(c) Gynoecium (d) Pea
(d) Androecium 45. Roots play insignificant role in absorption of
36. Stems modified into flat green organs water in: (2015 Re)
performing the functions of leaves are (a) Pistia
known as: (2016 - I) (b) Pea
(a) Cladodes (c) Wheat
(b) Phyllodes (d) Sunflower
(c) Phylloclades 46. Axile Placentation is present in: (2015 Re)
(d) Scales (a) Lemon
37. Which of the following is not a stem (b) Pea
modification? (2016 - I) (c) Argemone
(a) Pitcher of Nepenthes (d) Dianthus
(b) Thorns of Citrus 47. Among china rose, mustard, brinjal, potato,
(c) Tendrils of cucumber onion and tulip, how many plants have
(d) Flattened structures of Opuntia superior ovary? (2015 Re)
38. Tricarpellary, syncarpous gynoecium is (a) Six
found in flowers of: (2016 - I) (b) Three
(a) Liliaceae (c) Four
(b) Solanaceae (d) Five

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) Fabaceae 48. An aggregate fruit is one which develops
(d) Poaceae from: (2014)
39. The standard petal of a papilionaceous (a) Multicarpellary superior ovary
corolla is also called: (2016 - I) (b) Multicarpellary syncarpous gynoecium
(a) Carina (c) Multicarpellary apocarpus gynoecium
(b) Pappus (d) Complete inflorescence
(c) Vexillum 49. Which one of the following statements is
(d) Corona correct? (2014)
40. Leaves become modified into spines in: (a) A sterile pistil is called a staminode
(2015) (b) The seed in grasses is not endospermic
(a) Onion (c) Mango is a parthenocarpic fruit
(b) Silk Cotton (d) A proteinaceous aleurone layer is
(c) Opuntia present in maize grain
(d) Pea 50. When the margins of sepals or petals
41. Keel is the characteristic feature of flower of: overlap one another without any particular
(2015) direction, the condition is termed as:
(a) Aloe (2014)
(b) Tomato (a) Valvate
(c) Tulip (b) Vexillary
(d) Indigofera (c) Imbricate
42. Perigynous flowers are found in: (2015) (d) Twisted
(a) China rose 51. An example of edible underground stem is:
(b) Rose (2014)
(c) Guava (a) Potato
(d) Cucumber (b) Carrot
43. Ovary is inferior in: (2015) (c) Groundnut
(a) Guava (d) Sweet potato
(b) Rose 52. Placenta and pericarp are both edible
(c) China rose portions in: (2014)
(d) Peach (a) Potato

416 CHANNEL
JOIN TELEGRAM
 (b) Apple 54. Seed coat is not thin, membranous in:
(c) Banana (2013)
(d) Tomato (a) Gram
53. Among bitter gourd, mustard, brinjal, (b) Maize
pumpkin, china rose, Lupin, cucumber, (c) Coconut
sun hemp, gram, guava, bean,chili, plum, (d) Groundnut
Petunia, tomato, rose, Withania somnifera, 55. In China rose the flowers are: (2013)
potato, onion, Aloe and tulip how many (a) Zygomorphic, epigynous with twisted
plants have hypogynous flower? (2013) aestivation
(a) Eighteen (b) Actinomorphic, hypogynous with twisted
(b) Six aestivation
(c) Ten (c) Actinomorphic, epigynous with valvate
(d) Fifteen aestivation
(d) Zygomorphic, hypogynous with
imbricate aestivation

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

417 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (b) S29. Ans. (d)

S2. Ans. (a) S30. Ans. (a)

S3. Ans. (b) S31. Ans. (c)

S4. Ans.(a) S32. Ans. (c)

S5. Ans.(d) S33. Ans. (c)

S6. Ans.(d) S34. Ans. (d)

S7. Ans.(a) S35. Ans. (d)

S8. Ans.(c) S36. Ans. (c)

S9. Ans.(c) S37. Ans. (a)

S10. Ans.(c) S38. Ans. (a)

S11. Ans.(b) S39. Ans. (c)

S12. Ans.(b) S40. Ans. (c)

S13. Ans.(c) S41. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (d) S42. Ans. (b)

S15. Ans. (d) S43. Ans. (a)

S16. Ans. (d) S44. Ans. (a)

S17. Ans. (c) S45. Ans. (a)

S18. Ans. (d) S46. Ans. (a)

S19. Ans. (b) S47. Ans. (a)

S20. Ans. (d) S48. Ans. (c)

S21. Ans. (c) S49. Ans. (d)

S22. Ans. (a) S50. Ans. (c)

S23. Ans. (b) S51. Ans. (a)

S24. Ans. (a) S52. Ans. (d)

S25. Ans. (a) S53. Ans. (d)

S26. Ans. (c) S54. Ans. (c)

S27. Ans. (c) S55. Ans. (b)

S28. Ans. (a)

418 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(b) known as the standard' or 'banner. The
Fabaceae → Diadelphous and dithecous two lateral petals are referred to as
anther
'wings'. The two anterior petals are
Solanaceae → Polyandrous, epipetalous
usually fused at their edges and form a
and dithecous anther.
structure that looks like a boat's keel,
Liliaceae → Polyandrus, epiphyllous and
dithecocus anther. which is why they are called the 'keel. 50,

S2. Ans.(a) the arrangement is 'Standard, Wings and

China rose, Tomato, Petunia and Lemon Keel

show axile placentation.
S6. Ans.(d)
Dianthus and Primrose show free
Rhizome is an underground (sub-aerial)
central placentation. stem. It bears distinct nodes and
Pea, Lupin and Beans show marginal internodes.
placentation. S7. Ans.(a)
Cucumber and mustard show parietal The sclereids are the spherical, oval or
placentation.
cylindrical, highly thickened dead cells
S3. Ans.(a)
with very narrow cavities (lumen). These

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
The flower is a modified shoot where in
the shoot apical meristem changes to are found commonly in the fruit wall of
floral meristem. Internodes do not nuts.
elongate and the axis gets condensed.
S8. Ans.(c)
The apex produces different kinds of
floral appendages laterally at the Imbricate aestivation is found in Cassia
successive nodes instead of leaves.
Valvate aestivation is found in
Therefore, both A and R are true and R
Calotropis
is correct explanation of A.
S4. Ans.(a) Vexillary aestivation is found in Bean

When sepals or petals in a whorl just Twisted aestivation is found in cotton

touch one another at margin, without S9. Ans.(c)

overlapping, as in Calotropis, it is said to The floral diagram given in the question
be valvate. Imbricate aestivation is represents Brassicaceae family. It can be
exhibited by Cassia, Twisted aestivation easily identified by looking on its parietal
is exhibited by China rose, Vexillary placentation.
aestivation is exhibited by Pea.
S10. Ans.(c)
S5. Ans.(d)
Axillary buds of stems get modified into
In a typical pea flower, which is a type of woody, straight and pointed thorns.
papilionaceous flower, the petals are Thorns are found in many plants such as
arranged in a specific pattern. The single Citrus and Bougainvillea.
large posterior petal, often larger and
S11. Ans.(b)
more visually striking than the others, is

419 CHANNEL
JOIN TELEGRAM
 • Vexillary aestivation and diadelphous
stamens are the characteristic features
of family Fabaceae.
• Pisum sativum (garden pea) belongs to
family Fabaceae.
• Allium cepa (onion) and Colchicum
autumnale (colchicine) belong to family
Liliaceae.
• Solanum nigrum belongs
Solanaceae.
S12. Ans.(b)
When a flower can be divided into two
similar halves only in one particular
vertical plane, it is zygomorphic for e.g.
pea, gulmohar, bean, Cassia. Mustard,
Datura and Chilly show actinomorphic
flowers.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S13. Ans.(c)
The given figure is of a false unit. False
fruit develops from other floral parts
and thalamus along with the
development of ovary wall.
S14. Ans.(d)
A-(iii), B-(iv), C-(ii), D-(i)
S15. Ans.(d)
The thalamus margin develops upward
in epigynous flowers, entirely enclosing
and fusing with the ovary; the other
parts of the flower ascend above the
ovary. As a result, the ovary is
considered inferior. For example-
Sunflower ray florets.
S16. Ans.(d)
The primary root is replaced by a large
number of roots in several monocots.
The fibrous root system is made up
of roots that grow from the base of the
stem.
S17. Ans.(c)
The ovary lies at the centre of
perigynous flowers,while the other floral
elements are positioned on the
420 CHANNEL
JOIN TELEGRAM
thalamus' rim. The ovary is considered
to be half inferior in this case, as in
plum, rose, and peach.
S18. Ans.(d)
Mustard is an example of a hypogynous
flower, in which the gynoecium is at the
top and the rest of the flower is below it.
Such blooms are known to have
superior ovary.
to S19. Ans.(b)
Liliaceae The 'Lily family,' as it is more
often known, is a monocotyledonous
plant family.
S20. Ans.(d)
The fruit is known as a drupe in mango
and coconut. They are one seeded and
develop from monocarpellary superior
ovaries. An exterior thin epicarp, a
middle fleshy edible mesocarp, and an
inner stony hard endocarp distinguish
the mango pericarp. The mesocarp of
coconut, which is also a
drupe, is fibrous. Endosperm is the
edible component
of the coconut.
S21. Ans.(c)
The ovules develop on the inner wall of
the ovary or in the peripheral region of
the ovary in parietal placentation.
Mustard, Argemone, and so on.
S22. Ans.(a)
Halophytes are found in high-salinity
environments such as mangrove
swamps, marshes, and sloughs, as
well as along seashores. To compensate
for the absence of soil aeration,
halophytes grow pneumatophores, a
form of
negatively geotropic root (breathing
roots).
S23. Ans.(b)
Sweet potato has modified lateral or
adventitious roots.
S24. Ans.(a)
These are very fine, delicate thread-like
structures created by epidermal cells in
the maturation region, which is located
behind the elongation region. Water
and minerals from the soil are absorbed
by them.
S25. Ans.(a)
A drupe is a type of coconut fruit.
S26. Ans.(c)
Thorns are harsh, pointed straight
constructions for
protection. These are stems that have
been altered.
S27. Ans.(c)
Drupe is the name given to the coconut
fruit. The endosperm is represented
with tender milk. The edible coconut
flesh is formed as the cellular layers
of endosperm are deposited along the
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
walls as development occurs.
S28. Ans.(a)
At each node, a pair of leaves emerges
and lies opposite each other. For
example Calotropis, guava, and mint.
S29. Ans.(d)
The main axis of a cymose inflorescence
stops in a flower, limiting its expansion.
The blooms bloom in a basipetal
pattern. Flowers that are younger are
found near the base, while those that
are older are found at the top.
S30. Ans.(a)
Mustard has six free stamens, the inner
four of which are huge and the outside
two of which are little.
S31. Ans.(c)
Some epidermal cells develop root hairs,
which are very tiny and delicate thread-
like structures that emerge from the
maturation zone. The soil's water
and minerals are absorbed by these root
hairs.
S32. Ans.(c)
The placentation is called free central
when the ovules are borne on the
421 CHANNEL
JOIN TELEGRAM
central axis and the septa are missing,
as in Dianthus and Primrose.
S33. Ans.(c)
Mustard (Brassica), Datura, and chilli
are all actinomorphic (Radial symmetry)
flowers that may be divided into two
equal radial halves in any radial
plane passing through the centre.
S34. Ans.(d)
Flowers of salvia, mustard, radish, and
turnip have stamens of various lengths.
S35. Ans.(a)
Androecium is made up of stamens,The
stamens can be grouped into a single
bunch or bundle (Monoadelphous), two
bundles (Diadelphous), or more than
two bundles (Polyadelphous) as in the
China rose, or more than two bundles
(Polyadelphous) as in Citrus.
S36. Ans.(c)
Phylloclade: Stems that have been
transformed into flat green organs that
serve the same tasks as leaves.
Examples: Euphorbia (flattened stem)
Opuntia (Cylindrical stem)
S37. Ans.(a)
Modified leaves are found on
insectivorous plants such pitcher plants
(Nepenthes) and Venus-fly traps.
S38. Ans.(a)
Gynoecium is tricarpellary, syncarpous,
ovary superior, trilocular with multiple
ovules, and axile. Placentation is
present in the Liliaceae family.
S39. Ans.(c)
There are five petals, the largest of
which (banner or standard or vexillum)
overlaps the two lateral petals
(wings), which overlap the two smallest
anterior petals (keel); this is known as
Vexillary aestivation.
S40. Ans.(c)
Under xerophytic adaptations, Opuntia
leaves become transformed into spines
to minimise transpiration.
S41. Ans.(d) S49. Ans.(d)
Keel is a feature of the Fabaceae family, The aleurone layer is made up of protein
which was previously known as found in maize grain
papilonoideae. Gram, Arhar, Moong, S50. Ans.(c)
Sem, Groundnut, Soyabean,
Imbricate occurs when sepals or petals
Indigofera, Sun hemp, Sesbania, in a whorl overlap at the margin without
Trifolium, Lupin, Sweet pea, and any particular direction.
Muliathi are examples of these plants.
S51. Ans.(a)
S42. Ans.(b)
Food storage causes edible
Perigynous means that the gynoecium is subterranean stem to develop fleshy and
in the centre and the other parts of the tuberous. Potato, Ginger, Turmeric,
flower are on the thalamus rim almost Zaminkand, and Colocasia are just a
at the same level. Peach, Rose, and few examples.
Plum, for example.
S52. Ans.(d)
S43. Ans.(a)
Tomatoes have a fleshy placenta and
In epigynous flowers, such as guava and pericarp
cucumber blooms, and sunflower ray
S53. Ans.(d)
florets, the ovary is considered to be
inferior. Gynoecium is the highest-ranking
hypogynous flower.
S44. Ans.(a)
For example- Brinejal, Mustard, Tulip,
A flower that consists just of stamens or

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Aloe, Onion, Potato, Gramme, Bean,
carpels is unisexual. Cucumber, maize,
Chilli, China rose, Lupin, Tomato,
papaya, and so on.
Withania somnifera, Petunia and Sun
S45. Ans.(a) hemp.
Floating roots are spongy white roots S54. Ans.(c)
that emerge from the node stem and
The seed coats of groundnut, gramme,
store air. They aid aquatic plants in
and maize are thin, whereas the seed
maintaining their position on the
coats of coconut are thick.
water's surface.
S55. Ans.(b)
Jussiaea and Pistia, for example.
It is said to be actinomorphic when a
S46. Ans.(a)
flower may be divided into two equal
It is considered to be axile when the radial halves in any radial plane passing
placenta is axial and the ovules are through the centre. Twisted refers to
linked to it in a multilocular ovary.
when one appendage's margin overlaps
for example- China rose, tomato, and that of the next and so on, as in China
lemon. rose, lady's finger, and cotton.
S47. Ans.(a)
The ovary is superior in hypogynous
flowers, such as mustard, china rose,
brinjal, potato, onion, and tulip.
S48. Ans.(c)
Multicarpellary apocarpous gynoecium
produces aggregate fruit. For example-
raspberry

422 CHANNEL
JOIN TELEGRAM
 Chapter 6
Sankalp Bharat
Anatomy of Flowering Plants

1. Given below are two statements: (a) B and C only

Statement I: Endarch and exarch are the (b) B, C and E only
terms often used for describing the position (c) A and D only
of secondary xylem in the plant body. (d) A, B and D only
Statement II: Exarch condition is the most 4. The transverse section of a plant part
common feature of the root system. showed polyarch, radial and exarch xylem,
In the light of the above statements, choose with endodermis and pericycle. The plant
the correct answer from the options given part is identified as: (2023)
below: (2023) (a) Monocot root
(a) Statement I is incorrect but Statement II (b) Dicot root
is true (c) Dicot stem
(b) Both Statement I and Statement II are (d) Monocot stem
true 5. Consider the following tissues in the stelar
(c) Both Statement I and Statement II are region of a stem showing secondary growth.
false (A) Primary xylem
(d) Statement I is correct but Statement II is (B) Secondary xylem
false (C) Primary phloem

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
2. Given below are two statements: One is
labelled as Assertion A and the other is
labelled as Reason R:
Assertion A: Late wood has fewer xylary
elements with narrow vessels.
Reason R: Cambium is less active in
winters.
In the light of the above statements, choose
the correct answer from the options given
below: (NEET2023)
(a) A is false but R is true
(b) Both A and R are true and R is the
correct explanation of A
(c) Both A and R are true but R is NOT the
correct explanation of A
(d) A is true but R is false
3. Identify the correct statements:
A. Lenticels are the lens-shaped openings
permitting the exchange of gases.
B. Bark formed early in the season is
called hard bark.
C. Bark is a technical term that refers to
all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary
phloem.
E. Phellogen is single-layered in thickness.
Choose the correct answer from the options
given below: (2023)
423 CHANNEL
JOIN TELEGRAM
(D) Secondary phloem
Arrange these in the correct sequence of
their position from pith towards cortex.
(2023)
(a) (A) (B), (D), (C)
(b) (B) (A), (C) (D)
(c) (A) (B), (C), (D)
(B) (A), (D), (C)
6. Consider the following plant tissues:
(A) Axillary buds
(B) Fascicular vascular cambium
(C) Interfascicular cambium
(D) Cork cambium
(E) Intercalary meristem
Identify the lateral meristems among the
above. (2023)
(a) (A), (C) and (D) only
(b) (B), (C) and (D) only
(c) (A) (B) (C) and (E) only
(d) (A), (B) (D) and (E) only
7. Interfascicular cambium is present between
(NEET 2022 Phase 2)
(a) Secondary xylem and secondary phloem
(b) Primary xylem and primary phloem
(c) Pericycle and endodermis
(d) Two vascular bundles
8. Initiation of lateral roots and vascular
cambium during secondary growth takes
place in cells of (2022)
 (a) Pericycle
(b) Epiblema
(c) Cortex
(d) Endodermis
9. "Girdling Experiment" was performed by
Plant Physiologists to identify the plant
tissue through which: (2022)
(a) A water is transported
(b) food is transported
(c) for both water and food transportation
(d) Dosmosis is observed
10. Read the following statements about the
vascular bundles:
(a) In roots, xylem and phloem in a vascular
bundle are arranged in an alternate manner
along the different radii.
(b) Conjoint closed vascular bundles do not
possess cambium
(c) In open vascular bundles, cambium is
present in between xylem and phloem
(d) The vascular bundles of dicotyledonous
stem possess endarch protoxylem
12. What is the role of large bundle sheath cells
found around the vascular bundles in C.
plants? (2022)
(a) To provide the site for photorespiratory
pathway
(b) To increase the number of chloroplast for
the operation of Calvin cycle
(c) To enable the plant to tolerate high
temperature
(d) To protect the vascular tissue from high
light intensity
13. The anatomy of springwood shows some
peculiar features. Identify the correct set of
statements about springwood.
(a) It is also called as the earlywood
(b) In spring season cambium produces
xylem elements with narrow vessels
(c) It is lighter in colour
(d) The springwood along with autumn
wood shows alternate concentric rings
forming annual rings
(e) It has lower density
Choose the correct answer from the options

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(e) In monocotyledonous root, usually there given below: (2022)
are more than six xylem bundles present (a) (a), (b), (d) and (e) only
Choose the correct answer from the options (b) (a), (c), (d) and (e) only
given below: (2022) (c) (a), (b) and (d) only
(a) (a), (b) and (d) only (d) (c), (d) and (e) only
(b) (b), (c), (d) and (e) only 14. Select the correct pair. (2021)
(c) (a), (b), (c) and (d) only (a) In dicot leaves, Conjunctive
(d) (a), (c), (d) and (e) only vascular tissue
11. In old trees the greater part of secondary
xylem is dark brown and resistant to insect bundles are
attack due to: surrounded
(a) secretion of secondary metabolities and by large thick-walled
their deposition in the lumen of vessels. cells
(b) deposition of organic compounds like
(b) Cells of medullary Interfascicul
tannins and resins in the central layers of
rays that form part of cambium
stem.
(c) deposition of suberin and aromatic cambial rings
substances in the outer layer of stem. Loose parenchyma Spongy
(c)
(d) deposition of tannins, gum, resin and
cells parenchyma
aromatic substances in the peripheral
layers of stem. rupturing the
(e) presence of parenchyma cells, epidermis
functionally active xylem elements and and forming a lens-
essential oils. shaped opening in
Choose the correct answer from the options bark
given below: (2022 Phase 1)
(d) Large colorless empty Subsidiary
(a) (a) and (b) only
cells
(b) (c) and (d) only cells in the epidermis
(c) (d) and (e) only of
(d) (b) and (d) only
grass leaves
424 CHANNEL
JOIN TELEGRAM
15. Identify the incorrect statement. (2020) 21. Which of the statements given below is not
(a) Sapwood is involved in conduction of true about formation of annual rings in
water and minerals from root to leaf. trees? (2019)
(b) Sapwood is the innermost secondary (a) Annual ring is a combination of spring
xylem and is lighter in colour. wood and autumn wood produced in a
(c) Due to deposition of tannins, resins, oils year
etc., heart wood is dark in colour. (b) Differential activity of cambium causes
(d) Heart wood does not conduct water but light and dark bands of tissue-early and
gives mechanical support. late wood respectively.
16. The transverse section of a plant shows (c) Activity of cambium depends upon
following anatomical features: (2020) variation in climate.
1. Large number of scattered vascular (d) Annual rings are not prominent in trees
bundles surrounded by bundle sheath. of temperate region.
2. Large conspicuous parenchymatous 22. Secondary xylem and phloem in dicot stem
ground tissue. are produced by (2018)
3. Vascular bundles conjoint and closed. (a) Apical meristem
4. Phloem parenchyma absent. (b) Vascular cambium
Identify the category of plant and its part: (c) Phellogen
(a) Monocotyledonous root (d) Axillary meristems
(b) Dicotyledonous stem 23. Casparian strips occur in (2018)
(c) Dicotyledonous root (a) Epidermis
(d) Monocotyledonous stem (b) Pericycle
17. Large, empty colourless cells of the adaxial (c) Cortex

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
epidermis along the veins of grass leaves are (d) Endodermis
(2020 Covid Re-NEET) 24. Plants having little or no secondary growth
(a) Guard cells are (2018)
(b) Bundle sheath cells (a) Grasses
(c) Bulliform cells (b) Deciduous angiosperms
(d) Lenticels (c) Conifers
18. Which of the following statements about (d) Cycads
cork cambium is incorrect? 25. Stomata in grass leaf are: (2018)
(2020 Covid Re-NEET) (a) Dumb-bell shaped
(a) It forms a part of periderm (b) Kidney shaped
(b) It is responsible for the formation of (c) Rectangular
lenticels (d) Barrel shaped
(c) It is a couple of layers thick 26. Which of the following is made up of dead
(d) It forms secondary cortex on its cells? (2017)
Outerside (a) Xylem parenchyma
19. Grass leaves curl inwards during very dry (b) Collenchyma
weather. Select the most appropriate reason (c) Phellem
from the following (2019) (d) Phloem
(a) Closure of stomata 27. The vascular cambium normally gives rise
(b) Flaccidity of bulliform cells to: (2017)
(c) Shrinkage of air spaces in spongy (a) Phelloderm
mesophyll (b) Primary phloem
(d) Tyloses in vessels (c) Secondary xylem
20. Phloem in gymnosperms lacks (2019) (d) Periderm
(a) Albuminous cells and sieve cells 28. Identify the wrong statement in context of
(b) Sieve tubes only heartwood: (2017)
(c) Companion cells only (a) Organic compounds are deposited in it
(d) Both sieve tubes and companion cells (b) It is highly durable
(c) It conducts water and minerals
efficiently

425 CHANNEL
JOIN TELEGRAM
 (d) It comprises dead elements with highly (c) Open vascular bundles
lignified wall (d) Scattered vascular bundles
29. Which of the following statements is true for 36. Read the different components from (A) to
phloem in plants? (2017) (D) in the list given below and tell the correct
(a) Phloem fibres are made up of order of the components with reference to
collenchymatous cells their arrangement from outer side to inner
(b) Sieve tube elements are multicellular side in a woody dicot stem: (2015 Re)
with wide lumen and rich cytoplasm (A) Secondary cortex
(c) Companion cells help in maintaining the (B) Wood
pressure gradient in sieve tubes (C) Secondary phloem
(d) Phloem parenchyma is a abundantly (D) Phellem
present in monocots The correct order is:
30. The chief function of vessels in the plant (a) (A), (B), (D), (C)
body is to: (2017) (b) (D), (A), (C), (B)
(a) Eliminate excess of water (c) (D), (C), (A), (B)
(b) Transport food materials manufactured (d) (C), (D), (B), (A)
in the leaves to other parts of the plant 37. You are given a fairly old piece of dicot stem
(c) Store food material in the form of starch and a dicot root. Which of the following
or fat anatomical structures will you use to
(d) Conduct water and mineral salts distinguish between the two? (2014)
31. The balloon-shaped structures called (a) Cortical cells
tyloses: (2016 - II) (b) Secondary xylem
(a) Are extensions of xylem parenchyma (c) Secondary phloem

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
cells into vessels (d) Protoxylem
(b) Are linked to the ascent of sap through 38. Tracheids differ from other tracheary
xylem vessels elements in: (2014)
(c) Originate in the lumen of vessels (a) Being lignified
(d) Characterise the sapwood (b) Having casparian strips
32. Cortex is the region found between: (c) Being imperforate
(2016 - II) (d) Lacking nucleus
(a) Endodermis and pith 39. Lenticels are involved in: (2013)
(b) Endodermis and vascular bundle (a) Photosynthesis
(c) Epidermis and stele (b) Transpiration
(d) Pericycle and endodermis (c) Gaseous exchange
33. Specialised epidermal cells surrounding the (d) Food transport
guard cells are called (2016 - I) 40. Interfascicular cambium develops from the
(a) Complementary cells cells of: (2013)
(b) Subsidiary cells (a) Pericycle
(c) Bulliform cells (b) Medullary rays
(d) Lenticels (c) Xylem parenchyma
34. Vascular bundles in monocotyledons are (d) Endodermis
considered closed because: (2015) 41. Age of a tree can be estimated by: (2013)
(a) There are no vessels with perforations (a) Diameter of its heartwood
(b) Xylem is surrounded all around by (b) Its height and girth
phloem (c) Biomass
(c) A bundle sheath surrounds each bundle (d) Number of annual rings
(d) Cambium is absent
35. A major characteristic of the monocot root
is the presence of: (2015)
(a) Vasculature without cambium
(b) Cambium sandwiched between phloem
and xylem along the radius

426 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (a) S33. Ans. (b)

S2. Ans. (b) S34. Ans. (d)

S3. Ans. (c) S35. Ans. (a)

S4. Ans. (a) S36. Ans. (b)

S5. Ans. (a) S37. Ans. (d)

S6. Ans. (b) S38. Ans. (c)

S7. Ans. (d) S39. Ans. (c)

S8. Ans. (a) S40. Ans. (b)

S9. Ans. (b) S41. Ans. (d)

S10. Ans. (a)

S11. Ans. (a)

S12. Ans. (b)

S13. Ans. (b)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (b)

S15. Ans. (b)

S16. Ans. (d)

S17. Ans. (c)

S18. Ans. (d)

S19. Ans. (b)

S20. Ans. (d)

S21. Ans. (d)

S22. Ans. (b)

S23. Ans. (d)

S24. Ans. (a)

S25. Ans. (a)

S26. Ans. (c)

S27. Ans. (c)

S28. Ans. (c)

S29. Ans. (c)

S30. Ans. (d)

S31. Ans. (a)

S32. Ans. (c)

427 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(a)
Endarch and exarch are the terms often
used for describing the position of
primary xylem in the plant body.
S2. Ans.(b)
In winter, the cambium is less active and
forms fewer xylary elements that have
narrow vessels, and this wood is called
autumn wood or late wood.
S3. Ans.(c)
Lenticels are lens shaped opening
permitting exchange of gases between
the outer atmosphere and internal tissue
of the stem.
Bark that is formed early in the season is
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
called early or soft bark. Towards the end
of the season late or hard bark is formed.
S4. Ans.(a)
Radial vascular bundles are present in
roots. Monocot roots have polyarch and
exarch condition of xylem.
S5. Ans.(a)
Explanation The correct sequence of
tissues in the stelar region of the stem
showing secondary growth from pith
towards cortex is:
Primary Xylem → Secondary Xylem
Secondary Phloem → Primary Phloem
S6. Ans.(b)
Lateral meristems are the meristems that
add to the width or girth in a process
known as secondary growth. They are
responsible for the secondary growth in
plants and are found parallel to the sides
of the plants.
S7. Ans.(d)
428 CHANNEL
JOIN TELEGRAM
During secondary growth in dicot stem,
the cells of medullary rays lie between
the vascular bundles become
dedifferentiated and give rise to new
cambium called interfascicular
cambium.
S8. Ans.(a)
Initiation of lateral roots and vascular
cambium during secondary growth takes
place in pericycle cells of dicot roots.
Epiblema, endodermis and cortex do not
dedifferentiate.
S9. Ans.(b)
The girdling experiment shows that
phloem is the tissue responsible for
translocation of food; and that transport
takes place in one direction i.e. towards
the root.
S10. Ans.(a)
All the statements are correct regarding
vascular bundles but none of the options
with such combination is given.
S11. Ans.(a)
In old trees, the greater part of secondary
xylem is dark brown due to deposition of
organic compounds like tannins, resins,
oils, gums, aromatic substances and
essential oils in the central or innermost
layers of the stem. These substances
make it hard, durable and resistant to
the attacks. of micro-organisms and
insects.
S12. Ans.(b)
The large cells around the vascular
bundles of C. plants form bundle sheath.
These cells have large number of
chloroplasts to perform calvin cycle.
S13. Ans.(b)
Spring wood is also called early wood. It
is lighter in colour and has a lower
 density. The vessels are produced with
the wider lumens to transport more
water to meet the requirement by
increased transpiring surface in spring
season.
The spring and autumn wood appear as
alternate concentric rings of light and
dark colour forming annual rings.
S14. Ans.(b)
S15. Ans.(b)
Due to the deposition of organic
compounds such as tannins, resins,
oils, gums, aromatic chemicals, and
essential oils, the middle or innermost
part of secondary xylem in old trees is
dark brown. The heartwood region
consists of dead elements with strongly
lignified walls. Sapwood refers to the
lighter-colored peripheral area
(outermost) of the secondary xylem.
S16. Ans.(d)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
A sclerenchymatous hypodermis, a large
number of distributed vascular bundles,
each surrounded by a
sclerenchymatous bundle sheath, and a
vast, visible parenchymatous ground
tissue characterise the
monocotyledonous stem. The vascular
bundles are joined and closed together.
S17. Ans.(c)
Certain adaxial epidermal cells along
veins in grasses transform into huge,
empty, colourless cells. Bulliform cells
are what they're termed.
S18. Ans.(d)
Cells on both sides are cut off by cork
cambium or phellogen. Inner cells
differentiate into secondary cortex or
phelloderm, whereas exterior cells
differentiate into cork or phellem. On
the inside, it produces secondary cortex.
S19. Ans.(b)
Water stress causes bulliform cells to
become flaccid. This causes the leaves
to curl inward, reducing water loss.
S20. Ans.(d)
Gymnosperm phloem is devoid of both
sieve tubes and companion cells.
429 CHANNEL
JOIN TELEGRAM
Albuminous cells and sieve cells are
seen in gymosperms.
S21. Ans.(d)
The cyclical activity of cambium
produces annual rings. Climate
conditions in temperate zones are
rarely consistent throughout the year.
The climatic conditions in the tropics,
on the other hand, are consistent
throughout the year. As a result, in
temperate plants, cambium is more
active in the spring and less active in
the autumn.
S22. Ans.(b)
In the stem and root of a vascular plant,
vascular cambium is found between the
xylem and phloem. It is the source of
both secondary xylem (inwards,
towards pith) and secondary phloem
(outwards, away from pith) growth
(outwards).
S23. Ans.(d)
The casparian strip is a band of cell wall
material deposited in the endodermis'
radial and transverse walls. Suberin
and lignin make up this substance.
S24. Ans.(a)
Monocots have either no secondary
growth or abnormal secondary
development, as seen in grass.
In monocots, this occurs due to the lack
of cambium between the xylem and the
phloem.
S25. Ans.(a)
Guard cells in broad-leaved plants are
kidney- shaped, whereas those on
grasses' leaf blades, such as wheat and
bamboo, are dumb-bell shaped.
S26. Ans.(C)
Both sides of the cell are cut off by
phellogen. The cork (phellem)
differentiates from the outer cells,
whereas the secondary cortex develops
from the inner cells (phelloderm).
Secondary cortical cells are
parenchymatous. Phellem is made up of
cells that have died.
S27. Ans.(c)
The vascular cambium produces
secondary xylem and secondary phloem
during secondary growth.
Cork cambium produces phelloderm.
S28. Ans.(c)
Heartwood is the non-functional middle
section of the secondary xylem of old
trees that is hard, lifeless, dark brown
in colour, and heavily lignified.
Deposition of organic molecules is
responsible for the dark colour (tannins,
resins, oils, gums, aromatic
substances, essential oils, etc). These
ingredients make it tough, long-lasting,
and resistant to bacteria
and insects. The stem is supported
mechanically by the heartwood, which
does not conduct water.
S29. Ans.(c)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Sieve tube elements are long, tube-like
structures that are coupled with
companion cells and are oriented
longitudinally. The sieve plates are
formed by perforating their end walls. A
developed sieve element has a big
vacuole and peripheral cytoplasm
but no nucleus. The nucleus of
companion cells controls the actions of
sieve tubes.
S30. Ans.(d)
Tracheids and vessels are the principal
water transportation elements in
flowering plants. Vessel is a long
cylindrical tube-like structure composed
of multiple vessel parts, each with
lignified walls and a huge central
chamber.
S31. Ans.(a)
Tyloses are balloon-shaped structures
that extend from xylem parenchyma
cells into vessels.
S32. Ans.(c)
Between the epidermis and the stele is
the cortex. The stele is made up of all
tissues on the inner side of the
endodermis, such as the pericycle,
vascular bundles, and pith.
430 CHANNEL
JOIN TELEGRAM
S33. Ans.(b)
In the area of the guard cells, a few
epidermal cells become specialised in
their shape and size and are known as
subsidiary cells. Stomatal apparatus
refers to the stomatal orifice, guard
cells, and auxiliary cells that surround
it.
S34. Ans.(d)
The vascular bundles of
monocotyledonous plants are devoid of
cambium.
S35. Ans.(a)
The vascular bundles of
monocotylednous plants are
devoid of cambium. As a result, they are
referred to as closed since they do not
generate additional tissues. The
monocot stem, not the root, has scatter
vascular bundles.
S36. Ans.(b)
The correct order from the outer to the
inner side
of the dicot stem is phellem-secondary
cortex- secondary phloem-wood.
S37. Ans.(d)
The stem of a dicot is endarch, while the
root of a dicot is exarch. Protoxylem
distinguished them anatomically.
S38. Ans.(c)
Tracheids are imperforate, while the rest
of the trachea is perforated.
S39. Ans.(c)
The exchange of gases between the
outer atmosphere and the inside tissue
of the stem is enabled through
lenticels, which are lens-shaped
openings. Most woody trees have these.
S40. Ans.(b)
The intrafasicular cambium is the
cambium present between primary
xylem and primary phloem in dicot
stems. Adjacent to these are the cells of
medullary rays.
The interfascicular cambium is formed
when the intrafascicular cambium
becomes meristematic.
 Xylem parenchyma is a live, thin-walled
organ with cellulose-based cell walls.
Endodermis is the innermost layer of
the cortex in dicot roots.
The pericycle is a layer of thin-walled
parenchymatous cells that is next to the
endodermis.
S41. Ans.(d)
The number of annual rings equals the
number of years.

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

431 CHANNEL
JOIN TELEGRAM
 Chapter 7
Sankalp Bharat
Structural Organisation in Animals

1. The Cockroach is : (2023) 5. Match List I with List II. (2023)

(a) Ammonotelic only List - I List – II
(b) Uricotelic only Mast cells (I) Ciliated
(c) Ureotelic only (A)
epithelium
(d) Ureotelic and Uricotelic
2. Statement I : In cockroach, the forewings (B) Inner surface (II) Areolar
are transparent and prothoracic in origin. of branchiole connective
Statement II : In cockroach, the hind wings tissue
are opaque, leathery and mesothoracic in (C) Blood (III) Cuboidal
origin. (2023) epithelium
(a) Statement I is correct but statement II Tubular parts (IV) Specialised
is false (D)
of nephron connective
(b) Statement I is incorrect nut statement II tissue
is true
(c) Both statement I and statement II are Choose the correct answer from the options
true give below:
(d) Both statement I and Statement II are (a) A-II, B-III, C-I, D-IV

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
false. (b) A-II, B-I, C-IV, D-III
3. Match List-I with List-II. (2023) (c) A-III, B-IV, C-II, D-I
List -I List -II (d) A-I, B-II, C-IV, D-III
Columnar (I) Ducts of glands 6. In cockroach, excretion is brought about by
(A)
epithelium – (2023)
Ciliated (II) Inner lining of (A) Phallic gland
(B)
epithelium stomach and (B) Urecose gland
intestine (C) Nephrocytes
Squamous (III) Inner lining of (D) Fat body
(C)
epithelium branchales (E) Collaterial glands
Cuboidal (IV) Endothelum Choose the correct answer from the options
(D)
epithelium given below :
(a) A, B and E only
Choose the correct answer from the options
(b) B, C and D only
given below:]
(c) B and D only
(a) A-III, B-II, C-I, D-IV
(d) A and E only
(b) A-III, B-II, C-IV, D-I
7. Which of the following is characteristic
(c) A-II, B-III, C-I, D-IV
feature of cockroach regarding sexual
(d) A-II, B-III, C-IV, D-I
dimorphism? (2023)
4. Statement I : Ligaments are dense
(a) Presence of anal styles
irregular tissue.
(b) Presence of sclerites
Statement II : Cartilage is dense regular
(c) Presence of anal cerci
tissue. (2023)
(d) Dark brown body colour and anal cerci
(a) Statement I is correct but statement II
8. Which of the following types of epithelium is
is false
present in the bronchioles and Fallopian
(b) Statement I is incorrect nut statement II
tubes? (2022)
is true
(a) Stratified squamous epithelium
(c) Both statement I and statement II are
(b) Simple squamous epithelium
true
(c) Simple columnar epithelium
(d) Both statement I and Statement II are
(d) Ciliated epithelium
false.

432 CHANNEL
JOIN TELEGRAM
9. Match List-I with List-II regarding the (c) Cartilage
organs of Cockroach: (2022) (d) Neuroglia
List - I List - I 14. Tegmina in cockroach, arises from (2022)
Crop (I) Malpighian (a) Prothorax
(A) (b) Mesothorax
tubules
(c) Metathorax
(B) Proventriculus (II) Malpighian (d) Prothorax and Mesothorax
tubules 15. Match List - I with List – II (2022)
(C) Hepatic caecae (III) Malpighian List - I List - II
tubules Bronchioles (I) Dense
(A)
(D) Malpighian (IV) Storage of Regular
tubules food Connective
Tissue
Choose the correct answer from the options
given below : (B) Goblet Cell (II) Losse
(a) A-I, B-IV, C-III, D-II Connective
(b) A-IV, B-I, C-II, D-III Tissue
(c) A-III, B-II, C-I, D-IV (C) Tendons (III) Glandular
(d) A-II, B-IV, C-I, D-III Tissue
10. Choose the correct statements: (2022)
(a) Bones support and protect softer tissues (D) Adipose Tissue (IV) Ciliated
Epithelium
and organs
(b) Weight bearing function is served by Choose the correct answer from the options

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
limb bones given below:
(c) Ligament is the site of production of (a) A-IV, B-III, C-I, D-II
blood cells. (b) A-I, B-II, C-III, D-IV
(d) Adipose tissue is specialised to store (c) A-II, B-I, C-IV, D-III
fats. (d) A-III, B-IV, C-II, D-I
(e) Tendons attach one bone to another. 16. Which of the following characteristic is
Choose the most appropriate answer from incorrect with respect to cockroach? (2021)
the options given below: (a) Hypopharynx lies within the cavity
(a) (A), (B) and (E) only enclosed by the mouth parts
(b) (A), (B) and (D) only (b) In females, 7th-9th sterna together form
(c) (B), (C) and (E) only a genital pouch
(d) (A), (C) and (D) only (c) 10th abdominal segment in both sexes,
11. Excretion in cockroach is performed by all, bears a pair of anal cerci
EXCEPT: (2022) (d) A ring of gastric caeca is present at the
(a) Hepatic caeca junction of midgut and hind gut
(b) Urecose glands 17. Which of the following statement is wrongly
(c) Malpighian tubules represent the nature of smooth muscle?
(d) Fat body (2021)
12. In which of the following animals, digestive (a) They are involuntary muscles
tract has additional chambers like crop and (b) Communication among the cells is
gizzard? (2022) performed by intercalated discs
(a) Corvus, Columba, Chameleon (c) These muscles are present in the wall of
(b) Bufo, Balaenoptera, Bangarus blood vessels
(c) Catla, Columba, Crocodilus (d) These muscle have no striations
(d) Pavo, Psittacula, Corvus 18. Identify the types of cell junctions that help
13. Pavo (Peacock), Psittacula (Parrot), Corvus to stop the leakage of the substances across
(Crow) and Columba (Pigeon) are birds. a tissue and facilitation of communication
(2022) with neighbouring cells via rapid transfer of
(a) Blood ions and molecules (2021)
(b) Adipose tissue

433 CHANNEL
JOIN TELEGRAM
 (a) Tight junctions and Gap junctions, (b) Mouth → Gizzard → Crop → Pharynx →
respectively Oesophagus
(b) Adhering junctions and Tight junctions, (c) Mouth → Pharynx → Oesophagus →
respectively Crop → Gizzard
(c) Adhering junctions and Gap junctions, (d) Mouth → Oesophagus → Pharynx →
respectively Crop → Gizzard
(d) Gap junctions and Adhering junctions, 24. Match the following columns with reference
Respectively to cockroach and select the correct option
19. Following are the statements about (2020 Covid Re-NEET)
prostomium of earth-worm (2021)
A. It serves as a covering for mouth Column-I Column-II
B. It helps to open cracks in the soil into
which it can crawl 1. Grinding of (i) Hepatic
the food caecae
C. It is one of the sensory structures
particles
D. It is the first body segment
2. Secrete (ii) 10th segment
Choose the correct answer from the options gastric juice
given below. 10 pairs (iii) Proventriculus
3.
(a) A, B and D are correct
4. Anal cerci (iv) Spiracles
(b) A, B, C and D are correct
(c) B and C are correct (v) Alary muscles
(d) A, B and C are correct
1 2 3 4
20. Cuboidal epithelium with brush border of

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
microvilli is found in (2020)
(a) Ducts of salivary glands
(b) Proximal convoluted tubule of nephron
(c) Eustachian tube
(d) Lining of intestine
21. If the head of cockroach is removed, it may
live for few days because (2020)
(a) The cockroach does not have nervous
system
(b) The head holds a small proportion of a
nervous system while the rest is situated
along the ventral part of its body
(c) The head holds a 1/3rd of a nervous
system while the rest is situated along
the dorsal part of its body
(d) The supra-oesophageal ganglia of the
cockroach are situated in ventral part of
abdomen
22. Goblet cells of alimentary canal are
modified from (2020)
(a) Columnar epithelial cells
(b) Chondrocytes
(c) Compound epithelial cells
(d) Squamous epithelial cells
23. In cockroach, identify the parts of the
foregut in correct sequence
(2020 Covid Re-NEET)
(a) Mouth → Crop → Pharynx →
Oesophagus → Gizzard
(a) (iv) (iii) (v) (ii)
(b) (i) (iv) (iii) (ii)
(c) (ii) (iii) (i) (iv)
(d) (iii) (i) (iv) (ii)
25. Select the incorrectly matched pair from
following (2020 Covid Re-NEET)
(a) Neurons - Nerve cells
(b) Fibroblast - Areolar tissue
(c) Osteocytes - Bone cells
(d) Chondrocytes - Smooth muscle cells
26. Ciliated epithelial cells are required to move
particles or mucus in a specific direction. In
humans, these cells are mainly present in
(2019)
(a) Bile duct and Bronchioles
(b) Fallopian tubes and Pancreatic duct
(c) Eustachian tube and Salivary duct
(d) Bronchioles and Fallopian tubes
27. Select the correct sequence of organs in the
alimentary canal of cockroach starting from
mouth (2019)
(a) Pharynx → Oesophagus → Crop →
Gizzard → Ileum → Colon → Rectum
(b) Pharynx → Oesophagus → Gizzard →
Crop → Ileum → Colon → Rectum
(c) Pharynx → Oesophagus → Gizzard →
Ileum → Crop → Colon → Rectum
(d) Pharynx → Oesophagus → Ileum → Crop
→ Gizzard → Colon → Rectum

434 CHANNEL
JOIN TELEGRAM
28. Which of the following feature is used to (c) Seminal vesicles
identify a male cockroach from a female (d) Mushroom glands
cockroach? (2018) 34. Which of the following feature is not present
(a) Presence of a boat shaped sternum on in Periplaneta americana? (2016 - I)
the 9th abdominal segment (a) Schizocoelom as body cavity
(b) Presence of caudal styles (b) Indeterminate and radial cleavage
(c) Forewings with darker tegmina during embryonic development
(d) Presence of anal cerci (c) Exoskeleton composed of N-acetyl
29. Select the correct route for the passage of glucosamine
sperms in male frogs (2017) (d) Metamerically segmented body
(a) Testes → Bidder’s canal → Kidney →
Vasa efferentia → Urinogenital duct → 35. Which type of tissue correctly matches with
Cloaca its location (2016 - I)
(b) Testes → Vasa efferentia → Kidney → Tissue Location
Seminal Vesicle → Urinogenital duct → Smooth muscle Wall of intestine
Cloaca (a)
(c) Testes → Vasa efferentia → Bidder’s (b) Areolar tissue Tendons
canal → Ureter → Cloaca (c) Transitional Tip of nose
(d) Testes → Vasa efferentia → Kidney → epithelium
Bidder’s canal → Urinogenital duct → (d) Cuboidal Lining of
Cloaca epithelium stomach
30. Which of the following structures does not
open into the genital chamber of female 36. The terga, sterna and pleura of cockroach

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
cockroaches? (2017) body are joined by (2015)
(a) A pair of collateral glands (a) Arthrodial membrane
(b) A single median oviduct (b) Cartilage
(c) Spermatheca (c) Cementing glue
(d) A pair of anal cerci (d) Muscular tissue
31. Select incorrect option with respect to 37. The body cells in cockroach discharge their
features present in three animals (2017) nitrogenous waste in the haemolymph
Chara Cockro Earthw Frog mainly in the form of (2015 Re)
cters ach orm (a) Potassium urate
(b) Urea
(a) Develo Direct Indirect Indire
(c) Calcium carbonate
pment ct
(d) Ammonia
(b) Blood Open Closed Close 38. Which of the following is not a function of
vascul d the skeletal system? (2015 Re)
ar (a) Storage of minerals
system (b) Production of body heat
Body Dry Moist Moist (c) Locomotion
(c) (d) Production of erythrocytes
surfac
e 39. Function of the gap junction is to (2015 Re)
Eyes Compou Absent Simpl (a) Facilitate communication between
(d) adjoining cells by connecting the cytoplasm
nd e
for rapid transfer of ions, small molecules
32. Smooth muscles are (2016 - II) and some large molecules
(a) Involuntary, cylindrical, striated (b) Separate two cells from each other
(b) Voluntary, spindle–shaped, uninucleate (c) Stop substance from leaking across a
(c) Involuntary, fusiform, non-striated tissue
(d) Voluntary, multinucleate, cylindrical (d) Performing cementing to keep
33. In male cockroaches, sperms are stored in neighboring cells together
(2016 - II) 40. Choose the correctly matched pair (2014)
(a) Testes (a) Cartilage - Loose connective tissue
(b) Vas deferens (b) Tendon - Specialised connective tissue
435 CHANNEL
JOIN TELEGRAM
 (c) Adipose tissue - Dense connective tissue
(d) Areolar tissue - Loose connective tissue
41. Choose the correctly matched pair (2014)
(a) Inner surface of bronchioles - Squamous
epithelium
(b) Inner lining of salivary ducts - Ciliated
epithelium
(c) Moist surface of buccal cavity -
Glandular epithelium
(d) Tubular parts of nephrons - Cuboidal
Epithelium
42. Select the correct option with respect to
cockroaches (2013)
(a) Malpighian tubules convert nitrogenous
wastes into urea
(b) Males bear short anal styles not present
in females
(c) Nervous system comprises of a dorsal
nerve cord and ten pairs of ganglia
(d) Forewings are tegmina which are used in
Flight
43. What external changes are visible after the
last moult of a cockroach nymph? (2013)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) Labium develops
(b) Mandibles become harder
(c) Anal cerci develop
(d) Both fore wings and hind wings develop

436 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (b) S23. Ans. (c)

S2. Ans. (d) S24. Ans. (d)

S3. Ans. (d) S25. Ans. (d)

S4. Ans. (a) S26. Ans. (d)

S5. Ans. (a) S27. Ans. (a)

S6. Ans. (b) S28. Ans. (b)

S7. Ans. (a) S29. Ans. (d)

S8. Ans. (d) S30. Ans. (d)

S9. Ans. (b) S31. Ans. (a)

S10. Ans. (b) S32. Ans. (c)

S11. Ans. (a) S33. Ans. (c)

S12. Ans. (d) S34. Ans. (b)

S13. Ans. (d) S35. Ans. (a)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (b) S36. Ans. (a)

S15. Ans. (a) S37. Ans. (a)

S16. Ans. (d) S38. Ans. (b)

S17. Ans. (b) S39. Ans. (a)

S18. Ans. (a) S40. Ans. (d)

S19. Ans. (b) S41. Ans. (d)

S20. Ans. (b) S42. Ans. (b)

S21. Ans. (b) S43. Ans. (d)

S22. Ans. (a)

437 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(b)
Cockroaches are uricotelic organisms.
The nature of the nitrogenous waste
excreted can be species-specific and is
often influenced by the organism's
environment and water availability.
S2. Ans.(d)
The first pair of wings (forewings or
tegmina) are not transparent and
prothoracic in origin, as stated in
Statement I. Instead, they are opaque,
dark, leathery and originate from the
mesothorax.
S3. Ans.(d)
Columnar epithelium : This type of
epithelium consists of tall, slender and
column-like cells. It's found in the inner
lining of the stomach and intestine
where it aids in secretion and
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
absorption. So, matches with .Ciliated
epithelium : These are typically
columnar or cuboidal cells that have
cilia (small hair-like projections) on their
surface. Ciliated epithelium is usually
found in the bronchioles (air passages
in the lungs) and in the fallopian tubes
in females. The cilia help to move
mucus and other substances. So,
matches with .Squamous epithelium :
Squamous cells are thin and flat,
similar in shape to fish scales (the word
"squamous" means scaly). This type of
epithelium forms the endothelium (the
lining of the heart, blood vessels, and
lymphatic vessels). So, matches with.
Cuboidal epithelium : These cells are
cube-shaped and are most commonly
found in the ducts of glands and kidney
tubules, where they assist with
secretion and absorption. So, matches
with .
S4. Ans.(a)
The correct answer is Option A : Both
Statement I and Statement II are false.
On the other hand, cartilage is a type of
specialized connective tissue that is not
classified as dense.
438 CHANNEL
JOIN TELEGRAM
S5. Ans.(d)
- Mast cells (A) : These are a type of
white blood cell that is part of the
immune system.
Inner surface of bronchiole (B) : The
bronchioles are small airways in the
respiratory tract that lead to the alveoli
(tiny air sacs in the lungs).
- Blood (C) : This is a specialized type of
connective tissue.
- Tubular parts of nephron (D) :
Nephrons are the functional units of the
kidney, responsible for filtering blood
and creating urine.
S6. Ans.(d)
Nephrocytes are large, colourless, ovoid,
binucleate cells attached to the dorsal
diaphragm in the body cavity.
Collaterial gland is the structure of
female reproductive system of cockroach
and it secretes the hard egg-case or
ootheca around fertilised eggs.
S7. Ans.(d)
Is the correct answer because anal
styles are present in male cockroaches
and absent in female cockroaches.
S8. Ans.(d)
Is the correct answer as ciliated
epithelium is mainly present in the
inner lining of hollow organs like
bronchioles and fallopian tubes.
S9. Ans.(b)
(a) Crop – Responsible for storage of
food
(b) Proventriculus – Grinding the food
particles
(c) Hepatic caecae – Secretion of
digestive juice
(d) Malpighian tubules – Removal of
nitrogenous waste
S10. Ans.(b)
∙ Bones are the hardest tissue of our
body that support and protect softer
tissues and organs.
 ∙ Limb bones serve weight bearing
function.
∙ Adipose tissue is a type of loose
connective tissue specialised to store
fats.
S11. Ans.(a)
Is correct answer because hepatic caeca
are responsible for secretion of digestive
juices in cockroach and it does not
participate in excretion. Urecose glands
in male cockroach, Malpighian tubules
and fat bodies in both male and female
cockroach are considered as excretory
structures.
S12. Ans.(d)
Pavo (Peacock), Psittacula (Parrot),
Corvus (Crow) and Columba (Pigeon) are
birds.
S13. Ans.(d)
Neuroglia are the supportive cells of
nervous tissue. They make up more
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
than half the volume of neural tissue.
Neurons, the unit of neural system are
excitable cells.
S14. Ans.(b)
Option (b) is the correct answer because
tegmina or forewings (the first pair of
wings) in cockroach arises from
mesothorax.
S15. Ans.(a)
Ciliated epithelium is mainly present in
the inner surface of hollow organs like
bronchioles and fallopian tubes. The
function is to move particles or mucus
in a specific direction over the
epithelium. Some of the columnar or
cuboidal cells get specialised for
secretion and are called glandular
epithelium. Goblet cells are unicellular
glands. Tendons are dense regular
connective tissues. They attach skeletal
muscles to bones. Adipose tissue is a
type of loose connective tissue located
mainly beneath the skin. The cells of
this tissue are specialised to store fats.
S16. Ans.(d)
A ring of gastric caeca is present at the
junction of foregut and midgut.
439 CHANNEL
JOIN TELEGRAM
S17. Ans.(b)
Communication among the cells
performed by intercalated discs is
present in cardiac cells.
S18. Ans.(a)
• Tight junction helps to stop the
leakage of the substance across a
tissue.
• Gap junction facilitates
communication with neighbouring
cells via rapid transfer of ions and
molecule.
S19. Ans.(d)
Prostomium serves as covering for
mouth;helps to open cracks in the soil
into which it can crawl;sensory
structures,
S20. Ans.(b)
Microvilli can be found in the cuboidal
epithelium of the proximal convoluted
tubule (PCT) of the nephron in the
kidney.
S21. Ans.(b)
A portion of the nervous system is
located in the cockroach’s head while
the rest is located along the ventral
(belly-side) region of its body. As a
result, even if the cockroach’s head is
removed, it can live for up to a week.
S22. Ans.(a)
Goblet cells in the alimentary canal’s
mucosal epithelium release mucus that
aids in lubrication. These are made from
columnar epithelial cells that have been
modified.
S23. Ans.(c)
The mouth opens into a short tubular
pharynx which leads to the oesophagus,
a tiny tube conduit. This expands into a
sac-like structure called a crop which
is used to store food. Gizzard or
proventriculus comes after the crop.
S24. Ans.(d)
• The gizzard, also known as the
proventriculus, aids in the crushing of
food particles.
 • At the foregut-midgut junction,
hepatic caecae can be found.
• The cockroach’s 10th segment bears a
pair of jointed filamentous filaments
known as anal cerci in both sexes.
• Cockroach has 12 pairs of alary
muscles that are connected to the
heart and circulatory system.
• The respiratory system is made up of a
network of trachea that open through
ten pairs of small openings on the
body’s lateral side called spiracles.
S25. Ans.(d)
Cartilage’s intercellular substance is
solid and pliable and it resists
compression. This tissue’s cells
(chondrocytes) are encased in small
cavities within the matrix they secrete.
S26. Ans.(d)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Ciliated epithelium lines the bronchioles
and fallopian tubes to transfer particles
or mucus in a certain direction across
the epithelium.
S27. Ans.(a)
Starting with the mouth, the correct
order of organs in the cockroach
alimentary canal is: Pharynx-
Oesophagus-Crop-Gizzard-Ileum-
Colon-Rectum
S28. Ans.(b)
A pair of tiny, unjointed anal styles, also
known as caudal styles can be found in
the 9th sternum of males’ abdomen.
S29. Ans.(d)
Sperms in male frogs migrate in the
following manner:
Testes → Vasa efferentia → Kidney →
Bidder’s
canal → Urinogenital duct → Cloaca
S30. Ans.(d)
The anterior region of the vaginal pouch
contains gonopores, spermathecal pores
and collateral gland apertures.
440 CHANNEL
JOIN TELEGRAM
S31. Ans.(a)
Earthworm development is direct, i.e. no
larva is generated.
S32. Ans.(c)
Smooth muscles are referred to as
“involuntary” since they cannot be
controlled directly. Smooth muscle
fibres have no striations and taper at
both ends (fusiform).
S33. Ans.(c)
Sperms are kept in seminal vesicles and
cemented together in spermatophores
which are expelled during copulation.
S34. Ans.(b)
Periplaneta americana does not have
indeterminate or radial cleavage during
embryonic development (cockroach).
S35. Ans.(a)
• Areolar tissue present under the skin.
• Smooth muscle tissue lines the inside
walls of internal organs such as blood
vessels, stomachs, and
intestines.
• Cuboidal epithelium is found in gland
ducts and
tubular sections of nephrons in the
kidneys.
• Transitional epithelium is found in
ureter, urinary bladder.
S36. Ans.(a)
Exoskeleton of Periplaneta americana
has firm plates termed sclerites (tergites
dorsally and sternites ventrally) that are
linked to each other by a thin and
flexible articular membrane in each
segment (Arthrodial membrane).
S37. Ans.(a)
Insects including cockroach excrete
nitrogenous waste in the form of soluble
potassium urate which is released into
the haemolymph and taken up by the
cells lining the malpighian tubule.
S38. Ans.(b)
Heat generation is linked to respiration
rather than the skeletal system.
S39. Ans.(a)
Gap junctions allow cells to
communicate by connecting the
cytoplasm of neighbouring cells
allowing for the rapid transport of ions,
small molecules and occasionally large
molecules.
S40. Ans.(d)
• Tendon - Tissue with a high density of
connective tissue.
• Cartilage is a type of connective tissue
that is specialised.
• Areolar tissue and adipose tissue are
two types of loose connective tissue.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
441 CHANNEL
JOIN TELEGRAM
S41. Ans.(d)
Cuboidal epithelium in the tubular
region of the nephron. Compound
epithelium covers the moist surface of
the buccal cavity and the inner lining of
the salivary ducts. Ciliated epithelium
lines the inner surface of bronchioles.
S42. Ans.(b)
On the 9th abdominal segments, males
have paired anal styles while females do
not have.
S43. Ans.(d)
Wing pads are present in the last
nymphal stage, however only adult
cockroaches have wings.
 Chapter 8
Sankalp Bharat
Cell The Unit of Life

1. How many different proteins does the (B) It produces cellular energy in the form of
ribosome consist of? (2023) ATP.
(a) 60 (C) It modifies the protein synthesized by
(b) 40 ribosomes on ER.
(c) 20 (D) It facilitates the transport of ions.
(d) 80 (E) It provides mechanical support.
2. Which of the following are NOT considered Choose the most appropriate answer from
as the part of endomembrane system? the options given below: (2023)
A. Mitochondria (a) (B) and (C) only
B. Endoplasmic reticulum (b) (A) and (C) only
C. Chloroplasts (c) (A) and (D) only
D. Golgi complex (d) (D) and (E) only
E. Peroxisomes 6. Match List-l with List-II:
Choose the most appropriate answer from List – I LIst – II
the options given below: (2023) Porins (i) Pink coloured
(a) A. C and E only A
nodules
(b) A and D only

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) A, D and E only B leg (ii) Lumen of
(d) B and D only haemoglobin thylakoid
3. Which of the following functions is carried H+ (iii) Amphibolic
C
out by cytoskeleton in a cell? (2023) accumulation pathway
(a) Protein synthesis
(b) Motility D Respiration (iv) Huge pores in
(c) Transportation outer
(d) Nuclear division membrane of
4. Given below are two statements: mitochondria
Statement I:- In bacteria, the mesosomes Choose the correct answer from the options
are formed by the extensions of plasma given below. (2022)
membrane. (a) (a)-(ii), (b)-(iv), (c)-(i), (d)-(iii)
Statement II: The mesosomes, in bacteria, (b) (a)-(ii), (b)-(i), (c)-(iv), (d)-(iii)
help in DNA replication and cell wall (c) (a)-(iv), (b)-(i). (c)-(ii), (d)-(iii)
formation. (d) (a)-(iii), (b)-(iv), (c)-(ii), (d)-(i)
In the light of the above statements, choose 7. Match List-l with List-II:
the most appropriate answer from the List – I LIst – II
options given below:
a Bacteriophage (i) 48502 base
(NEET Manipur2023)
 x 174 pairs
(a) Statement I is correct but Statement is
incorrect b Bacteriophage (ii) 5386
(b) Statement I is incorrect but Statement II lambda nucleotides
is correct
c Escherichia coli (iii) 33 x 109 base
(c) Both Statement I and Statement II are
pairs
correct
(d) Both Statement I and statement II are Haploid (iv) 4.6 x 109 base
d
incorrect. content of pairs
5. Which of the following statements are human DNA
correct with respect of Golgi apparatus? Choose the correct answer from the
(A) It is the important site of formation of options given below: (2022)
glycoprotein and glycolipids.
442 CHANNEL
JOIN TELEGRAM
 (a) (a) (i) (b)-(ii), (c)-(iv), (d)-(iii) (d) Mature sieve tube elements possess a
(b) (a)-(i), (b)-(ii), (c)-(iii), (d)-(iv) conspicuous nucleus and usual
(c) (a) (ii), (b) (iv), (c)-(1), (d)-(iii) cytoplasmic organelles.
(d) (a) (ii), (b), (c)-(iv), (d)-(iii) 13. Match List-1 with List-2 (2021)
8. Which type of substance would face List-1 List-2
difficulty to pass through the cell Cristae (i) Primary
membrane? (2022) A.
constriction
(a) Substance soluble in lipids in
(b) Substance with hydrophobic moiety chromosome
(c) Substance with hydrophilic moiety
(d) All substance irrespective of B. Thylakoids (ii) Disc-shaped
hydrophobic and hydrophilic moiety sacs in Golgi
9. If the pH in lysosomes is increased to apparatus
alkaline, what will be the outcome?
C. Centromere (iii) Infoldings in
(2022)
mitochondria
(a) Lysosomal enzymes will be more active
(b) Hydrolytic enzymes will function more D. Cisternae (iv) Flattened
efficiently membranous
(c) Hydrolytic enzymes will become inactive sacs in
(d) Lysosomal enzymes will be released into
stroma of
the cytoplasm
plastids
10. Arrange the following formed elements in
the decreasing order of their abundance in Choose the correct answer from the options

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
blood in humans:
(a) Platelets
(b) Neutrophils
(c) Erythrocytes
(d) Eosinophils
(e) Monocytes
Choose the most appropriate answer from
the options given below:
(a) (a), (c), (b), (d), (e)
(b) (c), (a), (b), (e), (d)
(c) (c), (b), (3), (e), (d)
(d) (d), (e), (b), (a), (c)
11. Which of the following statements with
respect to Endoplasmic Reticulum is
incorrect?
(a) RER has ribosomes attached to ER
(b) SER is devoid of ribosomes
(c) prokaryotes only RER are present in
(d) SER are the sites for lipid synthesis
12. Which of the following is an incorrect
statement?
(a) Microbodies are present both in plant
and animal cells.
(b) The perinuclear space forms a barrier
between the materials present inside the
nucleus and that of the cytoplasm.
(c) Nuclear pores act as passages for
proteins and RNA molecules in both
directions between nucleus
cytoplasm.
given below.
(a) A-(i) B-(iv) C-(iii) D-(ii)
(b) A-(iii) B-(iv) C-(i) D-(ii)
(c) A-(ii) B-(iii) C-(iv) D-(i)
(d) A-(iv) B-(iii) C-(ii) D-(i)
14. When the centromere is situated in the
middle of two equal arms of chromosomes,
(2022) the chromosome is referred as: (2021)
(a) Telocentric
(b) Sub-metacentric
(c) Acrocentric
(d) Metacentric
15. The organelles that are included in the
endomembrane system are: (2021)
(2022) (a) Endoplasmic reticulum, Golgi complex,
Lysosomes and Vacuoles.
(b) Golgi complex, Mitochondria, Ribosomes
and Lysosomes.
(c) Golgi complex, Endoplasmic reticulum,
Mitochondria and Lysosomes.
(2021) (d) Endoplasmic reticulum, Mitochondria,
Ribosomes and Lysosomes.
16. Which of the following statements about
inclusion bodies is incorrect? (2020)
(a) These are involved in ingestion of food
particles.
(b) They lie free in the cytoplasm
(c) These represent reserve material in
and cytoplasm
(d) They are not bound by any membrane

443 CHANNEL
JOIN TELEGRAM
17. Which is the important site of formation of 23. Which of the following statements is not
glycoproteins and glycolipids in eukaryotic correct? (2019)
cells? (2020) (a) Lysosomes have numerous hydrolytic
(a) Peroxisomes enzymes.
(b) Golgi bodies (b) The hydrolytic enzymes of lysosomes are
(c) Polysomes active under acidic pH.
(d) Endoplasmic reticulum (c) Lysosomes are membrane bound
18. The biosynthesis of ribosomal RNA occurs structures.
in: (2020 Covid Re-NEET) (d) Lysosomes are formed by the process of
(a) Golgi apparatus Packaging in the endoplasmic reticulum.
(b) Microbodies 24. The concept of “Omnis cellula-e cellula”
(c) Nucleolus regarding cell division was first proposed by
(d) Ribsosomes (2019)
19. Inclusion bodies of blue-green, purple and (a) Rudolf Virchow
green photosynthetic bacteria are: (b) Theodor Schwann
(2020 Covid Re-NEET) (c) Schleiden
(a) Gas vacuoles (d) Aristotle
(b) Centrioles 25. Which of the following statements regarding
(c) Microtubules mitochondria is incorrect? (2019)
(d) Contractile vacuoles (a) Outer membrane is permeable to
20. Match the following columns and select the monomers of carbohydrates, fats and
correct option; (2020 Covid Re-NEET) proteins.
Column-I Column-II (b) Enzymes of electron transport are

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(i) Protein synthesis embedded in outer membrane.
1. Smooth
(c) Inner membrane is convoluted with
Endoplasmic
infoldings.
Reticulum
(d) Mitochondrial matrix contains single
2. Rough (ii) Lipid synthesis
circular DNA molecule and ribosomes.
endoplasmic 26. Which among the following is not a
reticulum prokaryote? (2018)
3. Golgi complex (iii) Glycosylation (a) Saccharomyces
Centriole (iv) Spindle formation (b) Mycobacterium
4.
(c) Nostoc
(1) (2) (3) (4) (d) Oscillatoria
(a) (iii) (i) (ii) (iv) 27. Which of the following is true for nucleolus?
(b) (iv) (ii) (i) (iii) (2018)
(c) (i) (ii) (iii) (iv) (a) Larger nucleoli are present in dividing
(d) (ii) (i) (iii) (iv) cells.
21. The size of Pleuropneumonia - like (b) It is a membrane-bound structure.
Organism (PPLO) is: (c) It takes part in spindle formation.
(2020 Covid Re-NEET) (d) It is a site for active ribosomal RNA
(a) 1 - 2 𝜇𝑚 Synthesis
(b) 10 - 20 𝜇𝑚 28. The Golgi complex participates in (2018)
(c) 0.1 𝜇𝑚 (a) Fatty acid breakdown
(d) 0.02 𝜇𝑚 (b) Formation of secretory vesicles
22. The shorter and longer arms of a (c) Respiration in bacteria
submetacentric chromosome are referred to (d) Activation of amino acid
as (2019) 29. Which of the following events does not occur
(a) s-arm and l-arm respectively in rough endoplasmic reticulum? (2018)
(b) p-arm and q-arm respectively (a) Protein folding
(c) q-arm and p-arm respectively (b) Protein glycosylation
(d) m-arm and n-arm respectively (c) Cleavage of signal peptide
(d) Phospholipid synthesis

444 CHANNEL
JOIN TELEGRAM
30. Many ribosomes may associate with a single (c) RER → Cis face of Golgi body → Trans
mRNA to form multiple copies of a face of Golgi body → Secretory vesicles
polypeptide simultaneously. Such strings of (d) Cis face of Golgi body → Trans face of
ribosomes are termed as (2018) Golgi body → RER → Secretory vesides
(a) Polysome 36. The type of ribosomes is same in (2017)
(b) Polyhedral bodies (a) Eukaryotic cytoplasm, mitochondria and
(c) Plastidome endoplasmic reticulum
(d) Nucleosome (b) Cytoplasm of eukaryotic cells, their
31. Select the incorrect match: (2018) mitrochondria and chloroplasts
(a) Lampbrush - Diplotene (c) Cytoplasm of eukaryotic cells, their
chromosomes bivalents chloroplasts and microbodies
Allosomes - Sex (d) Prokaryotes, mitochondria and
(b) Chloroplasts
chromosomes
37. Reserved material in prokaryotic cells is
(c) Submetacentric - L-shaped stored as: (2017)
chromosomes chromosomes (a) Basal body
(d) Polytene - Oocytes of (b) Inclusion bodies
chromosomes amphibians (c) Mesosome
(d) Polysome
32. Which of the following cell organelles is 38. A complex of ribosomes attached to a single
responsible for extracting energy from strand of mRNA is known as: (2017)
carbohydrates to form ATP? (2017) (a) Okazaki fragment
(a) Lysosome (b) Polymer

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Ribosome (c) Polyribosome
(c) Chloroplast (d) Polypeptide
(d) Mitochondrion 39. A cell organelle containing hydrolytic
33. Which of the following components provides enzymes is: (2016 - II)
sticky character to the bacterial cell? (2017) (a) Ribosome
(a) Cell wall (b) Mesosome
(b) Nuclear membrane (c) Lysosome
(c) Plasma membrane (d) Microsome
(d) Glycocalyx 40. Select the wrong statement: (2016 - II)
34. The correct sequence of involvement of cell (a) Cyanobacteria lack flagellated cells.
organelles in secretion of proteins from the (b) Mycoplasma is a wall-less
cell is: (2017) microorganism
(a) Nucleus → Endoplasmic reticulum → (c) Bacterial cell wall is made up of
Ribosomes → Golgi apparatus → peptidoglycan.
Secretory vesicles → Plasma membrane (d) Pilli and fimbriae are mainly involved in
(b) Nucleus → Ribosomes → Endoplasmic motility of bacterial cells
reticulum → Golgi apparatus → 41. Select the mismatch: (2016 - II)
Secretory vesicles → Plasma membrane (a) Protists - Eukaryotes
(b) Nucleus → Ribosomes → Endoplasmic (b) Methanogens - Prokaryotes
reticulum → Lysosomes → Plasma (c) Gas vacuoles - Green bacteria
membrane (d) Large central vacuoles - Animal cells
(d) Nucleus → Endoplasmic reticulum → 42. Microtubules are the constituents of:
Ribosomes → Golgi apparatus → (2016 - I)
Lysosomes → Plasma membrane (a) Cilia, Flagella and Peroxisomes
35. Which of the following pathways is involved (b) Spindle fibres, Centrioles and Cilia
for packaging of secretory proteins? (2017) (c) Centrioles, Spindle fibres and Chromatin
(a) RER → Trans face of Golgi body → Cis (d) Centrosome, Nucleosome and Centrioles
face of Golgi body → Secretory vesicles 43. Spindle fibres attach on to: (2016 - I)
(b) Trans face of Golgi body → Cis face of (a) Telomere of the chromosome
Golgi body → RER → SER → Secretory (b) Kinetochore of the chromosome
veiscles
445 CHANNEL
JOIN TELEGRAM
 (c) Centromere of the chromosome A. Thylakoids (i) Disc-shaped sacs
(d) Kinetosome of the chromosome in Golgi apparatus
44. Mitochondria and chloroplast are
(A) Semi-autonomous organelles B. Cristae (ii) Condensed
(B) Formed by division of pre-existing structure of DNA
organelles and they contain DNA but C. Cisternae (iii) Flat membranous
lack protein synthesizing machinery sacs in
Which one of the following options is
Stroma
correct? (2016 - I)
(a) Both (A) and (B) are correct D. Chromatin (iv) Infoldings in
(b) (B) is true but (A) is false mitochondria
(c) (A) is true but (B) is false
(a) A-(iii), B-(iv), C-(i), D-(ii)
(d) Both (A) and (B) are false
(b) A-(iii), B-(i), C-(iv), D-(ii)
45. Which one of the following is not an
(c) A-(iii), B-(iv), C-(ii), D-(i)
inclusion body found in prokaryotes?
(d) A-(iv), B-(iii), C-(i), D-(ii)
(2015)
52. Cellular organelles with membranes are:
(a) Glycogen granule
(2015 Re)
(b) Polysome
(c) Phosphate granule (a) Chromosomes, ribosomes and
(d) Cyanophycean granule endoplasmic reticulum
46. The chromosomes in which centromere are (b) Endoplasmic reticulum, ribosomes and
situated close to one end are: (2015) nuclei
(a) Telocentric (c) Lysosomes, Golgi apparatus and

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Sub-metacentric mitochondria
(c) Metacentric (d) Nuclei, ribosome and mitochondria
(d) Acrocentric 53. Balbiani rings are sites of: (2015 Re)
47. Select the correct matching in the following (a) Nucleotide synthesis
pairs: (2015) (b) Polysaccharide synthesis
(a) Rough ER – Synthesis of glycogen (c) RNA and protein synthesis
(b) Rough ER – Oxidation of fatty acids (d) Lipid synthesis
(c) Smooth ER – Oxidation of phospholipids 54. Chromatophores take part in: (2015 Re)
(d) Smooth ER – Synthesis of lipids (a) Growth
48. The structures that are formed by stacking (b) Movement
of organized flattened membranous sacs in (c) Respiration
the chloroplasts are: (2015) (d) Photosynthesis
(a) Stroma lamellae 55. The structures that help some bacteria to
(b) Stroma attach to rocks and / or host tissues are:
(c) Cristae (2015 Re)
(d) Grana
49. Nuclear envelope is a derivative of: (2015) (a) Fimbriae
(a) Microtubules (b) Mesosomes
(b) Rough endoplasmic reticulum (c) Holdfast
(c) Smooth endoplasmic reticulum (d) Rhizoids
(d) Membrane of Golgi complex 56. Which of the following structures is not
50. DNA is not present in: (2015) found in a prokaryotic cell? (2015 Re)
(a) Nucleus (a) Ribosome
(b) Mitochondria (b) Mesosome
(c) Chloroplast (c) Plasma membrane
(d) Ribosomes (d) Nuclear envelope
51. Match the columns and identify the correct 57. Which of the following is not membrane-
option. (2015 Re) bound? (2015 Re)
(a) Ribosomes
Column I Column II
(b) Lysosomes
(c) Mesosomes
446 CHANNEL
JOIN TELEGRAM
 (d) Vacuoles (b) Rough endoplasmic reticulum,
58. The motile bacteria are able to move by: formation of glycoproteins
(2014)
(c) Golgi apparatus, protein synthesis
(a) Pili
(b) Fimbriae (d) Golgi apparatus, formation of
(c) Flagella Glycolipids
(d) Cilia
64. A major site for synthesis of lipids is: (2013)
59. The solid linear cytoskeleton elements
(a) Nucleoplasm
having a diameter of 6 nm and made up of
(b) RER
a single type of monomer are known as:
(c) SER
(2014)
(d) Symplast
(a) Lamins
65. The Golgi complex plays a major role:
(b) Microtubules
(2013)
(c) Microfilaments
(a) In post translational modification of
(d) Intermediate filaments
proteins and glycosidation of lipids
60. The osmotic expansion of a cell kept in
(b) In trapping the light and transforming it
water is chiefly regulated by: (2014)
into chemical energy
(a) Ribosomes
(c) In digesting proteins and carbohydrates
(b) Mitochondria
(d) As energy transferring organelles
(c) Vacuoles
(d) Plastids
61. Which structures perform the function of
mitochondria in bacteria? (2014)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) Mesosomes
(b) Nucleoid
(c) Ribosomes
(d) Cell wall
62. Match the following and select the correct
answer: (2014)
A. Centriole i. Infoldings in
mitochondria

B. Chlorophyll ii. Thylakoids

C. Cristae iii. Nucleic acids

D. Ribozymes iv. Basal body cilia or

flagella

(a) A-iv B-iii C-i D-ii

(b) A-iv B-ii C-i D-iii
(c) A-i B-ii C-iv D-iii
(d) A-i B-iii C-ii D-iv
63. Which one of the following organelle in the
figure correctly matches with its function?
(2013)

(a) Rough endoplasmic reticulum,

protein synthesis

447 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (d) S35. Ans. (c)
S2. Ans. (a) S36. Ans. (d)
S3. Ans. (b) S37. Ans. (b)
S4. Ans. (c) S38. Ans. (c)
S5. Ans. (b) S39. Ans. (c)
S6. Ans. (c) S40. Ans. (d)
S7. Ans. (d) S41. Ans. (d)
S8. Ans. (c) S42. Ans. (b)
S9. Ans. (c) S43. Ans. (b)
S10. Ans. (b) S44. Ans. (c)
S11. Ans. (c) S45. Ans. (b)
S12. Ans. (d) S46. Ans. (d)
S13. Ans. (b) S47. Ans. (d)
S14. Ans. (a) S48. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S15. Ans. (a) S49. Ans. (b)
S16. Ans. (b) S50. Ans. (d)
S17. Ans. (c) S51. Ans. (a)
S18. Ans. (d) S52. Ans. (c)
S19. Ans. (c) S53. Ans. (c)
S20. Ans. (b) S54. Ans. (d)
S21. Ans. (d) S55. Ans. (a)
S22. Ans. (a) S56. Ans. (d)
S23. Ans. (b) S57. Ans. (a)
S24. Ans. (a) S58. Ans. (c)
S25. Ans. (d) S59. Ans. (c)
S26. Ans. (a) S60. Ans. (c)
S27. Ans. (d) S61. Ans. (a)
S28. Ans. (b) S62. Ans. (b)
S29. Ans. (d) S63. Ans. (a)
S30. Ans. (a) S64. Ans. (c)
S31. Ans. (d) S65. Ans. (a)
S32. Ans. (d)
S33. Ans. (d)
S34. Ans. (b)

448 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(d)
The ribosome consists of structural
RNAs and about 80 different proteins.
S2. Ans.(a)
The endomembrane system in a cell
includes: The nuclear envelope, The
endoplasmic reticulum (ER), The Golgi
apparatus (Golgi complex), Lysosomes,
Vesicles, The plasma membrane
S3. Ans.(b)
Escherichia coli contains 4.6 x 10º base
pairs
Haploid content of human DNA contains
3.3 × 10º base pairs
S8. Ans.(c)
Substances that have a hydrophilic
moiety find it difficult to pass through
the plasma membrane; thus, their
movement has to be facilitated.
S9. Ans.(c)

An elaborate network of filamentous Lysosomes contain hydrolytic enzymes

proteinaceous structures consisting of
microtubules, microfilaments and
intermediate filaments present in
cytoplasm is collectively referred to as
the cytoskeleton. It is involved in many
functions such as mechanical support,
motility, maintenance of the shape of
the cell.
which become active at acidic pH.
If pH in lysosomes is increased to
alkaline or basic then hydrolytic
enzymes will become inactive.
S10. Ans.(b)
A healthy adult man has, on an average,
5 millions to 5.5 millions of RBCs

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(erythrocytes) mm of blood.
S4. Ans.(c)
S11. Ans.(c)
Option C: Both Statement I and
Statement II are correct In prokaryotes, ER is absent be it RER
or SER.
S5. Ans.(b)
S12. Ans.(d)
A critical role in the processing and
Mature sieve tube elements do not have
packaging of proteins and lipids
nucleus but have cytoplasm.
following their synthesis in the
(Anucleated living cells).
endoplasmic reticulum. It also has a
role in the formation of glycoproteins S13. Ans.(b)
and glycolipids. A-(iii) B-(iv) C-(i) D-(ii)
(A) and (C) only. S14. Ans.(d)
S6. Ans.(c) I. Telocentric Centromere
Porins are huge pores in outer placement very
membrane of mitochondria. Leg
haemoglobin turns the nodules pink in close to the top,
colour p arms barely
H+ accumulation in lumen of thylakoid
visible if visible
occurs during photosynthetic electron
transport. at all.
Respiration is an amphibolic pathway. II. Acrocentric q arms are still
S7. Ans.(d) much longer
Genetic material of Bacteriophage x 174 than
contains 5386 nucleotides
the p arms, but
Bacteriophage lambda contains 48502
base pairs the p arms are

449 CHANNEL
JOIN TELEGRAM
 longer than S20. Ans.(d)
those in The smooth endoplasmic reticulum
(SER) is the primary location for lipid
telocentric.
production. SER produces
III. Submetacentric p and q arms lipid-like steroidal hormones in animal
are very close cells.
RER is found in a lot of cells that are
in length but
involved in protein synthesis and
not equal. secretion. They are long and
IV. Metacentric p and q arms contiguous with the nucleus's outer
membrane.
are equal in
The Golgi apparatus is a key site for the
length. production of glycoproteins and
glycolipids. During cell division in
S15. Ans.(a)
animal cells, the centrioles
Endomembrane system includes the
create the basal body of cilia or flagella,
endoplasmic reticulum (ER), Golgi
as well as spindle fibres that give rise to
apparatus, and lysosomes. Vesicles also
the spindle apparatus.
allow the exchange of membrane
S21. Ans.(c)
S16. Ans.(a)
Bacteria, blue-green algae, mycoplasma,
In prokaryotic cells, reserve material is
and PPLO are examples of prokaryotic

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
stored in the cytoplasm as inclusion
bodies. These are unbound by
any membrane system and are found
floating around in the cytoplasm.
Food particle ingestion is aided by
lysosomes.
S17. Ans.(b)
The production of glycoproteins and
glycolipids takes place in the Golgi
bodies.
S18. Ans.(c)
Nucleolus is a location where active
ribosomal RNA synthesis takes place. In
cells that are actively synthesising
proteins, nucleoli are larger and more
numerous.
S19. Ans.(a)
In prokaryotic cells, reserve material is
stored in the cytoplasm as inclusion
bodies. Phosphate granules,
cyanophycean granules, and glycogen
granules, for example, are not bound by
any membrane system and lie free in
the cytoplasm. Blue green, purple, and
green photosynthetic bacteria have gas
vacuoles.
cells (Pleuro Pneumonia Like
Organisms). PPLO has a diameter of 0.1
𝜇𝑚.
S22. Ans.(b)
The 'p' arm (p = petite, i.e. short) and
the 'q' arm (q = long) of the chromosome
are the shorter and longer arms,
respectively.
S23. Ans.(d)
Lysosomes bud off from transface to
Golgi bodies Precursor of lysosomal
enzymes are synthesized
by RER and then send to Golgi bodies
for further processing. So, the not
correct answer is Lysosomes are formed
by the process of packaging in the
endoplasmic reticulum.
S24. Ans.(a)
Rudolf Virchow was the first to
introduce the concept of "Omnis cellula-
e cellula" in relation to cell theory.
S25. Ans.(b)
Electron transport enzymes are situated
in the inner membrane of mitochondria.
S26. Ans.(a)
Saccharomyces is a yeast genus.

450 CHANNEL
JOIN TELEGRAM
S27. Ans.(d)
In the nucleus of a cell, the nucleolus is
a tiny compact spherical structure.
Ribosome biosynthesis takes place here.
S28. Ans.(b)
The Golgi complex (apparatus), like the
ER, is a packaging organelle. It
concentrates and packs proteins and
lipids from the ER into secretory
vesicles after modifying them.
S29. Ans.(d)
Phospholipid production occurs in the
cystosol close to the ER membrane.
Phospholipids are made in the smooth
endoplasmic reticulum from
phosphatidic acid and 1, 2
diacylglycerol.
S30. Ans.(a)
Polysome or polyribosome is a cluster of
ribosomes bound together by a strand of
mRNA in
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S31. Ans.(d)
Polytene chromosomes are present in
salivary glands of Dipteran larvae,
according to NCERT
S32. Ans.(d)
Mitochondria is where carbohydrates
are aerobically oxidised to produce ATP.
S33. Ans.(d)
The glycocalyx or slime layer is
responsible for the bacterial wall's
stickiness. Glycoproteins abound in
this stratum.
S34. Ans.(b)
The nucleus, ribosomes, endoplasmic
reticulum, golgi apparatus, secretory
vesicles, and plasma membrane
are the correct order of cell organelles
involved in protein secretion.
S35. Ans.(c)
Materials from the RER that will be
packaged as vesicles fuse with the cis
face of the Golgi apparatus
and migrate towards the developing face
before being released from the trans
face.
451 CHANNEL
JOIN TELEGRAM
S36. Ans.(d)
70S ribosomes are found in
mitochondria, chloroplasts, and
bacterial ribosomes.
S37. Ans.(b)
NCERT (XI) Ch - 8, Pg. 129 In
prokaryotic cells, reserve material is
stored in the cytoplasm as inclusion
bodies.
S38. Ans.(c)
In the cytoplasm, a polyribosome or
polysome is formed when many
ribosomes connect to a single strand of
mRNA.
S39. Ans.(c)
Almost all types of hydrolytic enzymes
(hydrolases – lipases, proteases,
carbohydrases) were discovered to
be abundant in the isolated lysosomal
vesicles, which are best active at acidic
pH.
S40. Ans.(d)
The pili are tubular elongated
structures formed of a unique protein.
Fimbriae are small bristle-like threads
that emerge from the cell's surface. They
are known to aid in the attachment of
bacteria to rocks in streams
as well as host tissues in some bacteria,
but they do not play a role in motility.
Plant cells have cell walls, plastids, and
a big central vacuole, which are lacking
in animal cells.
S41. Ans.(d)
Plant cells have cell walls, plastids, and
a large central vacuole, which are
absent in animal cells. Animal
cells, on the other hand, have
centrioles, which are lacking in
practically all plant cells.
S42. Ans.(b)
Microtubules are the constituents of
spindle fibres, centrioles, and cilia.
S43. Ans.(c)
Spindle fibres adhere to the
chromosome's kinetochore.
S44. Ans.(c)
Mitochondria and chloroplast are semi-
autonomous organelles that include
single circular DNA, a few RNA
molecules, ribosomes (70S), and other
proteins- synthesis-related components.
S45. Ans.(b)
In prokaryotic cells, reserve material is
retained in the cytoplasm as inclusion
bodies, such as phosphate granules,
glycogen granules, and cyanophycean
granules.
S46. Ans.(d)
The centromere is located in acrocentric
chromosomes. At its ends, forming one
extremely short and one extremely long
arm.
S.47 Ans.(d)
RER stands for protein synthesis.
SER stands for lipid and steroidal
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
hormone synthesis.
S48. Ans.(d)
The stroma contains a number of
thylakoids, which are flattened
membrane sacs that are organised.
Thylakoids are stacked in grana, which
are stacks of coins.
The nucleus is a double membrane
bound organelle.
S49. Ans.(b)
Its outer membrane is normally
contiguous with the ribosome-bearing
endoplasmic reticulum. Except for
ribosomes, the nucleus, chloroplast,
and mitochondria all carry DNA.
S50. Ans.(d)
Ribosomes are made up of ribonucleic
acid (RNA) and proteins and do not have
a membrane surrounding them.
S51. Ans.(a)
The stroma of chloroplasts contains a
number of organised flattened
membrane sacs called thylakoids.
The cristae form a series of infoldings in
the inner mitochondrial membrane as it
moves towards the matrix. Golgi bodies
are made up of multiple flat, disc-
452 CHANNEL
JOIN TELEGRAM
shaped sacs or cisternae that are
stacked parallel to one other and range
in diameter from 0.5 to 1.0 m.
S52. Ans.(c)
Ribosomes are the granular structures
first observed by George Palade. They
are not encased in any kind of
membrane.
S53. Ans.(c)
Polytene chromosomes were discovered
for the first time in the salivary gland of
Chironomus tantans. They have puff or
balbiani rings that create lateral
loops where DNA becomes active and
copies of RNA are produced.
S54. Ans.(d)
Other membrane expansions into the
cytoplasm of some prokaryotes, such as
cyanobacteria, are called
chromatophores, and they carry
photosynthetic pigments.
S55. Ans.(a)
Fimbriae are small bristle-like fibres
that emerge from the cell's surface. They
are known to aid in the bacteria's
adhesion to rocks in streams as well as
host tissues.
S56. Ans.(d)
Membrane-bound organelles do not
exist in prokaryotic cells.
They don't have a nucleus that is
attached to the membrane.
S57. Ans.(a)
Riibosomes are granular formations that
are primarily made up of RNA and
proteins. They are not encased in any
kind of membrane.
S58. Ans.(c)
Flagella helps with motility. Pili and
fimbriae are not involved in motility.
S59. Ans.(c)
Microfilament is a single monomer with
a diameter of 5-7 nm.
S60. Ans.(c)
Osmoregulation is the purpose of
vacuoles.
S61. Ans.(a)
In prokaryotes, similar to mitochondria,
the mesosome aids in respiration.
S62. Ans.(b)
On flagella, the centriole is the basal
body cilia.
Infoldings in mitochondria - Chlorophyll
– Thylakoid Cristae Nucleic acid
ribozymes
SER: Ribosome absent, engaged in lipid
synthesis
S63. Ans.(a)
SER: Ribosome absent, involved in lipid
synthesis
RER: Ribosomes are present and play a
role in protein synthesis.
S64. Ans.(c)
SER is the location of lipid production.
S65. Ans.(a)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Plays a key function in protein post-
translational modification and lipid
glycosidation. It's also useful
for packaging.

453 CHANNEL
JOIN TELEGRAM
 Chapter 10
Sankalp Bharat
Cell Cycle & Cell Division

1. The process of appearance of recombination 6. Select the correct statements.

nodules occurs at which sub stage of A. Tetrad formation is seen during
prophase I in meiosis? (2023) Leptotene.
(a) Pachytene B. During Anaphase, the centromeres split
(b) Diplotene and chromatids separate.
(c) Diakinesis C. Terminalization takes place during
(d) Zygotene Pachytene.
2. Which of the following stages of meiosis D. Nucleolus, Golgi complex and ER are
involves division of centromere? reformed during Telophase.
(2023) E. Crossing over takes place between sister
(a) Telophase chromatids of homologous chromosome.
(b) Metaphase I Choose the correct answer from the options
(c) Metaphase II given below: (2023)
(d) Anaphase II (a) Band D only
3. The process of appearance of recombination (b) A. C and E only
nodules occurs at which sub stage of (c) Band E only
prophase I in meiosis? (2023) (d) A and C only

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) Diakinesis 7. Given below are two statements:
(b) Zygotene Statement I: During GO phase of cell cycle,
(c) Pachytene the cell is metabolically inactive.
(d) Diplotene Statement II: The centrosome undergoes
4. Among eukaryotes, replication of DNA takes duplication during S phase of interphase.
place in: (2023) In the light of the above statements, choose
(a) G₂ phase the most appropriate answer from the
(b) M phase options given below: (2023)
(c) S phase (a) Both Statement i and Statement II are
(d) G, phase incorrect
5. Match List-l with List-II: (b) Statement I is correct but Statement Il is
List – I LIst – II incorrect,
M Phase (i) Proteins are (c) Statement I is incorrect but Statement. II
A is correct
synthesized
(d) Both Statement and Statement II are
B G₂ Phase 2 (ii) Inactive phase Correct
C Quiescent stage (iii) Interval 8. Doubling of the number of chromosomes
between can be achieved by disrupting mitotic cell
mitosis and division soon after: (2023)
initiation of (a) Anaphase
DNA (b) Telophase
replication (c) Prophase
(iv) Equational (d) Metaphase
D G1 Phase 9. During which stages of mitosis and meiosis,
division
respectively does the centromere of each
Choose the correct answer from the options chromosome split? (2023)
given below : (2023) (a) Metaphase, Metaphase II
(a) A-II, B-IV, C-I, D-III (b) Prophase, Telophase
(b) A-III, B-II, C-IV, D-I (c) Telophase, Anaphase
(c) A-IV, B-II, C-I, D-III (d) Anaphase, Anaphase
(d) A-IV, B-I, C-II, D-III
464 CHANNEL
JOIN TELEGRAM
10. Which stage of meiosis can last for months (b) Bivalent
or years in the oocytes of some vertebrates? (c) Sites at which crossing over occurs
(2022) (d) Terminalization
(a) Diakinesis 16. Match List-l with List-II:
(b) Leptotene List – I LIst – II
(c) Pachytene Metacentric (i) Centromere
(d) Diplotene A
chromosome situated close
11. Identify the correct sequence of events to the end
during Prophase I of meiosis: forming one
(a) Synapsis of homologous chromosomes extremely
(b) Chromosomes become gradually visible short and one
under microscope very long arms
(c) Crossing over between non-sister
chromatids of homologous chromosomes B Acrocentric (ii) Centromere at
(d) Terminalisation of chiasmata chromosome the terminal
(e) Dissolution of synaptonemal complex end
Choose the correct answer from the options C Submetacentric (iii) Centromere in
given below: (2022) the middle
(a) (a), (c), (d), (e), (b) forming two
(b) (a), (b), (c), (d), (e) equal arms of
(c) (b), (c), (d), (e), (a) chromosomes
(d) (b), (a), (c), (e), (d)
12. Bivalent or Tetrad formation is a D Telocentric (iv) Centromere
chromosome slightly away

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
characteristic feature observed during from the
(2022) middle
(a) Chiasmata in zygotene stage forming one
(b) Synaptonemal complex in zygotene stage shorter arm
(c) Chiasmata in Diplotene stage and one longer
(d) Synaptonemal complex in Pachytene arm
Stage
13. With respect to metaphase, which of the Choose the correct answer from the options
following statements is incorrect? (2022) given below: (2022)
(a) Chromosomes lie at the equator of the (a) (a)-(iii), (b)-(i), (c)-(iv), (d)-(ii)
cell (b) (a)-(i), (b)-(iii), (c)-(ii), (d)-(iv)
(b) Complete disintegration of nuclear (c) (a)-(i), (b)-(ii), (c)-(iv), (d)-(i)
envelope takes place (d) (a)-(1), (b)-(1), (c)-(iii), (d)-(iv)
(c) Chromosomes are highly condensed 17. Regarding Meiosis, which of the statements
(d) Metaphase chromosomes are made up of is incorrect? (2022)
four sister chromatids held together by (a) There are two stages in Meiosis, Meiosis-
centromere I and II
14. Which one of the following never occurs (b) DNA replication occurs in S phase of
during mitotic cell division (2022) Meiosis-II
(a) Spindle fibres attach to kinetochores of (c) Pairing of homologous chromosomes and
chromosomes recombination occurs in Meiosis-l
(b) Movement of centrioles towards opposite (d) Four haploid cells are formed at the end
poles of Meiosis-II
(c) Pairing of homologous chromosomes 18. Select the incorrect statement with
(d) Coiling and condensation of the reference to mitosis: (2022)
chromatids (a) All the chromosomes lie at the equator at
15. The appearance of recombination nodules metaphase
on homologous chromosomes during (b) 8 Spindle fibres attach to centromere of
meiosis characterizes: (2022) chromosomes
(a) Synaptonemal complex (c) Chromosomes decondense at telophase

465 CHANNEL
JOIN TELEGRAM
 (d) Splitting of centromere occurs at 1. Zygotene (i) Terminalization
Anaphase
19. Which of the following stages of meiosis 2. Pachytene (ii) Chiasmata
involves division of centromere? (2021)
3. Diplotene (iii) Crossing over
(a) Metaphase-II
(b) Anaphase-II 4. Diakinesis (iv) Synapsis
(c) Telophase-II
(d) Metaphase-I Select the correct option from the following:
20. Match List-1 with List-2 (2021) (1) (2) (3) (4)
List - I List -II (a) (iv) (iii) (ii) (i)
(b) (i) (ii) (iv) (iii)
A. S phase (i) Proteins are
(c) (ii) (iv) (iii) (i)
synthesized
(d) (iii) (iv) (i) (ii)
B. 𝐺2 phase (ii) Inactive phase 25. Some dividing cells exit the cell cycle and
(iii) Interval enter vegetative inactive stage. This is called
C. Quiescent between
quiescent stage (𝐺0 ). This process occurs at
Stage mitosis and
the end of: (2020)
initiation of DNA (a) 𝐺1 phase
replication (b) S phase
(iv) DNA replication (c) 𝐺2 phase
D. 𝐺1 phase
(d) M phase
Choose the correct answer from the options 26. In a mitotic cycle, the correct sequence of
given below. phases is (2020 Covid Re-NEET)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) A-(iv) B-(ii) C-(iii) D-(i) (a) 𝐺1 , S, 𝐺2 , M
(b) A-(iv) B-(i) C-(ii) D-(iii)
(c) A-(ii) B-(iv) C-(iii) D-(i) (b) M, 𝐺1 , 𝐺2 , S
(d) A-(iii) B-(ii) C-(i) D-(iv) (c) 𝐺1 , 𝐺2 , S, M
21. The fruit fly has 8 chromosomes (2n) in
(d) S, 𝐺1 , 𝐺2 , M
each cell. During interphase of Mitosis if the
number of chromosomes at 𝐺1 phase is 8, 27. Attachment of spindle fibers to
what would be the number of chromosomes kinetochores of chromosomes becomes
after S phase? (2021) evident in: (2020 Covid Re-NEET)
(a) 16 (a) Telophase
(b) 4 (b) Prophase
(c) 32 (c) Metaphase
(d) 8 (d) Anaphase
22. Which stage of meiotic prophase shows 28. Match the following events that occur in
terminalization of chiasmata as its their respective phases of cell cycle and
distinctive feature? (2021) select the correct option:
(a) Zygotene (2020 Covid Re-NEET)
(b) Diakinesis
1. 𝐺1 phase (i) Cell grows and
(c) Pachytene
organelle
(d) Leptotene
duplication
23. The centriole undergoes duplication during:
(2021) 2. S phase DNA replication
(a) Prophase (ii) and chromosome
(b) Metaphase duplication
(c) G2 phase
(d) S-phase 3. 𝐺2 phase (iii) Cytoplasmic
24. Match the following with respect to meiosis: growth
(2020) 4. Metaphase (iv) Alignment of
Column -I Column -II in chromosomes
M-phase

466 CHANNEL
JOIN TELEGRAM
 (1) (2) (3) (4) 36. Which of the following options gives the
(a) (iii) (iv) (i) (ii) correct sequence of events during mitosis?
(b) (iv) (i) (ii) (iii) (2017)
(c) (i) (ii) (iii) (iv) (a) Condensation → Nuclear membrane
(d) (ii) (iii) (iv) (i) disassembly → Crossing over →
29. Identify the correct statement with regard to Segregation → Telophase
G1 phase (Gap 1) of interphase. (2020) (b) Condensation → Nuclear membrane
(a) Reorganisation of all cell components disassembly → Arrangement at equator
takes place. → Centromere division →Segregation →
(b) Cell is metabolically active, grows but Telophase
does not replicate its DNA. (c) Condensation → Crossing over →
(c) Nuclear division takes place. Nuclear membrane disassembly →
(d) DNA synthesis or replication takes place. Segregation → Telophase
30. Dissolution of the synaptonemal complex (d) Condensation → Arrangement at
occurs during: (2020) equator → Centromere division →
(a) Zygotene Segregation → Telophase
(b) Diplotene 37. DNA replication in bacteria occurs: (2017)
(c) Leptotene (a) During S-phase
(d) Pachytene (b) Within nucleolus
31. During Meiosis-I, in which stage synapsis (c) Prior to fission
takes place? (2020 Covid Re-NEET) (d) Just before transcription
(a) Zygotene 38. At what phase of meiosis homologous
(b) Diplotene chromosomes are separated? (2017)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) Leptotene (a) Anaphase-II
(d) Pachytene (b) Prophase-I
32. The correct sequence of phases of cell cycle (c) Prophase-II
is (2019) (d) Anaphase-I
(a) M → G1→ G2→ S 39. During cell growth, DNA synthesis takes
(b) G1→ G2→ S → M place in: (2016 - II)
(c) S → G1→ G2→ M (a) G2 phase
(d) G1→ S → G2→ M (b) M phase
33. Cell in G0 phase (2019) (c) S phase
(a) Exit the cell cycle (d) G1 phase
(b) Enter the cell cycle 40. Which of the following is not a characteristic
(c) Suspend the cell cycle feature during mitosis in somatic cells?
(d) Terminate the cell cycle (2016 - I)
34. The stage during which separation of the (a) Spindle fibres
paired homologous chromosomes begins is (b) Disappearance of nucleolus
(2018) (c) Chromosome movement
(a) Pachytene (d) Synapsis
(b) Diplotene 41. Match the stages of meiosis in Column–I to
(c) Diakinesis their characteristic features in Column–II
(d) Zygotene and select the correct option using the
35. Which of the following statements is correct codes given below: (2016 - II)
with respect to cell cycle? (2017) Column I Column II
(a) DNA content of cell remains constant Pachytene (i)
during entire cell cycle A. Pairing of
(b) A cell in G1 phase has double the homologous
amount of DNA than a cell in G2 phase chromosomes
(c) Each chromosome has two chromatids in Metaphase-I (ii)
B. Terminalisation
G1 phase
of chiasmata
(d) Nerve cells in adult human are in G0
State

467 CHANNEL
JOIN TELEGRAM
 C. Diakinesis (iii) Crossing over (b) Four times the number of chromosomes
takes place and twice the amount of DNA
Zygotene (iv) (c) Twice the number of chromosomes and
D. Chromosomes twice the amount of DNA
align at (d) Same number of chromosomes but twice
equatorial plate the amount of DNA
45. Arrange the following events of meiosis in
Codes:
correct sequence: (2015 Re)
(a) A-(ii) B-(iv) C-(iii) D-(i)
A. Crossing over
(b) A-(iv) B-(iii) C-(ii) D-(i)
B. Synapsis
(c) A-(iii) B-(iv) C-(ii) D-(i)
C. Terminalisation of chiasmata
(d) A-(i) B-(iv) C-(ii) D-(iii)
D. Disappearance of nucleolus
42. In meiosis, crossing over is initiated at:
(a) (B), (A), (C), (D)
(2016 - I)
(b) (A), (B), (C), (D)
(a) Pachytene
(c) (B), (C), (D), (A)
(b) Leptotene
(d) (B), (A), (D), (C)
(c) Zygotene
46. During which phase(s) of cell cycle, amount
(d) Diplotene
of DNA in a cell remains at 4C level if the
43. Select the correct option: (2015)
initial amount is denoted as 2C? (2014)
Column I Column II
(a) G2 and M
A. Synapsis (i) Anaphase-II (b) G0 and G1
aligns the (c) G1 and S
(d) Only G2

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
homologous
47. In ‘S’ phase of the cell cycle: (2014)
chromosomes
(a) Amount of DNA is reduced to half in each
B. Synthesis of (ii) Zygotene
cell
RNA and (b) Amount of DNA doubles in each cell
protein (c) Amount of DNA remains same in each
C. Action of (iii) G2 cell
enzyme -phase (d) Chromosome number is increased
recombinase 48. The enzyme recombinase is required at
(iv) Anaphase-I which stage of meiosis? (2014)
D. Centromeres
(a) Diakinesis
do not
(b) Pachytene
separate
(c) Zygotene
but (d) Diplotene
chromatids 49. A stage in cell division is shown in the
move figure. Select the answer which gives correct
towards identification of the stage with its
opposite poles characteristics: (2013)
(v) Pachytene

(a) A-(i) B-(ii) C-(iii) D-(iv)

(b) A-(ii) B-(iii) C-(iv) D-(v)
(c) A-(ii) B-(i) C-(iii) D-(iv)
(d) A-(ii) B-(iii) C-(v) D-(iv)
44. A somatic cell that has just completed the S
phase of its cell cycle, as compared to
gamete of the same species, has: (a) Telophase Endoplasmic
(2015 Re) reticulum and
(a) Twice the number of chromosomes and nucleolus not
four times the amount of DNA reformed yet.

468 CHANNEL
JOIN TELEGRAM
 (b) Telophase Nuclear envelope
reforms, Golgi
complex reforms.

(c) Late Anaphase Chromosomes

move away from
equatorial plate,
Golgi complex not
present.

(d) Cytokinesis Cell plate formed,

mitochondria

50. The complex formed by a pair of synapsed

homologous chromosomes is called: (2013)
(a) Axoneme
(b) Equatorial plate
(c) Kinetochores
(d) Bivalent

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

469 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (a) S33. Ans. (a)

S2. Ans. (d) S34. Ans. (b)

S3. Ans. (c) S35. Ans. (d)

S4 Ans. (c) S36. Ans. (b)

S5. Ans. (d) S37. Ans. (c)

S6. Ans. (a) S38. Ans. (d)

S7. Ans. (c) S39. Ans. (c)

S8. Ans. (d) S40. Ans. (d)

S9. Ans. (d) S41. Ans. (c)

S10. Ans. (d) S42. Ans. (a)

S11. Ans. (d) S43. Ans. (d)

S12 Ans. (b) S44. Ans. (a)

S13. Ans. (d) S45. Ans. (a)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (c) S46. Ans. (d)

S15. Ans. (c) S47. Ans. (b)

S16. Ans. (a) S48. Ans. (b)

S17. Ans. (b) S49. Ans. (b)

S18. Ans. (b) S50. Ans. (d)

S19. Ans. (b)

S20. Ans. (b)

S21. Ans. (d)

S22. Ans. (b)

S23. Ans. (d)

S34. Ans. (a)

S25. Ans. (a)

S26. Ans. (a)

S27. Ans. (c)

S28. Ans. (c)

S29. Ans. (b)

S30. Ans. (b)

S31. Ans. (a)

S32. Ans. (d)

470 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(a)
Recombination nodules appear during
the pachytene stage of prophase I in
meiosis. These nodules are thought to
be involved in crossing over, a process
where homologous chromosomes
exchange genetic material. This leads to
genetic recombination, which is a
significant source of genetic variation in
sexually reproducing organisms.
S2. Ans.(d)
Splitting of centromere occurs during
anaphase of mitosis or anaphase II of
meiosis.
During Metaphase I and II,
chromosomes align at the equator.
During telophase, chromosomes reach
the respective poles.
S3. Ans.(c)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
The process of recombination occurs at
Pachytene stage of prophase I. This
stage is characterised by the
appearance of recombination nodules.
S4. Ans.(c)
Replication of DNA takes place in S-
phase of cell cycle in eukaryotes. Most
of the cell organelles duplicate in G,
phase.
S5. Ans.(d)
M phase or mitosis is the phase where
the actual cell division occurs. Mitosis is
also called equational division.
During G2 phase DNA synthesis stops
but cell synthesis RNA, proteins, etc. for
next phase.
Quiescent stage is inactive phase in
which non-dividing cells enters.
G₁ phase is the interval between mitosis
and initiation of DNA replication.
S6. Ans.(a)
1. Tetrad formation is seen during the
Zygotene stage.
2. During Anaphase, the centromeres
split and chromatids separate.
471 CHANNEL
JOIN TELEGRAM
3. Terminalization of chiasmata takes
place during Diakinesis.
4. Nucleolus, Golgi complex, and ER are
reformed during Telophase.
5. Crossing over takes place between
non-sister chromatids of homologous
chromosomes.
S7. Ans.(c)
Statement I is incorrect. The GO phase
is a state in the cell cycle in which cells
exist in a quiescent or dormant stage.
Statement II is correct. During the S
phase (synthesis phase) of interphase,
DNA replication occurs, and the
centrosome, which plays a key role in
cell division, also duplicates.
S8. Ans.(d)
The doubling of the number of
chromosomes can be achieved by
disrupting mitotic cell division soon
after DNA replication has occurred and
before the separation of sister
chromatids. This stage of mitosis is the
metaphase, where chromosomes align
in the center of the cell, prior to
separation in anaphase.
If mitosis is disrupted after this point,
sister chromatids cannot separate,
leading to a doubling of the
chromosome number in the resulting
cells.
S9. Ans.(d)
The centromere of each chromosome
splits during the anaphase stage of both
mitosis and meiosis.
In mitosis, this happens during
anaphase, when sister chromatids
separate and move to opposite poles of
the cell.
In meiosis, the centromere splits during
anaphase II, which is similar to
anaphase of mitosis, and sister
chromatids separate.
S10. Ans.(d)
In oocytes of some vertebrates, diplotene
lasts for months or years. This stage is
referred as dictyotene stage.
S11. Ans.(d)
Correct sequence of events during
Prophase I of meiosis is: (b)→(a)→
(c)→(e)→(d)
S12. Ans.(b)
Bivalent or tetrad formation is called
synapsis which is accompanied by the
formation of complex structure called
synaptonemal complex.
S13. Ans.(d)
Metaphase chromosomes are not made
up of four sister chromatids held
together by the centromere. Instead,
metaphase chromosomes consist of two
sister chromatids held together by the
centromere. The sister chromatids are
identical copies of a single chromosome
that have been replicated during the S
phase of the cell cycle.
S14. Ans.(c)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Pairing of homologous chromosomes
occurs during prophase I of meiosis.
Coiling and condensation of chromatids,
spindle fibres attachment to the
kinetochores and movement of
centrioles towards opposite poles occur
in both mitosis and meiosis.
S15. Ans.(c)
Pachytene stage of meiosis is
characterized by the appearance of
recombination nodules, the sites at
which crossing over occurs between non
sister chromatids of homologous
chromosomes.
S16. Ans.(a)
In metacentric chromosome, centromere
is in the middle of the chromosomes.
Acrocentric chromosome has
centromere close to the end of the
chromosome. In submetacentric
chromosome, centromere is slightly
away from the middle of the
chromosome. Telocentric chromosome
has terminal centromere.
S17. Ans.(b)
Meiosis involves two sequential cycles of
nuclear and cell division called meiosis-l
472 CHANNEL
JOIN TELEGRAM
and meiosis-II but only single cycle of
DNA replication.
The stage between two meiotic divisions
is called interkinesis and is generally
short lived and involves no DNA
replication.
S18. Ans.(b)
Spindle fibres attach to the kinetochores
of chromosomes.
Kinetochores are the disc shaped
structures present on sides of primary
constriction or centromere of
chromosomes.
S19. Ans.(b)
In anaphase-II, the centromeres
separate and the sister chromatids—
now individual chromosomes—move
toward the opposite poles of the cell.
The centromeres separate, and the two
chromatids of each chromosome
move to opposite poles on the spindle.
The separated chromatids are now
called chromosomes in their own
right.
S20. Ans.(b)
S21. Ans.(d)
During mitotic cell cycle if the
chromosome number in G1 phase is 8, is
remains same till metaphase.
Hence, even after S phase same
chromosome number 8 is maintained in
the cell of fruit fly.
S22. Ans.(b)
Terminalization of chiasma takes place
throughout diplotene, after crossing
over at pachytene, and terminalization
completion takes region in diakinesis.
Zygotene is the sub-stage where
synapsis among homologous
chromosomes begins.
S23. Ans.(d)
S24. Ans.(a)
Zygotene-The second stage of Prophase-
I. Chromosomes starts pairing together
in a process called synapsis.
Pachytene-The third stage of prophase-I,
bivalent chromosomes clearly appears
 as tetrads, crossing over between
homologous chromosomes occurs.
Diplotene-The fourth stage of the
prophase of meiosis, following
pachytene, during which the
paired chromosomes begin to separate
into two pairs
of chromatids and chiasmata becomes
visible. Diakinesis-The fifth and last
stage of the prophase of
meiosis, following diplotene, when the
separation of
homologous chromosomes is complete
and crossing over has occurred.
Terminalization occurs as the
chiasmata move towards the ends of the
tetrad. Thus, the correct answer is (A) -
(a) - (iv), (b) - (iii),
(c) - (ii), (d) - (i)
S25. Ans.(a)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Some cells in the adult animals do not
appear to exhibit division (e.g., heart
cells) and many other cells divide only
occasionally, as needed to replace
cells that have been lost because of
injury or cell death. These cells that do
not divide further exit G1 phase to enter
an inactive stage called quiescent
stage (G0 ) of the cell cycle.
S26. Ans.(a)
During cell division, the cell cycle is
divided into distinct phases. It is split
into two sections. The M Phase is the
time when a cell divides or undergoes
mitosis, while the interphase is the time
between two successive M phases. G1
(first gap), S (synthesis), and G2
(interphase) are the three phases of
interphase (second gap).
S27. Ans.(d)
All of the chromosomes are present in
metaphase. Coming to rest near the
equator, with one chromatid
of each chromosome attached to spindle
fibres from one pole and its sibling
chromatid joined to spindle
fibres from the opposing pole by its
kinetochore.
473 CHANNEL
JOIN TELEGRAM
S28. Ans.(c)
Cytoplasmic proliferation in the G1
phase Only DNA replication occurs
during the S phase, and the
chromosome number remains constant.
G2 phase - Cell division and duplication
of organelles. In M-phase, the
chromosomes are aligned.
Note: Although the actions described in
the question may not perfectly
correspond to the phases of the cell
cycle, the most accurate response is (c).
S29. Ans.(b)
The cell is metabolically active and
expands continually during the G1
phase, but it does not duplicate its
DNA. The S phase, also known as the
synthesis phase, is the time when DNA
is synthesised or replicated. M-Phase
involves the reorganisation of all cell
components.
S30. Ans.(b)
The breakdown of the synaptonemal
complex, as well as X-shaped structures
known as chiasmata, characterise the
diplotene stage.
S31. Ans.(a)
During zygotene, homologous
chromosomes are paired (synapsis).
S32. Ans.(d)
G1 → S → G → M is the correct
sequence of cell cycle phases.
S33. Ans.(a)
Cells in the G0 phase are considered to
have exited the cell cycle. They are in a
dormant state and do not proliferate
unless they are stimulated, yet they are
metabolically active.
S34. Ans.(b)
Diplotene is the fourth stage of
prophase-I in meiosis, when the paired
chromosomes begin to split
and appear as a 0 or 8-shaped structure
under the microscope.
S35. Ans.(d)
Nerve cells in adult human do not divide
further.
 These cells exit G1 phase to enter an
inactive stage called quiescent stage of
the cell cycle. Cells in this stage remain
metabolically active but ni longer
proliferate.
S36. Ans.(b)
The following is the right order of events
during mitosis:
(i) During early to mid-prophase, DNA
condenses, allowing chromosomes to
be seen.
(ii) Disassembly of the nuclear
membrane begins in late prophase or
the transition to metaphase.
(iii) During metaphase, chromosomes
are arranged along the equator, a
process known as congression.
(iv) During anaphase, centromere
division or splitting occurs, resulting
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
in the formation of daughter
chromosomes.
(v) During anaphase, daughter
chromosomes divide and migrate to
opposite poles, resulting in
segregation.
(vi) The production of two daughter
nuclei occurs during telophase.
S37. Ans.(c)
In bacteria, DNA replication occurs
before fission. Because of their
primordial origin, prokaryotes do not
have a well-defined S-phase.
S38. Ans.(d)
The homologous chromosomes separate
in anaphase -I, but sister chromatids
stay connected at their centromeres.
S39. Ans.(c)
The S phase, also known as the
synthesis phase, is the time when DNA
is synthesised or replicated. The
amount of DNA per cell doubles
throughout this time.
474 CHANNEL
JOIN TELEGRAM
S40. Ans.(d)
Only mitosis occurs in somatic cells.
Meiosis, on the other hand, occurs in
germ cells (sperm/ova). Chromosomes
begin pairing together during the
zygotene stage of meiosis-I, and this
process is known as synapsis.
S41. Ans.(c)
Pachytene: With the help of an enzyme
called recombinase, genetic material is
exchanged between non-sister
chromatids of two homologous
chromosomes. Chromosomes align to
the equatorial plate in Metaphase-I.
Diakinesis is the process of the
chiasmata being terminated.
Zygotene: A sophisticated structure
called the synaptonemal complex helps
similar chromosomes pair together
(synapsis).
S42. Ans.(a)
● The exchange of genetic material
between two non-
sister chromatids of homologous
chromosomes is known as crossing
over.
● Crossing over is likewise an enzyme-
Mediated process, with recombinase
as the enzyme involved.
S43. Ans.(d)
A-(ii) B-(iii) C-(v) D-(iv)
S44. Ans.(a)
Gametic Somatic cell
Ploidy n 2n
DNA c 4C
S45. Ans.(a)
Synapsis - Zygotene
Pachytene - Crossing over
Diplotene - Chiasmata Termination
The nucleolus vanishes in diakinesis.
S46. Ans.(d)
Ploidy Amount of DNA
level

G1 n 2C

S n 4C

G2 n 4C

M 2n 2C

S47. Ans.(b)
The 'S' phase denotes the time when
DNA is synthesised or replicated.
Per cell, the amount of DNA doubles.
S48. Ans.(b)
Crossing over is an enzyme-mediated
process involving the recombinase
enzyme. This can be found in
pachytene.
S49. Ans.(b)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
The nucleolus, Golgi complex, and ER
reform during telophase.
S50. Ans.(d)
In the zygotene stage, bivalent or tetrad
refers to paired homologous
chromosomes.

475 CHANNEL
JOIN TELEGRAM
 Chapter 11
Sankalp Bharat
Photosynthesis in Higher Plants

1. The first stable product of CO2 fixation in (c) RuBisCO action requires ATP and
sorghum is: (2021) NADPH
(a) Oxaloacetic acid (d) RuBisCO is a bifunctional enzyme
(b) Succinic acid 7. In Hatch and Slack pathway, the primary
(c) Phosphoglyceric acid CO2 acceptor is: (2019)
(d) Pyruvic acid (a) Rubisco
2. Which of the following statements is (b) Oxaloacetic acid
incorrect? (2021) (c) Phosphoglyceric acid
(a) Stroma lamellae have PS I only and lack (d) Phosphoenol pyruvate
NADP reductase. 8. Which of the following is not a product of
(b) Grana lamellae have both PS I and PS light reaction of photosynthesis? (2018)
II. (a) ATP
(c) Cyclic photophosphorylation involves (b) NADH
both PS I and PS II. (c) NADPH
(d) Both ATP and NADPH + H+ are (d) Oxygen
synthesized during non-cyclic 9. With reference to factors affecting the rate
photophosphorylation. of photosynthesis, which of the following

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
3. The oxygenation activity of RuBisCo enzyme statements is not correct? (2017)
in photorespiration leads to the formation (a) Light saturation for CO2 fixation occurs
of: (2020) at 10% of full sunlight
(a) 1 molecule of 3-C compound (b) Increasing atmospheric CO2
(b) 1 molecule of 6-C compound concentration upto 0.05% can enhance
(c) 1 molecule of 4-C compound and 1 CO2 fixation rate
molecule of 2-C compound (c) C3 plants responds to higher
(d) 2 molecules of 3-C compound temperatures with enhanced
4. In light reaction, plastoquinone facilitates photosynthesis while 𝐶4 plants have
the transfer of electrons from: (2020) much lower temperature optimum
(a) Cytb6f complex to PS-I (d) Tomato is a greenhouse crop which can
(b) PS-I to NADP+ be grown in 𝐶𝑂2− enriched atmosphere
(c) PS-I to ATP synthase for higher yield
(d) PS-II to Cytb6 f complex 10. Phosphoenol pyruvate (PEP) is the primary
5. During non-cyclic photophosphorylation, CO2 acceptor in: (2017)
when electrons are lost from the reaction (a) C3 plants
centre at PS II, what is the source which (b) C4 plants
replaces these electrons? (c) C2 plants
(2020 Covid Re-NEET) (d) C3 and 𝐶4 plants
(a) Water 11. Which of the following is a proteinaceous
(b) Carbon dioxide and water soluble photosynthetic pigment?
(c) Light (2017)
(d) Oxygen (a) Chlorophyll
(b) Xanthophyll
6. Which of the following statements is (c) Phycocyanin
incorrect? (2020 Covid Re-NEET) (d) Anthocyanin
(a) In C4 plants, the site of RuBisCO activity 12. Which statement is wrong about
is mesophyll cell photorespiration? (2017)
(b) The substrate molecule for RuBisCO (a) RuBP binds with O2 to form two
activity is a 5-carbon compound molecules of phosphoglycolate

476 CHANNEL
JOIN TELEGRAM
 (b) Photorespiration occurs in C3 plants and 17. Water soluble pigments found in plant cell
not C4 plants vacuoles are: (2016 - I)
(c) There is no synthesis of ATP or NADPH (a) Xanthophylls
(d) RuBisCO has higher affinity for CO2 than (b) Chlorophylls
O2 (c) Carotenoids
13. The process which makes major difference (d) Anthocyanins
between C3 and C4 plants is: (2016 - II) 18. Emerson’s enhancement effect and Red
(a) Photorespiration drop have been instrumental in the
(b) Respiration discovery of: (2016 - I)
(c) Glycolysis (a) Photophosphorylation and non-cyclic
(d) Calvin cycle electron transport
14. Phytochrome is a: (2016 - II) (b) Two photosystem operating
(a) Lipoprotein simultaneously
(b) Chromoprotein (c) Photophosphorylation and cyclic
(c) Flavoprotein electron transport
(d) Glycoprotein (d) Oxidative phosphorylation
15. In a chloroplast the highest number of 19. In photosynthesis, the light-independent
protons are found in: (2016 - I) reactions take place at: (2015 Re)
(a) Stroma (a) Photosystem-I
(b) Lumen of thylakoid (b) Photosystem-II
(c) Inter membranal space (c) Stromal matrix
(d) Antennae complex (d) Thylakoid lumen
16. A plant in your garden avoids 20. Anoxygenic photosynthesis is characteristic

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
photorespiratory losses, has improved of: (2014)
water use efficiency, shows high rates of (a) Ulva
photosynthesis at high temperatures and (b) Rhodospirillum
has improved efficiency of nitrogen (c) Spirogyra
utilisation. In which of the following (d) Chlamydomonas
physiological groups would you assign this
plant? (2016 - I)
(a) 𝐶3
(b) 𝐶4
(c) CAM
(d) Nitrogen fixer

477 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (a) S12. Ans. (a)

S2. Ans. (c) S13. Ans. (a)

S3. Ans. (a) S14. Ans. (b)

S4. Ans. (d) S15. Ans. (b)

S5. Ans. (a) S16. Ans. (b)

S6. Ans. (a) S17. Ans. (d)

S7. Ans. (d) S18. Ans. (b)

S8. Ans. (b) S19. Ans. (c)

S9. Ans. (c) S20. Ans. (b)

S10. Ans. (b)

S11. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

478 CHANNEL
JOIN TELEGRAM
 Solutions

S1. Ans.(a) bundle sheath cells, it is again broken

The first stable product of CO2 fixation
in Sorghum (C4 plant) is Oxaloacetic
acid.
S2. Ans.(c)
In cyclic photophosphorylation,
electrons are passed from 𝑃700 of PS-I
via electron transfer chain to back to
𝑃700 with the formation of ATP. It does
S8.
not include PS II.
S3. Ans.(a)
In photorespiration, the oxygenation
activity of RuBisCo enzyme produces
one molecule of 3-phosphoglycerate
(PGA) and one molecule of 2-
S9.
phosphoglycolate (2PG or PG). A 3C
chemical is 3-phosphoglycerate, while a
2C compound is 2-phosphoglycolate.
S10.
down into a 3-carbon compound with the
release of CO2 . The CO2 released enters
the Calvin cycle in the bundle shealth
cells, while the 3 carbon compound I
transported back to the mesophyll cells.
In the mesophyll cells, the 3 carbon
compound is converted back to PEP,
thus completing the cycle.
Ans.(b)
During the light reaction, sunlight
energy is transformed into a little
amount of ATP and an energy carrier,
NADPH. Additionally, water is divided
and oxygen is released.
Ans.(c)
C4 plants can withstand a wide
temperature range.
Ans.(b)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S4. Ans.(d)
The following is the electron transport
pathway in the light reaction:
S5. Ans.(a)
The electrons lost from photosystem II
must be replenished during non-cyclic
photophosphorylation. This is
accomplished by using electrons that
are Photosynthesis in Higher Plants 95
available as a result of water splitting.
Photosystem II breaks down H2 O
molecules into 1/2 O, 2H + , and two
electrons. Electrons lost by Photosystem
II antenna complexes are constantly
replaced by these electrons.
S6. Ans.(a)
The RuBisCO enzyme is absent in C4
plants' mesophyll cells. RuBisCO is
abundant in bundle sheath cells.
S7. Ans.(d)
Hatch and slack pathway is a cyclic
pathway for CO2 fixation. The primary CO2
acceptor is a 3-carbon compound
phosphoenol pyruvate (PEP) which is
present in mesophyll cells. PEP is
converted to oxaloacetic acid (OAA)
which is then further converted into a 4-
carbon compund such a malic acid or
aspartic, which is then transported to the
479 CHANNEL
JOIN TELEGRAM
PEP is a 3C molecule that acts as a main C
CO2 acceptor in the cytoplasm of mesophyll
cells CO2 in plants such as maize,
sugarcane, and sorghum
S11. Ans.(d)
The presence of a purple pigment called
anthocyanin alters the colour of leaves
in some plants. Because anthocyanins
are water soluble, they are found in
solution in the cells' water
S12. Ans.(a)
RuBP interacts to O2 and forms one
phosphoglycolate and one
phosphoglycerate molecule.
S13. Ans.(a)
Photorespiration is the process that
distinguishes C3 plants from C4 plants. C4
plants have a unique leaf morphology
that allows them to withstand higher
temperatures, respond to higher light
intensities, lack the process of
 photorespiration, and produce more S17. Ans.(d)
biomass. Anthocyanins are water-soluble
S14. Ans.(b) pigments present in plant cell vacuoles
Phytochrome is a kind of chromoprotein S18. Ans.(b)
S15. Ans.(b) The finding of two photosystems
The lumen of the thylakoid contains the working simultaneously was aided by
most protons in a chloroplast. Protons in Emerson's amplification effect (1957)
the stroma of the chloroplast decrease in and Red drop. Chlorella was the subject
number, whereas protons accumulate in of Emerson's experiment.
the lumen of the thylakoid. A proton S19. Ans.(c)
gradient is created across the thylakoid Enzymatic reactions in the stroma
membrane, as well as a detectable drop incorporate CO2 into the plant, resulting
in pH in the lumen. in sugar production. These reactions are
S16. Ans.(b) dependent on the products of light
C4 plants are unique in that they have a reactions and are not directly light-
unique leaf anatomy, can withstand driven (ATP and NADPH).
higher temperatures, and respond to S20. Ans.( b)
high light intensities, yet they lack Rhodospirillum uses H2 S instead of H2 O
photorespiration as a source of hydrogen. As a result, O2
is not produced during photosynthesis.

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

480 CHANNEL
JOIN TELEGRAM
 Chapter 12
Sankalp Bharat
Respiration in Plants

1. Match List-l with List-II: 6. The number of time(s) decarboxylation of

List – I LIst – II isocitrate occurs during single TCA cycle is
Oxidative (i) Citrate (2022)
A (a) Four
decarboxylation synthase
(b) One
B Glycolysis (ii) Pyruvate (c) Two
dehydrogenas (d) Three
e 7. What is the net gain of ATP when each
C Oxidative (iii Electron molecule of glucose is converted to two
phosphorylatio ) transport molecules of pyruvic acid? (2022)
n system (a) Four
(b) SIX
D Tricarboxylic (iv) EMP pathway
(c) Two
acid cycle
(d) Eight
Choose the correct answer from the options 8. What amount of energy is released from
given below: (2023) glucose during lactic acid fermentation?
(a) A-II, B-IV, C-III, D-I (2022)
(b) A-III, B-IV, C-II, D-I

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) Approximately 15%
(c) A-II, BIV, C-1, D-III (b) More than 18%
(d) A-III, B-I, C-II, D-IV (c) About 10%
2. Which of the following combinations is (d) Less than 7%
required for chemiosmosis? (2023) 9. Which of the following statements is
(a) Membrane, proton pump, proton incorrect? (2021)
gradient, NADP synthase (a) In ETC (Electron Transport Chain), one
(b) Proton pump, electron gradient, ATP molecule of NADH + H + gives rise to 2 ATP
synthase molecules, and one FADH2 gives rise to
(c) Proton pump, electron gradient, NADIP 3 ATP molecules
synthase (b) ATP is synthesized through complex-V
(d) Membrane, proton pump, proton (c) Oxidation-reduction reactions produce
gradient, ATP synthase proton gradient in respiration
3. Melonate inhibits the growth of pathogenic (d) During aerobic respiration, role of
bacteria by inhibiting the activity of (2023) oxygen is limited to the terminal stage
(a) Amylase 10. The number of substrate level
(b) Lipase phosphorylations in one turn of citric acid
(c) Dinitrogenase cycle is: (2020)
(d) Succinic dehydrogenase (a) One
4. How many times decarboxylation occurs (b) Two
during each TCA cycle? (2023) (c) Three
(a) Thrice (d) Zero
(b) Many 11. Pyruvate dehydrogenase activity during
(c) Once aerobic respiration requires:
(d) Twice (2020 Covid Re-NEET)
5. Fatty acids are connected with the (a) Iron
respiratory pathway through: (2023) (b) Cobalt
(a) Acetyl CoA (c) Magnesium
(b) a-Ketoglutaric acid (d) Calcium
(c) Dihydroxy acetone phosphate 12. Respiratory Quotient (RQ) value of
(d) Pyruvic acid tripalmitin is (2019)
481 CHANNEL
JOIN TELEGRAM
 (a) 0.9 18. Oxidative phosphorylation is: (2016 - II)
(b) 0.7 (a) Addition of phosphate group to ATP.
(c) 0.07 (b) Formation of ATP by energy released
(d) 0.09 from electrons removed during substrate
13. Conversion of glucose to glucose-6- oxidation.
phosphate, the first irreversible reaction of (c) Formation of ATP by transfer of
glycolysis, is catalysed by (2019) phosphate group from a substrate to
(a) Aldolase ADP
(b) Hexokinase (d) Oxidation of phosphate group in ATP
(c) Enolase 19. Which of the following biomolecules is
(d) Phosphofructokinase common to respiration-mediated
14. What is the role of NAD+ in cellular breakdown of fats, carbohydrates and
respiration? (2018) proteins? (2016 - II, 2003)
(a) It functions as an enzyme (a) Pyruvic acid
(b) It functions as an electron carrier (b) Acetyl CoA
(c) It is a nucleotide source for ATP (c) Glucose-6-phosphate
synthesis (d) Fructose 1, 6-bisphosphate
(d) It is the final electron acceptor for 20. Cytochromes are found in: (2015)
anaerobic respiration (a) Cristae of mitochondria
15. Which of these statements is incorrect? (b) Lysosomes
(2018) (c) Matrix of mitochondria
(a) Enzymes of TCA cycle are present in (d) Outer wall of mitochondria
mitochondrial matrix. 21. In which one of the following processes CO2

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Glycolysis occurs in cytosol. is not released? (2014)
(c) Glycolysis operates as long as it is (a) Lactate fermentation
supplied with NAD that can pick up (b) Aerobic respiration in plants
hydrogen atoms. (c) Aerobic respiration in animals
(d) Oxidative phosphorylation takes place in (d) Alcoholic fermentation
outer mitochondrial membrane. 22. The three boxes in this diagram represent
16. Which statement is wrong for Krebs’ cycle? the three major biosynthetic pathways in
(2017) aerobic respiration. Arrows represent net
(a) There are three points in the cycle where reactants or products: (2013)
NAD+ is reduced to NADH + H+
(b) There is one point in the cycle where
FAD+ is reduced to FADH2
(c) During conversion of succinyl CoA to
succinic acid, a molecule of GTP is
Arrows numbered 4, 8, and 12 can all be
synthesized
(a) FAD+ or FADH2
(d) The cycle starts with condensation of
(b) NADH
acetyl group (acetyl CoA) with pyruvic
(c) ATP
acid to yield citric acid
(d) H2 O
17. Which of the following values will depict
correct respiratory quotient when
tripalmitin (a fatty acid) is used as a
respiratory substrate? (2017)
(a) 1.1
(b) 1
(c) 0.7
(d) 0.9

482 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (a) S13. Ans. (b)

S2. Ans. (d) S14. Ans. (b)

S3. Ans. (d) S15. Ans. (d)

S4. Ans. (d) S16. Ans. (d)

S5. Ans. (a) S17. Ans. (c)

S6. Ans. (c) S18. Ans. (b)

S7. Ans. (c) S19. Ans. (b)

S8. Ans. (d) S20. Ans. (a)

S9. Ans. (a) S21. Ans. (a)

S10. Ans. (a) S22. Ans. (c)

S11. Ans. (c)

S12. Ans. (b)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

483 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(a) S8.
Pyruvate, which is formed by the
glycolytic catabolism of carbohydrates
in the cytosol, after it enters
mitochondrial matrix undergoes
oxidative decarboxylation by a complex S9.
set of reactions catalyzed by pyruvate
dehydrogenase.
S2. Ans.(d)
Membrane, proton pump, proton
gradient, ATP synthase S10.
S3. Ans.(d)
Melonate is a known inhibitor of the
enzyme succinic dehydrogenase, which
is involved in the citric acid cycle (also S11.
known as the Krebs cycle or TCA cycle),
an essential metabolic pathway in many
organisms, including bacteria.
S4. Ans.(d)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
The tricarboxylic acid (TCA) cycle, also
known as the citric acid cycle or Krebs
cycle, involves the oxidative
decarboxylation of malate to
oxaloacetate and of isocitrate to alpha-
ketoglutarate. However, the latter
reaction is followed by another S12.
decarboxylation when alpha-
ketoglutarate is converted to succinyl-
CoA. So in total, there are two
decarboxylation reactions per TCA cycle.
S5. Ans.(a)
fatty acids are connected with the S13.
respiratory pathway through Acetyl
CoA. So, the correct answer is Option A:
Acetyl CoA.
S6. Ans.(c)
S14.
During TCA cycle, 6-C compound
isocitrate is converted into succinyl
CoA, a 4-C compound by removing two
CO, molecules.
S7. Ans.(c)
During glycolysis, total 4 ATPs are
produced from one glucose molecule S15.
with a net gain of 2 ATPs.
484 CHANNEL
JOIN TELEGRAM
Ans.(d)
Less than seven percent of the energy in
glucose is released during lactic acid
fermentation and not all of it is trapped
as high energy bonds of ATP.
Ans.(a)
Oxidation of one molecule of NADH gives
rise to 3 molecules of ATP and that one
molecule of FADH2 produces 2 molecules
of ATP.
Ans.(a)
The number of substrate level
phosphorylations in one turn of citric
acid cycle is 1.
Ans.(c)
Pyruvate, which is formed by the
glycolytic catabolism of carbohydrates in
the cytosol, after it enters mitochondrial
matrix undergoes oxidative
decarboxylation by a complex set of
reactions catalysed by pyruvic
dehydrogenase. The reactions
catalysed by pyruvic dehydrogenase
require the participation of magnesium
ions.
Ans.(b)
Respiratory quotient
= Amount of CO2 evolved / Amount of O2
consumed 2(𝐶51 𝐻98 𝑂6 ) + 145𝑂 →
102 𝐶𝑂2 + 98𝐻2 𝑂 + Energy
𝑅𝑄 = 102 𝐶𝑂2 \145 𝑂2 = 0.7
Ans.(b)
Hexokinase catalyse the conversion of
glucose to glucose-6 phosphate. It is the
first step of activation phase of glycolysis.
Ans.(b)
NAD+ is an oxidising agent that accepts
the electrons from other molecules and
becomes reduced to form NADH. NADH,
then can be used to donate electrons.
In this way NAD+ acts as an electron
carrier.
Ans.(d)
Oxidative phosphorylation takes place in
inner mitochondrial membrane.
S16. Ans.(d) S20. Ans.(a)
Krebs cycle starts with condensation of The inner mitochondrial membrane
acetyl forms a number of infoldings called the
CoA (2C) with oxaloacetic acid (4C) to cristae towards the matrix.
form citric Inner mitochondrial membrane is the
acid (6C). site of electron transport chain in which
S17. Ans.(c) cytochrome are arranged.
Calculations for a fatty acid, tripalmitin, S21. Ans.(a)
if used as a substrate is shown: Lactate fermentation is a type of
2(C51 H98 O6 ) + 145 O2 → 102 CO2 + 98 H2 O anaerobic respiration in which the
+ energy Tripalmitin respiratory substrate is converted into
RQ = 102 𝐶O2 = 0.7 lactate along with the production of ATP.
= 145O2 It takes place in muscles during
S18. Ans.(b) strenuous physical work.

Unlike photophosphorylation where it is S22. Ans.(c)

the light energy that is utilised for the
production of proton gradient required
for phosphorylation, in respiration
it is the energy of oxidation-reduction
utilised for the same process. It is for this
reason that the process is called
Pathway A is glycolysis and pathway B is
kreb’s cycle.
ATP is generated at substrate level in
glycolysis and in Kreb’s cycle

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
oxidative phosphorylation.
S19. Ans.(b)
Acetyl CoA is common to respiration-
mediated
breakdown of fats, carbohydrates and
proteins

485 CHANNEL
JOIN TELEGRAM
 Chapter 13
Sankalp Bharat
Plants Growth and Development

1. Spraying of which of the following formation to increase the absorption

phytohormone on juvenile conifers helps surface
hastening the maturity period, that leads (c) help overcome apical dominance
early seed production? (2023) (d) kill dicotyledonous weeds in the fields
(a) Abscisic Acid 8. Production of Cucumber has increased
(b) Indole-3-butyric Acid manifold in recent years. Application of
(c) Gibberellic Acid which of the following phytohormones has
(d) Zeatin resulted in this increased yield as the
2. Which hormone promotes internode/petiole hormone is known to produce female
elongation in deep water rice? (2023) flowers in the plants: (2022)
(a) 2, 4-D (a) ABA
(b) GA3 (b) Gibberellin
(c) Kinetin (c) Ethylene
(d) Ethylene (d) Cytokinin
3. Which of the following statements is not 9. The site of perception of light in plants
correct? (2023) during photoperiodism is: (2021)
(a) Phase of cell elongation of plant cells is (a) Stem

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
characterized by increased vacuolation (b) Axillary bud
(b) Cells in the meristematic phase of (c) Leaf
growth exhibit abundant (d) Shoot apex
plasmodesmatal connections 10. The plant hormone used to destroy weeds in
(c) Plant growth is generally determinate a field is: (2021)
(d) Plant growth is measurable (a) NAA
4. The ability of plants to follow different (b) 2, 4-D
pathways in response to environment (c) IBA
leading to formation of different kinds of (d) IAA
structures is called (2022) 11. Plants follow different pathways in response
(a) Differentiation to environment or phase of life to form
(b) Redifferentiation different kinds of structures. This ability is
(c) Development called: (2021)
(d) Plasticity (a) Flexibility
5. Which of the following growth regulators is (b) Plasticity
an adenine derivative? (2022) (c) Maturity
(a) Abscisic acid (d) Elasticity
(b) Auxin 12. The process of growth is maximum during:
(c) Cytokinin (2020)
(d) Ethylene (a) Lag phase
6. Which one of the following plants does not (b) Senescence
show plasticity? (2022) (c) Dormancy
(a) Cotton (d) Log phase
(b) Coriander 13. Which of the following is not an inhibitory
(c) Buttercup substance governing seed dormancy?
(d) Maize (2020)
7. The gaseous plant growth regulator is used (a) Abscisic acid
in plants to: (2022) (b) Phenolic acid
(a) speed up the malting process (c) Para-ascorbic acid
(b) promote root growth and roothair (d) Gibberellic acid

486 CHANNEL
JOIN TELEGRAM
14. Name the plant growth regulator which (c) Shoot apex
upon spraying on sugarcane crop, increases (d) Leaves
the length of stem, thus increasing the yield 20. Fruit and leaf drop at early stages can be
of sugarcane crop. (2020) prevented by the application of: (2017)
(a) Gibberellin (a) Cytokinins
(b) Ethylene (b) Ethylene
(c) Abscisic acid (c) Auxins
(d) Cytokinin (d) Gibberellic acid
15. Match the following concerning the 21. Match Column - I with Column - II and
activity/function and the phytohormone select the correct option using codes give
involved. (2020 Covid Re-NEET) below. (2017)
1. Fruit ripener (i) Abscisic Column - I Column - II
acid Cytokinin (i) Stimulates closure
A.
2. Herbicide (ii) GA3 of stomata

3. Bolting agent (iii) 2, 4-D B. Ethylene (ii) Increases stem

Stress (iv) Ethephon length
4.
hormone C. Gibberellin (iii) Promotes lateral
Select the correct option from following: shoot growth
(1) (2) (3) (4) D. Abscisic (iv) Found in large
(a) (iii) (iv) (ii) (i)
acid amount in
(b) (iv) (iii) (ii) (i)
(c) (iv) (ii) (i) (iii) tissues

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) (ii) (iii) (iv) (i) undergoing
16. Who coined the term ‘Kinetin’? senescence
(2020 Covid Re-NEET) Codes:
(a) Darwin
(b) Went (a) A-(iii) B-(iv) C-(ii) D-(i)
(c) Kurosawa (b) A-(iii) B-(ii) C-(iv) D-(i)
(d) Skoog and Miller (c) A-(iv) B-(i) C-(iii) D-(ii)
17. Inhibitory substances in dormant seeds (d) A-(ii) B-(iv) C-(i) D-(iii)
cannot be removed by subjecting seeds to: 22. Growth hormone Auxin was isolated by
(2020 Covid Re-NEET) F.W. Went from tips of seeding coleoptile of:
(a) Nitrate (2017)
(b) Ascorbic acid (a) Rice
(c) Chilling conditions (b) Maize
(d) Gibberellic acid (c) Wheat
18. It takes very long time for pineapple plants (d) Oat
to produce flowers. Which combination of 23. You are given a tissue with its potential for
hormones can be applied to artificially differentiation in an artificial culture. Which
induce flowering in pineapple plants of the following pairs of hormones would
throughout the year to increase yield? you add to the medium to secure shoots as
well as roots? (2016-II)
(2019)
(a) Auxin and Abscisic acid
(a) Auxin and Ethylene (b) Gibberellin and Abscisic acid
(b) Gibberellin and Cytokinin (c) IAA and Gibberellin
(c) Gibberellin and Abscisic acid (d) Auxin and Cytokinin
(d) Cytokinin and Abscisic acid 24. The Avena curvature is used for bioassay of:
19. What is the site of perception of photoperiod (2016-I)
necessary for induction of flowering in (a) ABA
plants? (2019) (b) GA
(a) Lateral buds (c) IAA
(b) Pulvinus (d) Ethylene

487 CHANNEL
JOIN TELEGRAM
 29. A few normal seedlings of tomato were kept
25. Typical growth curve in plants is: (2015) in a dark room.
(a) Stair-steps shaped After a few days they were found to have
(b) Parabolic become white- colored like albinos. Which
(c) Sigmoid of the following terms will you use to
(d) Linear describe them? (2014)
26. What causes a green plant exposed to the (a) Defoliated
light on only one side, to bend toward the (b) Mutated
source of light as it grows? (2015) (c) Embolised
(a) Light stimulates plant cells on the (d) Etiolated
lighted side to grow faster. 30. Which one of the following growth
(b) Auxin accumulates on the shaded side, regulators is known as ‘stress hormone’?
stimulating greater cell elongation there. (2014)
(c) Green plants need light to perform (a) Indole acetic acid
photosynthesis. (b) Abscisic acid
(d) Green plants seek light because they are (c) Ethylene
phototropic. (d) GA3
27. Auxin can be bioassay by: (2015 Re) 31. During seed germination its stored food is
(a) Hydroponics mobilised by: (2013)
(b) Potometer (a) Gibberellin
(c) Lettuce hypocotyl elongation (b) Ethylene
(d) Avena coleoptile curvature (c) Cytokinin
28. Dr. F. Went noted that if coleoptile tips were (d) ABA

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
removed and placed on agar for one hour,
the agar would produce a bending when
placed on one side of freshly cut coleoptile
stumps. Of what significance is this
experiment? (2014)
(a) It demonstrated polar movement of
auxins
(b) It made possible the isolation and exact
identification of auxin
(c) It is the basis for quantitative
determination of small amounts of
growth-promoting substances
(d) It supports the hypothesis that IAA is
Auxin

488 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (c) S21. Ans. (a)

S2. Ans. (d) S22. Ans. (d)

S3. Ans. (c) S23. Ans. (d)

S4. Ans. (d) S24. Ans. (c)

S5. Ans. (c) S25. Ans. (c)

S6. Ans. (d) S26. Ans. (b)

S7. Ans. (b) S27. Ans. (d)

S8. Ans. (c) S28. Ans. (b)

S9. Ans. (c) S29. Ans. (d)

S10. Ans. (b) S30. Ans. (b)

S11.Ans. (b) S31. Ans. (a)

S12. Ans. (d)

S13. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (a)

S15. Ans. (b)

S16. Ans. (d)

S17. Ans. (b)

S18. Ans. (a)

S19. Ans. (d)

S20. Ans. (c)

489 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(c)
Spraying juvenile conifers with
gibberellins (GAS) hastens the maturity
period, thus leading to early seed
production.
S2. Ans.(d)
Ethylene promotes rapid
internode/petiole elongation in deep
water rice plants.
S3. Ans.(c)
This is a key characteristic of plants. So,
the statement that plant growth is
generally determinate is incorrect.
S4. Ans.(d)
The ability of plant to follow different
pathways and produce different
structures in response to environment
is called plasticity.
During differentiation, cells lose their
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
ability to divide and form permanent
cell.
The process where the differentiated
cells again lose the ability to divide and
form permanent cells is called
redifferentiation.
S5. Ans.(c)
- Cytokinins are derived from adenine.
- Auxins are derivatives of indole
compounds.
- Abscisic acid is derived from
carotenoids.
- Ethylene is derived from methionine.
S6. Ans.(d)
Plants follow different pathways in
response to environment or phases of
life to form different kinds of structures.
This ability is called plasticity e.g.
heterophylly in cotton, coriander and
larkspur. In such plants, leaves of
juvenile plant are different in a shape
from those in mature plants.
S7. Ans.(b)
Ethylene is a gaseous plant hormone. It
induces development of adventitious
roots on various types of cutting. It
promotes the development of lateral
490 CHANNEL
JOIN TELEGRAM
roots and growth of root hairs.
Cytokinin helps to overcome the apical
dominance.
Auxin is used to kill dicot weeds.
Gibberellin speeds up the malting
process.
S8. Ans.(c)
Ethylene increases the number of
female flowers and fruits in certain
plants such as cucumber. Gibberellins
are used to increase the size of fruits in
some plants.
S9. Ans.(c)
The response of plants to periods of
day/night is termed as photoperiodism.
The hormonal substance
responsible for flowering is formed in
the leaves, subsequently migrating to
the shoot apices and modifying them
into flowering apices. Photoperiodism
helps in studying the response of
flowering in various crop plants with
respect to the duration of exposure to
light.
S10. Ans.(b)
The synthetic auxin 2, 4−D is used to
destroy weeds in a monocot field.
S11. Ans.(b)
The ability of plants to form
morphologically different structures by
following different pathways in response
to environment or phases of life is called
plasticity.
S12. Ans.(d)
The log phase, also known as the
exponential phase, is a period of rapid
plant development. The number
of cells has increased significantly,
resulting in an increase in height and
biomass.
S13. Ans.(d)
Effect of inhibitory substances can be
removed by subjecting the seeds to
chilling conditions or by application of
certain chemicals like gibberellic acid
and nitrates.
S14. Ans.(a)
Sugarcane stems store carbohydrate in
the form of sugar. Spraying gibberellins
on sugarcane crops improves stem
length, resulting in output gains of up
to 20 tonnes per acre.
S15. Ans.(b)
Fruit ripening is aided greatly by
ethylene.
Herbicides containing auxins are
commonly used.
The herbicide 2, 4-D, which is
commonly used to
eliminate dicotyledonous weeds, has no
effect on mature monocotyledonous
plants. Bolting (internode elongation
just prior to flowering) is promoted by
gibberellins in beets, cabbages, and
many other rosette-forming plants. ABA
enhances plant tolerance to diverse
stressors by stimulating the closure of
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
stomata in the epidermis. As a result,
it's also known as the stress hormone.
S16. Ans.(d)
Skoog and Miller later discovered and
crystallised the cytokinesis-promoting
active component, which they
named kinetin.
S17. Ans.(b)
The effect of inhibitory compounds can
be reduced by freezing the seeds or
using chemicals like gibberellic
acid and nitrates. Seed dormancy can
also be overcome by altering
environmental variables like as
light and temperature.
S18. Ans.(a)
Auxin, a plant hormone, causes
pineapple to blossom. In pineapple,
ethylene is employed to synchronise
blooming and fruit set.
S19. Ans.(d)
Photoperiodic stimulation is sensed by
plant leaves during flowering.
S20. Ans.(c)
Auxins help to keep leaves and fruits
from falling off too soon.
491 CHANNEL
JOIN TELEGRAM
In tomatoes, NAA prevents fruit drop; in
citrus, 2, 4-D prevents fruit drop.
S21. Ans.(a)
A-(iii) B-(iv) C-(ii) D-(i)
S22. Ans.(d)
Auxin (Greek 'auxein': to grow) was
extracted from the tips of coleoptiles of
oat seedlings by F.W. Went.
Auxin was discovered in human urine
for the first time.
S23. Ans.(d)
Auxin aids in the production of roots,
while cytokinin aids in the development
of shoots.
S24. Ans.(c)
A bioassay is a method of determining
whether a drug has the ability to cause
a growth response in a living plant or a
component of one. Some bioassays
for determining auxin activity include
the Avena curvature test and the root
growth inhibition test.
S25. Ans.(c)
Numerous annual plants have an S-
shaped or sigmoid growth curve. It is
divided into three phases: the lag
phase (slow), the log phase exponential),
and the stable phase. It's a common
occurrence in all cells.
S26. Ans.(b)
In the presence of light, auxin synthesis
occurs more quickly and in bigger
amounts in the part of the plant
which is in the dark. Auxin
translocations are polar.
S27. Ans.(d)
The avena curvature test is based on
the discovery that the auxin
concentration in an agar block
determines the curvature produced in
0° at coleoptile. Auxin concentrations of
150 g/L cause 10° curvature.
S28. Ans.(b)
The isolation and precise identification
of auxin was made feasible by this
experiment.
S29. Ans.(d) S31. Ans.(a)
Etiolation: Seedling when grown in the Gibberellin causes aleurone cells to
dark, becomes pale to white in colour. release an enzyme that allows stored
Because of the lack of chlorophyll. food in seeds to be broken down.
S30. Ans.(b)
ABA boosts a plant's resistance to a
variety of stressors.

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

492 CHANNEL
JOIN TELEGRAM
 Chapter 14
Sankalp Bharat
Breathing and Exchange of Gases

1. Select the sequence of steps in Respiration. 5. Under normal physiological conditions in

(2023) human being every 100 ml of oxygenated
(A) Diffusion of gases 𝑂2 and 𝐶𝑂2 across blood can deliver ________ ML. of O2 to the
alveolar membrane. tissues. (2022)
(B) Diffusion of 𝑂2 and 𝐶𝑂2 between blood (a) 2 ml
and tissues. (b) 5 ml
(C) Transport of gases by the blood (c) 4 ml
(D) Pulmonary ventilation by which (d) 10 ml
atmospheric air is drawn in and CO2 rich 6. Which of the following is not the function of
alveolar air is released out. conducting part of respiratory system?
(E) Utilisation of 𝑂2 by the cells for catabolic (2022)
reactions are resultant release of 𝐶𝑂2 (a) It clears inhaled air form foreign
Choose the correct answer from the options particles
given below: (b) Inhaled air is humidified
(a) (D), (A), (C), (B), (E) (c) Temperature of inhaled air is brought to
(b) (C), (B), (A), (E), (D) body temperature
(c) (B), (C), (E), (D), (A) (c) Provides surface for diffusion of O2 and

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) (A), (C), (B), (E), (D) CO2
2. Vital capacity of lung is ____. (2023) 7. The partial pressures (in mm Hg) of oxygen
(a) IRV+ ERV+ TV+ RV (O2 ) and carbon dioxide (CO2 ) at alveoli (the
(b) IRV+ ERV+ TV + RV site of diffusion) are (2021)
(c) IRV+ ERV+ TV (a) 𝑝𝑂2 = 40 𝑎𝑛𝑑 𝑝𝐶𝑂2 = 45
(d) IRV + ERV (b) 𝑝𝑂2 = 95 and 𝑝𝐶𝑂2 = 40
3. Identify the region of human brain which (c) 𝑝𝑂2 = 159 and 𝑝𝐶𝑂2 = 0.3
has pneumotaxic centre that alters (d) 𝑝𝑂2 = 104 and 𝑝𝐶𝑂2 = 40
respiratory rate by reducing the duration of 8. Select the favourable conditions required
inspiration. (2022) for the formation of oxyhaemoglobin at the
(a) Cerebrum alveoli. (2021)
(b) Medulla (a) Low ) 𝑝𝑂2 , high 𝑝𝐶𝑂2 , more H+, higher
(c) Pons temperature
(d) Thalamus (b) High ) 𝑝𝑂2 , high 𝑝𝐶𝑂2 , less H+, higher
4. Which of the following statements are temperature
correct with respect to vital capacity? (c) Low ) 𝑝𝑂2 , low 𝑝𝐶𝑂2 , more H+, higher
(2022) temperature
(A) It includes ERV, TV AND IRV (d) High ) 𝑝𝑂2 , low 𝑝𝐶𝑂2 , less H+, lower
(B) Total volume of air a person can inspire temperature
after a normal expiration. 9. Identify the wrong statement with reference
(C) The maximum volume of air a person to transport of oxygen (2020)
can breathe in after forced expiration. (a) Partial pressure of 𝐶𝑂2 can interfere with
(D) It includes ERV, RV and IRV 𝑂2 binding with haemoglobin
(E) The maximum volume of air a person (b) Higher H+ concentration in alveoli
can breath out after a forced inspiration. favours the formation of oxyhaemoglobin
Choose the most appropriate answer from (c) Low 𝑝𝑂2 in alveoli favours the formation
the options given below: of oxyhaemoglobin
(a) (A) and (C) (d) Binding of oxygen with haemoglobin is
(b) (B), (D) and (E) mainly related to partial pressure of 𝑂2
(c) (A), (C), and (D)
(d) (A) and (C) and (E)
493 CHANNEL
JOIN TELEGRAM
10. Select the correct events that occur during Capacity if the Residual Volume is 1200
inspiration (2020) mL? (2019)
1. Contraction of diaphragm (a) 1500 mL
2. Contraction of external inter-costal (b) 1700 mL
muscles (c) 2200 mL
3. Pulmonary volume decreases (d) 2700 mL
4. Intra pulmonary pressure increases
(a) 3 and 4 15. Which of the following option is correctly
(b) 1, 2 and 4 represent the lung conditions in asthma
(c) Only 4 and emphysema respectively? (2018)
(d) 1 and 2 (a) Inflammation of bronchioles; Decreased
11. Match the following columns and select the respiratory surface
correct option (2020 Covid Re-NEET) (b) Increased number of bronchioles;
Column - I Column - II Increased respiratory surface
Pneumotaxic (i) Alveoli (c) Increased respiratory surface;
1. Inflammation of bronchioles
Centre
(d) Decreased respiratory surface;
2. O2 (ii) Pons region
dissociation of brain Inflammation of bronchioles
curve 16. Match the items given Column I with those
in Column II and select the correct option
3. Carbonic (iii) Haemoglobin
given below (2018)
anhydrase
Column I Column II
4. Primary site (iv) RBC

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) Tidal volume (i) 2500-3000 mL
of exchange
of gases (b) Inspiratory (ii) 1100-1200 mL
Reserve
1 2 3 4 volume
(a) (ii) (iii) (iv) (i) Expiratory (iii) 500-550 mL
(b) (iii) (ii) (iv) (i) (c)
Reserve
(c) (iv) (i) (iii) (ii) volume
(d) (i) (iii) (ii) (iv) Residual (iv) 1000-1100 mL
12. Total Lung Capacity (TLC) is the total (d)
volume
volume of air accomodated in the lungs at
the end of a forced inspiration. This (a) A-(iii) B-(ii) C-(i) D-(iv)
includes (2020 Covid Re-NEET) (b) A-(iii) B-(i) C-(iv) D-(ii)
(a) RV, ERV, IC and EC (c) A-(i) B-(iv) C-(ii) D-(iii)
(b) RV, ERV, VC and FRC (d) A-(iv) B-(iii) C-(ii) D-(i)
(c) RV, ERV, TV, and IRV 17. Which of the following is an occupational
(d) RV, IC, EC, and ERV respiratory disorder? (2018)
13. Due to increasing air-borne allergens and (a) Anthracis
pollutants, many people in urban areas are (b) Silicosis
suffering from respiratory disorder causing (c) Botulism
wheezing due to (2019) (d) Emphysema
(a) Benign growth on mucous lining of nasal 18. Lungs are made up of air-filled sacs, the
cavity alveoli. They do not collapse even after
(b) Inflammation of bronchi and bronchioles forceful expiration because of (2017)
(c) Proliferation of fibrous tissues and (a) Residual Volume
damage of the alveolar walls (b) Inspiratory Reserve Volume
(d) Reduction in the secretion of surfactants (c) Tidal Volume
by pneumocytes (d) Expiratory Reserve Volume
14. Tidal Volume and Expiratory Reserve 19. Which of the following cannot be measured
Volume of an athlete is 500 mL and 1000 by spirometry? (2017)
mL respectively. What will be his Expiratory (a) Vital capacity
(b) Tidal volume

494 CHANNEL
JOIN TELEGRAM
 (c) Inspiratory reserve volume
(d) Residual volume
20. Lungs do not collapse between breaths and
some air always remains in the lungs which
can never be expelled because (2016-II)
(a) There is a positive intrapleural pressure
(b) Pressure in the lungs is higher than the
atmospheric pressure
(c) There is a negative pressure in the lungs
(d) There is a negative intrapleural pressure
pulling at the lung walls
21. Partial pressure of oxygen in the alveoli of
the lungs is (2016-II)
(a) Less than that in the blood
(b) Less than that of carbon dioxide
(c) Equal to that in the blood
(d) More than that in the blood
22. Reduction in pH of blood will (2016-I)
(a) Reduce the rate of heart beat
(b) Reduce the blood supply to the brain
(c) Decrease the affinity of hemoglobin with
oxygen
(d) Release bicarbonate ions by the liver
23. When you hold your breath which of the
following gas changes in blood would first
lead to the urge to breathe? (2015 Re)
(a) Rising CO2 concentration
(b) Rising CO2 and falling O2 concentration
(c) Falling O2 concentration
(d) Falling CO2 concentration
24. Approximately seventy percent of carbon-
dioxide absorbed by the blood will be
transported to the lungs (2014)
(a) As carbamino-haemoglobin
(b) As bicarbonate ions
(c) In the form of dissolved gas molecules
(d) By binding to R.B.C

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

495 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (a) S14. Ans. (a)

S2. Ans. (c) S15. Ans. (a)

S3. Ans. (c) S16. Ans. (b)

S4. Ans. (d) S17. Ans. (b)

S5. Ans. (b) S18. Ans. (a)

S6. Ans. (d) S19. Ans. (d)

S7. Ans. (d) S20. Ans. (d)

S8. Ans. (d) S21. Ans. (d)

S9. Ans. (b) S22. Ans. (c)

S10. Ans. (d) S23. Ans. (a)

S11. Ans. (a) S24. Ans. (b)

S12. Ans. (c)

S13. Ans. (b)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

496 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(a)
Therefore, the sequence is (D), (A), (C),
(B), (E).
S2. Ans.(c)
The vital capacity (VC) of the lung is the
maximum amount of air a person can
expel form the lungs after a maximum
inhalation. It is equal to the sum of
inspiratory reserve volume (IRV), tidal
volume (TV), and expiratory reserve
volume (ERV).
S3. Ans.(c)
Option(c) is the correct answer Pneu-
motaxic centre is present in the pons
region of the brain that can moderate
centre. ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
the functions of the respiratory rhythm
S4. Ans.(d)
Option (d) is the correct answer because
statements (a), (c) and (e) are correct.
Viral capacity includes ERV, TV, and
IRV
Vital capacity is the maximum volume
of air a person can breathe in after a
forced expiration or the maximum
volume of air a person can breathe out
after a forced inspiration.
S5. Ans.(b)
Option (b) is the correct answer because
every 100 ml of oxygenated blood can
deliver around 5 ml O2 to the tissues
under normal physiological conditions.
S6. Ans.(d)
497 CHANNEL
JOIN TELEGRAM
Option (d) is correct because the parts
starting with the external nostrils upto
the terminal bronchioles constitute the
conducting part; whereas the alveoli
and their ducts form the respiratory or
exchange part of the respiratory system.
S7. Ans.(d)
pO2 = 104 mm Hg; pCO2 = 40 mmHg
S8. Ans.(d)
Favourable conditions required for the
formation of oxyhaemoglobin at the
alveoli is:. High pO2 . Low
pCO2 . Less H + . Lower temperature
S9. Ans.(b)
In tissues, higher H + concentration
favours the dissociation of oxygen from
oxyhaemoglobin. In the alveoli, high
pO2 , low pCO2 , lesser H + concentration
and lower temperature are the factors
favourable for the formation of
oxyhaemoglobin.
S10. Ans.(d)
Inspiration is initiated by the contra-
ction of diaphragm which increases the
volume of thoracic
chamber in the antero-posterior axis.
The contraction of external inter- costal
muscles lifts up the ribs and the ster-
num causing an increase in the volume
of the thoracic chamber in the dorso-
ventral axis. A similar rise in pulmonary
volume is caused by the overall increase
in thoracic volume. An increase in pul-
monary volume decreases the intra-
pulmonary pressure.
S11. Ans.(a)
Pneumotaxic centre can moderate the
functions of the respiratory rhythm
centre. It is present in the pons region
of brain. Alveoli is the primary site for
gaseous exchange. Nearly 70 per cent of
carbon dioxide is transported by RBC as
bicarbonate (𝐻𝐶𝑂3− ) with the help of the
enzyme carbonic anhydrase.
A sigmoid curve is obtained when
percentage saturation of haemoglobin
with O2 is plotted against the PO2 . This
curve is called the Oxygen dissociation
curve.
S12. Ans.(c)
Total Lung Capacity: Total volume of air
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
accommodated in the lungs at the end
of a forced inspiration. This includes
RV, ERV, TV and IRV or vital capacity +
residual volume.
S13. Ans.(b)
Asthma is a difficulty in breathing
causing wheezing due to inflammation
of bronchi and bronchioles.
It can be due to increasing air-borne
allergens and pollutants. Asthma is an
allergic condition. Many people in urban
areas are suffering from this respiratory
disorder.
S14. Ans.(a)
Tidal Volume = 500 ml
Expiratory Reserve Volume = 1000 ml
Expiratory Capacity = TV + ERV = 500 +
1000 = 1500 ml
498 CHANNEL
JOIN TELEGRAM
S15. Ans.(a)
Asthma is a chronic lung disease that
inflames and narrows the airways. It is
the result of chronic inflammation of
conducting zone of airways, especially
the bronchi and bronchioles.
Emphysema is a chronic disorder in
which alveolar walls are damaged due to
which respiratory surface is decreased.
S16. Ans.(b)
Tidal volume – Normal volume of air
displaced between normal inhalation
and exhalation. It is about 500 ml.
Inspiratory reserve volume – Maximal
amount of additional air that can be
drawn into lungs by determined effort; it
is 2500-3000 ml. Expiratory reserve
volume – Forceful expiration after
normal inspiration; It is volume is 1000-
1100 ml. Residual volume – volume
remaining in lungs after forceful
expiration, measures 1100-1200 ml.
S17. Ans.(b)
Silicosis is caused by inhalation of dust
containing silica. Defense mechanism of
the body can not fully cope with the
sitution. Long exposure can give rise
to inflammation leading to serious lung
damage. It is a form of occupational
lung disease. Workers in such
industries should wear protective
masks.
S18. Ans.(a)
Residual volume (RV) : Volume of air
remaining in lungs even after a forcible
expiration. It is about 1100-1200 ml.
S19. Ans.(d)

Spirometer is used in the estimation of

the volume of air involved in breathing S22. Ans.(c)
movements. Vital capacity, tidal volume,
Reduction in pH of blood will decrease
inspiratory reserve and expiratory
the affinity of haemoglobin with oxygen.
reserve can all be measured with a
S23. Ans.(a)
spirometer. Residual volume can not be
A chemosensitive area is situated
measured by the spirometer because it
adjacent to the rhythm centre which is
is impossible to breath out completely.
highly sensitive to CO2 and H + ions.
S20. Ans.(d)
Increase in these substances can
Lungs do not collapse between breaths
activate this centre which in turn can
and some air always remains in the
signal the rhythm centre to make
lungs which can never be expelled
necessary adjustments in the
because there is a negative intrapleural
respiratory process by which these
pressure pulling at the lung walls.
substances can be eliminated. The role

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S21. Ans.(d) of oxygen in the regulation of respiratory
The partial pressure of oxygen in the rhythm is quite insignificant.
alveoli (104mmHg) of the lungs is more S24. Ans.(b)
than that in the blood. (95mmHg)
Bicarbonate = 70 percent of CO2
Respi Atmo- Alveo Blood Blood Tis-
RBCs = 20-25 percent of CO2
- spheri li sue
Plasma = 7 percent of CO2
rator c (Deoxy- (Oxy- s
y
genate genate
Air d) d)
Gas

O2 159 104 40 95 40

CO2 0.3 40 45 40 45

499 CHANNEL
JOIN TELEGRAM
 Chapter 15
Sankalp Bharat
Body Fluid & Circulation

1. Match List -I with List -II (2023) (c) A-I, B-II, C-III, D-IV
List -I (ECG) List-II (Electrical (d) A-III, B-I, C-IV, D-II
activity of heart) 4. Which of the following statements are
P-wave (I) Depolarisation correct ? (2023)
(A) A. Basophils are most abundant cells of the
of ventricles
total WBCs
(B) QRS Complex (II) End of systole B. Basophils secrete histamine, serotonin
(C) T-wave (III) Depolarisation and heparin
of atria C. Basophils are involved in inflammatory
response
(D) End of T-wave (IV) Repolarisation
D. Basophils have kidney shaped nucleus
of ventricles
E. Basophils are agranulocytes
Choose the correct answer from the options Choose the correct answer from the options
given below:- given below:
(a) A-(IV), B-(I), C-(III), D-(II) (a) C and E only
(b) A-(I), B-(IV), C-(III), D-(II) (b) B and C only
(c) A-(IV), B-(III), C-(I), D-(II) (c) A and B only

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) A-(III), B-(I), C-(IV), D-(II) (d) D and E only
2. Match List -I with List -II. (2023) 5. A unique vascular connection between the
List -I List-II digestive tract and liver is called _____.
Eosinophils (I) 6-8% (2022)
(A)
(a) Hepato-cystic system
(B) Lymphocytes (II) 2-3% (b) Hepato-pancreatic system
(C) Neutrophills (III) 20-25% (c) Hepatic portal system
(d) Renal portal system
(D) Monocytes (IV) 60-65%
6. Given below are two statements :
Choose the correct answer from the options Statements I : The coagulum is formed of
given below: network of threads called thrombins.
(a) A-IV, B-I, C-II, D-III Statements II : Spleen is the graveyard of
(b) A-IV, B-I, C-III, D-II erythrocytes. In the light of the above
(c) A-II, B-III, C-IV, D-I statements, choose the most appropriates
(d) A-II, B-III, C-I, D-IV answer from the options given below :
3. Match List -I with List -II. (2023)
(2022)
List -I List-II
(a) Both statements I and statements II are
(A) P-wave (I) Beginning of correct.
systole (b) Both statement I and statement II are
(B) Q-wave (II) Repoarisation incorrect.
of ventricles (c) Statement I is correct but statement II is
QRS complex (III) Depolarisation incorrect
(C)
of atria (d) Statement I is incorrect but statement II
is Correct.
(D) T-wave (IV) Depolarisation 7. Which of the following statements is
of ventricles correct? (2022)
Choos the correct answer from the options (a) The atrio-ventricles node (AVN)
given below : generates can action potential to
(a) A-IV, B-III, C-II, D-I stimulates atrial contraction
(b) A-II, B-IV, C-I, D-III

500 CHANNEL
JOIN TELEGRAM
 (b) The tricuspid acid the bicuspid valves
open dur to pressure excreted by the
simultaneous contraction of the atria.
(c) Blood moves freely from atrium to the
ventricles during joint diastole.
(d) Increased ventricular pressure causes
closing of the semilunar valves.
8. Which enzyme is responsible for the
conversion of inactive fibrinogens to fibrins?
(2021)
(a) Renin
(b) Epinephrine
(c) Thrombokinase
(d) Thrombin
9. Persons with ‘AB’ blood group are called as
“Universal recipients”. This is due to
(2021)
(a) Absence of antigens A and B in plasma
(b) Presence of antibodies, anti-A and anti-
B, on RBCs
(c) Absence of antibodies, anti-A and anti-B,
in plasma
(d) Absence of antigens A and B on the
12. Which of the following is associated with
decrease in cardiac output?
(2020 Covid Re-NEET)
(a) Parasympathetic neural signals
(b) Pneumotaxic centre
(c) Adrenal medullary hormones
(d) Sympathetic nerves
13. Which of the following conditions cause
erythroblastosis foetalis?
(2020 Covid Re-NEET)
(a) Mother 𝑅ℎ −𝑣𝑒
and foetus 𝑅ℎ+𝑣𝑒
(b) Both mother and foetus 𝑅ℎ−𝑣𝑒
(c) Both mother and foetus 𝑅ℎ+𝑣𝑒
(d) Mother 𝑅ℎ+𝑣𝑒 and foetus Rh
14. What would be the heart rate of a person if
the cardiac output is 5 L, blood volume in
the ventricles at the end of diastole is 100
mL and at the end of ventricular systole is
50 mL? (2019)
(a) 50 beats per minute
(b) 75 beats per minute
(c) 100 beats per minute
(d) 125 beats per minute

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
surface of RBCs 15. Match the Column-I with Column-II (2019)
10. QRS complex in a standard ECG represents Column I Column II
(2020) P - wave i. Depolarisation of
(a) Depolarisation of auricles A.
ventricles
(b) Depolarisation of ventricles
(c) Repolarisation of ventricles B. QRS ii. Repolarisation of
(d) Repolarisation of auricles complex ventricles
11. Match the following columns and select the C. T - wave iii. Coronary
correct option (2020) ischemia
Column - I Column - II Depolarisation of
D. Reduction iv.
1. Eosinophils (i) Immune atria
in the size of
response
T-wave
2. Basophils (ii) Phagocytosis
v. Repolarisation of
3. Neutrophils (iii) Release atria
histaminase,
(a) A-iv B-i C-ii D-iii
destruc-
(b) A-iv B-i C-ii D-v
tive enzymes (c) A-ii B-i C-v D-iii
4. Lymphocytes (iv) Release (d) A-ii B-iii C-v D-iv
granules 16. Match the items given in Column I with
containing those in Column II and select the correct
option given below (2018)
histamine
Column I Column II
1 2 3 4 Tricuspid i.
A. Between left
(a) (iv) (i) (ii) (iii) valve atrium
(b) (i) (ii) (iv) (iii)
(c) (ii) (i) (iii) (iv) and left ventricle
(d) (iii) (iv) (ii) (i)

501 CHANNEL
JOIN TELEGRAM
 B. Bicuspid ii. Between right (a) Sino-atrial node has a lower inherent
valve ven-tricle and rate of depolarisation
pulmonary (b) All the other components in heart cannot
conduct the action potential
Artery
(c) Only the sino-atrial node is auto-
C. Semilunar iii. Between right excitable and auto-rhythmic
valve atrium (d) Sino-atrial node has a higher inherent
rate of depolarization
and right
21. In the heart, as the action potential reaches
ventricle
the AV node from the SA node, there is a
(a) A-iii B-i C-ii delay of the action potential.
(b) A-i B-iii C-ii This delay is important because (2017)
(c) A-i B-ii C-iii (a) It allows right atria to receive the blood
(d) A-ii B-i C-iii from vena cava
17. Match the items given in Column I with (b) It allows atria to rest
those in Column II and select the correct (c) It allows a stronger right atrial contaction
option given below (2018) (d) It allows ventricles to receive all the
Column I Column II blood from the atria
Fibrinogen i. Osmotic balance 22. Serum differs from blood in (2016 - II)
A.
(a) Lacking clotting factors
B. Globulin ii. Blood clot
(b) Lacking antibodies
ting
(c) Lacking globulins
C. Albumin iii. Defense (d) Lacking albumins

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
mechanism
23. Blood pressure in the pulmonary artery is
(a) A-iii B-ii C-i (2016 - I)
(b) A-i B-ii C-iii (a) Same as that in the aorta
(c) A-i B-iii C-ii (b) More than that in the carotid
(d) A-ii B-iii C-i (c) More than that in the pulmonary vein
18. Adult human RBCs are enucleate. Which of (d) Less than that in the vena cava
the following statement(s) is/are most 24. Blood pressure in the mammalian aorta is
appropriate explanation for this feature? maximum during (2015)
(2017) (a) Systole of the left ventricle
A. They do not need to reproduce (b) Diastole of the right atrium
B. They are somatic cells (c) Systole of the left atrium
C. They metabolise (d) Diastole of the right ventricle
D. All their internal space is available for 25. Which one of the following is correct?
oxygen transport (2015)
(a) Only D (a) Lymph = Plasma + RBC + WBC
(b) Only A (b) Blood = Plasma + RBC + WBC + Platelets
(c) A, C and D (c) Plasma = Blood – Lymphocytes
(d) B and C (d) Serum = Blood + Fibrinogen
19. Hepatic portal vein drains blood to liver 26. Erythropoiesis starts in (2015)
from (2017) (a) Spleen
(a) Heart (b) Red bone marrow
(b) Stomach (c) Kidney
(c) Kidneys (d) Liver
(d) Intestine 27. Which one of the following animals has two
20. All the components of the conducting separate circulatory pathways? (2015 Re)
system can generate an action potential for (a) Lizard
the contraction of heart muscle, but the (b) Whale
sino-atrial node acts as the pacemaker (c) Shark
because (2017) (d) Frog

502 CHANNEL
JOIN TELEGRAM
28. If you suspect major deficiency of antibodies 30. The diagram given here is the standard ECG
in a person to which of the following would of a normal person. The P-wave represents
you look for confirmatory evidences? the (2013)
(2015 Re)
(a) Serum albumins
(b) Haemocytes
(c) Serum globulins
(d) Fibrinogen in plasma (a) End of systole
29. Doctors use stethoscope to hear the sounds (b) Contraction of both the atria
produced during each cardiac cycle. The (c) Initiation of the ventricular contraction
second sound is heard when (2015 Re) (d) Beginning of the systole
(a) Ventricular walls vibrate due to pushing 31. The most abundant intracellular cation is
in of blood from atria (2013)
(b) Semilunar valves close down after the (a) K +
blood flows into vessels from ventricles (b) Na+
(c) AV node receives signal from SA Node (c) Ca++
(d) AV valves open up (d) H +

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

503 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (d) S17. Ans. (d)

S2. Ans. (c) S18. Ans. (a)

S3. Ans. (d) S19. Ans. (d)

S4. Ans. (b) S20. Ans. (d)

S5. Ans. (c) S21. Ans. (d)

S6. Ans. (d) S22. Ans. (a)

S7. Ans. (c) S23. Ans. (c)

S8. Ans. (d) S24. Ans. (a)

S9. Ans. (c) S25. Ans. (b)

S10. Ans. (b) S26. Ans. (b)

S11. Ans. (d) S27. Ans. (b)

S12. Ans. (a) S28. Ans. (c)

S13. Ans. (a) S29. Ans. (b)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (c) S30. Ans. (b)

S15. Ans. (a) S31. Ans. (a)

S16. Ans. (a)

504 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(d)
An ECG (Electrocardiogram) is a test
that measures the electrical activities of
the heart. Each wave in An ECG
represents a certain. Part of the heart’s
electrical activity.
S2. Ans.(c)
This questions asks to match types of
white blood cells (List) with their usual
proportion in the blood (List II). The
correct matching are :
Eosinophils (A)-typically make up 1-6%
of white blood cells, so the best match is
(1) 6-8%
Lymphocytes (B) -typically make up 20-
40% of white blood cells, but none of the
options are in this range. However since
the other cells have more fitting
matches, the remaining percentage (III)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
20-25% would be the best fit.
S3. Ans.(d)
P-wave : Depolarization of atria
Q- wave : Beginning of systole
QRS complex : Depolarisation of
ventricles
T -wave : Repolarisation of ventricles
S4. Ans.(b)
Statements B is correct. Basophils do
secrete histamine, serotonin, and
heparin, Histamine and serotonin are
involved in inflammatory response,
while heparin is an anticoagulant.
Statement C is also correct. Basophils
are involved in the inflammatory
response. They release chemicals such
as histamine and serotonin that dilate
blood vessels and attract other white
blood cells to the site of inflammation.
S5. Ans.(c)
Option (c) is the correct answer because
hepatic portal system is a unique
vascular connection between digestive
tract and liver.
505 CHANNEL
JOIN TELEGRAM
S6. Ans.(d)
Option (d) is the correct answer because
coagulum or not is formed mainly. A
network of threads called fibrins. Hence
statements I is incorrect.
RBCs are destroyed in the spleen so
spleen is known as the graveyard of
erythrocytes. Hence , statements II is
correct.
S7. Ans.(c)
Option (c) is the correct answer because
during joint diastole, blood moves freely
from atrium to ventricles as
atrioventocular valve remain open
during joint diastole.
S8. Ans.(d)
Fibrins are formed by the conversion of
inactive fibrinogens in the plasma by
the enzyme thrombin.
S9. Ans.(c)
Persons with ‘AB’ group can accept
blood from persons with AB as well as
the other groups of blood because they
do not have anti A and anti B antibodies
in their blood plasma.
S10. Ans.(b)
The depolarization of the ventricles
which initiates ventricular contraction is
shown by the QRS complex in a normal
ECG.
S11. Ans.(d)
Histaminase, destructive enzymes are
released by eosinophils. Histamine-
releasing granules are released by
basophils. Phagocytosis is a type of
phagocytosis that occurs in neutrophils.
Immune response is performed by
lymphocytes.
S12. Ans.(a)
Parasympathetic neural signals (another
component of the ANS) reduce heart
rate, speed of action potential
conduction and hence cardiac output.
S13. Ans.(a)
Rh antibodies from the mother (𝑅ℎ ) −𝑣𝑒
can leak into the blood of the foetus
(𝑅ℎ+𝑣𝑒 ) and kill the foetal RBCs
throughout subsequent pregnancies.
The foetus could die as a result, or the
newborn could develop severe anaemia
and jaundice. Erythroblastosis foetalis
is the name for this disorder.
S14. Ans.(c)
Cardiac output = Stroke volume × Heart
rate Cardiac output = 5 litres or 5000
millilitres At the end of diastole, the
blood volume in the ventricles is equal
to 100 ml. At the end of systole,
the blood volume in the ventricles is 50
ml.
Stroke Volume = EDV-ESV
As a result, the stroke volume is equal
to 100 – 50 = 50 ml.
As a result, 5000 ml = 50 ml × Heart
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
rate i.e. 100 beats per minute is the
heart rate
S15. Ans.(a)
P-wave in an ECG represents atria
depolarization. The depolarization of the
ventricles is represented by the QRS
complex. T-wave indicates ventricular
repolarization, or the transition from an
excited to a normal condition.
Insufficient oxygen supply, i.e.
coronary ischemia, is indicated by a
reduction in the size of the T-wave.
S16. Ans.(a)
Tricuspid valve is a three-cusp muscle
flap that connects the right atrium and
right ventricle. Backflow from the left
ventricle to the left atrium is prevented
by the bicuspid valve which is a
bimuscular flap. The semilunar valve
controls blood flow between the right
ventricle and the pulmonary artery.
S17. Ans.(d)
The action of thrombin, a clotting
enzyme, converts fibrinogen to fibrin.
These fibrin coagulate the blood
by forming a fibrous network. Globulin
makes up a considerable portion of the
506 CHANNEL
JOIN TELEGRAM
proteins in blood serum and are
primarily involved in the defense
mechanism. Albumin helps to maintain
plasma’s colloid osmotic pressure.
S18. Ans.(a)
In the bone marrow, the biconcave
mammalian erythrocyte is formed.
Following synthesis, the nucleus is
removed in a process known as
enucleation. The lack of a nucleus
permits red blood cells to hold more
haemoglobin, freeing up all of their
internal space for oxygen transfer to
the body’s tissues. They do not
demonstrate any metabolic activity or
multiplication because they do
not have any organelles.
S19. Ans.(d)
Hepatic portal system contains the
hepatic portal vein which transports
blood from the intestine to the liver
before delivering it to the systemic
circulation.
S20. Ans.(d)
SAN is in charge of initiating and
maintaining the heart’s rhythmic
contractile activity which can
generate up to 70-75 action potentials
each minute. As a result, it is known as
the pacemaker.
S21. Ans.(d)
The delay is crucial because it allows all
of the blood from the atria to reach the
ventricles.
S22. Ans.(a)
Serum is plasma lacking the clotting
factors.
S23. Ans.(c)
The pulmonary artery has a higher
blood pressure
than the pulmonary vein.
S24. Ans.(a)
Due to attempted blood backflow,
ventricular systole raises pressure,
causing the tricuspid and bicuspid
valves to close. As ventricular pressure
rises, the semilunar valves that protect
 the pulmonary artery and aorta are
forced to open, allowing blood to flow
through the ventricles.
S25. Ans.(b)
S26. Ans.(b)
In the early foetal development,
erythropoiesis is started in the yolk sac.
After a few months it takes place in the
spleen and liver. After birth,
erythropoiesis is taking place in red
bone marrow.
S27. Ans.(b)
Blood circulation in mammals is divided
into two types: pulmonary and systemic.
Pulmonary circulation is between the
heart and lungs. Systemic circulation is
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
between the heart and the other organs.
507 CHANNEL
JOIN TELEGRAM
S28. Ans.(c)
Globulins are largely involved in the
body’s defense processes.
S29. Ans.(b)
Two distinct sound are emitted
throughout each heart cycle which can
be heard with a stethoscope.
The closure of the tricuspid and
bicuspid valves is connected with the
first heart sound (lub). The closing of
the semilunar valves is associated with
the second heart sound (dub).
S30. Ans.(b)
P waves in the ECG represent atria
depolarization which causes both atria
to contract.
S31. Ans.(a)
The cation K + is the most abundant
intracellularly.
 Chapter 16
Sankalp Bharat
Excretory Products & Their Elimination

1. Select the correct statement 5. Match the items given in Column I with
(2020 Covid Re-NEET) those in Column II and select the correct
(a) Angiotensin II is a powerful vasodilator option given below (2018)
(b) Counter current pattern of blood flow is Column I Column II
not observed in vasa recta Glycosuria i. Accumulation
(c) Reduction in glomerular filtration rate A.
of uric acid in
activates JG cells to release renin joints
(d) Atrial Natriuretic Factor increases the
blood pressure B. Gout ii. Mass of
2. The increase in osmolarity from outer to crystallised
inner medullary interstitium is maintained salts within
due to (2020 Covid Re-NEET) the kidney
(i) Close proximity between Henle’s loop and
C. Renal iii. Inflammation
vasa recta
calculi in glomeruli
(ii) Counter current mechanism
(iii) Selective secretion of HCO− 3 and D. Glomerular iv. Presence of
hydrogen ions in PCT glucose in
nephritis

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(iv) Higher blood pressure in glomerular urine
capillaries
(a) A-iii B-ii C-iv D-i
(a) (iii) and (iv)
(b) A-i B-ii C-iii D-iv
(b) (i), (ii) and (iii)
(c) A-ii B-iii C-i D-iv
(c) (i) and (ii)
(d) A-iv B-i C-ii D-iii
(d) Only (ii)
6. Match the items given in Column I with
3. Which one of the following factor is
those Column II and select the correct
responsible for the formation of
option given below (2018)
concentrated urine? (2019)
(a) Low levels of antidiuretic hormone Column I Column II
(b) Maintaining hyperosmolarity towards
(Function) (Part of
inner medullary interstitium in the
Excretory
kidneys System)
(c) Secretion of erythropoietin by ]
juxtaglomerular complex A. Ultrafiltration i. Henle's
(d) Hydrostatic pressure during glomerular loop
Filtration B. Concentration ii. Ureter
4. Use of an artificial kidney during of urine
hemodialysis may result in (2019) C. Transport of iii. Urinary
A. Nitrogenous waste build-up in the body urine bladder
B. Non-elimination of excess potassium
D. Storage of iv. Malpighian
ions
urine corpuscle
C. Reduced absorption of calcium ions from
gastro-intestinal tract v. Proximal
D. Reduced RBC production convoluted
Which of the following option is the most tubule
appropriate?
(a) A and B are correct (a) A-iv B-v C-ii D-iii
(b) B and C are correct (b) A-iv B-i C-ii D-iii
(c) C and D are correct (c) A-v B-iv C-i D-ii
(d) A and D are correct (d) A-v B-iv C-i D-iii
508 CHANNEL
JOIN TELEGRAM
7. A decrease in blood pressure/volume will (d) Proximal convoluted tubule
not cause the release of (2017) 12. In mammals, which blood vessel would
(a) Renin normally carry largest amount of urea?
(b) Atrial Natriuretic Factor (2016 - I)
(c) Aldosterone (a) Renal Vein
(d) ADH (b) Dorsal Aorta
8. Which one of the following statement is (c) Hepatic Vein
correct? (2017) (d) Hepatic Portal Vein
(a) Ascending limb of loop of Henle is 13. Removal of proximal convoluted tubule
impermeable to water from the nephron will result in (2015)
(b) Descending limb of loop of Henle is (a) No change in quality and quantity of
impermeable to water urine
(c) Ascending limb of loop of Henle is (b) No urine formation
permeable to water (c) More diluted urine
(d) Descending limb of loop of Henle is (d) More concentrated urine
permeable to electrolytes 14. Which of the following does not favour the
9. formation of large quantities of dilute urine?
Subst Glomeru Reabsorb Urin (2015)
ance lar ed e (a) Renin
(b) Atrial-natriuretic factor
Filterate (c) Alcohol
i Protei 2g 1.9g 0.1g (d) Caffeine
ns 15. Human urine is usually acidic because

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
ii Gluco 162g 162g 0g (2015 Re)
se (a) Excreted plasma proteins are acidic
iii Urea 54g 24g 30g (b) Potassium and sodium exchange
iv Creati 1.6g 0g 1.6g generates acidity
nine (c) Hydrogen ions are actively secreted into
A. Glucose is completely reabsorbed the filtrate
B. Urea is partially reabsorbed (d) Sodium transporter exchanges one
C. Proteins are secreted into urine hydrogen ion for each sodium ion in
D. Creatinine is secreted into urine peritubular capillaries
Which of the following options in view of 16. Which of the following causes an increase in
above statements is correct? (2017) sodium reabsorption in the distal
(a) A, C and D convoluted tubule? (2014)
(b) A, B and C (a) Decrease in antidiuretic hormone levels
(c) B, C and D (b) Increase in aldosterone levels
(d) A, B and D (c) Increase in antidiuretic hormone levels
10. Which one of the following statement is not (d) Decrease in aldosterone levels
true? (2017) 17. Figure shows human urinary system with
(a) Loop of Henle is largely responsible for structures labeled A to D. Select option
concentrated urine which correctly identifies them and gives
(b) Descending limb of loop of Henle is their characteristics and/ or functions
impermeable to solutes (2013)
(c) Distal convoluted tubule functions in K+
- Na+ homeostasis
(d) Descending limb of loop of Henle is
impermeable to water
11. The part of nephron involved in active
reabsorption of sodium is (2016 - II)
(a) Bowman’s capsule
(b) Descending limb of Henle’s loop
(c) Distal convoluted tubule
509 CHANNEL
JOIN TELEGRAM
(a) D-Cortex - Outer part of kidney and do
not contain any part of nephrons
(b) A-Adrenal gland- Located at the anterior
part of kidney. Secrete catecholamine’s
which stimulate glycogen breakdown
(c) B-Pelvis-Broad funnel shaped space
inner to hilum, directly connected to
loops of Henle’s
(d) C-Medulla - Inner zone of kidney and
contains complete nephrons

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

510 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (c) S11. Ans. (d)

S2. Ans. (c) S12. Ans. (c)

S3. Ans. (b) S13. Ans. (c)

S4. Ans. (c) S14. Ans. (a)

S5. Ans. (d) S15. Ans. (c)

S6. Ans. (b) S16. Ans. (b)

S7. Ans. (b) S17. Ans. (b)

S8. Ans. (a)

S9. Ans. (d)

S10. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

511 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(c)
Angiotensin II is a very strong vasocon-
strictor. Mammals have the potential to
create urine that is highly concentrated.
The Henle’s loop and the vasa recta are
important in this. The flow of filtrate in
Henle’s loop’s two limbs is in opposite
directions forming a counter current. JG
cells can be activated by a decrease in
glomerular blood flow or glomerular
blood pressure.
ANF can lower blood pressure by
causing vasodilation (dilation of blood
vessels).
S2. Ans.(c)
The proximity of the Henle’s loop and
the vasa recta as well as the counter
current between them aid in
Maintaining a rising osmolarity towards
the inner medullary interstitium i.e.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
from 300 mOsmol/L in the cortex to
around 1200 mOsmol/L in the inner
medulla. NaCl and urea are the main
causes of this gradient.
S3. Ans.(b)
The close proximity to Henle’s loop and
the vasa recta as well as the counter-
current between them aidin the main-
tenance of a rising osmolarity towards
the inner medullary interstitium. This
mechanism contributes to the
maintenance of a concentration gradient
in the medullary interstitium resulting
in human urine that is nearly four times
as oncentrated as the initial filtrate.
S4. Ans.(c)
Dialysis removes urea and potassium
from the body. Phosphate ions as well
as calcium ions are removed during
dialysis. As a result, the absorption
of calcium ions from the gastrointestinal
system will be reduced. Due to a
decrease in erythropoietin hormone,
RBC production will be lowered.
S5. Ans.(d)
Glycosuria is the presence of glucose in
the urine, which can be caused by
512 CHANNEL
JOIN TELEGRAM
diabetes. Gout is a condition in which
uric acids build up in the joints.
Renal calculi are deposits of crystallised
salts within the kidneys. Glomerular
nephritis - Inflammation of glomeruli.
S6. Ans.(b)
A-iv B-i C-ii D-iii
Ultrafiltration is carried out by the
malpighian corpuscle.
Henle’s loop along with vasa recta help
to produce a concentrated urine by
counter-current mechanism. Urine
travels from the ureter to the urinary
bladder, where it is stored until
micturition.
S7. Ans.(b)
The renin-angiotensin system is
examined by ANF. The release of atrial
natriuretic factor is triggered by
an increase in blood flow to the heart’s
atria. ANF decreases blood pressure by
causing vasodilation (dilation of blood
vessels).
S8. Ans.(a)
Ascending limb of the Henle loop is
impermeable to water but allows trans-
port of electrolytes actively or passively
Descending limb is permeable to water
but impermeable to electrolytes.
S9. Ans.(d)
A total of 162 g glucose is reabsorbed,
leaving 0 g glucose in the urine. This
means that all of the glucose has been
absorbed. As a result, statement (a) is
true.
Only 24 g of urea is reabsorbed while
the rest is excreted in urine, making it
partially reabsorbed. As a result,
statement (B) is also true. In urine, only
0.1 g of protein is excreted. As a result,
proteins are nearly reabsorbed. As a
result, statement (C) is false.
Because there is no resorption of
creatinine, statement (D) is also correct.
S10. Ans.(d)
 Descending limb of the loop of Henle is
permeable to water but almost
impermeable to electrolytes.
S11. Ans.(d)
The part of nephron involved in active
reabsorption of sodium is proximal
convoluted tubule.
S12. Ans.(c)
In mammals, hepatic vein blood vessel
would normally carry largest amount of
urea.
S13. Ans.(c)
Nearly all the essential nutrients and
70-80 per cent of water and electrolytes
are reabsorbed by PCT. If PCT is
removed, there is no water absorption
hence more dilute urine is formed.
S14. Ans.(a)
Fall in GFR activate the JG cells to
release renin which facilitates the
absorption of water and Na+
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
513 CHANNEL
JOIN TELEGRAM
through activation of adrenal cortex.
Hence, its action result in output of less
but concentrated urine.
S15. Ans.(c)
PCT helps to maintain the pH and ionic
balance of the body fluids by selective
secretion of hydrogen ions, NH3 and K +
into the filtrate.
S16. Ans.(b)
Fall in GFR followed by release of renin
which converts Angiotensinogen to
Angiotensin I then Angiotensin I
converted into Angiotensin II.
Angiotensin II activates the adrenal
cortex to release aldosterone which
causes Na+ reabsorption from distal
parts of the tubule.
S17. Ans.(b)
A-Adrenal gland; B-Renal pelvis; C-
Medulla; D-Cortex.
 Chapter 17
Locomotion And Movement Sankalp Bharat

1. Match List-I with List-II. (2023) (a) Smooth muscles are multinucleated and
List-I List-II involuntary
(Type of Joint) (Found between) (b) Skeletal muscle fibres are uninucleted
Cartilaginous (i) Between flat and found in parallel bundles
A. (c) Intercalated discs allow the cardiac
Joint skull bones
muscle cells to contract as a unit
B. Ball and (ii) Between (d) The walls of blood vessels are made up
Socket Joint adjacent of columnar epithelium
vertebrae in 4. According to the sliding filament theory:
vertebral (2022)
column
(a) The actin filaments slide away from A-
C. Fibrous Joint (iii) Between band resulting in shortening of
carpal and sarcomere
metacarpal of
(b) Actin and myosin filaments slide over
thumb
each other to increase the length of the
D. Saddle Joint (iv) Between
sarcomere
Humerus and

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Pectoral girdle
Choose the correct answer from the options
given below:
(a) A-(ii), B-(iv), C-(i), D-(iii)
(b) A-(i), B-(iv), C-(iii), D-(ii)
(c) A-(ii), B-(iv), C-(iii), D-(i)
(d) A-(iii), B-(i), C-(ii), D-(iv)
2. Which of the following statements are
correct regarding skeletal muscle? (2023)
A. Muscle bundles are held together by
collagenous connective tissue layer
called fascicle.
B. Sarcoplasmic reticulum of muscle fibre
is store house of calcium ions.
C. Straited appearance of skeletal muscle
fibre is due to distribution pattern of
actin and myosin proteins.
D. M line is considered as functional unit of
contraction called sarcomere.
Choose the most appropriate answer from
the options given below:
(a) B and C only
(b) A, C and D only
(c) C and D only
(d) A, B and C only
3. Choose the correct statement about a
muscular tissue (2022)
514 CHANNEL
JOIN TELEGRAM
(c) Length of A-band does not change
(d) I-band increases in length
5. Gout is a type of disorder which leads to:
(2022)
(a) Weakening of bones due to low calcium
level
(b) Inflammation of joints due to
accumulation of uric acid crystals
(c) Weakening of bones due to decreased
bone mass
(d) Inflammation of joints due to cartilage
Degeneration
6. Given below are two statements : one is
labelled as Assertion (A) and the other is
labelled as Reason (R). (2022)
Assertion (A) : Osteoporosis is characterized
by decreased bone mass and increased
change of fractures.
Reason (R) : Common cause of osteoporosis
is increased levels of estrogen.
In the light of the above statements, choose
the most appropriate answer from the
options given below:
(a) Both (A) and (R) are correct and (R) is the
correct explanation of (A)
(b) Both (A) and (R) are correct but (R) is not
the correct explanation of (A)
(c) (A) is correct but (R) is not correct
(d) (A) is not correct but (R) is correct
7. Which of the following is a correct match for 1 2 3 4
disease and its symptoms? (2022) (a) (iii) (i) (ii) (v)
(a) Arthritis – Inflammed joints (b) (iv) (v) (i) (ii)
(c) (i) (ii) (iii) (iv)
(b) Tetany – High Ca2+ level causing rapid
(d) (ii) (i) (iii) (iv)
spasma 11. Which of the following muscular disorder is
(c) Myastnenia gravis – Genetic disorder inherited? (2019)
resulting in weakening and paralysis of (a) Tetany
skeletal muscle (b) Muscular dystrophy
(d) Muscular dystrophy – An auto immune (c) Myasthenia gravis
disorder causing progressive (d) Botulism
degeneration of skeletal muscle 12. Select the correct option (2019)
8. Chronic auto immune disorder affecting (a) 8th, 9th and 10th pairs of ribs articulate
neuromuscular junction leading to fatigue, directly with the sternum
weakening and paralysis of skeletal muscle (b) 11th and 12th pairs of ribs are
is called as (2021) connected to the sternum with the help
(a) Muscular dystrophy of hyaline cartilage
(b) Myasthenia gravis (c) Each rib is a flat thin bone and all the
(c) Gout ribs are connected dorsally to the
(d) Arthritis thoracic vertebrae and ventrally to the
9. Match the following columns and select the sternum
correct option (2020) (d) There are seven pairs of vertebrosternal,
Column - I Column - II three pairs of vertebrochondral and two

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
pairs of vertebral ribs
1. Floating (i) Located between 13. Calcium is important in skeletal muscle
ribs second and contraction because it (2018)
seventh ribs (a) Binds to troponin to remove the masking
of active sites on actin for myosin
2. Acromion (ii) Head of the
(b) Activates the myosin ATPase by binding
humerus
to it
3. Scapula (iii) Clavicle (c) Detaches the myosin head from the actin
4. Glenoid (iv) Do not connect filament
cavity with the sternum (d) Prevents the formation of bonds between
the myosin cross bridges and the actin
1 2 3 4 filament
(a) (i) (iii) (ii) (iv) 14. Pivot joint between atlas and axis is a type
(b) (iii) (ii) (iv) (i) of (2017)
(c) (iv) (iii) (i) (ii) (a) Fibrous joint
(d) (ii) (iv) (i) (iii) (b) Cartilaginous joint
10. Match the following columns and select the (c) Synovial joint
correct option (2020 Covid Re-NEET) (d) Saddle joint
Column-I Column-II 15. Out of ‘X’ pairs of ribs in humans only ‘Y’
Gout pairs are true ribs. Select the option that
Decreased levels of
correctly represents values of X and Y and
estrogen
provides their explanation (2017)
Osteoporosis Low Ca++ ions in the (a) X = 12, True ribs are
blood Y=7 attached dor-
Tetany sally to
Accumulation of uric
vertebral
acid Crystals
column and
Muscular Auto immune disorder ventrally to the
dystrophy sternum

515 CHANNEL
JOIN TELEGRAM
 (b) X = 12, True ribs are combination of joints would be badly
attached dor- affected in this accident? (2017)
Y=5 (a) Cartilaginous and synaptic joints
sally to
vertebral (b) Fibrous and cartilaginous joints
column and (c) Fibrous and synovial joints
sternum on (d) Cartilaginous and synovial joints
the two ends 20. Osteoporosis, an age–related disease of
skeletal system, may occur due to (2016-II)
(c) X = 24, True ribs are (a) Decreased level of estrogen
Y=7 dorsally atta- (b) Accumulation of uric acid leading to
ched to inflammation of joints
vertebral (c) Immune disorder affecting
column but neuromuscular junction leading to
are free on fatigue
ventral side (d) High concentration of Ca++ and Na+
21. Name the ion responsible for unmasking of
(d) X = 24, True ribs are
active sites for myosin for cross–bridge
Y = 12 dorsally atta-
activity during muscle contraction (2016-II)
ched to
(a) Sodium
vertebral
(b) Potassium
column but
(c) Calcium
are free on
(d) Magnesium
ventral side
22. Lack of relaxation between successive

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
16. Hypersecretion of growth hormone in adults stimuli in sustained muscle contraction is
does not cause further increase in height known as (2016-I)
because (2017) (a) Spasm
(a) Growth hormone becomes inactive in (b) Fatigue
adults (c) Tetanus
(b) Epiphyseal plates close after adolescence (d) Tonus
(c) Bones loose their sensitivity to growth 23. Sliding filament theory can be best
hormone in adults explained as (2015)
(d) Muscle fibres do not grow in size after (a) Actin and myosin filaments do not
Birth shorten but rather slide pass each other
17. Which of the following type of muscle fibres (b) When myofilaments slide pass each
will be the first one to undergo fatigue? other, myosin filaments shorten while
(2017) actin filaments do not shorten
(a) Aerobic fibres (e) When myofilaments slide pass each
(b) Slow oxidative fibres other, actin filaments shorten while
(c) Fast oxidative glycolytic fibres myosin filament do not shorten
(d) Fast glycolytic fibres (d) Actin and myosin filaments shorten and
18. Which one of the following is not a ciliary slide pass each other
movement? (2017) 24. Which one of the following joints would
(a) Food gathering in Paramoecium allow no movement? (2015 Re)
(b) Removal of dust particles in trachea (a) Cartilaginous joint
(c) Passage of ova through female (b) Synovial joint
reproductive tract (c) Ball and Socket joint
(d) Movement of macrophages and (d) Fibrous joint
Leucocytes 25. Stimulation of a muscle fibre by a motor
19. An athlete while running fell on the track. neuron occurs at (2014)
She used her hands to sustain minimal (a) Sacroplasmic reticulum
injury. In the process, her hands received (b) Neuromuscular junction
the maximum blow on the joints. Which (c) Transverse tubules
(d) Myofibril

516 CHANNEL
JOIN TELEGRAM
26. The characteristics and an example of a 27. Select the correct statement with respect to
synovial joint in humans is (2013) locomotion in humans (2013)
Characteristics Examples (a) Joint between adjacent vertebrae is a
fibrous joint
(a) Lymph filled Gliding joint (b) A decreased level of progesterone causes
between two between osteoporosis in old people
bones, limited carpals (c) Accumulation of uric acid crystals in
movement joints causes their inflammation of joints
(d) Vertebral column has 10 thoracic
(b) Fluid cartilage Knee joints
Vertebrae
between two
28. H-Zone in the skeletal muscle fibre is due to
bones, limited (2013)
movements (a) Extension of myosin filaments in the
(c) Fluid filled between Skull bones central portion of the A-band
two (b) Absence of myofibrils in the central
portion of A-band
joints, provides
(c) Central gap between myosin filaments in
cushion
the A-band
(d) Fluid filled synovial Joint (d) Central gap between actin filaments
cavity between extending through myosin filaments in
between two bones atlas and the A-band
axis

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

517 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (a) S25. Ans. (b)

S2. Ans. (a) S26. Ans. (d)

S3. Ans. (c) S27. Ans. (c)

S4. Ans. (c) S28. Ans. (d)

S5. Ans. (b)

S6. Ans. (c)

S7. Ans. (a)

S8. Ans. (b)

S9. Ans. (c)

S10. Ans. (a)

S11. Ans. (b)

S12. Ans. (d)

S13. Ans. (a)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (c)

S15. Ans. (a)

S16. Ans. (b)

S17. Ans. (d)

S18. Ans. (d)

S19. Ans. (c)

S20. Ans. (a)

S21. Ans. (c)

S22. Ans. (c)

S23. Ans. (a)

S24. Ans. (d)

518 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(a)
These joints are connected by cartilage
and allow limited movement. They are
found between adjacent vertebrae in the
vertebral column.S2. Ans.(a)
Option (a) is the correct answer because
statements B and C are only correct
statements while A and D are incorrect
statements.
Muscle bundles are held together by
collagenous connective tissue layer
called fascia. Muscle bundles are called
fascicles. The portion of the myofibril
between two successive ‘Z’ lines is
considered as functional unit of
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
contraction called sarcomere.
S3. Ans.(c)
Option (c) is the correct answer as
cardiac muscle fibres possess
communication junctions (intercalated
discs) at some fusion points that allow
the cells to contract as unit, i.e., when
one cell receives a signal to contract, its
neighbours are also stimulated to
contract.
S4. Ans.(c)
Option (c) is the correct answer because
length of A band remains unchanged
during muscle contraction.
S5. Ans.(b)
Option (b) is the correct answer as
inflammation of joints due to
accumulation of uric acid crystals is
known as gout.
S6. Ans.(c)
519 CHANNEL
JOIN TELEGRAM
Option (c) is the correct answer as
osteoporosis is due to decreased levels
of estrogen. Osteoporosis is an age-
related disorder characterized by
decreased bone mass hence, the
chances of fractures increase.
S7. Ans.(a)
Option (a) is the correct answer because
Arthritis is inflammation of joints.
S8. Ans.(b)
Chronic auto immune disorder affecting
neuromuscular junction leading to
fatigue, weakening and paralysis of
skeletal muscle is called as myasthenia
gravis
S9. Ans.(c)
11th and 12th pairs of ribs are known as
floating ribs because they are not linked
to the sternum. The acromion is a
flattened projection of the scapula’s
spine. The clavicle’s lateral end
articulates with the acromion process.
Between the second and seventh ribs,
the scapula is a flat triangular bone in
the dorsal region of the thorax.
The shoulder joint is formed by the
glenoid cavity of the scapula articulating
with the head of the humerus.
S10. Ans.(a)
Gout is an inflammation of the joints
caused by the buildup of uric acid
crystals. Osteoporosis is an age-related
condition marked by a loss of bone
mass and an increased risk of fractures.
Estrogen deficiency is one of the most
common causes. Tetany: Muscle
spasms (wild contractions) caused
by a lack of Ca++ in the body fluid.
Muscular dystrophy is a genetic
disorder that causes progressive skeletal
muscle degeneration.
S11. Ans.(b)
Muscular dystrophy is a progressive
degeneration of skeletal muscle caused
 primarily by a hereditary condition
whereas tetany is muscle spasm caused
by a lack of calcium in the bodily fluid.
Myasthenia gravis is an autoimmune
disease that causes skeletal muscle
weakness. The bacteria Clostridium
Botulinum causes botulism, an
uncommon and serious type of food
poisoning.
S12. Ans.(d)
• Vertebrosternal ribs are real ribs that
are joined to the thoracic vertebrae on
the dorsal side and
connected to the sternum on the
ventral side by
hyaline cartilage. True ribs are the
first seven pairs
of ribs that attach to the sternum
ventrally.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
• The eighth, ninth, and tenth pairs of
ribs do not articulate directly with the
sternum but instead use hyaline
cartilage to connect to the seventh
ribs. These are vertebrochondral ribs,
sometimes known as false ribs.
• The last two pairs of ribs (11th and
12th) are called floating ribs because
they are not attached ventrally.
S13. Ans.(a)
Calcium binds to troponin causing
tropomyosin to move away from the face
of the actin filament where myosin
heads must engage in order to cause
contraction.
S14. Ans.(c)
A fluid-filled synovial cavity exists
between the articulating surfaces of two
bones in synovial (movable) joints.
Joints between the atlas and the axis
are examples of pivot joints.
S15. Ans.(a)
True ribs (1st to 7th Pairs) are attached
dorsally to vertebral column and
ventrally to the sternum False ribs (8th ,
9th , and 10th pairs): They do not
520 CHANNEL
JOIN TELEGRAM
articulate directly with the sternum,
instead using hyaline cartilage to link
the 7th rib. Floating Ribs: 11th and
12th pairs of ribs are not linked
ventrally (no connection with sternum
or other ribs).
S16. Ans.(b)
Because the epiphyseal plate is
important for bone growth and closes
after adolescence, hypersecretion
of growth hormone in adults does not
result in further height gain.
S17. Ans.(d)
Fast glycolytic fibres exhaust quickly
but slow oxidative fibres are more
fatigue resistant. Fatigue-
resistant slow oxidative muscle fibres
are found in greater abundance in
muscles that must be active continually
such as weight-supporting postural
muscles.
S18. Ans.(d)
Ciliary movement occurs in most of our
internal tubular organs which are lined
by ciliate epithelium. The coordinated
movements of cilia in the trachea
help us in removing dust particles and
some of the foreign substances inhaled
along with the atmospheric air.
Passage of ova through the female
reproductive tract is also facilitated by
the ciliary movement.
S19. Ans.(c)
In this accident, fibrous and synovial
joints would be severely harmed.
S20. Ans.(a)
Osteoporosis is an age-related condition
marked by a loss of bone mass and an
increased risk of fractures. Estrogen
deficiency is one of the most common
causes.
S21. Ans.(c)
Calcium ions are stored in the
endoplasmic reticulum which is also
known as the sacroplasmic reticulum
of muscle fibres. An increase in Ca2+
levels causes calcium to bind to a
 subunit of troponin on actin filaments,
removing the masking of myosin active
sites.
S22. Ans.(c)
Spasm: A sudden involuntary
contraction of a muscle, a group of
muscles or a hollow organ such
as the bladder. Fatigue: Muscle comes
weaker and tired due to vigorous
exercise. It leads to the formation of
lactic acid in the absence of oxygen.
Tonus: Slight contraction of a muscle in
the resting state to maintain the
posture. Tetanus: Lack of relaxation
between subsequent stimuli in a
persistent muscular contraction.
S23. Ans.(a)
Actin and myosin filament do not
shorten rather slide passes each other.
S24. Ans.(d)
S26. Ans.(d)
Pivot joint connects the atlas and the
axis. It is an example of synovial joints.
They allow considerable movement.
S27. Ans.(c)
A cartilaginous junction connects two
neighbouring vertebrae.
Osteoporosis is caused by a reduction in
estrogen levels in older persons.
There are 12 thoracic vertebrae in the
vertebral column.
Gout is the accumulation of uric acid
crystals in joints causes inflammation
in joints.
S28. Ans.(d)
In the A-band, the centre gap between
actin filaments that extend across
myosin filaments. In H band, Only thick

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
There is no movement in a fibrous joint. band (myosin) is present.
There is very limited movement allowed
in cartilaginous joints. Synovial joints,
on the other hand, allowed for a lot of
movement.
S25. Ans.(b)
The neuromuscular junction or motor-
end plate is the point where a motor
neuron and a muscle fibre’s sarcolemma
meet. A neural signal reaching this
junction releases a neurotransmitter
(Acetyl choline) which generates an action
potential in the sacrolemma.

521 CHANNEL
JOIN TELEGRAM
 Chapter 18
Sankalp Bharat
Neural Control & Coordination

1. Given below are two statements: (2023) (c) Chemical synapse use
Statement I : The nose contains mucus – neurotransmitters
coated receptors which are specialized for (d) Impulse transmission across a chemical
receiving the sense of smell and are called synapse is always faster than that
olfactory receptors. across an electrical synapse
Statement II : Wall of the eye ball has the 4. Match the following columns and select the
layers. The external layer is called choroid correct option (2020)
(dense connective tissue), middle layer is Column - I Column - II
sclera (thin pigmented layer) and internal
1. Organ of corti (i) Connects
layer is retina (ganglion cells, bipolar cells middle ear
and photoreceptor cells). and pharynx
In the light of the above statements, choose
2. Cochlea Coiled part of
the correct answer from the options given (ii) the labyrinth
below:
3. Eustachian (iii) Attached to
(a) Statement I is true but statement II is
the oval
false tube window
(b) Statement I is false but statement II is
Stapes (iv) Located on

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
true 4.
the basilar
(c) Both statement I and statement II are
membrane
true
(d) Both statement I and statement II are 1 2 3 4
false (a) (iii) (i) (iv) (ii)
2. Match List-I with List-II with respect to (b) (iv) (ii) (i) (iii)
human eye. (2022) (c) (i) (ii) (iv) (iii)
List-I List-II (d) (ii) (iii) (i) (iv)
Multipolar (i) Somatic neural 5. Match the following columns and select the
A.
neuron system correct option (2020 Covid Re-NEET)
Column-I Column-II
B. Bipolar (ii) Cerebral cortex
Rods and (i) Absence of
neuron 1.
Cones photoreceptor cells
C. Myelinated (iii) Retina of Eye
Blind Spot (ii) Cones are densely
nerve fibre 2.
packed
D. Unmyelinated (iv) Spinal nerves
nerve fibre 3. Fovea (iii) Photoreceptor cells

Choose the correct answer from the options 4. Iris (iv) Visible coloured
given below: portion of the eye
(a) A-(ii), B-(iii), C-(iv), D-(i)
1 2 3 4
(b) A-(iii), B-(i), C-(iv), D-(ii)
(a) (ii) (iii) (i) (iv)
(c) A-(ii), B-(iv), C-(iii), D-(i)
(b) (iii) (iv) (ii) (i)
(d) A-(ii), B-(iii), C-(i), D-(iv)
(c) (ii) (iv) (iii) (i)
3. Select the incorrect statement regarding
(d) (iii) (i) (ii) (iv)
synapses : (2022)
6. Which part of the brain is responsible for
(a) The membranes of presynaptic and
thermoregulation? (2019)
postsynaptic neutrons are in close
(a) Cerebrum
proximity in an electrical synapse
(b) Hypothalamus
(b) Electrical current can flow directly from
(c) Corpus callosum
one neuron into the other across the
(d) Medulla oblongata
electrical synapse
522 CHANNEL
JOIN TELEGRAM
7. Which one of the following statement is 12. Pacinian corpuscle responds to rapid
correct? (2019) changes in (2017)
(a) Cornea is an external, transparent and (a) Light intensity
protective proteinaceous covering of the (b) Gravity
eye-ball (c) Pressure
(b) Cornea consists of dense connective (d) Temperature
tissue of elastin and can repair itself 13. Which of the following ossicles is adhered to
(c) Cornea is convex, transparent layer tympanic membrane of middle ear? (2017)
which is highly vascularised (a) Malleus
(d) Cornea consists of dense matrix of (b) Incus
collagen and is the most sensitive portion (c) Stapes
the eye (d) Utricle
8. Which of the following structure or region is 14. Choose the correct statement (2016 - II)
incorrectly paired with its function? (2018) (a) Photoreceptors in the human eye are
(a) Medulla oblongata: Controls respiration depolarized during
and cardio-vascular reflexes darkness and become hyperpolarised in
(b) Limbic system : Consists of fibre tracts response to the light stimulus
that interconnect different regions of (b) Receptors do not produce graded
brain; controls movement potentials
(c) Hypothalamus : Production of releasing (c) Nociceptors respond to changes in
hormones and regulation of temperature, pressure
hunger and thirst (d) Meissner’s corpuscles are
(d) Corpus callosum : Band of fibres Thermoreceptors

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
connecting left and right cerebral 15. Photosensitive compound in human eye is
hemispheres made up of (2016 - I)
9. Transparent lens in the human eye is held (a) Guanosine and Retinol
in its place by (2018) (b) Opsin and Retinal
(a) Ligaments attached to the ciliary body (c) Opsin and Retinol
(b) Ligaments attached to the iris (d) Transducin and Retinone
(c) Smooth muscles attached to the iris 16. Destruction of the anterior horn cell of the
(d) Smooth muscles attached to the ciliary spinal cord would result in loss of (2015 Re)
Body (a) Voluntary motor impulses
10. Good vision depends on adequate intake of (b) Commissural impulses
carotene rich food (2017) (c) Integrating impulses
Select the best option from the following (d) Sensory impulses
statements 17. Which of the following region of the brain is
(a) Vitamin A derivatives are formed from incorrectly paired with its function? (2015)
carotene (a) Corpus callosum - Communication
(b) The photopigments are embedded in the between the left and right cerebral
membrane discs of the inner segment cortices
(c) Retinal is a derivative of vitamin A (b) Cerebrum - Calculation and
(d) Retinal is a light absorbing part of all the contemplation
visual photopigments (c) Medulla oblongata - Homeostatic control
(a) A & B (d) Cerebellum - Language comprehension
(b) A, C & D 18. A gymnast is able to balance his body
(c) A & C upside down even in the total darkness
(d) B, C & D because of (2015)
11. Myelin sheath is produced by (2017) (a) Tectorial membrane
(a) Schwann Cells and Oligodendrocytes (b) Organ of Corti
(b) Astrocytes and Schwann Cells (c) Cochlea
(c) Oligodendrocytes and Osteoclasts (d) Vestibular apparatus
(d) Osteoclasts and Astrocytes

523 CHANNEL
JOIN TELEGRAM
19. In mammalian eye, the ‘fovea’ is the centre
of the visual field, where (2015 Re)
(a) Optic nerve leaves the eye
(b) Only rods are present
(c) More rods than cones are found
(d) High density of cones occurs, but has no
Rods
20. Injury localised to the hypothalamus would
most likely disrupt (2014)
(a) Regulation of body temperature
(b) Short term memory
(c) Coordination during locomotion
(d) Executive function, such as decision
Making
21. Parts A, B, C and D of the human eye are
shown in the diagram. Select the option
which gives correct identification along with
its functions/ characteristics (2013)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
524 CHANNEL
JOIN TELEGRAM
(a) D: Choroid – Its anterior part forms
ciliary body
(b) A: Retina – Contains photo receptors –
rods and cones
(c) B: Blind spot – Has only a few rods and
cones
(d) C: Aqueous chamber – Reflects the light
which does not pass through the lens
22. A diagram showing axon terminal and
synapse is given.
Identify correctly at least two of A-D (2013)
(a) C - Neurotransmitter; D - Ca++
(b) A - Receptor; C - Synaptic vesicles
(c) B - Synaptic connection; D - K +
(d) A - Neurotransmitter; B - Synaptic cleft
 Answer Key
S1. Ans. (a) S13. Ans. (a)

S2. Ans. (a) S14. Ans. (a)

S3. Ans. (d) S15. Ans. (b)

S4. Ans. (b) S16. Ans. (a)

S5. Ans. (d) S17. Ans. (d)

S6. Ans. (b) S18. Ans. (d)

S7. Ans. (d) S19. Ans. (d)

S8. Ans. (b) S20. Ans. (a)

S9. Ans. (a) S21. Ans. (b)

S10. Ans. (b) S22. Ans. (b)

S11. Ans. (a)

S12. Ans. (c)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

525 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(a)
Statement I : This is correct. The
olfactory receptors are specialized cells
in the nasal cavity that are responsible
for the sense of smell. They are coated
with mucus which helps to dissolve oror
molecules, making them easier to
detect.
Statement II : This statement is
incorrect due to a mix-up in the
description of the layers. The wall of the
eyeball indeed has three layers but they
are as follows :
1. The external layer is the sclera,
which is a dense, tough white
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
connective tissue that gives the eye
its shape and protects the inner
components.
2. The middle layer is the choroid,
which is a thin pigmented layer that
provides oxygen and nourishment to
the outer layers of the retina.
3. The internal layer is the retina,
which contains photoreceptor cells
(rods and cones), bipolar cells, and
ganglion cells, and is responsible for
detecting light and transmitting
these signals to the brain through
the optic nerve.
S2. Ans.(a)
Option (a) is the correct answer because
multipolar neurons are present in
cerebral cortex.
S3. Ans.(d)
Option (d) is the correct answer as
impulse transmission across an electric
526 CHANNEL
JOIN TELEGRAM
synapse is always faster than that
across a chemical synapse.
S4. Ans.(b)
Basilar membrane contains the Organ
of Corti. Cochlea is the coiled section of
the labyrinth. Eustachian tube connects
the throat to the middle
ear chamber. Stapes ossicle is linked to
the oval window of the cochlea in the
middle ear.
S5. Ans.(d)
• Rods and cones are photoreceptor
cells.
• Blind spot is absence of photoreceptor
cells.
• Fovea where cones are densely packed
• Iris is visible coloured portion of the
eye.
S6. Ans.(b)
Hypothalamus lies at the base of
thalamus, our brain’s thermoregulatory
centre. It has a number of centres that
regulate body temperature, hunger
and thirst. It also contains several
groups of neurosecretory cells which
secrete hormones called hypothalamic
hormone.
S7. Ans.(d)
Cornea is made up of a strong collagen
matrix and corneal epithelium. It is the
most delicate portion of the eye.
S8. Ans.(b)
The limbic system’s primary structures
are the amygdala, hippocampus,
thalamus, hypothalamus, basal ganglia
and cingulate gyrus. Along with the
hypothalamus, it is involved in the
regulation of sexual behaviour,
expression of emotional reactions
and motivation.
S9. Ans.(a)
Suspensory ligaments linked to the
ciliary body that maintain the lens in
place. Suspensory ligaments,
 also known as zonules, connect the lens
capsule to the ciliary processes The
ciliary body and the zonule fibres are
responsible for modifying the shape of
the lens.
S10. Ans.(b)
Carotene is a source of retinal which is
required for rhodopsin production. All
visual photopigments contain retina, a
vitamin A derivative that absorbs
light.
S11. Ans.(a)
In the central nervous system,
oligodendrocytes make myelin sheath
but schwann cells produce myelin
sheath in the peripheral nervous
system.
S12. Ans.(c)
The pacinian mechanoreceptor is one of
the most common types of skin
mechanoreceptors. They are in charge of
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
vibration and pressure sensitivity.
S13. Ans.(a)
Malleus, incus and stapes, (smallest
bones) make up the three primary
elements of the ear ossicles. Malleus is
linked to the tympanic membrane.
Stapes is attached to the cochlea’s oval
window.
S14. Ans.(a)
Rod and cone cells depolarise and
release a neurotransmitter when
exposed to darkness. This
neurotransmitter causes others to
hyperpolarize, allowing photoreceptors
to engage antagonistically.
S15. Ans.(b)
The photopigments (photosensitive
chemicals) in the human eyes is
composed of opsin (a protein)
and retinal (a pigment) make up the
human eye (an aldehyde of vitamin A).
Light induces dissociation of the retinal
from opsin resulting in changes in the
structure of the opsin.
527 CHANNEL
JOIN TELEGRAM
S16. Ans.(a)
The anterior horn cells of the spinal
cord are found in the grey matter. It is
made up of motor neurons that control
the axial muscles. It contains cell bodies
of alpha motor neurons which
innervate skeletal muscle to induce
movement.
S17. Ans.(d)
Language comprehension is a function
of the cerebrum’s forebrain, namely
Wernicke’s region which is located in
the temporal lobe.
S18. Ans.(d)
A protruding ridge termed the macula
can be found in the saccule and utricle.
The vestibular apparatus’s
specialised receptors, the crista and
macula, are important for maintaining
body balance and posture.
S19. Ans.(d)
A yellowish pigmented area called the
macula lutea with a central pit called
the fovea centralis is located on the
posterior pole of the eye, lateral to the
blind spot. The fovea is a thinned-out
section of the retina with tightly packed
cones. It is where you will have the best
optical acuity.
S20. Ans.(a)
Hypothalamus lies at the base of
thalamus, our brain’s thermoregulatory
centre. It has a number
of centres that regulate body
temperature, hunger and thirst. It also
contains several groups of
neurosecretory cells which secrete
hormones called hypothalamic
hormone.
S21. Ans.(b)
Diagrammatic factual question
S22. Ans.(b)
A - Receptor, B - Synaptic cleft, C –
Synaptic vesicles, D- Neurotransmitters
 Chapter 19
Sankalp Bharat
Chemical Coordination & Integration

1. Which of the following are NOT under the Choose the most appropriate answer
control of thyroid hormone? (2023) from the options given below:
A. Maintenance of water and (a) A and C only
electrolyte balance (b) B, D and E only
B. Regulation of basal metabolic rate (c) A and E only
C. Normal rhythm of sleep-wake (d) B and C only
cycle 4. Erythropoietin hormone which stimulates
D. Development of immune system RBC formation is produced by (2021)
E. Support the process of RBCs (a) Cells of rostral adenohypophysis
formation (b) Cells of bone marrow
Choose the correct answer from the (c) Juxtaglomerular cells of the kidney
options given below: (d) Alpha cells of pancreas
(a) B and C only 5. Presence of which of the following
(b) C and D only conditions in urine are indicative of
(c) D and E only diabetes mellitus? (2020)
(d) A and D only (a) Uremia and Renal Calculi
(b) Ketonuria and glycosuria

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
2. Given below are two statements : one is (c) Renal calculi and hyperglycemia
labelled as Assertion (A) and the other is (d) Uremia and ketonuria
labelled as Reason (R). (2022) 6. Match the following columns and select the
Assertion (A) : FSH which interacts with correct option (2020)
membrane bound receptors does not Column - I Column - II
enter the target cell.
Reason (R) : Binding of FSH to its 1. Pituitary (i) Grave’s
receptors generates second messenger gland disease
(cyclic AMP) for its biochemical and 2. Thyroid gland (ii) Diabetes
physiological responses. mellitus
In the light of the above statements, Adrenal gland (iii) Diabetes
choose the most appropriate answer from 3.
insipidus
the options given below:
(a) (A) is not correct but (R) is correct 4. Pancreas (iv) Addison’s
(b) Both (A) and (R) are correct and (R) is disease
the correct explanation of (A) 1 2 3 4
(c) Both (A) and (R) are correct but (R) is (a) (iii) (ii) (i) (iv)
not the correct explanation of (A) (b) (iii) (i) (iv) (ii)
(d) (A) is correct but (R) is not correct (c) (ii) (i) (iv) (iii)
3. Which of the following are not the effects (d) (iv) (iii) (i) (ii)
of Parathyroid hormone? (2022) 7. Which of the following would help in
A. Stimulates the process of bone prevention of diuresis? (2020)
resorption (a) Reabsorption of Na+ and water from
B. Decreases Ca2+ level in blood renal tubules due to aldosterone
C. Reabsorption of Ca2+ by renal (b) Atrial natriuretic factor causes
tubules vasoconstriction
D. Decreases the absorption of Ca2+ (c) Decrease in secretion of renin by JG cells
from digested food (d) More water reabsorption due to
E. Increases metabolism of undersecrtion of ADH
carbohydrates

528 CHANNEL
JOIN TELEGRAM
8. Which one of the following is correct (d) Parathyroid hormone and prolactin
statement? (2020) 14. GnRH, a hypothalamic hormone, needed in
(a) Glucagon is associated with reproduction acts on (2017)
hypoglycemia (a) Anterior pituitary gland and stimulates
(b) Insulin acts on pancreatic cells and secretion of LH and oxytocin
adipocytes (b) Anterior pituitary gland and stimulates
(c) Insulin is associated with hypoglycemia secretion of LH and FSH
(d) Glucocorticoids do not stimulate (c) Posterior pituitary gland and stimulates
Gluconeogenesis secretion of oxytocin and FSH
9. Hormones stored and released from (d) Posterior pituitary gland and stimulates
neurohypophysis are secretion of LH and relaxin
(2020 Covid Re-NEET) 15. Cholecystokinin acts on (2017)
(a) Oxytocin and vasopressin (a) Pancreas and gall bladder
(b) Follicle stimulating hormone and (b) Gastric glands and liver
luteinizing hormone (c) Pancreas and duodenum
(c) Prolactin and vasopressin (d) Pancreas and intestine
(d) Thyroid stimulating hormone and 16. The posterior pituitary gland is not a true
Oxytocin endocrine gland because (2016 - II)
10. Match the following hormones with the (a) It is under the regulation of
respective disease (2019) hypothalamus
A. Insulin (i) Addison’s disease (b) It secretes enzymes
Thyroxine (ii) Diabetes insipidus (c) It is provided with a duct
B. (d) It only stores and releases hormones

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
C. Corticoids (iii) Acromegaly 17. Name a peptide hormone which acts mainly
D. Growth (iv) Goitre on hepatocytes, adipocytes and enhances
Hormone cellular glucose uptake and utilisation
(v) Diabetes mellitus (2016 - II)
(a) Secretin
A B C D (b) Gastrin
(a) (v) (i) (ii) (iii) (c) Insulin
(b) (ii) (iv) (iii) (i) (d) Glucagon
(c) (v) (iv) (i) (iii) 18. Grave’s disease is caused due to (2016 - II)
(d) (ii) (iv) (i) (iii) (a) Hyposecretion of adrenal gland
11. How does steroid hormone influence the (b) Hypersecretion of adrenal gland
cellular activities? (2019) (c) Hyposecretion of thyroid gland
(a) Changing the permeability of the cell (d) Hypersecretion of thyroid gland
membrane 19. Tryptophan is the precursor for the
(b) Binding to DNA and forming a gene- synthesis of (2016 - I)
hormone complex (a) Melatonin and serotonin
(c) Activating cyclic AMP located on the cell (b) Thyroxine and triodothyronine
membrane (c) Estrogen and progesterone
(d) Using aquaporin channels as second (d) Cortisol and cortisone
Messenger 20. Which of the following pairs of hormones
12. Which of the following is an amino acid are not antagonistic (having opposite
derived hormone? (2018) effects) to each other? (2016 - I)
(a) Epinephrine (a) Parathormone - Calcitonin
(b) Ecdysone
(c) Estradiol (b) Insulin - Glucagon
(d) Estriol (c) Aldosterone - Atrial
13. Which of the following hormones can play a Natriuretic
significant role in osteoporesis? (2018) Factor
(a) Aldosterone and prolactin Relaxin - Inhibin
(b) Progesterone and aldosterone (d)
(c) Estrogen and parathyroid hormone
529 CHANNEL
JOIN TELEGRAM
21. Which hormones do stimulate the
production of pancreatic juice and
bicarbonate? (2016 - II)
(a) Cholecystokinin and secretin
(b) Insulin and glucagon
(c) Angiotensin and epinephrine
(d) Gastrin and insulin
22. A chemical signal that has both endocrine
and neural roles is (2015)
(a) Epinephrine
(b) Cortisol
(c) Melatonin
(d) Calcitonin
23. Which one of the following hormones
though synthesised elsewhere is stored and
released by the master gland? (2015 Re)
(a) Luteinising hormone
(b) Prolactin
(c) Melanocyte stimulating hormone
(d) Antidiuretic hormone
24. Which one of the following hormone is not
involved in sugar metabolism? (2015 Re)
(a) Aldosterone
26. Identify the hormone with its correct
matching of source and function (2014)
(a) Atrial natriuretic factor: Ventricular wall,
increases the blood pressure
(b) Oxytocin: Posterior pituitary, growth and
maintenance of mammary glands
(c) Melatonin: Pineal gland, regulates the
normal rhythms of sleep wake cycle
(d) Progesterone: Corpus luteum,
stimulation of growth and activities of
female secondary sex organs
27. A pregnant female delivers a baby who
suffers from stunted growth, mental
retardation, low intelligence quotient and
abnormal skin. This is the result of (2013)
(a) Over-secretion of pars distalis
(b) Deficiency of iodine in diet
(c) Low secretion of growth hormone
(d) Cancer of the thyroid gland
28. Which one of the following is not the
function of placenta? (2013)
(a) Secretes oxytocin during parturition
(b) Facilitates supply of oxygen and

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Insulin nutrients to embryo
(c) Glucagon (c) Secretes estrogen
(d) Cortisone (d) Facilitates removal of carbon dioxide and
25. Fight or flight reactions cause activation of Waste material from embryo
(2014)
(a) Pancreas leading to a reduction in the
blood sugar levels
(b) Parathyroid glands leading to increased
metabolic rate
(c) Kidney leading to suppression of renin
angiotensin- aldosterone pathway
(d) Adrenal medulla leading to increased
secretion of epinephrine and
norepinephrine

530 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (b) S16. Ans. (d)

S2. Ans. (c) S17. Ans. (c)

S3. Ans. (b) S18. Ans. (d)

S4. Ans. (c) S19. Ans. (a)

S5. Ans. (b) S20. Ans. (d)

S6. Ans. (b) S21. Ans. (a)

S7. Ans. (a) S22. Ans. (a)

S8. Ans. (c) S23. Ans. (d)

S9. Ans. (a) S24. Ans. (a)

S10. Ans. (c) S25. Ans. (d)

S11. Ans. (b) S26. Ans. (c)

S12. Ans. (a) S27. Ans. (b)

S13. Ans. (c) S28. Ans. (a)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (b)

S15. Ans. (a)

531 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(b)
Option (b) is the correct answer because
thyroid hormones play an important role
in the regulation of basal metabolic rte,
maintenance of water and electrolyte
balance and support the process of
RBCs formation, whereas this hormone
is not involved in regulating normal
rhythm of sleep-wake cycle and
development of immune system.
S2. Ans.(c)
Assertion (A) is correct because FSH, or
follicle-stimulating hormone, is a
peptide hormone hormone that does not
enter the target cell. Instead, it interacts
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
with membrane-bound receptors on the
surface of the target cell. This is a
common feature of peptide hormones,
as they are too large and hydrophilic to
pass through the cell membrane.
Reason (R) is also correct. When FSH
binds to its receptor, it triggers a
cascade of intracellular events,
including the production of second
messengers like cyclic AMP (cAMP). The
second messengers then go on to
activate various biochemical and
physiological responses within the target
cell, such as cell growth and hormone
production. This is a typical process for
signal transduction initiated by the
binding of a hormone to its cell surface
receptor.
However, (R) is not the correct
explanation of (A) because it doesn’t
directly address why FSH doesn’t enter
the target cell. The reason FSH does not
532 CHANNEL
JOIN TELEGRAM
enter the target cell is that it is a peptide
hormone, which cannot cross the cell
membrane. Instead, it interacts with cell
surface receptors to initiate a signaling
cascade. The generation of second
messengers, like cAMP, is a part of the
signaling process that takes place after
FSH binds to its receptor, but it is not
the reason why FSH doesn’t enter the
cell.
S3. Ans.(b)
Option (b) is the correct answer because
parathyroid hormone is a hypercalcemic
hormone i.e., it increases the blood
calcium levels. It also increases the
absorption of calcium from digested
food. Glucocorticoids regulate the
carbohydrate metabolis.
S4. Ans.(c)
JG cells of kidney secrete erythropoietin
hormone which stimulates RBC
formation (erythropoiesis).
S5. Ans.(b)
Glycosuria (the loss of glucose through
the urine) and the development of toxic
chemicals known as ketone bodies in
urine are two symptoms of diabetes
mellitus, a complex illness.
S6. Ans.(b)
Grave’s disease is caused by excessive
thyroid hormone secretion (T3 & T4 ).
Diabetes mellitus is caused by a lack of
insulin release from the pancreas beta
cells. Hyposecretion of ADH from the
posterior pituitary causes diabetes
insipidus. Hyposecretion of hormone
from the adrenal cortex causes
addison’s disease.
S7. Ans.(a)
Mineralocorticoids like aldosterone are
secreted by the zona glomerulosa of
 adrenal cortex which enhance the
reabsorption of Na+ and water from the
renal tubule, preventing diuresis.
It also causes water and sodium to be
reabsorbed, increasing blood volume
and thus blood pressure.
S8. Ans.(c)
Hyperglycemia is linked to glucagon.
Glucagon acts mainly on the liver cells
(hepatocytes) and stimulates
glycogenolysis resulting in an increased
blood sugar (hyperglycemia).
Hepatocytes and adipocytes are both
affected by insulin. It has a link to
hypoglycemia.
S9. Ans.(a)
The posterior pituitary, also known as
the neurohypophysis (pars nervosa),
stores and releases two hormones
named oxytocin and vasopressin
synthesised by the hypothalamus and
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
delivered axonally to neurohypophysis.
S10. Ans.(c)
• Diabetes mellitus is a condition
caused by a lack of insulin.
• Hypersecretion or hyposecretion of
thyroxine can lead to goitre which is
an enlargement of the thyroid
gland.
• Addison’s disease is caused by a
corticoid deficiency (glucocorticoid +
mineralocorticoid).
• Acromegaly is caused by excessive
growth hormone release in adults.
S11. Ans.(b)
Steroid hormones enter the cell directly
and create a hormone receptor complex
by binding to intracellular receptors in
the nucleus. The hormone receptor
complex interacts with the genome to
control gene expression and
chromosomal function.
S12. Ans.(a)
Epinephrine, often known as
adrenaline, is a hormone generated from
533 CHANNEL
JOIN TELEGRAM
tryptophan (an aromatic amino acid)
plays a crucial part in the fight or flight
response.
S13. Ans.(c)
PTH (parathyroid hormone) has higher
favourable effects on osteoporosis
sufferers when combined
with estrogen hormones. Estrogen
stimulates the activity of osteoblasts
that produce bone. PTH regulates
calcium-phosphate metabolism.
S14. Ans.(b)
Hypothalamus produces GnRH which
stimulates the anterior pituitary gland
to produce gonadotropins (FSH and LH).
S15. Ans.(a)
Cholecystokinin (CCK) is a significant
gastrointes- tinal hormone that aids in
pancreatic secretion and
gallbladder contraction, as well as
regulating gas- trointestinal motility and
inducing satiety. Plasma
CCK levels rise significantly when fat
and protein are consumed.
S16. Ans.(d)
The pituitary gland is housed in the
sella tursica, a bony cavity that is
connected to the hypothalamus
by a stalk. It is also known as the
master gland. Because it simply stores
and releases hormones, the posterior
pituitary gland is not a real endocrine
gland.
S17. Ans.(c)
Insulin promotes cellular glucose
absorption and utilisation by acting
primarily on hepatocytes
and adipocytes (adipose tissue cells). As
a result, glucose moves quickly from the
bloodstream to hepatocytes and
adipocytes lowering blood glucose
levels (hypoglycemia).
S18. Ans.(d)
Grave’s disease is caused by
hypersecretion of thyroid gland.
Thyroid-stimulating immunoglobulins
(TSI) are antibodies that stimulate
 thyroid to produce too much of two
thyroid hormones: triiodothyronine
(T3 ) and thyroxine (T4 ).
S19. Ans.(a)
Tryptophan is an aromatic amino acid
that serves as a precursor for the
production of melatonin and serotonin
Both are hormones of pineal gland.
S20. Ans.(d)
Sertoli cells secrete a protein called
inhibin which inhibits the production of
FSH. Relaxin softens the connective
tissue making parturition easier.
S21. Ans.(a)
In the duodenum, secretin and
cholecystokinin(CKK) aid in the
synthesis of alkaline bicarbonate in
pancreatic juice, which neutralises the
acidic substances that enter the
duodenum from the stomach.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S22. Ans.(a)
Epinephrine secreted from the medulla
of adrenal gland acts as both, an
endocrine hormone and as a
neurotransmitter (produced at the ends
of sympathetic never fibres).
S23. Ans.(d)
The posterior lobe, also known as the
pars nervosa, does not synthesise
hormones; instead, it stores and
secretes hormones produced by the
hypothalamus. As a result, the posterior
lobe is sometimes known as the storing
organ. The hormones oxytocin and
vasopressin are secreted by the
posterior lobe.
534 CHANNEL
JOIN TELEGRAM
S24. Ans.(a)
Corticoids which regulates the balance
of water and electrolytes in our body are
called mineralocorticoids. Aldosterone is
the main mineralocorticoid in our body.
S25. Ans.(d)
In response to stress of any kind, as
well as during an emergency, the
adrenal medulla releases epinephrine
and norepinephrine. That’s why they are
known as “emergency hormones.”
S26. Ans.(c)
ANF - Atrial walls which helps to lower
blood pressure.
Oxytocin: Posterior pituitary, Smooth
muscle contraction Melatonin. Hormone
produced by the pineal gland that
regulates the sleep-wake cycle.
Progesterone - Promotes pregnancy and
alveoli formation in the mammary
gland.
S27. Ans.(b)
Hypothyroidism during pregnancy
causes defective development and
maturation of the growing baby
leading to stunted growth, mental
retardation, low intelligence quotient,
abnormal skin, deaf-mutism etc.
S28. Ans.(a)
The Posterior pituitary secretes
oxytocin. It works by stimulating the
vigorous contraction of smooth
muscles of uterus at the time of child
birth (foetal explusion hormone) and
milk ejection from the mammary gland
(milk ejection hormone).
 Chapter 20
Sankalp Bharat
Sexual Reproduction in Flowering Plants

1. Large, colourful, fragrant flowers with 6. In angiosperms the correct sequence of

nectar are seen in (2023) events in formation of female gametophyte
(a) Wind pollinated plants in the ovule is:
(b) Insect pollinated plants (A) 3 successive free nuclear divisions
(c) Bird pollinated plants functional megaspore.
(d) Bat pollinated plants (B) Degeneration of 3 megaspores.
2. What is the function of tassels in the corn (C) Meiotic division in megaspore mother
cob? (2023) cell.
(a) To protect seeds (D) Migration of 3 nuclei towards each pole.
(b) To attract insects (E) Formation of wall resulting in seven
(c) To trap pollen grains celled embryosac.
(d) To disperse pollen grains
Choose the correct answer from the options
3. In angiosperm, the haploid, diploid and
given below: (2023)
triploid structures of a fertilized embryo sac
(a) (A), (B), (C), (D), (E)
sequentially are: (2023)
(b) (C), (E), (A), (D), (B)
(a) Synergids, antipodals and Polar nuclei
(c) (B), (C), (A), (D), (E)
(b) Synergids, Primary endosperm nucleus
(d) (C), (B), (A), (D), (Ε)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
and zygote
7. The residual persistent part which forms
(c) Antipodals, synergids, and primary
the perisperm in the seeds of beet is (2022)
endosperm nucleus
(a) Integument
(d) Synergids, Zygote and Primary
(b) Calyx
endosperm nucleus
(c) Endosperm
4. Assertion A: In gymnosperms the pollen
(d) Nucellus
grains are released from the
8. In general the egg apparatus of embryo sac
microsporangium and carried by air
in angiosperm consists of (2022)
currents.
(a) One egg cell, two synergids, two
Reason R: Air currents carry the pollen
antipodal cells, two Polar nuclei
grains to the mouth of the archegonia where
(b) One egg cell, two synergids, three
the male gametes are discharged and pollen
antipodal cells, two Polar nuclei
tube is not formed.
(c) One egg cell, two synergids, two
In the light of the above statements, choose
antipodal cells, three Polar nuclei
the correct answer from the options given
(d) One egg cell, three synergids, two
below: (2023)
antipodal cells, two Polar nuclei
(a) Both A and Rare true but R is NOT the
9. Statement I: Cleistogamous flowers are
current explanation of A
invariably autogamous
(b) A is true but R is false
Statement II: Cleistogamy is
(c) A is false but R is true
disadvantageous as there is no chance for
(d) Both A and R are true and R is the correct
cross pollination
explanation of A
In the light of the above statements, choose
5. Transfer of pollen grains from another to
the correct answer from the options given
stigma of another flower of same plant is
below : (2022)
known as: (2023)
(a) Both Statement I and Statement II are
(a) Geitonogamy
correct
(b) Xenogamy
(b) Both Statement I and Statement II are
(c) Autogamy
incorrect
(d) Cleistogamy
(c) Statement I is correct but Statement II
is incorrect

535 CHANNEL
JOIN TELEGRAM
 (d) Statement I is incorrect but Statement Il 16. The body of the ovule is fused within the
is correct funicle at: (2020)
10. Identify the incorrect statement related to (a) Micropyle
Pollination: (2022) (b) Nucellus
(a) Pollination by water is quite rare in (c) Chalaza
flowering plants (d) Hilum
(b) Pollination by wind is more common 17. Which of the following is incorrect for wind-
amongst abiotic pollination pollinated plants? (2020 Covid Re-NEET)
(c) Flowers produce foul odours to attract (a) Many ovules in each ovary
flies and beetles to get pollinated (b) Flowers are small and not brightly
(d) Moths and butterflies are the most coloured
dominant pollinating agents among (c) Pollen grains are light and non-sticky
insects (d) Well exposed stamens and stigma
11. A typical angiosperm embryo sac at 18. In some plants thalamus contributes to
maturity is: (2021) fruit formation. Such fruits are termed as
(a) 7- nucleate and 8-celled (2020 Covid Re-NEET)
(b) 7- nucleate and 7-celled (a) Aggregate fruits
(c) 8- nucleate and 8-celled (b) True fruits
(d) 8-nucleate and 7-celled (c) Parthenocarpic fruit
12. The term used for transfer of pollen grains (d) False fruits
from anthers of one plant to stigma of 19. Which one of the following statements
different plant which, during pollination, regarding post-fertilization development in
brings genetically different types of pollen flowering plants is incorrect? (2019)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
grains to stigma, is: (2021) (a) Ovary develops into fruit
(a) Geitonogamy (b) Zygote develops into embryo
(b) Chasmogamy (c) Central cell develops into endosperm
(c) Cleistogamy (d) Ovules develop into embryo sac
(d) Xenogamy 20. Persistent nucellus in the seed is known as
13. In some members of which of the following (2019)
pairs of families, pollen grains retain their (a) Chalaza
viability for months after release? (2021) (b) Perisperm
(a) Poaceae ; Leguminosae (c) Hilum
(b) Poaceae ; Solanaceae (d) Tegmen
(c) Rosaceae ; Leguminosae 21. What is the fate of the male gametes
d) Poaceae ; Rosaceae discharged in the synergid? (2019)
14. The plant parts which consist of two (a) One fuses with egg other(s) degenerate(s)
generations one within the other: (2020) in the synergid.
1. Pollen grains inside the anther (b) All fuse with the egg.
2. Germinated pollen grain with two male (c) One fuses with the egg, other(s) fuse(s)
gametes with synergid nucleus.
3. Seed inside the fruit (d) One fuses with the egg and other fuses
4. Embryo sac inside the ovule with central cell nuclei.
(a) (1), (2) and (3) 22. Which of the following has proved helpful in
(b) (3) and (4) preserving pollen as fossils? (2018)
(c) (1) and (a) Pollenkitt
(d) (d) (1) only (b) Cellulosic intine
15. In water hyacinth and water lily, (c) Oil content
pollination takes place by: (2020) (d) Sporopollenin
(a) Water currents only 23. Pollen grains can be stored for several years
(b) Wind and water in liquid nitrogen having a temperature of:
(c) Insects and water (2018)
(d) Insects or wind (a) –120°C
(b) –80°C

536 CHANNEL
JOIN TELEGRAM
 (c) –196°C (a) Genetic drift
(d) –160°C (b) Heterosis
24. Double fertilisation is: (2018) (c) Inbreeding depression
(a) Fusion of two male gametes of a pollen (d) Polyembryony
tube with two different eggs 32. Pollen grains can be stored for years in
(b) Fusion of one male gamete with two liquid nitrogen, maintained at temperature:
polar nuclei (2017)
(c) Fusion of two male gametes with one egg (a) –120°C
(d) Syngamy and triple fusion (b) –20°C
25. Functional megaspore in an angiosperm (c) –70°C
develops into: (2017) (d) –196°C
(a) Ovule 33. The ovule of an angiosperm is technically
(b) Endosperm equivalent to: (2016 - II)
(c) Embryo sac (a) Megaspore mother cell
(d) Embryo (b) Megaspore
26. A dioecious flowering plant prevents both: (c) Megasporangium
(2017) (d) Megasporophyll
(a) Autogamy and xenogamy 34. Pollination in water hyacinth and water lily
(b) Autogamy and geitonogamy is brought about by the agency of:
(c) Geitonogamy and xenogamy (2016 - II)
(d) Cleistogamy and xenogamy (a) Birds
27. Flowers which have single ovule in the ovary (b) Bats
and are packed into inflorescence are (c) Water

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
usually pollinated by: (2017) (d) Insects or wind
(a) Water 35. In majority of angiosperms: (2016 - II)
(b) Bee (a) Reduction division occurs in the
(c) Wind megaspore mother cell
(d) Bat (b) A small central cell is present in the
28. Attractants and rewards are required for: embryo sac
(2017) (c) Egg has a filiform apparatus
(a) Anemophily (d) There are numerous antipodal cells
(b) Entomophily 36. Which of the following statements is not
(c) Hydrophily correct? (2016 - I)
(d) Cleistogamy (a) Pollen grains of many species can
29. The hollow foliar structure in a wheat germinate on the stigma of a flower, but
embryo that encloses the shoot apex and a only one pollen tube of the same species
few leaf primordia is called: (2017) grows into the style.
(a) Coleoptile (b) Insects that consume pollen or nectar
(b) Coleorhiza without bringing about pollination are
(c) Epicotyl called pollen/nectar robbers.
(d) Hypocotyl (c) Pollen germination and pollen tube
30. Choose the correct sequence representing growth are regulated by chemical
the ploidy of Nucellus; Megaspore mother components of pollen interacting with
cell; Megaspore; Egg cell; Zygote; A polar those of the pistil.
nucleus of embryo sac; Secondary (d) Some reptiles have also been reported as
nucleus and Primary endosperm nucleus. pollinators in some plant species.
(2017) 37. Seed formation without fertilisation in
(a) n; 2n; 2n; n; 2n; n; 2n; and 2n flowering plants involves the process of:
(b) 2n; 2n; n; 2n; n; 2n; 3n; and 2n (2016 - I)
(c) 2n; 2n; n; n; 2n; n; 2n; and 3n (a) Sporulation
(d) 2n; n; n; 2n; 3n; n; and 3n (b) Budding
31. Continued self-pollination results in: (c) Somatic hybridisation
(2017) (d) Apomixis

537 CHANNEL
JOIN TELEGRAM
38. Cotyledon of maize grain is called: 46. In angiosperms, microsporogenesis and
(2016 - I) megasporogen-esis: (2015 Re)
(a) Plumule (a) Form gametes without further divisions
(b) Coleorhiza (b) Involve meiosis
(c) Coleoptile (c) Occur in ovule
(d) Scutellum (d) Occur in anther
39. Which one of the following statements is not 47. The wheat grain has an embryo with one,
true? (2016 - I) large, shield- shaped cotyledon known as:
(a) Tapetum helps in the dehiscence of (2015 Re)
anther (a) Coleorhiza
(b) Exine of pollen grains is made up of (b) Scutellum
sporopollenin (c) Coleoptile
(c) Pollen grains of many species cause (d) Epiblast
severe allergies 48. Filiform apparatus is characteristic feature
(d) Stored pollen in liquid nitrogen can be of: (2015 Re)
used in the crop breeding programmes (a) Nucellar embryo
40. Proximal end of the filament of stamen is (b) Aleurone cell
attached to the: (2016 - I) (c) Synergids
(a) Anther (d) Generative cell
(b) Connective 49. Which one of the following fruits is
(c) Placenta parthenocarpic? (2015 Re)
(d) Thalamus or petal (a) Apple
41. The coconut water from tender coconut (b) Jackfruit

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
represents: (2016 - I) (c) Banana
(a) Endocarp (d) Brinjal
(b) Fleshy mesocarp 50. Coconut water from a tender coconut is:
(c) Free nuclear proembryo (2015 Re)
(d) Free nuclear endosperm (a) Free nuclear endosperm
42. In bryophytes and pteridophytes, transport (b) Innermost layers of the seed coat
of male gametes requires: (2016 - I) (c) Degenerated nucellus
(a) Wind (d) Immature embryo
(b) Insects 51. Male gametophyte in angiosperms
(c) Birds produces: (2015 Re)
(d) Water (a) Single sperm and a vegetative cell
43. The hilum is a scar on the: (2015) (b) Single sperm and two vegetative cells
(a) Fruit, where style was present (c) Three sperms
(b) Seed, where micropyle was present (d) Two sperms and a vegetative cell
(c) Seed, where funicle was attached 52. Non-Albuminous seed is produced in:
(d) Fruit, where it was attached to pedicel (2014)
44. Which one of the following may require (a) Pea
pollinators but is genetically similar to (b) Maize
autogamy? (2015) (c) Castor
(a) Apogamy (d) Wheat
(b) Cleistogamy 53. Pollen tablets are available in the market
(c) Geitonogamy for: (2014)
(d) Xenogamy (a) Ex situ conservation
45. Which of the following are important floral (b) In vitro fertilisation
rewards to the animal pollinators? (2015) (c) Breeding programmes
(a) Floral fragrance and calcium crystal (d) Supplementing food
(b) Protein pellicle and stigmatic exudates 54. Male gametophyte with least number of
(c) Colour and large size of flower cells is present in: (2014)
(d) Nectar and pollen grains (a) Pinus
(b) Pteris

538 CHANNEL
JOIN TELEGRAM
 (c) Funaria
(d) Lilium
55. Function of filiform apparatus is to: (2014)
(a) Guide the entry of pollen tube
(b) Recognise the suitable pollen at stigma
(c) Stimulate division of generative cell
(d) Produce nectar
56. Geitonogamy involves: (2014)
(a) Fertilisation of a flower by the pollen
from a flower of another plant belonging
to a distant population
(b) Fertilisation of a flower by the pollen
from another flower of the same plant
(c) Fertilisation of a flower by the pollen
from the same flower
(d) Fertilisation of a flower by the pollen
from a flower of another plant in the
same population
57. Which one of the following statements is
correct? (2013)
(a) Tapetum nourishes the developing
pollen
(b) Hard outer layer of pollen is called intine
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) Sporogenous tissue is haploid
(d) Endothecium produces the microspores
539 CHANNEL
JOIN TELEGRAM
58. Advantage of cleistogamy is: (2013)
(a) Vivipary
(b) Higher genetic variability
(c) More vigorous offspring
(d) No dependence on pollinators
59. Megasporangium is equivalent to: (2013)
(a) Ovule
(b) Embryo sac
(c) Fruit
(d) Nucellus
60. Perisperm differs from endosperm in:
(2013)
(a) Its formation by fusion of secondary
nucleus with several sperms
(b) Being a haploid tissue
(c) Having no reserve food
(d) Being a diploid tissue
61. Product of sexual reproduction generally
generates: (2013)
(a) Large biomass
(b) Longer viability of seeds
(c) Prolonged dormancy
(d) New genetic combination leading to
Variation
 Answer Key
S1. Ans. (b) S32. Ans. (d)

S2. Ans. (c) S33. Ans. (c)

S3. Ans. (d) S34. Ans. (d)

S4. Ans. (b) S35. Ans. (a)

S5. Ans. (a) S36. Ans. (a)

S6. Ans. (d) S37. Ans. (d)

S7. Ans. (d) S38. Ans. (d)

S8. Ans. (b) S39. Ans. (a)

S9. Ans. (a) S40. Ans. (d)

S10. Ans. (d) S41. Ans. (d)

S11. Ans. (d) S42. Ans. (d)

S12. Ans. (d) S43. Ans. (c)

S13. Ans. (c) S44. Ans. (c)

S14. Ans. (c)

S15. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ S45. Ans. (d)
S46. Ans. (b)

S16. Ans. (d) S47. Ans. (b)

S17. Ans. (a) S48. Ans. (c)

S18. Ans. (d) S49. Ans. (c)

S19. Ans. (d) S50. Ans. (a)

S20. Ans. (b) S51. Ans. (d)

S21. Ans. (d) S52. Ans. (a)

S22. Ans. (d) S53. Ans. (d)

S23. Ans. (c) S54. Ans. (d)

S24. Ans. (d) S55. Ans. (a)

S25. Ans. (c) S56. Ans. (b)

S26. Ans. (b) S57. Ans. (a)

S27. Ans. (c) S58. Ans. (d)

S28. Ans. (b) S59. Ans. (a)

S29. Ans. (a) S60. Ans. (d)

S30. Ans. (c) S61. Ans. (d)

S31. Ans. (c)

540 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(b)
Large, colourful, fragrant flowers with
nectar attract biotic pollinators (insects),
thus, they are seen in insect pollinated
plants.
S2. Ans.(c)
Tassels in the com cob represents
stigma and style which wave in the wind
to trap pollen grains.
S3. Ans.(d)
Synergids are the cells of gametophyte
and hence these are haploid Zygote is
formed by fusion of two gametes and
thus it is diploid.
Primary endosperm nucleus is formed
by the fusion of diploid secondary
nucleus with a male gamete. Therefore,
it is triploid.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S4. Ans.(b)
A is true but R is false.
S5. Ans.(a)
Geitonogamy refers to the transfer of
pollen from the anther of one flower to
the stigma of another flower on the
same plant. While this process involves
pollination between different flowers,
because it occurs on the same plant, it
does not increase genetic diversity.
S6. Ans.(d)
The process of female gametophyte
formation in angiosperms, also known
as mega-gametogenesis.
S7. Ans.(d)
Mostly nucellus is consumed after
fertilisation due to absorption of food by
developing embryo in a seed.
Sometimes, the nucellus remains
persistent in the seed and is called
perisperm.
S8. Ans.(b)
The egg apparatus of an embryo sac
consists of one egg cell and two
synergids.
541 CHANNEL
JOIN TELEGRAM
Whereas the embryo sac consists of one
egg cell, two synergies, three antipodals
and two polar nuclei.
As per the question none of the option is
correct however considering the
composition of embryo sac the correct
option should be 2.
S9. Ans.(a)
Cleistogamous flowers does not open at
all. In such flowers autogamy occurs.
Lack of cross pollination is a
disadvantage of cleistogamy.
S10. Ans.(d)
Explanation Among the animals,
insects, particularly bees are the
dominant biotic pollinating agents.
S11. Ans.(d)
Flowers are miracles of embryology and
morphology. Flowers are the site of
sexual reproduction in a flowering plant.
They are a morphological and
embryological marvel. The proximal end
of the filament of the stamen is attached
to the thalamus or the petal of the
flower. The number and length of
stamens are variable in flowers of
different species. The number varies
from 3 to 10 in different species.
Also, the size of stamens varies largely
in different species. Stamen attached to
the petal is called as epipetalous. For
example, Brinjal.
S12. Ans.(d)
Xenogamy is the transfer of pollen
grains from one plant’s anther to
another’s stigma. It is the only kind
of pollination that results in the stigma
containing genetically diverse pollen
grains. Cross pollination between the
flowers of various plants is known as
xenogamy. Because two genetically
distinct parents are involved, it causes
heterozygosity.
• Geitonogamy is a sort of self-
pollination in which pollen from one
flower’s anther is transported to
 the stigma of another flower from the S18.
same plant.
• Chasmogamy is a condition in which
the anthers and stigma of bisexual
flowers are visible.
These blooms are capable of both self S19.
and cross pollination.
• Pollen is transmitted from the anther
to the stigma of the same flower in
autogamy, a sort of self- pollination.
• Cleistogamous flower blooms do not
open at all, and so seed set is not
reliant on pollinators.
S20.
S13. Ans.(c)
In some cereals such as rice and wheat,
pollen grains lose viability within 30
minutes of their release, and in some
S21.
members of Rosaceae, Leguminoseae
and Solanaceae, they maintain viability
for months.
Ans.(d)
False fruits are the fruits in which the
thalamus part of the flower also
contributes to fruit formation. These
fruits are not formed only from ovary.
Ans.(d)
The following are the post-fertilisation
changes:
• Ovule → Seed
• Ovary → Fruit
• Zygote → Embryo
• Central cell → Endosperm
Ans.(b)
Perisperm is the name for the nucellus
that remains after fertilisation. Seeds of
black pepper and beets, for example.
Ans.(d)
One of the two male gametes released in
synergids in flowering plants fuses with

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans.(c)
Inside the diploid anther, the pollen
grain is haploid. Similarly, the embryo
sac inside the diploid ovule is haploid.
As a result, pollen grain and embryo sac
are plant parts that have two
enerations within them.
S15. Ans.(d)
Water hyacinths and water lilies are
aquatic plants with flowers that rise
above the water’s surface. As with most
land plants, they are pollinated by
insects or the wind.
S16. Ans.(d)
Hilum is the connection between the
funicle and the ovule body.
S17. Ans.(a)
Pollen grains must be light and non-
sticky in order to be transported in wind
currents during wind pollination. They
frequently have exposed stamens
(allowing pollen to be easily dispersed in
wind currents) and a large, often
feathery stigma to trap pollen grains in
the air. Wind-pollinated flowers
typically have a single ovule in each
ovary and a dense inflorescence of
flowers.
542 CHANNEL
JOIN TELEGRAM
the egg, while the other unites with the
secondary or definitive nucleus
located in the central cell. Zygote = egg
(n) + 1st male gamete (n) (2n) PEN (3n)
(2n) Secondary nucleus + 2nd male
gamete (n) (central cell nuclei)
S22. Ans.(d)
Sporopollenin is a prominent
component of pollen grains’ strong outer
walls. It has a chemical stability
that allows it to survive in soils and
sediments.
S23. Ans.(c)
Because liquid nitrogen has a very low
boiling point of –196°C, it is commonly
employed to preserve pollen grains.
S24. Ans.(d)
When one of the two male gametes from
a pollen grain fertilises the egg, the
other male gamete fertilises the
central cell’s previously fused two polar
nuclei (i.e., triple fusion). Syngamy is
the first fertilisation of a male gamete
and an egg.
S25. Ans.(c)
One of the megaspores of angiosperms
is functional, while the other three
degenerate. Only the female
 gametophyte grows from the functioning
megaspore (embryo sac).
S26. Ans.(b)
Pollen grains are transferred from the
anther to the stigma of the same flower
in autogamy. Pollen grains are
transferred from the anther to
the stigma of another flower on the
same plant in geitonogamy. It’s cross-
pollination with a pollinating agent in
terms of function. However, because
the pollen grains come from the same
plant, it is genetically identical to
autogamy.
S27. Ans.(c)
Wind pollinated flowers have a single
ovule in each ovary and a dense cluster
of flowers.
S28. Ans.(b)
Entomophily (pollination by insects),
notably bees, is more widespread.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
• Large, colourful, aromatic, and nectar-
rich flowers pollinated by insects. The
flower rewards for pollination are
nectar and pollen grains.
• Pollinated by flies and beetles, the
flowers grow inflorescence to make
themselves noticeable.
• Pollen grains are often sticky.
S29. Ans.(a)
The leaf primordia is encased in the
coleoptile, a hollow foliar structure (a
protective sheath).
S30. Ans.(c)
Megaspore, egg cell, and embryo sac
polar nucleus are all haploid (n). The
nucellus, mother cell of the megaspore,
and secondary nucleus are all diploid
(2n) in nature. In nature, the primary
endosperm nucleus is triploid.
S31. Ans.(c)
Continuous mating of closely related
individuals within the same breed
causes inbreeding depression,
which reduces an organism’s fertility
and productivity.
543 CHANNEL
JOIN TELEGRAM
S32. Ans.(d)
Pollen grains from a wide range of
species can be kept for years in liquid
nitrogen (-196°C). Pollen banks made
from banked pollen can be employed in
crop breeding programmes.
S33. Ans.(c)
Megasporangia (Megasporangium), also
known as ovules, arise from the
placenta.
S34. Ans.(d)
The flowers of most aquatic plants, such
as water hyacinth and water lily, emerge
above the water’s surface and are
pollinated by insects or wind, just like
most land plants.
S35. Ans.(a)
The megaspore mother cell in the
majority of angiosperms undergoes
reduction division. Megasporogenesis is
the process of producing megaspores
from a megaspore mother cell. Meiotic
division occurs in the MMC. The process
of meiosis produces four megaspores.
S36. Ans.(a)
The pistil can tell if pollen is of the
proper type (compatible) or the wrong
type (incompatible). The pistil receives
pollen and supports post-pollination
activities that lead to fertilisation if it is
of the proper type. The pistil rejects
pollen by blocking pollen germination
on the stigma or pollen tube growth in
the style if the pollen is of the wrong
type.
S37. Ans.(d)
Apomixis is a special process for
producing seeds without fertilisation.
Apomixis can be found in several
Asteraceae and grass species.
S38. Ans.(d)
The cotyledon of the grass family is
known as scutellum, and it is located on
one side (lateral) of the embryonal axis.
S39. Ans.(a)
The tapetum is a specialized layer of
nutritive cells found within the
sporangium, particularly within the
 anther, of flowering plants, where it is
located between the sporangenous
tissue and the anther wall. Tapetum
is important for the nutrition and
development of pollen grains, as well as
a source of precursors for the
pollen coat, however it does not help in
dehiscence of the anther. So, the correct
answer is ‘Tapetum helps in
the dehiscence of anther.’
S40. Ans.(d)
The filament’s proximal end is linked to
the flower’s thalamus or petal.
S41. Ans.(d)
The coconut water you’re familiar with
is made up of free-nuclear endosperm
(made up of thousands of nuclei),
whereas the white kernel around it is
cellular endosperm.
S42. Ans.(d)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Male gametes must be transported by
water in bryophytes and pteridophytes.
Bryophytes are also known as
amphibians of the plant kingdom since
they can live in soil but need water to
reproduce sexually. The proliferation of
live pteridophytes is limited and
restricted to certain geographical
regions due to the need for water for
fertilisation. The ovule is a tiny
structure linked to the placenta by
a stalk called a funicle.
S43. Ans.(c)
In the hilum area, the ovule’s body
unites with the funicle. This is also
present in seed (seed is mature ovule).
S44. Ans.(c)
Pollen grains are transferred from an
anther to the stigma of another flower
on the same plant. Although
geitonogamy is cross-pollination with a
pollinating agent, it is genetically
identical to autogamy because
the pollen grains come from the same
source.
S45. Ans.(d)
544 CHANNEL
JOIN TELEGRAM
Flowers must provide rewards to the
animals in order to aid pollination and
maintain animal visits. The usual floral
rewards are nectar and pollen grains.
S46. Ans.(b)
Microsporogenesis and
megasporogenesis are the
processes of forming microspores and
megaspores from a pollen mother cell
(PMC) and a megaspore mother cell
(MMC), respectively, during meiosis.
S47. Ans.(b)
The monocot embryo has only one
cotyledon, the scutellum, which is
shaped like a shield.
S48. Ans.(c)
Synergids feature filiform apparatus,
which are specific cellular thickenings
at the micropylar tip that help guide the
pollen tube.
S49. Ans.(c)
Fruits are produced via fertilisation in
the majority of species, however
parthenocarpic fruits are produced
by a few species that do not require
fertilisation. Banana, for example.
S50. Ans.(a)
The primary endosperm nucleus (PEN)
undergoes multiple nuclear divisions to
give rise to free nuclei in the most
prevalent type of endosperm
development. Free nuclear endosperm is
the name for this stage. Coconut water
is made up of free nuclear endosperm
from sensitive coconuts. Pollen grains
indicate the male gametophyte in
angiosperms.
S51. Ans.(d)
The pollen grain is made up of two cells:
a vegetative cell and a generative cell
when it is fully grown. Later, two male
gametes were produced by mitotic
division of the progenitor cells.
S52. Ans.(a)
Nonalbuminous seed - Bean, Pea, and
Groundnut.
S53. Ans.(d)
Pollen grains are nutrient-dense. It is S58. Ans.(d)
used to augment food. Advantage of cleistogamy is no
S54. Ans.(d) dependence on pollinators.
Lilium pollen grains have only two cells S59. Ans.(a)
and angiosperm. Megasporangium is equivalent to the
S55. Ans.(a) ovule. Megasporangium ovule is
Filiform apparatus directs the pollen connected to the placenta with a stalk
tube as it grows. called funicle. It yields megasporocytes
that form megaspores
S56. Ans.(b)
S60. Ans.(d)
Pollen grains are transferred from the
anther to the stigma of another flower Perisperm is diploid, while endosperm is
on the same plant in a process known triploid in nature.
as geitonogamy. S61. Ans.(d)
S57. Ans.(a) Genetic combination generates variance
Tapetum is the innermost layer that in sexual reproduction.
feeds the growing embryo. Wind pollinates plants with ovaries that
have either one or a few ovules.

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

545 CHANNEL
JOIN TELEGRAM
 Chapter 21
Sankalp Bharat
Human Reproduction

1. Which of the following statements are (a) Both Statement I and Statement II are
correct regarding female reproductive cycle? false.
A. In non-primate mammals cyclical (b) Statement I is correct but Statement II is
changes during reproduction are called false.
oestrus cycle.
(c) Statement I is incorrect but Statement II
B. First menstrual cycle begins at puberty
is true.
is called menopause.
C. Lack of menstruation may be indicative (d) Both Statement I and Statement II are
of pregnancy. true.
D. Cyclic menstruation extends between 4. How many secondary spermatocytes are
menarche and menopause. required to form 400 million spermatozoa?
Choose the most appropriate answer from (2022)
the options given below: (2023) (a) 400 million
(a) A and B only (b) 50 million
(b) A, B and C only (c) 100 million
(c) A, C and D only (d) 200 million

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) A and D only
2. Given below are two statements: one is
labelled as Assertion and the other is
labelled as Reason R.
Assertion A: Endometrium is necessary for
implantation of blastocyst.
Reason R: In the absence of fertilization,
the corpus luteum degenerates that causes
disintegration of endometrium.
In the light of the above statements, choose
the correct answer from the options given
below: (2023)
(a) Both A and R are true but R is NOT the
correct explanation of A.
(b) A is true but R is false.
(c) A is false but R is true.
(d) Both A and R are true and R is the
correct explanation of A.
3. Given below are two statements:
Statement I : Vas deferens receives a duct
from seminal vesicle and opens into urethra
as the ejaculatory duct.
Statement II : The cavity of the cervix is
called canal which along with vagina forms
birth canal.
In the light of the above statements, choose
the correct answer from the options given
below: (2023)
5. Arrange the components of mammary
gland. (from proximal to distal). (2022)
A. Mammary duct
B. Lactiferous duct
C. Alveoli
D. Mammary ampulla
E. Mammary tubules
Choose the most appropriate answer from
the options given below:
(a) E → C → D → B → A
(b) C → A → D → E → B
(c) B → C → E → D → A
(d) C → E → A → D → B
6. Given below are two statements: one is
labelled as Assertion (A) and the other is
labelled as Reason (R).
Assertion (A): During pregnancy the level of
thyroxine is increased in the maternal
blood.
Reason (R): Pregnancy is characterized by
metabolic changes in the mother.
In the light of the above statements, choose
the most appropriate answer from the
options given below: (2022)
(a) (A) is not correct but (R) is correct
(b) Both (A) and (R) are correct and (R) is
the correct explanation of (A)

546 CHANNEL
JOIN TELEGRAM
 (c) Both (A) and (R) are correct but (R) is not (b) Perivitelline space
the correct explanation of (A) (c) Zona pellucida
(d) (A) is correct but (R) is not correct (d) Corona radiata
11. Which of these is not an important
7. Which of the following statements are true
component of initiation of parturition in
for spermatogenesis but do not hold true for
humans? (2021 , 2015)
Oogenesis? (2022)
(a) Synthesis of prostaglandins
A. It results in the formation of haploid
(b) Release of Oxytocin
gametes.
(c) Release of Prolactin
B. Differentiation of gamete occurs after
(d) Increase in estrogen and progesterone
the completion of meiosis.
Ratio
C. Meiosis occurs continuously in a
12. Which of the following secretes the
mitotically dividing stem cell population.
hormone, relaxin during the later phase of
D. It is controlled by the Luteinising
pregnancy? (2021)
Hormone (LH) and Follicle Stimulating
(a) Corpus luteum
Hormone (FSH) secreted by the anterior
(b) Foetus
pituitary.
(c) Uterus
E. It is initiated at puberty.
(d) Graafian follicle
Choose the most appropriate answer from 13. Which of the following hormone levels will
the options given below: cause release of ovum (ovulation) from the
(a) C and D only graffian follicle? (2020)
(a) High concentration of Progesterone
(b) B and C only
(b) Low concentration of LH

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) B, D and E only (c) Low concentration of FSH
(d) B, C and E only (d) High concentration of Estrogen
8. Given below are two statements: (2022) 14. Meiotic division of the secondary oocyte is
Statement I : The release of sperms into the completed (2020)
seminiferous tubules is called spermiation. (a) At the time of copulation
Statement II : Spermiogenesis is the process (b) After zygote formation
of formation of sperms from spermatogonia. (c) At the time of fusion of a sperm with an
In the light of the above statements, choose ovum
the most appropriate answer from the (d) Prior to ovulation
options given below: 15. Match the following columns and select the
correct option (2020)
(a) Both Statement I and Statement II are
Column - I Column - II
correct
1. Placenta (i) Androgens
(b) Both Statement I and Statement II are
incorrect 2. Zona (ii) Human
pellucida chorionic
(c) Statement I is correct but Statement II is
gonadotropin
incorrect
(hCG)
(d) Statement I is incorrect but Statement II
3. Bulbo- (iii) Layer of the
is correct
urethral ovum
9. At which stage of life the oogenesis process glands
is initiated? (2022) Leydig (iv)
4. Lubrication of
(a) Puberty cells the penis
(b) Embryonic development stage
1 2 3 4
(c) Birth (a) (i) (iv) (ii) (iii)
(d) Adult (b) (iii) (ii) (iv) (i)
10. Receptors for sperm binding in mammals (c) (ii) (iii) (iv) (i)
are present on (2021) (d) (iv) (iii) (i) (ii)
(a) Vitelline membrane

547 CHANNEL
JOIN TELEGRAM
16. In human beings, at the end of 12 weeks formed, while in spermiation,
(first trimester) of pregnancy, the following spermatozoa are formed
is observed (2020 Covid Re-NEET) (b) In spermiogenesis, spermatozoa are
(a) Most of the major organ systems are formed, while in spermiation, spermatids
formed are formed
(b) The head is covered with fine hair (c) In spermiogenesis, spermatozoa from
(c) Movement of the foetus sertoli cells are released into the cavity of
(d) Eyelids and eyelashes are formed seminiferous tubules, while in
17. Select the correct option of haploid cells spermiation, spermatozoa are formed
from the following groups (d) In spermiogenesis, spermatozoa are
(2020 Covid Re-NEET) formed, while in spermiation,
(a) Secondary spermatocyte, First polar spermatozoa are released from Sertoli
body, Ovum cells into the cavity of seminiferous
(b) Spermatogonia, Primary spermatocyte, tubules
Spermatid 22. The amnion of mammalian embryo is
(c) Primary spermatocyte, Secondary derived from (2018)
spermatocyte, Second polar body (a) Ectoderm and mesoderm
(d) Primary oocyte, Secondary oocyte, (b) Endoderm and mesoderm
Spermatid (c) Mesoderm and trophoblast
18. Select the correct sequence for transport of (d) Ectoderm and endoderm
sperm cells in male reproductive system 23. Match the items given in Column I with
(2020, 2016 Covid Re-NEET) those in Column II and select the correct
(a) Testis → Epididymis → Vasa efferentia → option given below (2018)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Rete testis → Inguinal canal → Urethra Column I Column II
(b) Seminiferous tubules → Rete testis → Proliferative i.
Vasa efferentia → Epididymis → Vas A. Breakdown
Phase of
deferens → Ejaculatory duct → Urethra
→ Urethral meatus endometrial
(c) Seminiferous tubules → Vasa efferentia lining
→ Epididymis → Inguinal canal → Secretory ii. Follicular
B.
Urethra Phase Phase
(d) Testis → Epididymis → Vasa efferentia
C. Menstruation iii. Luteal
→ Vas deferens → Ejaculatory duct →
Phase
Inguinal canal → Urethra → Urethral
meatus (a) A-iii B-ii C-i
19. Extrusion of second polar body from egg (b) A-i B-iii C-ii
nucleus occurs (2019) (c) A-ii B-iii C-i
(a) After entry of sperm but before (d) A-iii B-i C-ii
fertilisation 24. A temporary endocrine gland in the human
(b) After fertilisation body is (2017)
(c) Before entry of sperm into ovum (a) Pineal gland
(d) Simultaneously with first cleavage (b) Corpus cardiacum
20. Hormones secreted by the placenta to (c) Corpus luteum
maintain pregnancy are (2018, 2016) (d) Corpus allatum
(a) hCG, hPL, progestogens, prolactin 25. Capacitation occurs in (2017)
(b) hCG, hPL, estrogens, relaxin, oxytocin (a) Rete testis
(c) hCG, hPL, progestogens, estrogens (b) Epididymis
(d) hCG, progestogens, estrogens, (c) Vas deferens
Glucocorticoids (d) Female Reproductive tract
21. The difference between spermiogenesis and 26. Match Column-I with Column-II and select
spermiation is (2018) the correct option using the codes given
(a) In spermiogenesis, spermatids are below (2016-II)

548 CHANNEL
JOIN TELEGRAM
 Column I Column II (d) The sperms are transported into cervix
Mons pubis i. Embryo within 48 hrs of release of ovum in
A. uterus
formation
31. The shared terminal duct of the
B. Antrum ii. Sperm reproductive and urinary system in the
C. Trophectoderm iii. Female human male is (2015-14)
external (a) Urethra
genitalia (b) Ureter
Nebenkern iv. Graafian (c) Vas deferens
D. (d) Vasa efferentia
follicle
32. Capacitation refers to changes in the (2015)
(a) A-iii B-i C-iv D-ii (a) Ovum after fertilisation
(b) A-i B-iv C-iii D-ii (b) Sperm after fertilisation
(c) A-iii B-iv C-ii D-i (c) Sperm before fertilisation
(d) A-iii B-iv C-i D-ii (d) Ovum before fertilisation
27. Identify the correct statement on inhibin 33. Which of the following cells during
(2016-II) gametogenesis is normally diploid? (2015)
(a) Inhibits the secretion of LH, FSH and (a) Spermatogonia
Prolactin (b) Secondary polar body
(b) Is produced by granulosa cells in ovary (c) Primary polar body
and inhibits the secretion of FSH (d) Spermatid
(c) Is produced by granulosa cells in ovary 34. In human females, meiosis-II in not
and inhibits the secretion of LH complete until (2015 Re)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) Is produced by nurse cells in testes and (a) Fertilisation
inhibits the secretion of LH (b) Uterine implantation
28. Changes in GnRH pulse frequency in (c) Birth
females is controlled by circulating levels of (d) Puberty
(2016-I) 35. Which of the following layers in an antral
(a) Estrogen and progesterone follicle is acelluar? (2015 Re)
(b) Estrogen and inhibin (a) Theca interna
(c) Progesterone only (b) Stroma
(d) Progesterone and inhibin (c) Zona pellucida
29. Select the incorrect statement (2016-I) (d) Granulosa
(a) FSH stimulates the sertoli cells which 36. Which of the following events is not
help in spermiogenesis associated with ovulation in human female?
(b) LH triggers ovulation in ovary (2015 Re)
(c) LH and FSH decrease gradually during (a) Full development of Graafian follicle
the follicular phase (b) Release of secondary oocyte
(d) LH triggers secretion of androgens from (c) LH surge
the Leydig cells (d) Decrease in estradiol
30. Fertilisation in humans is practically 37. Select the correct option describing
feasible only if (2016-I) gonadotropin activity in a normal pregnant
(a) The sperms are transported into vagina female (2014)
just after the release of ovum in fallopian (a) High level of hCG stimulates the
tube thickening of endometrium
(b) The ovum and sperms are transported (b) High level of FSH and LH stimulates the
simultaneously to ampullary - isthmic thickening of endometrium
junction of the fallopian tube (c) High level of FSH and LH facilitate
(c) The ovum and sperms are transported implantation of the embryo
simultaneously to ampullary - isthmic (d) High level of hCG stimulates the
junction of the cervix synthesis of estrogen and progesterone

549 CHANNEL
JOIN TELEGRAM
38. The main function of mammalian corpus
luteum is to produce (2014)
(a) Relaxin only
(b) Estrogen only
(c) Progesterone
(d) Human chorionic gonadotropin
39. What is the correct sequence of sperm
formation? (2013)
(a) Spermatogonia, Spermatocyte,
Spermatid, Spermatozoa
(b) Spermatid, Spermatocyte,
Spermatogonia, Spermatozoa
(c) Spermatogonia, Spermatocyte,
Spermatozoa, Spermatid
(d) Spermatogonia, Spermatozoa,
Spermatocyte, Spermatid
40. Menstrual flow occurs due to lack of (2013)
(a) Vasopressin
(b) Progesterone
(c) FSH
(d) Oxytocin

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

550 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (c) S23. Ans. (c)

S2. Ans. (a) S24. Ans. (c)

S3. Ans. (d) S25. Ans. (d)

S4. Ans. (d) S26. Ans. (d)

S5. Ans. (d) S27. Ans. (b)

S6. Ans. (b) S28. Ans. (a)

S7. Ans. (d) S29. Ans. (c)

S8. Ans. (c) S30. Ans. (b)

S9. Ans. (b) S31. Ans. (a)

S10. Ans. (c) S32. Ans. (c)

S11. Ans. (c) S33. Ans. (a)

S12. Ans. (a) S34. Ans. (a)

S13. Ans. (d) S35. Ans. (c)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (c) S36. Ans. (d)

S15. Ans. (c) S37. Ans. (d)

S16. Ans. (a) S38. Ans. (c)

S17. Ans. (a) S39. Ans. (a)

S18. Ans. (b) S40. Ans. (b)

S19. Ans. (a)

S20. Ans. (c)

S21. Ans. (d)

S22. Ans. (a)

551 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(c)
Lack of menstruation may be indicative
of pregnancy.
S2. Ans.(a)
Assertion A: True. The endometrium is
the inner lining of the uterus and it is
where the blastocyst (a very early stage
of an embryo) implants and develops
during pregnancy.
Reason R: True. The corpus luteum is a
temporary structure in the ovaries that
produces progesterone, a hormone
necessary for maintaining the
endometrium
S3. Ans.(d)
Statement I is correct because the vas
deferens does indeed receive a duct from
the seminal vesicle. This combined
structure is known as the ejaculatory
duct, and it does open into the urethra,
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
which carries semen out of the body
during ejaculation.
Statement II is also correct. The cavity
of the cervix is indeed referred to as the
cervical canal. The cervix, along with the
vagina, does form the birth canal, which
is the path through which a baby
travels during childbirth.
S4. Ans.(d)
Option (d) is the correct answer because
one primary spermatocyte produces two
secondary spermatocytes by meiosis I
and one secondary spermatocyte
produces two spermatozoa via meiosis
2. So, 200 million secondary
spermatocyte will produce 400 million
spermatozoa.
S5. Ans.(d)
Each mammary lobule is composed of a
number of alveoli which open into
mammary tubules. The tubules of each
lobule join to form a mammary duct.
Near the nipple, mammary ducts
expand to form mammary ampullae
where some milk is stored before going
to lactiferous duct which is present at
distal end through which milk is sucked
out.
552 CHANNEL
JOIN TELEGRAM
S6. Ans.(b)
Option (b) is the correct answer because
thyroxine is the main hormone that
increases the basal metabolic rate in
our body. A high metabolic rate is
required during pregnancy, so levels of
thyroxine increase in pregnant females
along with other hormones such as
cortisol, progesterone, etc.
S7. Ans.(d)
Spermatogenesis and oogenesis both are
controlled by LH and FSH secreted by
the anterior pituitary. Hence, (d) is true
for both.
S8. Ans.(c)
Option (c) is the correct answer because
Statement II is incorrect as the
transformation of spermatids into
spermatozoa (sperms) are called
spermiogenesis.
S9. Ans.(b)
Option (b) is the correct answer as
oogenesis is initiated during the
embryonic development stage when a
couple of million gamete mother cells
(oogonia) are formed within each foetal
ovary.
S10. Ans.(c)
Receptors for sperm binding in
mammals are present on zona pellucida
S11. Ans.(c)
An important component of initiation of
parturition in humans is not release of
prolactin but release of prostaglandins,
oxytocin,estrogen-progesterone ratio
S12. Ans.(a)
Corpus luteum secretes relaxin
hormone during the later phase of
pregnancy.
S13. Ans.(d)
During ovulation, the graffian follicle
releases an ovum which is caused by a
high estrogen concentration).
S14. Ans.(c)
The meiotic division of the secondary
oocyte is arrested during the Metaphase
 II phase of meiosis II. After fertilisation
by sperm, the division is completed.
S15. Ans.(c)
Placenta: During pregnancy, human
chorionic gonadotropin (hCG) is
produced primarily by the
syncytiotrophoblastic cells of the
placenta. Zona pellucida: An ovum is
surrounded by a thick,
transparent membrane before
implantation. Bulbourethral glands:
Two pea-shaped exocrine
glands located posterolateral to the
membranous urethra. By secreting
lubricating mucus, they contribute to
the final volume of semen. Leydig cells:
Their location in the testicle is adjacent
to the seminiferous tubules. They
produce testosterone in the presence of
the luteinizing hormone (LH).
S16. Ans.(a)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Most of the major organ systems, such
as the limbs and external genital
organs, are formed by the end of
the first trimester (12 weeks).
S17. Ans.(a)
Haploid cells include secondary
spermatocyte, the first polar body and
the ovum.
S18. Ans.(b)
The correct sequence for transport of
sperm cells in male reproductive system
is: Seminiferous tubules → Rete testis
→ Vasa efferentia → Epididymis → Vas
deferens → Ejaculatory duct → Urethra
→ Urethral meatus
S19. Ans.(a)
After sperm enters the egg nucleus, but
before fertilisation, the second polar
body extrudes from the nucleus. The
entry of sperm into the ovum causes the
secondary oocyte’s meiotic division to be
completed. . When sperm enters the
cell, the metaphase promoting
factor (MPF) is broken down and the
anaphase promoting complex is
activated (APC).
S20. Ans.(c)
553 CHANNEL
JOIN TELEGRAM
During pregnancy, the placenta is an
endocrine gland. Human chorionic
gonadotropin (hCG), progesterone,
estrogen and human placental lactogen
(hPL) are all secreted by it.
S21. Ans.(d)
Spermatogenesis is the process of
spermatid production. Spermatozoa are
formed from spermatids during
spermiogenesis. Spermiation is the
release of spermatozoa into the
cavity of the seminiferous tubule.
S22. Ans.(a)
Chorion and amnion are made up of
extraembryonic somatic mesoderm and
triploblastic ectoderm. Yolk sac and
allantois are generated from endoderm
and extraembryonic splanchnic
mesoderm, respectively.
S23. Ans.(c)
The follicular phase in which follicles
develop and mature inside the ovary is
known as the proliferative
phase. The secretory phase in which the
ovum is discharged and the mature
graafian follicle transforms
into the corpus luteum, is also known
as the luteal phase.
During menstruation, the endometrial
lining sheds and unfertilized, damaged
ovum flows out of the body.
S24. Ans.(c)
After ovulation, the graafian follicle
transforms into the corpus luteum, a
yellow endocrine mass. Progesterone is
secreted by it.
S25. Ans.(d)
Capacitation is the increase in sperm
fertilisation capability that occurs in the
female reproductive system.
S26. Ans.(d)
Nebenkern sheath is a spiral sheath of
mitochondria that surrounds the
axonema. The trophectoderm is a layer
of cells that forms the placental contact
between the mother and the baby.
The external genitalia of the female
include the mons pubis, the labia
 majora, the labia minora and the
hymen. The secondary follicle soon
changes into a tertiary follicle with a
fluid-filled cavity called the antrum.
S27. Ans.(b)
Inhibin is a protein generated by
granulosa cells in the ovary that
prevents FSH from being secreted.
S28. Ans.(a)
Estrogen and progesterone levels in the
blood govern changes in GnRH pulse
frequency in females.
S29. Ans.(c)
During the follicular phase,
gonadotropin (LH and FSH) output
increases progressively, stimulating
follicular development as well as
estrogen secretion by the developing
follicles.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S30. Ans.(b)
Fertilisation is only possible if the ovum
and sperms arrive to the ampullary
isthmic junction at the same time. This
is why, not all copulations result in
pregnancy and fertilisation.
S31. Ans.(a)
The urethra is an urine duct that begins
at the neck of the urinary bladder and
ends at the tip of the urethra. The
urethra provides an exit for the urine
(excretory system) as well as for the
semen (reproductive system) during
ejaculation in males.
S32. Ans.(c)
Capacitation is the process of preparing
sperm in order to fertilise an ovum. It is
the last stage of the spermatozoan
maturation process. As the sperm
reaches the ovum, it takes place inside
the vaginal canal.
554 CHANNEL
JOIN TELEGRAM
S33. Ans.(a)
Spermatogonia are diploid germ cells of
seminiferous tubules that undergo
mitosis to form the primary
spermatocytes. These primary
spermatocytes are coverted to haploid
sperms by meiotic of division.
S34. Ans.(a)
The initial polar body in humans does
not go through meiosis II, whereas the
secondary oocyte gets to the
metaphase stage of meiosis II. However,
it then stops progressing and waits for
sperm to arrive in order to complete
meiosis II.
S35. Ans.(c)
The thick non-cellular membrane that
develops surrounding the oocyte within
the ovarian follicle is known as the zone
pellucida. At least one spermatozoan
penetrates it during fertilisation and it
remains around the blastocyst until it
reaches the uterus.
S36. Ans.(d)
The Graafian follicle fully develops
during ovulation. On the 14th day of the
cycle, the secondary oocyte is released.
During the LH surge, which occurs in
the middle of the cycle, the level of LH
reaches its highest point. Estradiol
levels are rising.
S37. Ans.(d)
During the first trimester of pregnancy,
the endocrine placenta secretes hCG.
After implantation, it preserves the
endometrium’s lining by synthesising
estrogen and progesterone.
S38. Ans.(c)
The corpus luteum secretes
progesterone which keeps the
endometrium healthy until
implantation.
S39. Ans.(a)
In spermatogenesis, spermatozoa are
produced by the mitosis and meiosis
division of male primordial germ cells.
The initial cells are spermatogonia,
which produces primary spermatocytes
 by mitosis. The primary spermatocyte
divides meiotically (meiosis I)
into two secondary spermatocytes, each
secondary spermatocyte divides into two
spermatids by meiosis II.
These develop into mature spermatozoa,
also known as sperm cells.
S40. Ans.(b)
Progesterone keeps the endometrium
healthy during pregnancy, its
withdrawal results in menstrual flow.

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

555 CHANNEL
JOIN TELEGRAM
 Chapter 22 Sankalp Bharat
Reproductive Health

1. Match List-I with List-II. D. Amniocentesis is used to determine

List-I List-II genetic disorders and survivability of
Non-medicated (i) Multiload 375 foetus.
A.
IUDs Choose the most appropriate answer from
B. Copper (ii) Rubber the options given below: (2023)
releasing barrier (a) B and C only
IUDSs (b) D and C only
C. Hormone (iii) Lippes loop (c) A, B and D only
releasing IUDs (d) A and C only
D. Vaults (iv) LNG-20
4. Given below are two statements: one is
Choose the correct answer from the options labelled as Assertion A and other is labelled
given below: (2023) as Reason R.
(a) A-(iv), B-(iii), C-(i), D-(ii) Assertion A : Amniocentesis for sex
(b) A-(ii), B-(iv), C-(iii), D-(i) determination is one of the strategies of
(c) A-(iii), B-(i), C-(iv), D-(ii) Reproductive and Child Health Care
(d) A-(iii), B-(iv), C-(ii), D-(i) Programme.

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Reason R : Ban on amniocentesis checks
2. Given below are two statements: (2023)
increasing menace of female foeticide.
Statement I: Intra Cytoplasmic Sperm
In the light of the above statements, choose
Injection (ICSI) is another specialized
the correct answer from the options given
procedure of in-vivo fertilization.
below. (2023)
Statement II: Infertility cases due to
(a) Both A and R are true and R is NOT the
inability of the male partner to inseminate
correct explanation of A.
female can be corrected by artificial
(b) A is true but R is false.
insemination (AI).
(c) A is false but R is true.
In the light of the above statements, choose
(d) Both A and R are true and R is the
the correct answer from the options given
below: correct explanation of A.
(a) Statement I is correct but statement II is 5. Match List-I with List-II. (2023)
false List-I List-II
(b) Statement I is incorrect but Statement II
is true A. Vasectomy (i) Oral method
(c) Both Statement I and Statement II are B. Coitus (ii) Barrier
true interruptus method
(d) Both Statement I and Statement II are Cervical caps (iii) Surgical
C.
false method
3. Which of the following statements are D. Saheli (iv) Natural
correct? method
A. Reproductive health refers to total well-
Choose the correct answer from the options
being in all aspects of reproduction.
given below:
B. Amniocentesis is legally banned for sex
(a) A-(iii), B-(iv), C-(ii), D-(i)
determination in India.
(b) A-(ii), B-(iii), C-(i), D-(iv)
C. “Saheli” – a new oral contraceptive for
(c) A-(iv), B-(ii), C-(i), D-(iii)
females was developed in collaboration
(d) A-(iii), B-(i), C-(iv), D-(ii)
with ICMR (New Delhi).

556 CHANNEL
JOIN TELEGRAM
6. Which of the following is not an Intra Choose the correct answer from the options
Uterine Device? (2022) given below:
(a) Progestasert (a) A-(iv), B-(i), C-(iii), D-(ii)
(b) Progestogens (b) A-(iv), B-(i), C-(ii), D-(iii)
(c) Multiload 375 (c) A-(ii), B-(iv), C-(i), D-(iii)
(d) Lippes loop (d) A-(iii), B-(ii), C-(i), D-(iv)
7. IUDs are small objects made up of plastic or 10. Match List-I with List-II (2021)
copper that are inserted in the uterine List-I List-II
cavity. Which of the following statements Vaults (i)
are correct about IUDs? (2022) (A) Entry of sperm
A. IUDs decrease phagocytosis of sperm through cervix is
within the uterus. blocked
B. The released copper ions suppress the (B) IUDs (ii) Cut and tie of vas
sperm motility. deferens
C. IUDs do not make the cervix hostile to Vasectomy (iii)
(C) Phagocytosis of
the sperm.
sperms within
D. IUDs suppress the fertilization capacity
the uterus
of sperm.
E. The IUDs require surgical intervention (D) Tubectomy (iv) Cut and tie of
for their insertion in the uterine cavity. fallopian tube
Choose the most appropriate answer from
(a) A-(i) B-(iii) C-(ii) D-(iv)
the options given below:
(b) A-(ii) B-(iv) C-(iii) D-(i)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) D only (c) A-(iii) B-(i) C-(iv) D-(ii)
(b) A, D and E only (d) A-(iv) B-(ii) C-(i) D-(iii)
(c) B and C only 11. In which of the following techniques, the
(d) B and D only embryos are transferred to assist those
8. Lippe’s loop is a type of contraceptive used females who cannot conceive? (2020)
as: (2022) (a) GIFT and ZIFT
(a) Cervical barrier (b) ICSI and ZIFT
(b) Vault barrier (c) GIFT and ICSI
(c) Non-Medicated IUD (d) ZIFT and IUT
(d) Copper releasing IUD 12. Select the option including all sexually
transmitted diseases (2020)
9. Match List-I with List-II with respect to
(a) Gonorrhoea, Malaria, Genital herpes
methods of Contraception and their
(b) AIDS, Malaria, Filaria
respective actions. (2022)
(c) Cancer, AIDS, Syphilis
List-I List-II
(d) Gonorrhoea, Syphilis, Genital herpes
A. Diaphragma (i) Inhibit ovulation 13. Which of the following STDs are not
and Implantation curable? (2020, 2019 Covid Re-NEET)
B. Contraceptive (ii) Increase (a) Chlamydiasis, Syphilis, Genital warts
Pills phagocytosis of (b) HIV, Gonorrhoea, Trichomoniasis
sperm within (c) Gonorrhoea, Trichomoniasis, Hepatitis B
Uterus
(d) Genital herpes, Hepatitis B, HIV
C. Intra Uterine (iii) Absence of Infection
Devices Menstrual cycle 14. Progestogens alone or in combination with
and ovulation estrogens can be used as a contraceptive in
following
the form of (2020 Covid Re-NEET)
parturition
(a) Injections only
D. Lactational (iv) They cover the (b) Pills, injections and implants
Amenorrhea cervix blocking the
(c) Pills only
entry of sperms
(d) Implants only

557 CHANNEL
JOIN TELEGRAM
15. Select the hormone-releasing Intra-Uterine
Devices (2019)
(a) Vaults, LNG-20
(b) Multiload 375, Progestasert
(c) Progestasert, LNG-20
(d) Lippes Loop, Multiload 375
16. Which of the following contraceptive
methods do involve a role of hormone?
(2019)
(a) Lactational amenorrhea, Pills,
Emergency contraceptives
(b) Barrier method, Lactational
amenorrhea, Pills
(c) CuT, Pills, Emergency contraceptives
(d) Pills, Emergency contraceptives, Barrier
Methods
17. The contraceptive ‘SAHELI’ (2018)
(a) Blocks estrogen receptors in the uterus,
preventing eggs from getting implanted
(b) Increases the concentration of estrogen
and prevents ovulation in females
(c) Is an IUD
(d) Is a post-coital contraceptive
20. The function of copper ions in copper
releasing IUD’s is (2017)
(a) They suppress sperm motility and
fertilising capacity of sperms
(b) They inhibit gametogenesis
(c) They make uterus unsuitable for
implantation
(d) They inhibit ovulation
21. Which one of the following is not an IUD?
(2017)
(a) Vaults
(b) CuT
(c) Multiload 375
(d) Progestasert
22. Select the correct option (2017)
(a) IUI can help a woman with premature
menopause to bear a child
(b) GIFT involves IVF to help women who
cannot produce ovum to bear a child
(c) ZIFT involves IVF to help women who
cannot produce ovum to bear a child
(d) ZIFT involves IVF to help women who
have damaged fallopian tubes to bear a

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
18. Match the following sexually transmitted child
diseases (Column - I) with their causative 23. In Lactational amenorrhoea, ovulation does
agent (Column - II) and select the correct not occur during the period of intense
option (2017) lactation because of (2017)
Column - I Column- II (a) High level of FSH & LH
Gonorrhea (i) HIV (b) Surge of Estrogen
A. (c) Stimulation of GnRH
B. Syphilis (ii) Neisseria (d) High level of prolactin
C. Genital Warts (iii) Treponema 24. Embryo with more than 16 blastomeres
formed due to in vitro fertilisation is
D. AIDS (iv) Human
transferred into (2016 - II)
Papilloma
virus (a) Fimbriae
(b) Cervix
(c) Uterus
(a) A-(ii) B-(iii) C-(iv) D-(i) (d) Fallopian tube
25. Which of the following is incorrect regarding
(b) A-(iii) B-(iv) C-(i) D-(ii)
vasectomy? (2016 - II)
(c) A-(iv) B-(ii) C-(iii) D-(i) (a) Vasa deferentia is cut and tied
(d) A-(iv) B-(iii) C-(ii) D-(i) (b) Irreversible sterility
(c) No sperm occurs in seminal fluid
(d) No sperm occurs in epididymis
19. In case of a couple where the male is having
26. Which of the following is hormone releasing
a very low sperm count, which technique
IUD? (2014-2016 - II)
will be suitable for fertilisation? (2017)
(a) Lippes loop
(a) Intrauterine transfer
(b) Cu7
(b) Gamete intracytoplasmic fallopian
(c) LNG-20
transfer
(d) Multiload 375
(c) Artificial Insemination
27. Which of the following approaches does not
(d) Intracytoplasmic sperm injection
give the defined action of contraceptive?
(2016 - I)

558 CHANNEL
JOIN TELEGRAM
 31. A childless couple can be assisted to have a
(a) Barrier Prevent child through a technique called GIFT. The
fertilisation full form of this technique is (2015 Re)
Methods (a) Gamete intra fallopian transfer
(b) Intrauterine Increase (b) Gamete internal fertilisation and
devices phagocytosis of transfer
sperms, (c) Germ cell internal fallopian transfer
suppress sperm (d) Gamete inseminated fallopian transfer
32. Hysterectomy is surgical removal of (2015)
motility and
(a) Vasa deferens
fertilising
(b) Mammary glands
capacity of (c) Uterus
sperms (d) Prostate gland
Prevent/retard 33. Tubectomy is a method of sterilisation in
(c) Hormonal
which (2014)
contraceptives entry of
(a) Uterus is removed surgically
sperms, prevent (b) Small part of the fallopian tube is
ovulation and removed or tied up
fertilisation (c) Ovaries are removed surgically
Vasectomy Prevents (d) Small part of vas deferens is removed or
(d)
spermatogenesis tied up
34. Assisted reproductive technology, IVF
28. In context of amniocentesis, which of the involves transfer of (2014)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
following statement is incorrect? (2016 - I) (a) Embryo with 16 blastomeres into the
(a) It is usually done when a woman is fallopian tube
between 14 – 16 weeks pregnant (b) Ovum into the fallopian tube
(b) It is used for prenatal sex determination (c) Zygote into the fallopian tube
(c) It can be used for detection of Down’s (d) Zygote into the cervix
syndrome 35. Which of the following cannot be detected in
(d) It can be used for detection of cleft palate a developing foetus by amniocentesis?
29. Ectopic pregnancies are referred to as (2013)
(2015 Re) (a) Jaundice
(a) Implantation of embryo at site other than (b) Klinefelter’s syndrome
uterus (c) Sex of the foetus
(b) Implantation of defective embryo in the (d) Down syndrome
uterus
(c) Pregnancies terminated due to hormonal
imbalance
(d) Pregnancies with genetic abnormality
30. Which of the following is not a sexually
transmitted disease? (2015 Re)
(a) Trichomoniasis
(b) Encephalitis
(c) Syphilis
(d) Acquired Immuno Deficiency Syndrome

559 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (c) S19. Ans. (c)

S2. Ans. (b) S20. Ans. (a)

S3. Ans. (c) S21. Ans. (a)

S4. Ans. (c) S22. Ans. (c)

S5. Ans. (a) S23. Ans. (d)

S6. Ans. (b) S24. Ans. (c)

S7. Ans. (d) S25. Ans. (d)

S8. Ans. (c) S26. Ans. (c)

S9. Ans. (b) S27. Ans. (d)

S10. Ans. (a) S28. Ans. (d)

S11. Ans. (d) S29. Ans. (a)

S12. Ans. (d) S30. Ans. (b)

S13. Ans. (d) S31. Ans. (a)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (b) S32. Ans. (c)

S15. Ans. (c) S33. Ans. (b)

S16. Ans. (a) S34. Ans. (c)

S17. Ans. (a) S35. Ans. (a)

S18. Ans. (a)

560 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(c)
Here’s why :
A. Non-medicated IUDs : These are
intrauterine devices that do not
release any copper or hormones. An
example of this is the Lippes loop
(III).
B. Copper releasing IUDs : These IUDs
gradually release copper, which has
a spermicidal effect. Miltiload 375 (I)
is an example of this type of IUD.
C. Hormone releasing IUDs : These
IUDs release hormones to prevent
pregnancy. LNG-20, also known as
Mirena, (IV) is an example of this
type of IUD.
D. Vaults : This is another name for
cervical caps, a type of barrier
contraceptive method made of
rubber (II).
S2. Ans.(b)
Option (b) is correct.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Here’s why :
Statement I is incorrect. Intra
Cytoplasmic sperm Injection (ICSI) is a
specialized form of in-nitro (not in-vivo)
fertilization where a single sperm is
injected directly into the egg to facilitate
fertilization.
Statement II is correct. Infertility cases
due to inability of the male partner to
inseminate the female can indeed be
addressed through Artificial
Insemination (AI).
S3. Ans.(c)
(A) This statement is correct.
Reproductive health does indeed
refer to a total state of physical,
mental, and social well-being in all
matters relating to the reproductive
system at all stage of life.
(B) Amniocentesis is legally banned for
sex determination in India.
(D) Amniocentesis is used to determine
genetic disorders and survivability of
fetus.
S4. Ans.(c)
Assertion A is false because
amniocentesis for sex determination is
not a part of the Reproductive and Child
Health Care Programme.
561 CHANNEL
JOIN TELEGRAM
Reason R is true because a ban on
amniocentesis for sex determination is
indeed implemented in attempt to
reduce the incidence of female foeticide.
S5. Ans.(a)
A. Vasectomy: A surgical method of
male sterilization that involves
cutting or sealing the vas deferens to
prevent sperm from entering the
semen.
B. Coitus interruptus: A natural
method of contraception that
involves withdrawing the penis from
the vagina before ejaculation to
prevent sperms from entering the
vagina.
C. Cervical caps: A barrier method of
contraception that covers the cervix
to prevent sperm from entering the
uterus.
D. Saheli: An oral method of
contraception that involves taking a
non-steroidal, non0hormonal birth
control pill.
So, the correct matching is:
A-(iii), B-(iv), C-(ii), D-(i)
S6. Ans.(b)
Option (b) is the correct answer as
progestogens are the synthetic forms of
progesterone.
S7. Ans.(d)
Option (d) is the correct answer as only
statements (b) and (d) are correct
because the Cu ions which are released
suppress the sperm motility and the
fertilizing capacity of sperms.
S8. Ans.(c)
Option (c) is the correct answer because
the intrauterine device (IUD) presently
available as the non-medicated IUDs, is
Lippe’s loop.
S9. Ans.(b)
Diaphragms are barrier methods of
contraception. They cover the cervix and
block the entry of sperms.
S10. Ans.(a)
• Vaults prevent sperm from entering
the cervix.
• IUDs helps in phagocytosis of sperms
within the uterus.
• In vasectomy, a small part of the vas
 deferens is removed or tied up through
a small incision.
• In tubectomy, a small part of the
fallopian tube is removed or tied up
through a small incision.
S11. Ans.(d)
Embryos created through in vitro
fertilisation (gamete fusion outside the
female) or embryo transfer (ET) could be
utilised to help women who are unable
to conceive. Embryo transfer (ET)
involves transferring the zygote or early
embryos (with up to 8 blastomeres) into
the fallopian tube (ZIFT–zygote intra
fallopian transfer) and embryos
with more than 8 blastomeres into the
uterus (IUT– intra uterine transfer) to
complete their development.
S12. Ans.(d)
Sexually transmitted diseases include
gonorrhoea, syphilis and genital herpes.
S13. Ans.(d)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Sexually transmitted illnesses refers to
a group of diseases or infections that
are spread through sexual contact
(STDs). Other diseases, with the
exception of hepatitis B, genital herpes
and HIV infections, are totally curable if
diagnosed early and treated properly.
S14. Ans.(b)
Females can utilise progestogens alone
or in combination with estrogen as pills,
injections, or skin implants.
S15. Ans.(c)
The hormone-releasing IUDs
Progestasert and LNG-20 make the
uterus unsuitable for implantation
and the cervix hostile to sperms.
S16. Ans.(a)
• Gonadotropin levels drop in lactational
amenorrhoea due to elevated prolactin
levels.
• Females take oral pills that include
Progestogens or progestogen-estrogen
combination.
• Emergency contraceptives include
progestogens, progestogen-estrogen
combinations and IUDs administered
within 72 hours of coitus.
As a result, hormones have a role in
Lactational amenorrhoea, oral pills
and emergency contraception.
562 CHANNEL
JOIN TELEGRAM
S17. Ans.(a)
SAHELI, the contraceptive pill, is anti-
estrogen and causes a menstrual cycle
asynchrony between ovulation and
uterine lining formation. As a result,
the implantation is avoided.
S18. Ans.(a)
Gonorrhoea – Neisseria gonorrhea
(Bacteria) Treponema – Syphilis
(Bacteria) Human papillomavirus causes
genital warts (Virus) AIDS - Human
Immunodeficiency Virus (Virus)
S19. Ans.(c)
Artificial insemination (AI) is a method
of conceiving a child. The male’s or a
healthy donor’s sperm is intentionally
inserted into the female’s vaginal or
uterine cavity (IUI intra-uterine
insemination). This approach is
beneficial if the male partner is
unable to inseminate a female or has
poor sperm counts, for example.
S20. Ans.(a)
Cu ions inhibit sperm motility and
fertilisation ability.
S21. Ans.(a)
(a) Intrauterine Devices (IUDs):
These devices are inserted by doctors or
expert
nurses in the uterus through vagina
1. IUDs that aren’t medicated (e.g.,
Lippes loop)
2. IUDs that release copper (e.g., CuT,
Cu7, Multiload 375)
3. IUDs that release hormones (e.g.,
Progestasert, LNG-20)
S22. Ans.(c)
In both ZIFT and IVF, zygote or early
embryos are transferred into the
fallopian tube. These are successful
therapies for women who are unable to
conceive.
S23. Ans.(d)
The absence of menstruation is referred
to as lactational amenorrhea. This is
due to the fact that ovulation and hence
the cycle do not occur during
parturition’s intensive nursing period.
S24. Ans.(c)
To complete its development, the zygote
or early embryos (with up to 8
 blastomeres) could be transported into
the fallopian tube (ZIFT – Zygote
Intra Fallopian Transfer) and embryos
with more than 8 blastomeres into the
uterus (IUT – Intra Uterine Transfer).
S25. Ans.(d)
A tiny portion of the vas deferens is
removed or tied up through a small
incision in vasectomy, whereas a
small portion of the fallopian tube is
removed or tied up through a small
incision in the belly or by vaginal
surgery in tubectomy. Although these
procedures are quite effective, their
reversibility is weak.
S26. Ans.(c)
IUDs that release hormones
(Progestasert, LNG-20) make the uterus
unsuitable for implantation and the
cervix hostile to sperm.
S27. Ans.(d)
Surgical intervention prevents
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
conception by blocking gamete transit.
The male sterilization treatment is
known as a ‘vasectomy,’ whereas
the female sterilisation procedure is
known as a ‘tubectomy.’
S28. Ans.(d)
Amniocentesis is a test for determining
the gender of a growing embryo based
on the chromosomal pattern in the
amniotic fluid around the embryo.
It can not be utilised to find out if
someone has a cleft palate ( facial and
oral malformations).
S29. Ans.(a)
Ectopic pregnancy occurs when a
fertilised egg is implanted somewhere
other than the uterus.
563 CHANNEL
JOIN TELEGRAM
S30. Ans.(b)
Sexually transmitted diseases are
diseases or infections that are
transferred through sexual contact. e.g.,
gonorrhoea, syphilis, genital herpes,
trichomoniasis, AIDS and chlamydiasis.
S31. Ans.(a)
GIFT - Gamete intrafallopian transfer
S32. Ans.(c)
Hysterectomy is the surgical removal of
all or part of the uterus.
S33. Ans.(b)
Tubectomy: To inhibit gamete transport,
a little portion of the fallopian tube is
removed or tied up through a small
incision in the belly.
S34. Ans.(c)
ZIFT and IUT are used in IVF. In ZIFT, a
zygote with up to 8 blastomeres is
transferred into the fallopian tube. IUT
entails the transfer of a zygote (an
embryo with more than eight
blastomeres) into the uterus.
S35. Ans.(a)
Amniocentesis is a chromosomal
pattern in the ammiotic fluid
surrounding the growing embryo that
is used to determine the sex of the
foetus. Jaundice is a disorder that is
caused by liver malfunction rather
than a chromosomal abnormality.
 Chapter 23
Sankalp Bharat
Principle of Inheritance & Variation

1. The production of gametes by parents, (b) T.H. Morgan

formation of zygote, the f1 and f2 plants can (c) Watson and Crick
be understood from a diagram called: (d) Sutton and Boveri
(2021) 7. The number of contrasting characters
(a) Punnett square studied by Mendel for his experiments was:
(b) Net square (2020 Covid Re-NEET)
(c) Bullet square (a) 4
(d) Punch square (b) 2
2. Identify the wrong statement with reference (c) 7
to the gene ‘I’ that controls ABO blood (d) 14
groups. (2020) 8. The best example for pleiotropy is:
(a) A person will have only two of the three (2020 Covid Re-NEET)
alleles. (a) Phenylketonuria
(b) When IA and IB are present together, (b) Colour Blindness
they express same type of sugar. (c) ABO Blood group
(c) Allele ‘i’ does not produce any sugar (d) Skin colour
(d) The gene (I) has three alleles. 9. What map unit (Centimorgan) is adopted in

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
3. Experimental verification of the the construction of genetic maps? (2019)
chromosomal theory of inheritance was (a) A unit of distance between two expressed
done by: (2020) genes representing 10% cross over.
(a) Sutton (b) A unit of distance between two expressed
(b) Boveri genes representing 100% cross over.
(c) Morgan (c) A unit of distance between genes on
(d) Mendel chromosomes, representing 1% cross
4. Select the correct match (2020) over.
Column - I Column - II (d) A unit of distance between genes on
Phenylketonuria - Autosomal chromosomes, representing 50% cross
(a) over.
dominant trait
10. What is the genetic disorder in which an
(b) Sickle cell - Autosomal individual has an overall masculine
anaemia recessive trait, development gynaecomastia, and is
chromosome- sterile? (2019)
11 (a) Turner’s syndrome
(b) Klinefelter’s syndrome
(c) Thalassemia - X linked
(c) Edward syndrome
(d) Haemophilia - Y linked (d) Down’s syndrome
11. The frequency of recombination between
5. How many true breeding pea plant varieties
gene pairs on the same chromosome as a
did Mendel select as pairs, which were
measure of the distance between genes was
similar except in one character with
explained by (2019)
contrasting traits? (2020)
(a) T.H. Morgan
(a) 2
(b) Gregor J. Mendel
(b) 14
(c) Alfred Sturtevant
(c) 8
(d) Sutton Boveri
(d) 4
12. In Antirrhinum (Snapdragon), a red flower
6. Chromosomal theory of inheritance was
was crossed with a white flower and in F1
proposed by: (2020 Covid Re-NEET)
generation pink flowers were obtained.
(a) Bateson and Punnet
When pink flowers were selfed, the F2
564 CHANNEL
JOIN TELEGRAM
 generation showed white, red and pink
flowers. Choose the incorrect statement
from the following : (2019)
(a) This experiment does not follow the
principle of dominance.
(b) Pink colour in F1 is due to incomplete
dominance.
1 19. A disease caused by an autosomal primary
(c) Ratio of F2 is due to incomplete
4 non- disjunction is
Dominanace.
(d) Law of segregation does not apply in this
experiment
13. Select the incorrect statement. (2019)
(a) Male fruit fly is heterogametic
(b) In male grasshoppers 50% of sperms
have no sex-chromosome
(c) In domesticated fowls, sex of progeny
depends on the type of sperm rather than
egg
(d) Human males have one of their sex-
Chromosome much shorter than the
other
14. Select the correct statement: (2018)
18. Among the following characters, which one
was not considered by Mendel in his
experiments on pea? (2017)
(a) Stem – Tall or Dwarf
(b) Trichomes – Glandular or non-glandular
(c) Seed – Green or Yellow
(d) Pod – Inflated or Constricted
(2017)
(a) Down’s syndrome
(b) Klinefelter’s syndrome
(c) Turner’s syndrome
(d) Sickle cell anemia
20. The genotypes of a Husband and Wife are
I A IB and I A i. Among the blood types of their
children, how many different genotypes and
phenotypes are possible? (2017)
(a) 3 genotypes ; 3 phenotypes
(b) 3 genotypes ; 4 phenotypes
(c) 4 genotypes ; 3 phenotypes
(d) 4 genotypes ; 4 phenotypes
21. Which one from those given below is the
period for Mendel’s hybridisation

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) Franklin Stahl coined the term “linkage”. experiments? (2017)
(b) Punnett square was developed by a (a) 1856 - 1863
British scientist. (b) 1840 - 1850
(c) Spliceosomes take part in translation. (c) 1857 - 1869
(d) Transduction was discovered by S. (d) 1870 – 1877
Altman. 22. Thalassemia and sickle cell anemia are
15. Which of the following pairs is wrongly caused due to a problem in globin molecule
matched? (2018) synthesis. Select the correct statement.
(a) Starch synthesis in pea : Multiple alleles (2017)
(b) ABO blood grouping : Co-dominance (a) Both are due to a qualitative defect in
(c) XO type sex determination : Grasshopper globin chain synthesis
(d) T.H. Morgan : Linkag (b) Both are due to a quantitative defect in
16. Which of the following characteristics globin chain synthesis
represent ‘Inheritance of blood groups’ in (c) Thalassemia is due to less synthesis of
humans? (2018) globin molecules
A. Dominance (d) Sickle cell anemia is due to a
B. Co-dominance quantitative problem of globin molecules
C. Multiple dominance 23. Select the wrong statement: (2017)
D. Incompete dominance (a) Chromosomal Theory of inheritance was
E. Polygenic inheritance proposed by Sutton
(a) B, C and E (b) Law of Dominance and Law of
(b) A, B and C independent Assortment were proposed
(c) B, D and E by Mendel
(d) A, C and E (c) Linkage and recombination were
17. A woman has an X-linked condition on one discovered by Sutton
of her X chromosomes. This chromosome (d) Three scientists independently
can be inherited by: (2018) rediscovered the Mendel’s laws in 1900
(a) Only daughters 24. The recessive genes located on X-
(b) Only sons chromosome in humans are always:
(c) Only grandchildren (2017, 2004)
(d) Both sons and daughters
565 CHANNEL
JOIN TELEGRAM
 (a) Sub-lethal
(b) Expressed in females
(c) Expressed in males
(d) Lethal
25. Which one of the following is not true for the
experiment of Mendel on pea? (2017)
(a) His experiments had small sampling size
(b) He choose characters of two contrasting
states
(c) He used true-breeding lines
(d) His observations were based on natural,
Open pollination
26. Select the correct option: (2017)
(a) Klinefelters’s syndrome is due to an extra
X chromosome and results in sterile male
(b) Phenylketonuria is X linked disease and
results in accumulation of phenylpyruvic
acid
(c) Down’s syndrome is due to triploidy and
results in mental retardation
(d) Turner’s syndrome is due to trisomy and
results in sterile female
27. If a colour-blind man marries a woman who
30. In a test cross involving F1 dihybrid flies,
more parental- type offspring were
produced than the recombinant-type
offspring. This indicates (2016 - I)
(a) The two genes are located on two
different chromosomes
(b) Chromosomes failed to separate during
meiosis
(c) The two genes are linked and present on
the same chromosome
(d) Both of the characters are controlled by
more than one gene
31. Pick out the correct statements: (2016 - I)
A. Haemophilia is a sex-linked recessive
disease.
B. Down’s syndrome is due to aneuploidy.
C. Phenylketonuria is an autosomal
recessive gene disorder.
D. Sickle cell anaemia is an X-linked
recessive gene disorder.
(a) A and D are correct
(b) B and D are correct
(c) A, C and D are correct

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
is homozygous for normal colour vision, the (d) A, B and C are correct
probability of their son being colour-blind 32. Match the terms in Column I with their
is: (2016 - II) description in Column II and choose the
(a) 0.75 correct option (2016 - I)
(b) 1
(c) 0 Dominance (i)
(d) 0.5 A. Many genes
28. A true breeding plant is: (2016 - II) govern a single
(a) Near homozygous and produces character
offspring of its own kind Co- (ii)
B. In a
(b) Always homozygous recessive in its dominance heterozygous
genetic constitution
organism only
(c) One that is able to breed on its own
one allele
(d) Produced due to cross-pollination among
expresses itself
Unrelated plants
29. A cell at telophase stage is observed by a C. Pleiotropy (iii) In a
student in a plant brought from the field. He heterozygous
tells his teacher that this cell is not like organism both
other cells at telophase stage. There is no
alleles express
formation of cell plate and thus the cell is
themselves fully
containing more number of chromosomes
as compared to other dividing cells. This D. Polygenic (iv) A single gene
would result in: (2016 - I) inheritance influences many
(a) Aneuploidy characters
(b) Polyploidy
(c) Somaclonal variation (a) A–(ii), B–(i), C–(iv), D–(iii)
(d) Polyteny (b) A–(ii), B–(iii), C–(iv), D–(i)
(c) A–(iv), B–(i), C–(ii), D–(iii)
(d) A–(iv), B–(iii), C–(i), D–(ii)

566 CHANNEL
JOIN TELEGRAM
33. A tall true breeding garden pea plant is (c) Formation of abnormal sperms in the
crossed with a dwarf true breeding garden father
pea plant. When the F1 plants were selfed (d) Formation of abnormal ova in the mother
the resulting genotypes were in the ratio of: 41. In the following human pedigree, the filled
(2016 - I) symbols represent the affected individuals.
(a) 1 : 2 : 1 : Tall homozygous : Tall Identify the type of given pedigree.
heterozygous : Dwarf (2015)
(b) 1 : 2 : 1 : Tall heterozygous : Tall
homozygous : Dwarf
(c) 3 : 1 : Tall : Dwarf
(d) 3 : 1 : Dwarf : Tall
34. Which of the following most appropriately
describes haemophilia? (2016 - I)
(a) Recessive gene disorder
(b) X-linked recessive gene disorder
(a) X-linked recessive
(c) Chromosomal disorder
(b) Autosomal recessive
(d) Dominant gene disorder
(c) X-linked dominant
35. How many pairs of contrasting characters
(d) Autosomal dominant
in pea plants were studied by Mendel in his
42. A colour blind man marries a woman with
experiments? (2016 - I)
normal sight who has no history of colour
(a) Eight
blindness in her family. What is the
(b) Seven
probability of their grandson being colour
(c) Five

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
blind? (2015 Re)
(d) Six
(a) 1
36. A man with blood group ‘A’ marries a
(b) Nil
woman with blood group ‘B’. What are all
(c) 0.25
the possible blood groups of their
(d) 0.5
offspring’s? (2016 - I)
43. The term “linkage” was coined by:
(a) A, B, AB and O
(2015 Re)
(b) O only
(a) T. Boveri
(c) A and B only
(b) G. Mendel
(d) A, B and AB only
(c) W. Sutton
37. Multiple alleles are present: (2015)
(d) T.H. Morgan
(a) At the same locus of the chromosome
44. A gene showing co-dominance has:
(b) On non-sister chromatids
(2015 Re)
(c) On different chromosomes
(a) Alleles tightly linked on the same
(d) At different loci on the same
chromosome
Chromosome
(b) Alleles that is recessive to each other
38. The movement of a gene from one linkage
(c) Both alleles independently expressed in
group to another is called: (2015)
the heterozygote
(a) Translocation
(d) One allele dominant on the other
(b) Crossing over
45. A pleiotropic gene: (2015 Re)
(c) Inversion
(a) Is a gene evolved during Pliocene
(d) Duplication
(b) Controls a trait only in combination with
39. Alleles are: (2015)
another gene
(a) Different molecular forms of a gene
(c) Controls multiple traits in an individual
(b) Heterozygote’s
(d) Is expressed only in primitive plants
(c) Different phenotype
46. In his classic experiments on pea plants,
(d) True breeding homozygote’s
Mendel did not use: (2015 Re)
40. An abnormal human baby with ‘XXX’ sex
(a) Pod length
chromosomes was born due to: (2015)
(b) Seed shape
(a) Fusion of two ova and one sperm
(c) Flower position
(b) Fusion of two sperms and one ovum
(d) Seed colour
567 CHANNEL
JOIN TELEGRAM
47. Fruit colour in squash is an example of: 52. Which Mendelian idea is depicted by a cross
(2014) in which the F1 generation resembles both
(a) Inhibitory genes the parents? (2013)
(b) Recessive epistasis (a) Co-dominance
(c) Dominant epistasis (b) Incomplete dominance
(d) Complementary genes (c) Law of dominance
48. A human female with Turner’s syndrome: (d) Inheritance of one gene
(2014) 53. Which of the following statements is not
(a) Is able to produce children with normal true for two genes that show 50%
husband recombination frequency? (2013)
(b) Has 45 chromosomes with XO (a) If the genes are present on the same
(c) Has one additional X chromosome chromosome, they undergo more than
(d) Exhibits male characters one crossover in every meiosis
49. A man whose father was colour blind (b) The genes may be on different
marries a woman who had a colour blind chromosomes
mother and normal father. What (c) The genes are tightly linked
percentage of male children of this couple (d) The genes show independent assortment
will be colour blind? 54. If both parents are carriers for
(a) 75% Thalassaemia, which is an autosomal
(b) 25% recessive disorder, what are the chances of
(c) 0% pregnancy resulting in an affected child?
(d) 50% (2013)
50. The incorrect statement with regard to (a) 100%

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Haemophilia is: (2013) (b) No chance
(a) A single protein involved in the clotting (c) 50%
of blood is affected (d) 25%
(b) It is a sex-linked disease
(c) It is a recessive disease
(d) It is a dominant disease
51. If two persons with ‘AB’ blood group marry
and have sufficiently large number of
children, these children could be classified
as ‘A’ blood group : ‘AB’ blood group : ‘B’
blood group in 1 : 2 : 1 ratio. Modern
technique of protein electrophoresis reveals
presence of both ‘A’ and ‘B’ type proteins in
‘AB’ blood group individuals. This is an
example of: (2013)
(a) Complete dominance
(b) Co-dominance
(c) Incomplete dominance
(d) Partial dominance

568 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (a) S28. Ans. (a)

S2. Ans. (b) S29. Ans. (b)

S3. Ans. (c) S30. Ans. (c)

S4. Ans. (d) S31. Ans. (d)

S5. Ans. (b) S32. Ans. (b)

S6. Ans. (d) S33. Ans. (a)

S7. Ans. (c) S34. Ans. (b)

S8. Ans. (a) S35. Ans. (b)

S9. Ans. (c) S36. Ans. (a)

S10. Ans. (b) S37. Ans. (a)

S11. Ans. (c) S38. Ans. (a)

S12. Ans. (d) S39. Ans. (a)

S13. Ans. (c) S40. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (b) S41. Ans. (b)

S15. Ans. (a) S42. Ans. (d)

S16. Ans. (b) S43. Ans. (d)

S17. Ans. (d) S44. Ans. (c)

S18. Ans. (b) S45. Ans. (c)

S19. Ans. (a) S46. Ans. (a)

S20. Ans. (c) S47. Ans. (c)

S21. Ans. (a) S48. Ans. (b)

S22. Ans. (c) S49. Ans. (d)

S23. Ans. (c) S50. Ans. (d)

S24. Ans. (c) S51. Ans. (b)

S25. Ans. (a) S52. Ans. (a)

S26. Ans. (a) S53. Ans. (c)

S27. Ans. (c) S54. Ans. (d)

569 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(a)
Punnett square
S2. Ans.(b)
The gene (I) has three alleles in human
blood grouping: I, I A , and I B .
Only two of the three alleles would be
present in an individual.
On the surface of RBCs, Allele I does not
create any sugar/antigen. It's a
recessive trait. Sugar/antigen A antigen
is produced on the surface of RBCs by
allele I A . It has a stronghold in nature.
Sugar/antigen B antigen is produced on
the surface of RBCs by allele I B . It has a
stronghold in nature. Both Allele I A and
Allele IB produce both A and B antigens
on the surface of RBCs. Both of them
exhibit codominance. Because they
express two different sugars/antigens
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
on the surface of the RBCs, the
statement "When I A and I B . are present
together, they express the same
type of sugar" is incorrect.
S3. Ans.(c)
Thomas Hunt Morgan and his
colleagues performed experimental
verification of the chromosomal
theory of heredity. Morgan's research
with the microscopic fruit flies
Drosophila melanogaster led
to the discovery of the genetic
foundation for sexual reproduction's
variety. Laws of inheritance were given
by Mendel. Sutton and Boveri proposed
the chromosomal theory of inheritance.
S4. Ans.(b)
Phenylketonuria, thalassemia and sickle
cell anaemia are autosomal recessive
disorder. Haemophilia is X-linked
recessive disorder.
S5. Ans.(b)
Mendel selected 14 true breeding plant
varieties.
S6. Ans.(d)
The chromosomal theory of inheritance
was proposed by Sutton and Boveri in
570 CHANNEL
JOIN TELEGRAM
1903. Sutton and Boveri argued that
the pairing and separation of a pair of
chromosomes would lead to the
segregation of a pair of factors they
carried. Sutton united the knowledge of
chromosomal segregation with
Mendelian principles and called it the
chromosomal theory of inheritance.
S7. Ans.(c)
7 contrasting characters were studied
by Mendel for his experiments. Some of
the contrasting traits selected were
smooth or wrinkled seeds, yellow or
green seeds, inflated (full) or constricted
green or yellow pods and tall or dwarf
plants.
S8. Ans.(a)
When a single gene can exhibit multiple
phenotypic expression. Such a gene is
called a pleiotropic gene. The disease
phenylketonuria, which affects humans,
is an example of this. A mutation in the
gene that codes for the enzyme phenyl
alanine hydroxylase causes the
condition (single gene mutation).
S9. Ans.(c)
1 map unit is equivalent to 1% cross
over. Map unit is used to measure
genetic distance. This genetic distance
is based on average number of cross
over frequency.
S10. Ans.(b)
Individuals with Klinefelter’s syndrome
have an additional copy of X-
chromosome resulting into a karyotype
of 44 + XXY (47). They show overall
masculine development, gynaecomastia
and are sterile.
S11. Ans.(c)
The probability of recombination
between gene pairs on the same
chromosome was employed by
Alfred Sturtevant to calculate the
distance between genes.
S12. Ans.(d)
Genes for flower colour in snapdragon
shows incomplete dominance which is
 an exception of Mendel’s first principle, S19.
i.e., law of dominance. Here, the F1 had
a phenotype that did not resemble
either of the two parents and was in
between the two. Law of segregation is
universally applicable.
S13. Ans.(c)
In bird females, heterogamety is found,
i.e., a female bird has two sex
chromosomes, Z and W and can
produce two different types of gametes.
Thus sex of progeny depends on the
types of egg rather than the type of
sperm.
S14. Ans.(b)
Reignald C. Punnett, English geneticist,
devised the Punnett square in early
1900s.
S20.
S15. Ans.(a)
Starch synthesis in pea plants is
controlled by a single gene, which has
Ans.(a)
Down’s syndrome (Mongolism): It is the
presence of an additional copy of
chromosome number 21 (trisomy of 21).
Genetic constitution: 45 A + XX or
45 A + XY (i.e., 47 chromosomes).
Features:
• They are short statured with small
round head.
• Broad flat face.
• Furrowed big tongue and partially
open mouth.
• Many “loops” on finger tips.
• Palm is broad with characteristic palm
crease.
• Retarded physical, psychomotor and
Mental development.
• Congenital heart disease.
Ans.(c)
Husband × Wife I A IB I A i

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
two alleles- one dominant and other
recessive.
S16. Ans.(b)
Blood group represent – dominance, co-
dominance and multiple alleles. Three Number of genotypes = 4 Number of
alleles (I A , I B , I O ) determine one phenotypes
characteristic, i.e., blood group I A = 3 I A IA and I A i = A
and I B are dominant I A I B = AB I B i = B
S17. Ans.(d) S21. Ans.(a)
Women has only X-chromosome with Mendel experimented on pea plants for
her which she can pass to any child-boy seven years, from 1856 to 1863, and his
or girl. In contrast, a man can pass X- findings were published
chromosome to only his daughter and in 1865. Thalassemia differs from
Y-chromosome to only his son. sickle-cell anaemia in that the former is
S18. Ans.(a) a quantitative problem involving
insufficient globin molecules, whereas
Characters Dominant Recessive
the latter is a qualitative one involving
1. Stem height Tall Dwarf an incorrectly functioning globin.
2. Flower colour Violet White S22. Ans.(c)
3. Flower Axial Terminal Thalassemia and sickle cell anemia are
position genetic disorders in which hemoglobin
4. Pod shape Inflated Constricted synthesis is affected. In thalassemia,
there is a defect in the α or β globin
5. Pod colour Green Yellow
chain. This leads to the synthesis of
6. Seed shape Round Wrinkled abnormal red blood cells due to the
7. Seed colour Yellow Green decreased synthesis of globin

571 CHANNEL
JOIN TELEGRAM
 molecules. Whereas in sickle-cell
anemia there is a mutation in β globin
gene resulting in sickling of red
blood cells.
S23. Ans.(c)
Linkage was discovered by T.H. Morgan
S24. Ans.(c)
Females have a pair of X-chromosomes,
whereas males have one X and one Y
chromosome. Because of the presence of
only one X chromosome, the recessive
genes on X chromosome in males are
always expressed.
S25. Ans.(a)
His experiments had a large sampling
size, which gave greater credibility to
the data he collected.
S26. Ans.(d)
Turner’s syndrome is caused due to the
absence of one of the X chromosomes,
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
i.e., 45 with XO.
S27. Ans.(c)
Because it is an X-linked recessive trait
acquired by criss-cross inheritance, a
color-blind man (X c Y)
and a normal woman (XX) cannot bear a
color-blind kid. To bear a color-blind
son, the other must be a carrier (X c X) or
affected (X c X c) such that the affected X
chromosome is passed down to the son.
S28. Ans.(a)
A true breeding line is one that have
undergone continuous self-pollination,
shows the stable trait inheritance and
expression for several generations.
S29. Ans.(b)
Failure of cytokinesis after telophase
stage of cell division results in an
increase in a whole set of chromosomes
in an organism and this phenomenon
572 CHANNEL
JOIN TELEGRAM
is known as polyploidy. This condition is
often seen in plants.
S30. Ans.(c)
T.H. Morgan attributed the physical
association or linkage of the two genes
and coined the term linkage.
S31. Ans.(d)
Sickle cell anemia is an autosome linked
recessive trait that can be transmitted
from parents to the offspring when both
the partners are carrier for the gene (or
heterozygous).
Principles of Inheritance and Variation
S32. Ans.(b)
1. Dominance ii. In a heterozygous
organism only one allele expresses itself
2. Co-dominance iii. It is an inheritance
in which heterozygous offspring show
intermediate character between two
parental characteristics.
3. Pleiotropy iv. A single gene produces
more than one effect. E.g., starch
synthesis in pea seeds, sickle cell
anaemia, etc.
4. Polygenic inheritance i. Many genes
effects one phenotype
S33. Ans.(a)
A phenotypic ratio of 3/4th tall : (1/4 TT
+ 1/2 Tt) and 1/4th tt, i.e., 3:1 ratio,
but a genotypic ratio of 1:2:1.
S34. Ans.(b)
Hemophilia is X-linked sex linked
recessive disease, which shows its
transmission from unaffected
carrier female to some of the male
progeny; has been widely studied. The
family pedigree of Queen Victoria shows
a number of hemophiliac descendent’s
as she was a carrier of the disease.
S35. Ans.(b)
Mendel conducted hybridisation
experiments on garden pea. Mendel
investigated seven pair of contrasting
characters. These were Seed shape,
Seed colour, Flower colour, Pod Shape,
Pod colour, Flower position and Stem
height.
S36. Ans.(a)

Man I A i, woman I B i

S37. Ans.(a)
Multiple alleles: More than two alternate
forms of a gene present on the same
locus are called multiple alleles. There is
absence of crossing over in multiple
alleles.

S38. Ans.(a) Out of four grandson (XCY, XY, XY,

XXY), only
When a portion of chromosomes breaks one is colorblind.
and attached to another is known as
translocation. Probability 1⁄4 = 0.25

S39. Ans.(a) S43. Ans.(d)

Term allele was given by W. Bateson. Chromosomal theory of linkage was put
forward by T.H.Morgan

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Alleles are different molecular forms of a
gene.
S40. Ans.(d)
Abnormal ova is formed in mother’s
ovary due to non- disjunction of X-
chromosome in the mother.
S41. Ans.(b)
Autosomal recessive trait can be
transmitted from parents to the
offspring when both the partners are
carriers for the gene (or heterozygous).
In generation I, the female is a carrier of
the disease and male is affected by the
disease. In generation II, the female
receives the affected genes from both
mother and father. When II-1 marries a
normal male, none of the offsprings are
affected by the disease. However, the
female of generation III is a carrier of the
disease as she received the defective
gene from the mother. As III-6 and III-7
are not affected by the disorder, the
given pedigree is of X-linked recessive
disorder.
S42. Ans.(c)
Colorblind man crosses with normal
woman:
573 CHANNEL
JOIN TELEGRAM
S44. Ans.(c)
The alleles which do not show
dominance-recessive relationship and
are able to express themselves
independently and equally when present
together.
S45. Ans.(c)
When a gene affects many aspects of
phenotype or controls several
phenotypes, it is said to be pleiotropic
genes.
S46. Ans.(a)
Mendel conducted hybridisation
experiments on garden pea. Mendel
investigated seven characters
that were manifested as two opposite
traits. E.g., seed shape, seed colour,
flower colour, pod shape, flower position
and stem height.
S47. Ans.(c)
Fruit colour in squash is an example of
dominant epistasis.
S48. Ans.(b)
Turner syndrome (45 chromosome) (44
+ XO). It has 44 autosomes and 1 sex
chromosome.
S49. Ans.(d)
Because it is present on the X-
chromosome, colour blindness is an
autosomal recessive genetic disease.
According to the first figure, a guy
whose father was colorblind (will be, i.e.
XY normal) marries a woman whose
mother was colorblind and father was
normal (i.e. this woman will be a carrier)
according to the situation stated in the
question.
Thus, when a normal guy marries a
carrier woman, the probability of a male
offspring being colorblind is 25%.
S50. Ans.(d)
Haemophilla is an X - linked recessive
disorder.
S51. Ans.(b)
Neither phenotype is totally dominant in
homologous chromosome contains two
alleles that may create proteins, both
will be produced, resulting in a
phenotype or set of features that is
distinct from that of a homozygote.
S52. Ans.(a)
In case of co-dominance, F1 generation
resembles both parents. e.g., ABO blood
grouping in humans.
S53. Ans.(c)
Tightly linked genes show 100%
parental types and 0% recombinants.
S54. Ans.(d)
Autosomal recessive disorder -
Thalassemia. AA: Normal; Aa: Carrier;
aa: affected

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
codominance. The heterozygous
individual, on the other hand, manifests
both characteristics. The ABO
blood group system is a good example.
A, B, and I are the three alleles that
make up the blood type gene. I causes O
type and is recessive to both A and
B. The A and B alleles share a common
ancestor.
Type AB blood is formed when a person
has both A and B blood types. It makes
no difference whether the alleles in the
homologous chromosomes are dominant
or recessive in codominance. If a

574 CHANNEL
JOIN TELEGRAM
 Chapter 24
Sankalp Bharat
Molecular Basis of Inheritance

1. Upon exposure to UV radiation, DNA (b) 5' ATCGATCGATCGATCGATCGATCGAT

stained with ethidium bromide will show CG 3'
(2022) (c) 3' ATCGATCGATCGATCGATCGATCGA
(a) Bright blue colour TCG 5’
(b) Bright yellow colour (d) 5’ UAGCUAGCUAGCUAGCUAGCUAGC
(c) Bright orange colour UAGC 3'
(d) Bright red colour 5. Expressed Sequence Tags (ESTs) refers to
2. Match List-l with List-II: (2023)
List – I List – II (a) Certain important expressed genes.
Gene ‘a’ (i) Galactosidase (b) All genes that are expressed as RNA.
A (c) All genes that are expressed as proteins.
B Gene ‘y’ (ii) Transacetylase (d) All genes whether expressed or
C Gene ‘Y’ (iii) Permease unexpressed.
6. Unequivocal proof that DNA is the genetic
D Gene ‘Z’ (iv) Repressor
material was first proposed by (2023)
protein
(a) Wilkins and Franklin
Choose the correct answer from the (b) Frederick Griffith
options given below: (2023) (c) Alfred Hershey and Martha Chase

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) A-II, B-III, C-IV, D-I (d) Avery, Macleoid and McCarthy
(b) A-III, B-IV, C-1, D-II 7. What is the role of RNA polymerase III in the
(c) A-III, B-1, C-IV, D-II process of transcription in Eukaryotes?
(d) A-II, B-1, C-IV, D-III (2023)
3. Statement I: In prokaryotes, the positively (a) Transcription of only snRNAs
charged DNA is held with some negatively (b) Transcription of rRNAs (28S, 18S and
charged proteins in a region called nucleoid. 5.8S)
Statement II: In eukaryotes, the negatively (c) Transcription of tRNA, 5S rRNA and
charged DNA is wrapped around the snRNA
positively charged histone octamer to form (d) Transcription of precursor of mRNA
nucleosome. 8. The last chromosome sequenced in Human
In the light of the above statements, choose Genome Project was (2023)
the correct answer from the options given (a) Chromosome 6
below: (2023) (b) Chromosome 1
(a) Both Statement I and Statement il are (c) Chromosome 22
false. (d) Chromosome 14
(b) Statement I is correct but Statement Il 9. Name the component that binds to the
is false. operator region of an operon and prevents
(c) Statement I is incorrect but Statement II RNA polymerase from transcribing the
is true. operon. (2023)
(d) Both Statement I and Statement II are (a) Promotor
true. (b) Regulator protein
4. Which one of the following is the sequence (c) Repressor protein
on corresponding coding strand, if the (d) Inducer
sequence on mRNA formed is as follows 10. Statement I: The process of copying genetic
5'AUCGAUCGAUCGAUCGAUCGAUCG information from one strand of the DNA into
AUCG 3'? (2023) RNA is termed as transcription.
(a) 3’ UAGCUAGCUAGCUAGCUAGCUAGC Statement II: A transcription unit in DNA is
UAGC 5’ defined primarily by the three regions in the

575 CHANNEL
JOIN TELEGRAM
 DNA i.e., a promotor, the structural gene Choose the most appropriate answer from
and a terminator. the options given below: (2023)
In the light of the above statements, choose (a) (D) and (E) only
the correct answer from the options given (b) (A) and (B) only
below: (2023) (c) (A) and (C) only
(a) Statement I is true but Statement II is (d) (B) and (D) only
false 14. In lac operon, z gene codes for (2022)
(b) Statement I is false but Statement II is (a) Transacetylase
true (b) B-galactosidase
(c) Both Statement I and Statement II are (c) Permease
true (d) Repressor
(d) Both Statement I and Statement II are 15. Statement I: DNA polymerases catalyse
false polymerisation only in one direction, that is
11. Statement I: RNA being unstable, mutate at 5'→ 3'.
a faster rate. Statement II: During replication of DNA, on
Statement II: RNA can directly code for one strand the replication is continuous
synthesis of proteins hence can easily while on other strand it is discontinuous.
express the characters. In the light of the above statements, choose
In the light of the above statements, choose the correct answer from the options given
the correct answer from the options given below: (2022)
below: (2023) (a) Statement I is incorrect but Statement II
(a) Statement I is correct but Statement II is correct
is false (b) Both Statement I and Statement II are

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Statement I is incorrect but Statement II correct
is true (c) Both Statement I and Statement II are
(c) Both Statement I and Statement II are incorrect
true (d) Statement I is correct but Statement II
(d) Both Statement I and Statement II are is incorrect
false 16. Match List-l with List-II:
12. Which one of the following acts as an List – I List – II
inducer for lac operon? (2023) In lac operon i (i) transacetylase
(a) Sucrose A
gene codes for
(b) Lactose In lac operon z (ii) permease
(c) Glucose B
gene codes for
(d) Galactose
C In lac operon y (iii) B-
13. With reference to Hershey and Chase
gene codes for galactosidase
experiments. Select the correct statements.
(A) Viruses grown in the presence of D In lac operon a (iv) Repressor
gene code for
radioactive phosphorus contained
radioactive DNA. Choose the correct answer from the options
given below (2022)
(B) Viruses grown on radioactive sulphur (a) (a) (i), (b)(i), (c)-(iv), (d)-(ii)
contained radioactive proteins. (b) (a)(iii), (b)-(ii), (c)- (i), (d) - (iv)
(C) Viruses grown on radioactive (c) (a)(iv), (b)(iii), (c)-(ii), (d)-(i)
phosphorus contained radioactive (d) (a)(iv), (b)(i), (c)-(iii), (d)-(ii)
protein. 17. Against the codon 5' UAC 3', what would be
the sequence of anticodon on tRNA?
(D) Viruses grown on radioactive sulphur (2022)
contained radioactive DNA. (a) 5 GUA 3
(b) 5 AUG 3
(E) Viruses grown on radioactive protein
(c) 5' ATG 3
contained radioactive DNA.
(d) 5 GTA 3

576 CHANNEL
JOIN TELEGRAM
18. If A and C make 30% and 20% of DNA,
respectively, what will be the percentage
composition of T and G? (2022)
(a) T: 20%, G: 20%
(b) T: 20%, G: 30%
(c) T: 30%, G: 20%
(d) T: 30%, G: 30%
19. The process of translation of mRNA to
proteins begins as soon as: (2022)
(a) The small subunit of ribosome
encounters mRNA
(b) The larger subunit of ribosome
encounters mRNA
(c) Both the subunits join together to bind
with mRNA
(d) The tRNA is activated and the larger
subunit of ribosome encounters mRNA
20. DNA polymorphism forms the basis of:
(2022)
(a) Genetic mapping
(b) DNA finger printing
(c) Both genetic mapping and DNA finger
printing
(C)-Transcription;(D)- Transduction
(b) (A)-Replication;(B)-Transcription;
(C)-Translation; (D)-Protein
(c) (A)-Transduction;(B)-Translation;
(C)-Replication; (D)-Protein
(d) (A)-Replication;(B)-Transcription
(C)-Transduction;(D)-Protein
24. What is the role of RNA ploymerase III in the
process of transcription in eukaryotes?
(2021)
(a) Transcribes tRNA, 5s rRNA and sn RNA
(b) Transcribes precursor of mRNA
(c) Transcribes only snRNAs
(d) Transcribes rRNAs (28S, 18S and 5.8S)
25. DNA fingerprinting involves identifying
differences in some specific regions in DNA
sequence, called as: (2021)
(a) Repetitive DNA
(b) Single nucleotides
(c) Polymorphic DNA
(d) Satellite DNA
26. Identify the correct statement. (2021)
(a) RNA polymerase binds with Rho factor to

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) Translation terminate the process of transcription in
21. Read the following statements and choose bacteria.
the set of correct statements: (b) The coding strand in transcription unit
(a) Euchromatin is loosely packed is copied to an mRNA.
chromatin (c) Split gene arrangement is characteristic
(b) Heterochromatin is transcriptionally of prokaryotes.
active (d) In capping, methyl guanosine
(c) Histone octamer is wrapped by triphosphate is added to the 3′ end of
negatively charged DNA in nucleosome hnRNA.
(d) Histones are rich in lysine and arginine 27. If Adenine makes 30% of the DNA molecule,
(e) A typical nucleosome contains 400 bp what will be the percentage of Thymine,
of DNA helix Guanine and Cytosine in it? (2021)
(a) T : 20; G : 20; C : 30
Choose the correct answer from the options
(b) T : 30; G : 20; C : 20
given below : (2022)
(c) T : 20; G : 25; C : 25
(a) (b), (d), (e) only
(d) T : 20; G : 30; C : 20
(b) (a), (c), (d) only
28. Which is the “Only enzyme” that has
(c) (b), (e) only
“Capability” to catalyse Initiation,
(d) (a), (c), (e) only
Elongation and Termination in the process
22. Transposons can be used during which one
of transcription in prokaryotes? (2021)
of the following? (2022)
(a) DNA dependent RNA polymerase
(a) Polymerase Chain Reaction
(b) DNA Ligase
(b) Gene Silencing
(c) DNase
(c) Autoradiography
(d) DNA dependent DNA polymerase
(d) Gene sequencing
29. Which of the followingh RNAs is not
23. Complete the flow chart on central dogma.
required for the synthesis of protein?
(2021)
(2021)
(a) tRNA
(b) rRNA
(a) (A)-Translation;(B)-Replication; (c) siRNA

577 CHANNEL
JOIN TELEGRAM
 (d) mRNA (c) 2.7 meters
30. Statement I: The codon ‘AUG’ codes for (d) 2.0 meters
methionine and phenylalanine. (2021) 36. Choose the correct pair from the following:
Statement II: ‘AAA’ and ‘AAG’ both codons (2020)
code for the amino acid lysine.
(a) Polymerases - Break the DNA
In the light of the above statements, choose
into
the correct answer from the options given
below. fragments
(a) Both statement I and statement II are (b) Nucleases - Separate the two
false strands of DNA
(b) Statement I is correct but statement II is
false (c) Exonucle- - Make cuts at
(c) Statement I is incorrect but statement II ases specific
is true positions within
(d) Both statement I and statement II are DNA
True
(d) Ligases - Join the two DNA
31. Which one of the following statement about
molecules
histones is wrong? (2021)
(a) The pH of histones is slightly acidic. 37. The term ‘Nuclein’ for the genetic material
(b) Histones are rich in amino acids - Lysine was used by: (2020 Covid Re-NEET)
and Arginine. (a) Meischer
(c) Histones carry positive charge in the side (b) Chargaff
chain. (c) Mendel

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) Histones are organized to form a unit of
8 molecules.
32. Name the enzyme that facilitates opening of
DNA helix during transcription. (2020)
(a) DNA helicase
(b) DNA polymerase
(c) RNA polymerase
(d) DNA ligase
33. Which of the following statements is
correct? (2020)
(a) Adenine pairs with thymine through one
H-bond
(b) Adenine pairs with thymine through
three H-bonds.
(c) Adenine does not pair with thymine.
(d) Adenine pairs with thymine through two
H-bonds.
34. The first phase of translation is: (2020)
(a) Recognition of DNA molecule
(b) Aminoacylation of tRNA
(c) Recognition of an anti-codon
(d) Binding of mRNA to ribosome
35. If the distance between two consecutive
base pairs is 0.34 nm and the total number
of base pairs of a DNA double helix in a
typical mammalian cell is 6.6 × 109
bp, then the length of the DNA is
approximately: (2020)
(a) 2.5 meters
(b) 2.2 meters
(d) Franklin
38. In the polynucleotide chain of DNA, a
nitrogenous base is linked to the –OH of:
(2020 Covid Re-NEET)
(a) 3′C pentose sugar
(b) 5′C pentose sugar
(c) 1′C pentose sugar
(d) 2′C pentose sugar
39. Which is the basis of genetic mapping of
human genome as well as DNA finger
printing? (2020 Covid Re-NEET)
(a) Single nucleotide polymorphism
(b) Polymorphism in hnRNA sequence
(c) Polymorphism in RNA sequence
(d) Polymorphism in DNA sequence
40. E. Coli has only 4.6 × 106 base pairs and
completes the process of replication within
18 minutes; then the average rate of
polymerisation is approximately-
(2020 Covid Re-NEET)
(a) 3000 base pairs/second
(b) 4000 base pairs/second
(c) 1000 base pairs/second
(d) 2000 base pairs/second
41. Purines found both in DNA and RNA are
(2019)
(a) Adenine and thymine
(b) Adenine and guanine
(c) Guanine and cytosine
(d) Cytosine and thymine

578 CHANNEL
JOIN TELEGRAM
 Lac operon
42. Under which of the following conditions will 48. AGGTATCGCAT is a sequence from the
there be no change in the reading frame of coding strand of a gene. What will be the
following mRNA? (2019) corresponding sequence of the transcribed
5′AACAGCGGUGCUAUU3′ mRNA? (2018)
(a) Insertion of G at 5th position (a) AGGUAUCGCAU
(b) Deletion of G from 5th position (b) UGGTUTCGCAT
(c) Insertion of A and G at 4th and 5th (c) ACCUAUGCGAU
Positions respectively (d) UCCAUAGCGUA
(d) Deletion of GGU from 7th, 8th and 9th 49. All of the following are part of an operon
Positions except: (2018)
43. Expressed Sequence Tags (ESTs) refers to : (a) An operator
(2019) (b) Structural genes
(a) Genes expressed as RNA (c) An enhancer
(b) Polypeptide expression (d) A promoter
(c) DNA polymorphism 50. Select the correct match (2018)
(d) Novel DNA sequences (a) Ribozyme - Nucleic acid
44. Which of the following features of genetic
code does allow bacteria to produce human (b) F2 × - Dihybrid cross

insulin by recombinant DNA technology? Recessive

(2019) parent
(a) Genetic code is not ambiguous (c) T.H. - Transduction
(b) Genetic code is redundant Morgan

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) Genetic code is nearly universal (d) G. Mendel - Transformation
(d) Genetic code is specific
45. Match the following genes of the Lac operon 51. The association of histone H1 with a
with their respective products : (2019) nucleosome indicates:
(2017)
A i gene (i) β-
(a) Transcription is occurring
galactosidase
(b) DNA replication is occurring
B z gene (ii) Permease (c) The DNA is condensed into a chromatin
C a gene (iii) Repressor fibre
y gene (iv) Transacetylase (d) The DNA double helix is exposed
D 52. The final proof for DNA as the genetic
Select the correct option. material came from the experiments of
A B C D (2017)
(a) (i) (iii) (ii) (iv) (a) Griffith
(b) (iii) (i) (ii) (iv) (b) Hershey and Chase
(c) (iii) (i) (iv) (ii) (c) Avery, Mcleod and McCarty
(d) (iii) (iv) (i) (ii) (d) Hargobind Khorana
46. The experimental proof for 53. During DNA replication, Okazaki fragments
semiconservative replication of DNA was are used to elongate (2017)
first shown in a: (2018) (a) The leading strand towards replication
(a) Fungus fork
(b) Bacterium (b) The lagging strand towards replication
(c) Plant fork
(d) Virus (c) The leading strand away from replication
47. Select the correct match: (2018) fork
(a) Alec Jeffreys – Streptococcus (d) The lagging strand away from the
pneumoniae replication fork
(b) Alfred Hershey and Martha Chase – TMV 54. Spliceosomes are not found in cells of:
(c) Matthew Meselson and F. Stahl – Pisum (2017)
sativum (a) Plants
(d) Francois Jacob and Jacques Monod – (b) Fungi
579 CHANNEL
JOIN TELEGRAM
 (c) Animals (b) Generate unique fingerprints for each
(d) Bacteria finger
55. DNA fragments are: (2017) (c) Compare the whole DNA sequence of two
(a) Positively charged individuals
(b) Negatively charged (d) Differentiate between polymorphic DNA
(c) Neutral sequences among individuals
(d) Either positively or negatively charged 61. Which of the following enzymes is not
depending on their size protein? (2017)
56. If there are 999 bases in an RNA that codes (a) Ribozyme
for a protein with 333 amino acids, and the (b) Polymerase
base at position 901 is deleted such that the (c) Ligase
length of the RNA becomes 998 bases, how (d) Lysozyme
many codons will be altered? (2017) 62. Consider the following statements and
(a) 1 choose the correct option: (2017)
(b) 11 A. Six codons do not code for any amino–
(c) 33 acid
(d) 333 B. Codon is read in mRNA in a contiguous
57. Which of the following RNAs should be most fashion
abundant in animal cell? (2017) C. Three codons function as stop codons
(a) r-RNA D. The initiator codon AUG codes for
(b) t-RNA methionine
(c) m-RNA Option:
(d) mi-RNA (a) A is wrong

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
58. Select the wrong statement: (2017) (b) A, B and D are wrong
(a) DNA stores genetic information (c) A, B and C are wrong
(b) There is now enough evidence that (d) B, C and D are wrong
essential processes like metabolism, 63. If the ratio (A + G)/(T + C) in one strand of
translation and splicing evolved around DNA is 0.7, what is the same ratio in the
RNA complementary strand? (2017)
(c) DNA may act as a catalyst (a) 2.10
(d) RNA can splice itself and is also able to (b) 0.35
act as a catalyst (c) 0.70
59. A couple claimed in court that a child (d) 1.43
belonged to them. Their claim can be true if 64. DNA-dependent RNA polymerase catalyses
the DNA fingerprint pattern of the child transcription on one strand of the DNA
shows: (2017) which is called the: (2016 - II)
(a) 50% bands similar to father and 50% (a) Alpha strand
similar to another DNA fingerprint (b) Antistrand
pattern (c) Template strand
(b) 100% similarity to both the parents’ DNA (d) Coding strand
fingerprint as both contribute equally to 65. A molecule that can act as a genetic
zygote formation material must fulfill the traits given below,
(c) 100% similarity to mother’s DNA except: (2016 - II)
fingerprint because of maternal (a) It should be unstable structurally and
inheritance chemically
(d) 100% similarity to father’s DNA (b) It should provide the scope for slow
fingerprint due to large number of changes that are required for evolution
mitochondria in sperm (c) It should be able to express itself in the
60. The technique of DNA fingerprinting is form of ‘Mendelian characters’
superior to conventional fingerprinting (d) It should be able to generate its replica
because it can: (2017) 66. The equivalent of a structural gene is:
(a) Be generated more rapidly and is (2016 - II)
inexpensive (a) Operon

580 CHANNEL
JOIN TELEGRAM
 (b) Recon β-galactosidase can switch off
(c) Muton transcription
(d) Cistron (c) Positive and inducible because it can be
67. Taylor conducted the experiment to prove Induced lactose
semi- conservative mode of chromosome (d) Negative and inducible because
replication on: (2016 - II) repressor protein prevents transcription
(a) Drosophila melanogaster 74. Satellite DNA is important because it:
(b) E. coli (2015)
(c) Vinca rosea (a) Shows high degree of polymorphism in
(d) Vicia faba population and also the same degree of
68. Which of the following rRNA acts as polymorphism in an individual, which
structural RNA as well as ribozyme in are heritable form parents to children.
bacteria? (2016 - II) (b) Does not code for proteins and is same
(a) 23 S rRNA in all members of the population
(b) 5.8 S rRNA (c) Codes for enzymes needed for DNA
(c) 5 S rRNA replication
(d) 18 S rRNA (d) Codes for proteins needed in cell cycle.
69. Which one of the following is the starter 75. Identify the correct order of organisation of
codon? (2016 - I) genetic material from largest to smallest:
(a) AUG (2015 Re)
(b) UGA (a) Genome, chromosome, nucleotide, gene
(c) UAA (b) Genome, chromosome, gene, nucleotide
(d) UAG (c) Chromosome, genome, nucleotide, gene

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
70. Which of the following is not required for (d) Chromosome, gene, genome, nucleotide
any of the techniques of DNA fingerprinting 76. Which of the following biomolecules does
available at present? (2016 - I) have phosphodiester bond? (2015 Re)
(a) Polymerase chain reaction (a) Monosaccharides in a polysaccharide
(b) Zinc finger analysis (b) Amino acids in a polypeptide
(c) Restriction enzymes (c) Nucleic acids in a nucleotide
(d) DNA-DNA hybridisation (d) Fatty acids in a diglyceride
71. Which of the following is required as 77. Which one of the following is not applicable
inducer(s) for the expression of Lac operon? to RNA? (2015 Re)
(2016 - I) (a) 5′ phosphoryl and 3′ hydroxyl ends
(a) Glucose (b) Heterocyclic nitrogenous bases
(b) Galactose (c) Chargaff’s rule
(c) Lactose (d) Complementary base pairing
(d) Lactose and Galactose 78. Commonly used vectors for human genome
72. In sea urchin DNA, which is double sequencing are: (2014)
stranded, 17% of the bases were shown to (a) T/A Cloning Vectors
be cytosine. The percentages of the other (b) T-DNA
three bases expected to be present in this (c) BAC and YAC
DNA are: (2015) (d) Expression Vectors
(a) G = 17%, A = 33%, T = 33% 79. Transformation was discovered by: (2014)
(b) G = 8.5 %, A = 50 %, T = 24.5 % (a) Watson and Crick
(c) G = 34%, A = 24.5%, T = 24.5% (b) Messelson and Stahl
(d) G = 17%, A = 16.5%, T = 32.5% (c) Hershey and Chase
73. Gene regulation governing lactose operon of (d) Griffith
E. coli that involves the lac I gene product 80. An analysis of chromosomal DNA using the
is: (2015) southern hybridisation technique does not
(a) Negative and repressible because use: (2014)
Repressor protein prevents transcription (a) PCR
(b) Feedback inhibition because excess of (b) Electrophoresis
(c) Blotting

581 CHANNEL
JOIN TELEGRAM
 (d) Autoradiography 83. The diagram shows an important concept in
81. Which one of the following is wrongly the genetic implication of DNA Fill in the
matched? (2014) blanks A to C: (2013)
(a) Operon-Structural genes, operator and
promoter
(b) Transcription-Writing information from (a) A-translation, B-extension, C-Rosalind
DNA to tRNA Franklin
(c) Translation-Using information in mRNA (b) A-transcription, B-replication, C-James
to make protein Watson
(d) Repressor protein-Binds to operator to (c) A-translation, B-transcription, C-Erwin
stop enzyme synthesis Chargaff
82. Select the correct option: (2014) (d) A-transcription, B-translation, C-
Francis Crick
Direction Direction of reading
84. Which enzyme/s will be produced in a cell
of RNA of the
in which there is a nonsense mutation in
synthesis template DNA the lac Y gene? (2013)
strand (a) Lactose permease and transacetylase
3′ → 5′ 3′ → 5′ (b) β-galactosidase
(a)
(c) Lactose permease
(b) 5′ → 3′ 3′ → 5′
(d) Transacetylase
(c) 3′ → 5′ 5′ → 3′

(d) 5′ → 3′ 5′ → 3′

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

582 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (c) S33. Ans. (d)

S2. Ans. (a) S34. Ans. (b)

S3. Ans. (c) S35. Ans. (b)

S4. Ans. (b) S36. Ans. (d)

S5. Ans. (b) S37. Ans. (a)

S6. Ans. (c) S38. Ans. (c)

S7. Ans. (c) S39. Ans. (d)

S8. Ans. (a) S40. Ans. (d)

S9. Ans. (c) S41. Ans. (b)

S10. Ans. (c) S42. Ans. (b)

S11. Ans. (c) S43. Ans. (a)

S12. Ans. (b) S44. Ans. (c)

S13. Ans. (b) S45. Ans. (c)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (b) S46. Ans. (b)

S15. Ans. (b) S47. Ans. (d)

S16. Ans. (c) S48. Ans. (a)

S17. Ans. (b) S49. Ans. (c)

S18. Ans. (c) S50. Ans. (a)

S19. Ans. (a) S51. Ans. (c)

S20. Ans. (c) S52. Ans. (b)

S21. Ans. (b) S53. Ans. (d)

S22. Ans. (b) S54. Ans. (b)

S23. Ans. (b) S55. Ans. (b)

S24. Ans. (a) S56. Ans. (c)

S25. Ans. (a) S57. Ans. (a)

S26. Ans. (a) S58. Ans. (c)

S27. Ans. (b) S59. Ans. (a)

S28. Ans. (a) S60. Ans. (d)

S29. Ans. (c) S61. Ans. (a)

S30. Ans. (c) S62. Ans. (a)

S31. Ans. (a) S63. Ans. (d)

S32. Ans. (c) S64. Ans. (c)

583 CHANNEL
JOIN TELEGRAM
S65. Ans. (a)

S66. Ans. (d)

S67. Ans. (d)

S68. Ans. (a)

S69. Ans. (a)

S70. Ans. (b)

S71. Ans. (c)

S72. Ans. (a)

S73. Ans. (a)

S74. Ans. (a)

S75. Ans. (b)

S76. Ans. (c)

S77. Ans. (c)

S78. Ans. (c)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S79. Ans. (d)

S80. Ans. (a)

S81. Ans. (b)

S82. Ans. (b)

S83. Ans. (d)
S84. Ans. (b)

584 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(c)
Recombinant DNA technology the
separated DNA fragments can be
visualised only after staining the DNA
with a substance known as ethidium
bromide followed by exposure to U.V.
radiation.
S2. Ans.(a)
A-II, B-III, C-IV, D-I
S3. Ans.(c)
In prokaryotes, the negatively charged
DNA is held with some positively
charged proteins in a region termed as
nucleoid.
In eukaryotes, the negatively charged
DNA is wrapped around the positively
charged histone octamer to form a
structure called nucleosome.
S4. Ans.(b)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
5' AUCGAUCGAUCGAUCGAUCGAUCG
AUCG 3' (mRNA)
5' ATCGATCGATCGATCGATCGATCG
ATCG 3' (coding strand DNA)
S5. Ans.(b)
All the genes that are expressed as RNA
are referred to as Expressed Sequence
Tags (ESTs).
S6. Ans.(c)
The unequivocal proof that DNA is the
genetic material came from the
experiment of Alfred Hershey and
Martha Chase.
S7. Ans.(c)
In eukaryotes there are three major
types of RNA polymerases.
RNA polymerase I transcribes: 5.8S,
18S, 28S rRNAs
RNA polymerase II transcribes: hnRNAs
(precurssor of mRNA)
RNA polymerase III transcribes: tRNAs,
ScRNA, 5S rRNA and snRNA
S8. Ans.(a)
Chromosome 1, the largest human
chromosome, was the last to be fully
585 CHANNEL
JOIN TELEGRAM
sequenced, with this task not being
completed until May 2006. This marked
a significant milestone in human
genetics.
S9. Ans.(c)
Repressor protein.
S10. Ans.(c)
Both Statement I and Statement II are
true
S11. Ans.(c)
Both Statement I and Statement II are
true
S12. Ans.(b)
Lactose
S13. Ans.(b)
In the Hershey and Chase experiments,
they used bacteriophages (viruses that
infect bacteria) and grew one batch in
the presence of radioactive phosphorus
(P32) and another batch in the presence
of radioactive sulfur (S35).
S14. Ans.(b)
In lac operon, z gene codes for ẞ-
galactosidase.
Transacetylase, permease and repressor
protein are coded by genes 'a', 'y' and 'i'
respectively.
S15. Ans.(b)
The DNA-dependent DNA polymerases
catalyse polymerisation only in one
direction, that is 5' 3'. This creates some
additional complications at the
replicating fork. Consequently, on one
strand (the template with polarity 3' 5'),
the replication is continuous, while on
the other (the template with polarity 5'
3'), it is discontinuous.
S16. Ans.(c)
In lac operon,
The i gene codes for repressor protein.
The z gene codes for ẞ-galactosidase.
The y gene codes for permease and the a
gene codes for transacetylase.
S17. Ans.(b)
In the process of translation, the mRNA
codon pairs with the tRNA anticodon to
bring the correct amino acid to the
growing polypeptide chain
S18. Ans.(c)
According to Chargaff's rule, amount of
Adenine (A) is equal to thymine and
amount of cytosine (c) will be equal to
that of Guanine.
So,
A = T = 30%+30% = 60%
CG20%+20% = 40%
So, T and G will be 30% and 20%
respectively.
S19. Ans.(a)
When the small subunit of ribosome
encounters an mRNA, the process of
translation of the mRNA to protein
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
begins. This process is followed by the
binding of bigger/larger subunit.
t-RNA is activated by the addition of
amino acid prior to the attachment or
ribosome, in the first phase.
S20. Ans.(c)
Polymorphism in DNA sequence is the
basis of genetic mapping of human
genome as well as of DNA finger
printing.
S21. Ans.(b)
Heterochromatin is transcriptionally
inactive. A typical nucleosome contains
200 bp of DNA helix.
Euchromatin is the loosely packed
chromatin region.
The negatively charged DNA is wrapped
around the positively charged histone
octamer to form a structure called
nucleosome. Histones are rich in basic
amino acid residues lysine and arginine.
S22. Ans.(b)
The source of the complementary RNA
for RNAi could be mobile genetic
elements (transposons) that replicate via
an RNA intermediate.
586 CHANNEL
JOIN TELEGRAM
S23. Ans.(b)
(A)-Replication; (B)-Transcription;
(C)-Translation; (D)-Protein
S24. Ans.(a)
In eukaryote cells, RNA polymerase III
(also called Pol III) transcribes DNA to
synthesize ribosomal 5S rRNA, tRNA
and other small RNAs. The genes
transcribed by RNA Pol III fall in the
category of "housekeeping" genes whose
expression is required in all cell types
and most environmental conditions
S25. Ans.(a)
DNA fingerprinting involves identifying
differences in some specific regions in
DNA sequence called as repetitive DNA,
because in these sequences, a small
stretch of DNA is repeated many times
S26. Ans.(a)
S27. Ans.(b)
Together, adenine and thymine compose
60% of the segment. This means that
40% of the section is composed of
guanine-cytosine pairs. Since these
two bases will be equal in quantity, 20%
of the DNA section will be cytosine
bases
S28. Ans.(a)
DNA dependent RNA polymerase of
prokaryotes has the ability to initiate,
elongate and terminate the process of
transcription.
S29. Ans.(c)
siRNA (smaller interference RNA) is
involved in preventing the translation of
mRNA to form protein. It is associated
with pest resistance in plants by RNA
interference.
S30. Ans.(c)
AUG codes for only methionine but not
tryptophan. (A given codon codes for
only one amino acid but not more than
one amino acids.). AAG and AAA are the
two codons for the amino acid Lysine.
S31. Ans.(a)
Nature of histone is basic because of
presence of arginine and Lysine.
S32. Ans.(c)
During transcription, RNA polymerase
facilitates the opening of the DNA helix
and continues elongation.
S33. Ans.(d)
Adenine forms complementary pair with
thymine by forming two hydrogen
bonds.
S34. Ans.(b)
In the first phase of translation, amino
acids are activated in the presence of
ATP and linked to their cognate tRNA– a
process commonly called as charging of
tRNA or aminoacylation of tRNA.
S35. Ans.(b)
Given that,
Distance between two consecutive base
pairs= 0.34 nm = 0.34 × 10−9 m
Total number of base pairs= 6.6 × 10−9
bp
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Length of DNA = Distance between two
consecutive base pairs x Total number
of base pairs
= [0.34 × 10−9 ] m × 6.6 × 10−9
bp = 2.2 m
S36. Ans.(d)
Polymerases - Synthesizes long chains
of polymers or nucleic acids
Nucleases - Break the DNA into
fragments Helicases
- Separate the two strands of DNA
Exonucleases - Make cuts at the
terminals or ends of the DNA sequence.
Ligases - These are the enzymes which
reconnects the two DNA molecules.
S37. Ans.(a)
DNA as an acidic substance present in
nucleus was first identified by Friedrich
Meischer in 1869. He named it as
‘Nuclein’.
S38. Ans.(c)
A nitrogenous base is linked to the
pentose sugar through a N-glycosidic
linkage to form a nucleoside.
The nitrogenous bases are purines or
pyrimidines. Nitrogen base is attached
587 CHANNEL
JOIN TELEGRAM
to the hydroxyl group (-OH) of C-1 of the
pentose sugar.
S39. Ans.(d)
DNA fingerprinting is a technique for
detecting genetic differences in people in
a population. It is based on the
polymorphism principle in DNA
sequences. In the fields of forensic
science, genetic biodiversity, and
evolutionary biology, it has a wide range
of applications.
S40. Ans.(d)
E. coli that has only 4.6 × 106 bp
completes the process of replication
within 18 minutes; that means the
average rate of polymerisation has to be
approximately 2000 bp per second.
S41. Ans.(b)
Adenine and guanine are the purines
found both in DNA and RNA.
S42. Ans.(d)
A base insertion or deletion will not shift
the reading frame if it is in a multiple of
three mRNA No change in reading frame
of mRNA.
S43. Ans.(a)
Expressed Sequence Tags (ESTs) are
DNA sequences (genes) that are
expressed as mRNA for protein
synthesis. These are used in the Human
Genome Project.
S44. Ans.(c)
In recombinant DNA technology,
bacteria are able to produce human
insulin because the genetic code
is nearly universal. That means the DNA
sequence which codes for insulin will
produce insulin protein whether it is
present in a bacterial cell or a human
cell.
S45. Ans.(c)
In lac operon, the respective codes for
the following:
i gene — Repressor
z gene — -galactosidase
y gene — Permease
a gene — Transacetylase
S46. Ans.(b)
Semiconservative mode of DNA
replication was performed by Meselson
and Stahl in their experimental proof.
They labeled the DNA of bacteria
across generations using isotopes of
nitrogen.
S47. Ans.(d)
Lac Operon was studied and discovered
by Jacob and Monod to determine how a
cell knows which enzyme to synthesise.
This discovery won them Noble Prize.
Alec Jeffrey - DNA fingerprinting;
Hershey and Chase - Blender
experiment to proof DNA is the genetic
material; and Meselson and stahl –
Semiconservative mode of replication.
S48. Ans.(a)
Non-coding or template strand codes for
mRNA which is complementary to
coding strand. So, mRNA is identical to
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
coding stand, except it has uracil (U) in
place of thymine (T).
S49. Ans.(c)
Enhancer is a short region of DNA that
can be bound by activators (proteins) to
increase the chances of transcription of
a particular gene.
S50. Ans.(a)
Ribozymes are ribonucleic acids (RNAs)
that act as an enzyme and catalyse the
biochemical reactions.
S51. Ans.(c)
Histone H1 or linker histone’ links two
nucleosomes with each other and it is a
key player in determining the
compaction state of a number of
nucleosomes and influencing their
conformation.
S52. Ans.(b)
Hershey and Chase gave unequivocal
proof that DNA is genetic material.
S53. Ans.(d)
The process in which the DNA is
replicated and two copies are
synthesized is called DNA replication.
It involves the formation of replication
fork. The two strands of the DNA helix
588 CHANNEL
JOIN TELEGRAM
separate and the new strands are
formed on the original strands, known
as the template strands. The strand
which is synthesized in 3'-5' direction is
the leading strand and the strand
which is synthesized in the opposite
direction is the lagging strand which
contains the Okazaki fragments.
This strand is synthesized away from
the replication fork.
S54. Ans.(d)
Spliceosomes are used in removal of
introns during post- transcriptional
processing of hnRNA in eukaryotes only,
as split genes are absent as in
prokaryotes.
S55. Ans.(b)
DNA fragments are negatively charged
because of phosphate group.
S56. Ans.(c)
Given: 999 bases = 900 bases + 99
bases of 3 bases = 1 codon) When the
base at position 901 gets deleted,
change never happens in the 900 bases
but only in the last 99 bases.
Thus, the number of unaltered codons =
300 codons The number of altered
codons = 33 codons.
S57. Ans.(a)
rRNA is most abundant in animal cell. It
constitutes 80% of total RNA of the cell.
S58. Ans.(c)
RNA act as a catalyst
S59. Ans.(a)
DNA fingerprinting is the basis of
paternity testing as the polymorphisms
are inheritable from parents to
children. Since a child receives half of
his or her DNA from the mother and the
other half from the father, paternity can
be established.
S60. Ans.(d)
The repetitive DNA gets separated from
bulk genomic DNA as different peaks by
density gradient centrifugation. The
bulk DNA forms a major peak and
 the other small peaks are referred to as (i) It should be able to generate its
satellite DNA. The satellite DNA is replica (replication).
further classified into many categories
(ii) It should chemically and structurally
such as micro- satellite, mini-satellites,
be stable.
etc. These sequences normally do not
code for any proteins and show high (iii) It should provide the scope for slow
degree of polymorphism and form the changes (mutation) that are required
basis of DNA fingerprinting
for evolution.
S61. Ans.(a)
(iv) It should be able to express itself in
Ribozyme is a non-protein RNA the form of ‘Mendelian Characters’.
molecule which is capable of catalysing
S66. Ans.(d)
specific biochemical reactions.
The equivalent of a structural gene is
S62. Ans.(a)
cistron. Cistron: A segment of DNA
In a genetic code, 61 codons code for coding for a polypeptide
amino acids and 3 codons which are
S67. Ans.(d)
stop codons (UAA, UAG, UGA)
do not code for any amino acid. Taylor and colleagues in 1958 with the
help of radioactive thymidine detect
The codons in mRNA are read in a
distribution of newly synthesised DNA
contiguous manner, with no
in the chromosomes. The experiment
punctuation. A base deletion or addition
was performed on Vicia faba (Faba
can cause a shift in the reading frame,

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
resulting in frame- shift mutation. beans). The experiments proved that the
DNA in chromosomes also replicate
AUG is the first or initiation codon of
semi-conservatively.
DNA that codes methionine amino acid
in protein sequence. S68. Ans.(a)
S63. Ans.(d) The ribosome also acts as a catalyst
(23S rRNA in bacteria is the enzyme-
According to Chargaff’s rule,
ribozyme) for the formation of peptide
A:T=G:C bond.
(A + G)/(T + C) = 0.7 = 7/10 S69. Ans.(a)
(A + G)/(T + C) = 7/10 AUG has dual functions. It codes for
This means that A + G = 7 and T + C = methionine (met), and it also act as
10 initiator (Starter) codon.
In a complementary strand, A = T and G S70. Ans.(b)
= C.
Zinc finger analysis is not required for
(A + G)/(T + C) in the complementary any of the techniques of DNA
strand will be fingerprinting available at present
(T + C)/(A + G) = 10 : 7 because it is the test to check the
10/7 = 1.4285 = 1.43 presence of a zinc- binding motif in
protein that helps to stabilize the fold
S64. Ans.(c)
of proteins. This analysis is not linked
DNA-dependent RNA polymerase with DNA.
catalyses transcription on one strand of
S71. Ans.(c)
the DNA is called the template strand.
Glucose or galactose cannot act as
S65. Ans.(a)
inducers for lac operon. Regulation of
A molecule that can act as a genetic lac operon by repressor is referred to as
material must fulfill the following negative regulation.
criteria:

589 CHANNEL
JOIN TELEGRAM
 An inducer is a molecule that regulates
the expression of a gene by binding with
the repressor molecule, so that
repressor cannot bind with the operator
and transcription of molecule can takes
place. In other cases, an inducer binds
with the activator to enhance
transcription. Lactose is an inducer
because it binds with repressor
so that it cannot bind with operator and
transcription continues.
S72. Ans.(a)
According to Chargaff’s rule,
Adenine + Guanine = Thymine +
Cytosine
Also, Adenine = Thymine and Guanine =
Cytosine
Also, A + T + C + G = 100%
Given that, the percentage of Cytosine =
17%
That means the percentage of Guanine
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
= 17%
[because C = G]
Now, A + T + 17% + 17% = 100%
A + T = 100 – [17 + 17]
A + T = 66%
As Adenine = Thymine, substitute T
with A and we get
A + A = 66%
2A = 66%
A = 33%
Because Adenine = Thymine, thus,
Thymine = 33%
S73. Ans.(a)
Inducible operon system regulates
genetic material which remains
switched off normally but becomes
operational in the presence of inducer.
E.g., Lac operon transcription is under
negative control when lac repressor is
inactivated by inducer.
S74. Ans.(a)
Polymorphism: Variations at genetic
level arisen due to mutations is called
polymorphism. There variations
590 CHANNEL
JOIN TELEGRAM
occur in non-coding regions of DNA and
do not code for any protein but are
heritable. The polymorphism
in DNA is the basis of genetic mapping
and DNA fingerprinting.
S75. Ans.(b)
The genome is described as the genetic
information repository of an organism.
The genetic material, i.e., DNA is
packaged into thread-like structures
called chromosomes. Gene is the
segment of DNA that codes for the
protein. Nucleotide is the building
block of genetic material. Therefore, the
correct order of organisation is: Genome
- Chromosome - Gene - Nucleotide
S76. Ans.(c)
Backbone of DNA duplex is made up of
sugar - phosphate which are joined by
phosphodiester.
S77. Ans.(c)
Erwin Chargaff made observations on
the base and other DNA contents.
According to Chargaff’s rule, Adenine +
Guanine = Thymine + Cytosine
But this rule is not applicable in case of
RNA as it exhibits mostly as a single
strand and has uracil base pair instead
of thymine.
S78. Ans.(c)
Commonly used vector for HGP are
bacterial artificial chromosome (BAC)
and yeast artificial chromosome (YAC).
S79. Ans.(d)
Transformation was discovered by
Griffith.
S80. Ans.(a)
PCR is not involved in southern
hybridisation. Polymerase chain
reaction (PCR) is a widely used
method for rapidly producing millions or
more copies of a specific DNA sequence
that helps scientists to do their research
and study by amplifying a small amount
of DNA to a large sufficient amount.
S81. Ans.(b)
Transcription is the process by which
DNA synthesises mRNA with the help of
an enzyme called RNA polymerase.
Thus, it changes the information
of DNA into mRNA whereas the further
information from mRNA to tRNA is
provided by the translation process.
S82. Ans.(b)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
591 CHANNEL
JOIN TELEGRAM
S83. Ans.(d)
Central Dogma; proposed by Francis
Crick.
S84. Ans.(b)
The lac Y gene codes for permease,
which increases permeability of the cell
to β-galactosides. A nonsense
mutation in Y-gene causes generation of
a non- functional permease.
 Chapter 25
Sankalp Bharat
Evolution

1. The factor that leads to Founder effect in a 4. Man created breeds of domesticated
population is (2021) animals like dogs
(a) Genetic recombination (a) 1 and 3
(b) Mutation (b) 2, 3 and 4
(c) Genetic drift (c) Only 4
(d) Natural selection (d) Only 2
2. Match the following (2021) 5. Embryological support for evolution was
disapproved by (2020)
List-I List-II (a) Alfred Wallace
(b) Charles Darwin
A. Adaptive (i) Selection of (c) Oparin
radiation resistant (d) Karl Ernst Von Baer
varieties due 6. From his experiments, S.L. Miller produced
to excessive amino acids by mixing the following in a
use of closed flask (2020)
herbicides (a) CH3, H2, NH4 and water vapor at 800°C
and (b) CH4, H2, NH3 and water vapor at 600°C
pesticides

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) CH3, H2, NH3 and water vapor at 600°C
B. Convergent (ii) Bones of (d) CH4, H2, NH3 and water vapor at 800°C
evolution forelimbs in 7. After about how many years of formation of
man and earth, life appeared on this planet?
whale (2020 Covid Re-NEET)
Divergent (iii) Wings of (a) 50 million years
C. (b) 500 million years
evolution butterfly and
bird (c) 50 billion years
(d) 500 billion years
D. Evolution by (iv) Darwin 8. Embryological support for evolution was
anthropogenic Finches proposed by (2020 Covid Re-NEET)
action (a) Karl Ernst Von Baer
Choose the correct answer from the options (b) Charles Darwin
given below (c) Alfred Wallace
(a) A-iii B-ii C-i D-iv (d) Ernst Heckel
(b) A-ii B-i C-iv D-iii 9. A Hominid fossil discovered in Java in 1891,
(c) A-i B-iv C-iii D-ii now extinct, having cranial capacity of
(d) A-iv B-iii C-ii D-i about 900 cc was
3. Flippers of penguins and dolphins are (2020 Covid Re-NEET)
examples of (2020) (a) Neanderthal man
(a) Convergent evolution (b) Homo sapiens
(b) Industrial melanism (c) Australopithecus
(c) Natural selection (d) Homo erectus
(d) Adaptive radiation 10. The phenomenon of evolution of different
4. Which of the following refer to correct species in a given geographical area starting
example(s) of organisms which have evolved from a point and spreading to other habitats
due to changes in environment brought is called (2020 Covid Re-NEET)
about by anthropogenic action? (2020) (a) Co-evolution
1. Darwin’s Finches of Galapagos islands (b) Natural selection
2. Herbicide resistant weeds (c) Adaptive radiation
3. Drug resistant eukaryotes (d) Saltation
592 CHANNEL
JOIN TELEGRAM
11. A gene locus has two alleles A and a. If the
frequency of dominant allele A is 0.4, then
what will be the frequency of homozygous
dominant, heterozygous and homozygous
recessive individuals in the population?
(2019)
(a) 0.36(AA); 0.48(Aa); 0.16(aa)
(b) 0.16(AA); 0.24(Aa); 0.36(aa)
(c) 0.16(AA); 0.48(Aa); 0.36(aa)
(d) 0.16(AA); 0.36(Aa); 0.48(aa)
12. Variations caused by mutation, as proposed
by Hugo de Vries are (2019)
(a) Random and directional
(b) Random and directionless
(c) Small and directional
(d) Small and directionless
13. In a species, the weight of newborn ranges
from 2 to 5 kg. 97% of the newborn with an
average weight between 3 to 3.3 kg survive
whereas 99% of the infants born with
weight from 2 to 2.5 kg or 4.5 to 5 kg die.
Which type of selection process is taking
place? (2019)
16. Among the following sets of examples for
divergent evolution, select the incorrect
option (2018)
(a) Forelimbs of man, bat and cheetah
(b) Heart of bat, man and cheetah
(c) Brain of bat, man and cheetah
(d) Eye of octopus, bat and man
17. According to Hugo de Vries, the mechanism
of evolution is (2018)
(a) Multiple step mutations
(b) Saltation
(c) Phenotypic variations
(d) Minor mutations
18. Artificial selection to obtain cows yielding
higher milk output represents (2017)
(a) Stabilising selection as it stabilises this
character in the population
(b) Directional as it pushes the mean of the
character in one direction
(c) Disruptive as it splits the population into
two one yielding higher output and the
other lower output

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) Directional Selection (d) Stabilising followed by disruptive as it
(b) Stabilising Selection stabilises the population to produce
(c) Disruptive Selection higher yielding cows
(d) Cyclical Selection
19. Continental drift led to disappearance of a
14. Match the hominids with their correct brain
number of South American mammals
size (2019)
because (2017)
A. Homo habilis i. 900 cc (a) Alteration of vegetation was not
Homo ii. 1350 cc conducive to their survival
B. (b) There was an outbreak of a number of
neanderthalensis infectious diseases
Homo erectus iii. 650-800 (c) Sudden change in the climatic
C.
conditions
cc
(d) They were outcompeted by more highly
Homo sapiens iv. 1400 cc evolved animals reaching here from
D.
North America
A B C D 20. Which of the following is the correct
(a) (iii) (i) (iv) (ii) sequence of events in the origin of life?
(b) (iii) (ii) (i) (iv) (2016 - II)
(c) (iii) (iv) (i) (ii) I. Formation of protobionts
(d) (iv) (iii) (i) (ii) II. Synthesis of organic monomers
15. The similarity of bone structure in the III. Synthesis of organic polymers
forelimbs of many vertebrates is an example IV. Formation of DNA-based genetic
of (2018) systems
(a) Homology (a) II, III, I, IV
(b) Analogy (b) II, III, IV, I
(c) Convergent evolution (c) I, II, III, IV
(d) Adaptive radiation (d) I, III, II, IV

593 CHANNEL
JOIN TELEGRAM
21. The chronological order of human evolution
from early to the recent is
(2016 - II)
(a) Ramapithecus-Homo habilis-
Australopithecus -Homo erectus
(b) Australopithecus-Homo habilis-
Ramapithecus -Homo erectus
(c) Australopithecus-Ramapithecus-Homo
habilis -Homo erectus
(d) Ramapithecus-Australopithecus-Homo
habilis -Homo erectus
22. In Hardy-Weinberg equation, the frequency
of heterozygous individual is represented by
(2016 - II)
(a) pq
(b) q2
(c) p2
(d) 2pq
23. Genetic drift operates in (2016 - II)
(a) Non-reproductive population
(b) Slow reproductive population
(c) Small isolated population
(d) Large isolated population
(b) Recombination
(c) Transduction
(d) Chromosomal aberrations
28. A population will not exist in Hardy-
Weinberg equilibrium if (2015)
(a) There is no migration
(b) The population is large
(c) Individuals mate selectively
(d) There are no mutations
29. Which of the following had the smallest
brain capacity? (2015 Main)
(a) Homo neanderthalensis
(b) Homo habilis
(c) Homo erectus
(d) Homo sapiens
30. The following graph depicts changes in two
populations (A and B) of herbivores in a
grassy field. A possible reason for these
changes is that (2015)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
24. Analogous structures are a result of
(2016 - I)
(a) Divergent evolution
(b) Convergent evolution
(c) Shared ancestry (a) Population A produced more offspring
(d) Stabilising selection than population B
25. Following are the two statements regarding (b) Population A consumed the members of
the origin of life (2016 - I) population B
A. The earliest organisms that appeared on (c) Both plant populations in this habitat
the earth were non-green and presumably decreased
anaerobes (d) Population B competed more
B. The first autotrophic organisms were the successfully for food than population A
chemoautotrophs that never released 31. The wings of a bird and the wings of an
oxygen Of the above statements which one insect are (2015 Re)
of the following options is correct? (a) Analogous structures and represent
(a) A is correct but B is incorrect convergent evolution
(b) B is correct but A is incorrect (b) Phylogenetic structures and represent
(c) Both A and B are correct divergent evolution
(d) Both A and B are incorrect (c) Homologous structures and represent
26. Which of the following structures are convergent evolution
homologues to the wing of a bird? (d) Homologous structures and represent
(2016 - I) divergent evolution
(a) Dorsal fin of a Shark 32. Industrial melanism is an example of
(b) Wing of a Moth (2015 Re)
(c) Hind limb of Rabbit (a) Natural selection
(d) Flipper of Whale (b) Mutation
27. Which is the most common mechanism of (c) Neo Lamarckism
genetic variation in the population of a (d) Neo Darwinism
sexually reproducing organism? (2015)
(a) Genetic drift
594 CHANNEL
JOIN TELEGRAM
33. Forelimbs of cat, lizard used in walking; 38. The process by which organisms with
forelimbs of whale used in swimming and different evolutionary history evolve similar
forelimbs of bats used in flying are an phenotypic adaptations in response to a
example of (2014) common environmental challenge, is called
(a) Convergent evolution (2013)
(b) Analogous organs (a) Adaptive radiation
(c) Adaptive radiation (b) Natural selection
(d) Homologous organs (c) Convergent evolution
34. In a population of 1000 individuals 360 (d) Non-random evolution
belong to genotype AA, 480 to Aa and the 39. The tendency of population to remain in
remaining 160 to aa. Based on this data, genetic equilibrium may be disturbed by
the frequency of allele A in the population is (2013)
(2014) (a) Lack of random mating
(a) 0.7 (b) Random mating
(b) 0.4 (c) Lack of migration
(c) 0.5 (d) Lack of mutations
(d) 0.6 40. The eye of octopus and eye of cat show
35. Which one of the following are analogous different patterns of structure, yet they
structures? (2014) perform similar function. This is an
(a) Flippers of dolphin and legs of horse example of (2013)
(b) Wings of bat and wings of pigeon (a) Analogous organs that have evolved due
(c) Trachea of prawn and lungs of man to divergent evolution
(d) Thorns of Bougainvillea and tendrils of (b) Homologous organs that have evolved

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Cucurbita due to convergent evolution
36. Variation in gene frequencies within (c) Homologous organs that have evolved
populations can occur by chance rather due to divergent evolution
than by natural selection. This is referred to (d) Analogous organs that have evolved due
as (2013) to convergent evolution
(a) Genetic load
(b) Genetic flow
(c) Genetic drift
(d) Random mating
37. According to Darwin, the organic evolution
is due to (2013)
(a) Reduced feeding efficiency in one species
due to the presence of interfering species
(b) Intraspecific competition
(c) Interspecific competition
(d) Competition within closely related
Species

595 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (c) S22. Ans. (b)

S2. Ans. (d) S23. Ans. (c)

S3. Ans. (a) S24. Ans. (b)

S4. Ans. (b) S25. Ans. (c)

S5. Ans. (d) S26. Ans. (d)

S6. Ans. (d) S27. Ans. (b)

S7. Ans. (b) S28. Ans. (c)

S8. Ans. (d) S29. Ans. (b)

S9. Ans. (d) S30. Ans. (d)

S10. Ans. (c) S31. Ans. (a)

S11. Ans. (c) S32. Ans. (a)

S12. Ans. (b) S33. Ans. (d)

S13. Ans. (b) S34. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (c) S35. Ans. (b)

S15. Ans. (a) S36. Ans. (c)

S16. Ans. (d) S37. Ans. (c)

S17. Ans. (b) S38. Ans. (c)

S18. Ans. (b) S39. Ans. (a)

S19. Ans. (d) S40. Ans. (d)

S20. Ans. (a)

S21. Ans. (d)

596 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(c)
The factor that leads to Founder effect
in a population is genetic drift.
S2. Ans.(d)
Adaptive radiation: Darwin finches;
Convergent Evolution: Wings of
Butterfly and Bird; Divergent evolution:
Bones of forelimbs in man and whale;
Evolution by anthropogenic action:
Selection of resistant varieties due to
excessive use of herbicides and
pesticides
S3. Ans.(a)
● Flippers of penguins and dolphins are
examples of convergent evolution.
● Analogous evolution refers to the
functional similarities but superficial
morphological similarity of structures,
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
in other words, dissimilar morphological
traits.
● Both organs-flippers perform the same
function in aiding swimming, yet the
organisms are quite different in
appearance. Convergent evolution is the
term for this.
S4. Ans. (b)
● Anthropogenic evolution can be seen
in herbicideresistant plants, drug-
resistant eukaryotes and man-made
breeds of domesticated animals such as
dogs.
● The Galapagos Islands’ Darwin’s
Finches are an example of adaptive
radiation.
S5. Ans. (d)
● The embryological foundation for
evolution was criticised by Karl Ernst
Von Baer.
● He rejected the hypothesis that the
embryos of more complex creatures
went through morphological stages
similar to those of lower-ranking
organism’s adult forms.
597 CHANNEL
JOIN TELEGRAM
S6. Ans. (d)
In 1953, an American scientist named
S.L. Miller developed an electric
discharge in a closed flask containing
CH4 , H2 , NH3 and water vapour at
800°C.
S7. Ans. (b)
Life first appeared 500 million years
after the Earth’s origin, or about four
billion years ago. Evolution 109
S8. Ans. (d)
Ernst Heckel presented embryological
support for evolution based on the
discovery of some traits common to all
vertebrates at the embryonic stage that
are lost in adults.
S9. Ans. (d)
● Homo erectus lived 1.5 million years
ago, according to fossils unearthed in
Java in 1891.
● Homo erectus had a huge brain,
measuring roughly 900 cubic
centimetres.
● Meat was most likely consumed by
Homo erectus.
S10. Ans. (c)
● Adaptive radiation is the process of
distinct species in a certain
geographical area evolving from a single
point and literally radiating to other
parts of geography (habitats).
● One of the clearest instances of this
phenomenon is Darwin’s finches.
S11. Ans. (c)
Dominant allele frequency (p) = 0.4
Recessive allele frequency (q) = 1 – 0.4 =
0.6 . Individuals that are homozygous
dominant (AA) . (0.4)2 = 0.16 = p2 .
Individuals who are heterozygous (Aa) .
2(0.4)(0.6) = 0.48 = 2pq . Individuals
that are homozygous recessive (aa) .
(0.6)2 = 0.36 = 𝑞 2
S12. Ans. (b) S18.
Hugo de Vries claims that mutations are
random and directionless. De Vries felt
that mutation was the origin of
speciation, thus he coined the term
“saltation” (single step large mutation).
S19.
S13. Ans. (b)
The results indicate stabilising
selection, as most neonates with an
average weight of 3 to 3.3 kg survive,
but babies with less and higher weight
S20.
have a low survival probability.
S14. Ans. (c)
Hominids and their brain sizes should
be matched as follows:
● 650-800 cc - Homo habilis
● 1400 cc - Homo neanderthalensis
● 900 cc - Homo erectus
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
● 1350 cc - Homo sapiens
S15. Ans. (a)
Homologous organs, such as tetrapod
forelimbs, are physically identical but
functionally distinct, indicating common
ancestry.
S21.
S16. Ans. (d)
Although the camera eyes of octopuses
and humans are strikingly similar,
phylogenetic and embryological research
shows that their camera eyes evolved
independently, implying convergent
evolution.
S17. Ans. (b)
S22.
● Hugo de Vries believed that mutation
results in the production of new species,
which he referred to as saltation.
● Saltation is the development of new
and advanced species as a result of a
single major mutation.
● He did not believe that the slight
S23.
heritable mutations reported by Darwin
were the cause of evolution.
598 CHANNEL
JOIN TELEGRAM
Ans. (b)
Artificial selection to obtain cows that
provide more milk will shift the peak in
one direction, resulting in directional
selection.
Ans. (d)
When South America joined North
America due to continental drift, these
animals were displaced by North
American fauna.
Ans. (a)
● The following is the order in which life
events occurred:
● Initially, organic monomers were
synthesised, followed by the
development of organic polymers.
● The organic chemicals were then
clumped together and encased in a thin
membrane.
● The protobionts were the name given
to this formation.
● Following that, a much more
complicated DNA based genetic system
emerged.
Ans. (d)
The chronological order of human
evolution from early to the recent is:
● Ramapithecus (more man-like) →
Australopithecus (hunted with stone
weapons) → Homo habilis (first human-
like being) → Homo erectus (fossils were
discovered in 1891).
Ans. (d)
● Hardy-Weinberg principle can be
written as p2 + 2pq + q2 = 1.
● Here, p2 indicates dominant allele
frequency, q2 represents recessive allele
frequency, and 2pq represents
heterozygous individual frequency.
Ans. (c)
In small isolated populations, genetic
drift occurs. Genetic drift is defined as
when there is a change in allele or gene
 in small populations that occurs by
chance.
S24. Ans. (b)
● Analogous structures share a common
ancestor and perform the same
function.
● They are the outcome of convergent
evolution, which occurred when diverse
creatures shared the same habitat.
Convergent evolution is the process of
similar traits in separate lineages
evolving independently.
S25. Ans. (c)
● The earliest organisms that appeared
on the earth were non-green and
presumably anaerobes.
● The first autotrophic organisms were
the chemoautotrophs that never
released oxygen.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S26. Ans. (d)
● Organs that are homologous in
structure and origin but have diverse
functions are referred to as homologous
organs.
● The whale’s flipper is similar to a
bird’s wing. Organs with comparable
functions but differing structures and
origins are referred to as analogous
organs.
S27. Ans. (b)
The most prevalent process of genetic
diversity is recombination, which
includes the transfer of genetic material
between several chromosomes or
different areas of the same chromosome.
S28. Ans. (c)
● One of the conditions for a population
to be in Hardy-Weinberg equilibrium is
that it has no mutations.
● Individuals who mate selectively have
a higher likelihood of mutation which
shifts the HardyWeinberg equilibrium.
599 CHANNEL
JOIN TELEGRAM
S29. Ans. (b)
Homo habilis - 650-800 cc. Homo
erectus - 900 cc. Neanderthal man -
1400 cc
S30. Ans. (d)
Natural selection and the transmission
of beneficial variations through many
generations results in the emergence of
new species.
S31. Ans. (a)
● Convergent evolution describes the
process through which animals that are
not closely related gain comparable
traits on their own as a result of
needing to adapt to similar
environments or ecological niches.
● Analogous structures emerge from
convergent evolution.
● Organs with similar functions but
differing structures and origins exist.
For example, a bird’s wings and an
insect’s wings.
S32. Ans. (a)
In this case, the number of light-colored
moths (Biston betularia) declined with
time while the number of melanic moths
increased, indicating directional
selection. It gave a clear illustration of
natural directed selection.
S33. Ans. (d)
● Forelimbs of cat, lizard used in
walking; forelimbs of whale used in
swimming and forelimbs of bats used in
flying are an example of homologous
organ.
● They have evolved differently as a
result of adaptations to varied habitats,
but their origins are identical. As a
result, homologous organs are an
example.
S34. Ans. (d)
p2 + 2pq + q2 = 1. Here, p represents the
frequency of the “A” allele and q is the
frequency of the “a” allele in the
population. Thus, p2 represents the
 frequency of the homozygous dominant S38. Ans. (c)
AA. q2 represents the frequency of the
Convergent evolution is the process
homozygous recessive aa. 2pq
through which organisms that are not
represents the frequency of the
closely related evolve comparable traits
heterozygous Aa. According to the
independently as a result of needing to
question, there are 1000 individuals,
adapt to similar environments or
out of which 360 belong to genotype AA.
ecological niches.
p2 = AA = 360/1000 = 0.36. Then p = A
= 0.6. S39. Ans. (a)
S35. Ans. (b) ● The mathematical basis for genetic
equilibrium is provided by the Hardy-
● The organs which have similar
Weinberg principle.
functions but are different in their
structural details and origin are called ● Mutations, natural selection, non-
analogous organs. random mating, genetic drift, and gene
flow are among forces that can disrupt
● The wings of bat are analogous to
the Hardy-Weinberg equilibrium
wings of pigeon. It is due to the fact that
(immigration, emigration, or migration).
the basic structure of the wings of the
mammal is different from the wings of S40. Ans. (d)
bird. However, their function is similar.
● The eye of octopus and eye of cat are
● Similarly, gills of prawn and lungs of structurally different but performs the
man, both are respiratory organs yet

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
same function of vision/ sight.
they have very different basic structure.
● Organs which are structurally
S36. Ans. (c) dissimilar and functionally similar are
called analogous organs. They lead to
Genetic drift is the variation in gene
convergent evolution i.e. in different
frequencies within a population that can
organisms structural modification in an
happen by accident.
organ is due to a similar habitat.
S37. Ans. (c)
Interspecific competition, according to
Darwin, is the cause of organic
evolution. It is a form of competition
between members of various species. .
The presence of interfering species
causes a reduction in feeding efficiency
in one species, which is related to a
struggle for survival.

600 CHANNEL
JOIN TELEGRAM
 Chapter 26
Human Health and Disease Sankalp Bharat

1. Which of the following sexually transmitted (b) A-(iv), B-(iii), C-(ii), D-(i)
infections are completely curable? (2023) (c) A-(iii), B-(iv), C-(i), D-(ii)
(a) HIV infection and Trichomoniasis (d) A-(ii), B-(i), C-(iv), D-(iii)
(b) Syphilis and trichomoniasis 6. Match List-I with List-II. (2023)
(c) Hepatitis – B and Genital herpes
List-I List-II
(d) Genital herpes and Genital warts
A. Ringworm (i) Haemophilus
2. Which one of the following common sexually influenzae
transmitted diseases is completely curable
when detected early and treated properly? B. Filariasis (ii) Trichophyton
(2023) C. Malaria (iii) Wuchereria
(a) Gonorrhoea bancrofti
(b) Hepatitis-B
(c) HIV Infection D. Pneumonia (iv) Plasmodium vivax

(d) Genital herpes Choose the correct answer from the options
given below:
3. Which one of the following techniques does
(a) A-(ii), B-(iii), C-(i), D-(iv)
not serve the purpose of early diagnosis of a
(b) A-(iii), B-(ii), C-(i), D-(iv)
disease for its early treatment? (2023)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) A-(iii), B-(ii), C-(iv), D-(i)
(a) Serum and Urine analysis
(d) A-(ii), B-(iii), C-(iv), D-(i)
(b) Polymerase Chain Reaction (PCR)
technique 7. Which of the following reasons is mainly
(c) Enzyme Linked Immuno-Sorbent Assay responsible for graft rejection in
(ELISA) technique transplantation of organs? (2022)
(d) Recombinant DNA Technology (a) Cell-mediated response
(b) Inability of recipient to differentiate
4. In which blood corpuscles, the HIV
between ‘self’ and ‘non-self’
undergoes replication and produces
tissues/cells
progeny viruses? (2023)
(c) Humoral immune response only
(a) B-lymphocytes
(d) Auto-immune response
(b) Basophils
(c) Eosinophils 8. Match List-I with List-II: (2022)
(d) TH cells List-I List-II
5. Match List-I with List-II. (2023) A. Cellular barrier (i) Interferons
List-I List-II Cytokine (ii) Mucus
B.
Heroin (i) Effect on barrier
A.
cardiovascular C. Physical barrier (iii) Neutrophils
system
D. Physiological (iv) HCl in gastric
B. Marijuana (ii) Slow down body barrier juice
function
Choose the correct answer from the options
C. Cocaine (iii) Painkiller given below:
(a) A-(iii), B-(i), C-(ii), D-(iv)
D. Morphine (iv) Interfere with
transport of (b) A-(ii), B-(iii), C-(iv), D-(i)
dopamine (c) A-(ii), B-(iii), C-(i), D-(iv)
(d) A-(iii), B-(iv), C-(ii), D-(i)
Choose the correct answer from the options
given below:
(a) A-(i), B-(ii), C-(iii), D-(iv)

601 CHANNEL
JOIN TELEGRAM
9. Given below are two statements: (2022) 3 Filariasis (iii) Salmonella
Statement I: Autoimmune disorder is a Malaria (iv) Haemophilus
4
condition where body defense mechanism
recognizes its own cells as foreign bodies. 1 2 3 4
Statement II: Rheymatoid arthritis is a (a) (iii) (iv) (i) (ii)
condition where body does not attack self (b) (ii) (i) (iii) (iv)
cells. (c) (iv) (i) (ii) (iii)
In the light of the above statements, choose (d) (i) (iii) (ii) (iv)
the most appropriate answer from the 13. The infectious stage of Plasmodium that
options given below: enters the human body is (2020)
(a) Both Statement I and Statement II are (a) Sporozoites
correct (b) Female gametocytes
(b) Both Statement I and Statement II are (c) Male gametocytes
incorrect (d) Trophozoites
(c) Statement I is correct but Statement II 14. Identify the wrong statement with reference
is incorrect to immunity (2020)
(d) Statement I is incorrect but Statement II (a) When ready-made antibodies are
is correct directly given, it is called passive
10. Select the incorrect statement with respect immunity
to acquired immunity. (2022) (b) Active immunity is quick and gives full
(a) Primary response is produced when out response
body encounters a pathogen for the first (c) Foetus receives some antibodies from
time. mother, it is an example for passive

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Anamnestic response is elicited on immunity
subsequent encounters with the same (d) When exposed to antigen (living or dead)
pathogen. antibodies are produced in the host’s
(c) Anamnestic response is due to memory body. It is called active immunity
of first encounter. 15. The yellowish fluid colostrum secreted by
(d) Acquired immunity is non-specific type mammary glands of mother during the
of defense present at the time of birth. initial days of lactation has abundant
11. Match the following (2021) antibodies (IgA) to protect the infant. This
List-I List-II type of immunity is called as
(2020 Covid Re-NEET)
(A) Filariasis (i) Haemophilus
influenzae (a) Active immunity
(b) Acquired immunity
(B) Amoebiasis (ii) Trichophyton
(c) Autoimmunity
(C) Pneumonia (iii) Wuchereria (d) Passive immunity
bancrofti 16. Colostrum, the yellowish fluid, secreted by
(D) Ringworm (iv) Entamoeba mother during the initial days of lactation is
histolytica very essential to impart immunity to the
new born infants because it contains
Choose the correct answer from the options
(2019)
given below
(a) Natural killer cells
(a) A-(iii) B-(iv) C-(i) D-(ii)
(b) Monocytes
(b) A-(i) B-(ii) C-(iv) D-(iii)
(c) Macrophages
(c) A-(ii) B-(iii) C-(i) D-(iv)
(d) Immunoglobulin A
(d) A-(iv) B-(i) C-(iii) D-(ii)
17. Which of the following immune responses is
12. Match the following diseases with the
responsible for rejection of kidney graft?
causative organism and select the correct
(2019)
option (2020)
Column - I Column – II
(a) Auto-immune response
(b) Humoral immune response
1 Typhoid (i) Wuchereria
(c) Inflammatory immune response
2 Pneumonia (ii) Plasmodium (d) Cell-mediated immune response

602 CHANNEL
JOIN TELEGRAM
18. Drug called Heroin is synthesised by (b) Acquired immunity is pathogen specific
(2019) (c) The exaggerated response of the immune
(a) Methylation of morphine system to certain antigens present in the
(b) Acetylation of morphine environment is called auto-immunity
(c) Glycosylation of morphine (e) Bone marrow acts as a filter of the blood
(d) Nitration of morphine by trapping blood borne micro-
19. Identify the correct pair representing the organisms
causative agent of typhoid fever and the 26. Match Column - I with Column - II and
confirmatory test for typhoid (2019) select the correct option (2017)
(a) Plasmodium vivax / UTI test Column – I Column – II
(b) Streptococcus pneumoniae / Widal test Plasmodium (i) Ringworm
(c) Salmonella typhi / Anthrone test A
(d) Salmonella typhi / Widal test B Wuchereria (ii) Amoebiasis
20. Which part of poppy plant is used to obtain C Entamoeba (iii) Elephantiasis
the drug Smack? (2018)
(a) Flowers D Microsporum (iv) Malaria

(b) Latex (a) A-(iv) B-(iii) C-(ii) D-(i)

(c) Roots (b) A-(iv) B-(i) C-(ii) D-(iii)
(d) Leaves (c) A-(iv) B-(iii) C-(i) D-(ii)
21. In which disease does mosquito transmitted (d) A-(i) B-(iii) C-(ii) D-(iv)
pathogen cause chronic inflammation of 27. Which of the following sets of diseases is
lymphatic vessels? (2018) caused by bacteria? (2016 - II)
(a) Psoriasis (a) Tetanus and mumps

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Rheumatoid arthritis (b) Herpes and influenza
(c) Alzheimer’s disease (c) Cholera and tetanus
(d) Vitiligo (d) Typhoid and smallpox
22. MALT constitutes about ___________ percent 28. Which of the following is correct regarding
of the lymphoid tissue in human body AIDS causative agent HIV? (2016 - II)
(2017) (a) HIV is undeveloped retrovirus
(a) 50% (b) HIV does not escape but attacks the
(b) 20% acquired immune response
(c) 70% (c) HIV is enveloped virus containing one
(d) 10% molecule of single-stranded RNA and one
23. In which disease does mosquito transmitted molecule of reverse transcriptase
pathogen cause chronic inflammation of (d) HIV is enveloped virus that contains two
lymphatic vessels? (2018) identical molecules of single-stranded
(a) Elephantiasis RNA and two molecules of reverse
(b) Ascariasis transcriptase
(c) Ringworm disease 29. Which of the following statement is not true
(d) Amoebiasis for cancer cells in relation to mutations?
24. Transplantation of tissues/organs fails (2016 - I)
often due to non-acceptance by the (a) Mutations in proto-oncogenes accelerate
patient’s body. Which type of immune- the cell cycle
response is responsible for such rejections? (b) Mutations destroy telomerase inhibitor
(2017) (c) Mutations inactivate the cell control
(a) Autoimmune response (d) Mutations inhibit production of
(b) Cell-mediated immune response telomerase
(c) Hormonal immune response 30. The organisms which cause diseases in
(d) Physiological immune response plants and animals are called (2016 - I)
25. Which of the following statement is correct? (a) Pathogens
(2017) (b) Vectors
(a) AIDS is caused by a group of viruses (c) Insects
called rhinovirus (d) Worms

603 CHANNEL
JOIN TELEGRAM
31. Antivenom injection contains preformed 36. The active form of Entamoeba histolytica
antibodies while polio drops that are feeds upon (2015)
administered into the body contain (a) Food in intestine
(2016-I) (b) Blood only
(a) Activated pathogens (c) Erythrocytes; mucosa and submucosa of
(b) Harvested antibodies colon
(c) Gamma globulin (d) Mucosa and submucosa of colon only
(d) Attenuated pathogens 37. Which of the following diseases is caused by
32. In higher vertebrates, the immune system a protozoan? (2015 Re)
can distinguish self-cells and non-self. If (a) Influenza
this property is lost due to genetic (b) Babesiosis
abnormality and it attacks self cells, then it (c) Blastomycosis
leads to (2016 - I) (d) Syphilis
(a) Allergic response 38. At which stage of HIV infection does one
(b) Graft rejection usually show symptoms of AIDS? (2014)
(c) Auto-immune disease (e) When the viral DNA is produced by
(d) Active immunity reverse transcriptase
33. Which of the following virus is not (f) Within 15 days of sexual contact with an
transferred through semen of an infected infected person
male? (2015) (g) When the infected retro virus enters
(a) Chikungunya virus host cells
(b) Ebola virus (h) When HIV damages large number of
(c) Hepatitis B virus helper T- lymphocytes

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) Human immunodeficiency virus 39. Which is the particular type of drug that is
34. Match each disease with its correct type of obtained from the plant whose one
vaccine (2015) flowering branch is shown below? (2014)
A Tuberculosis (i) Harmless virus (a) Pain-killer
Whooping (ii) Inactivated (b) Hallucinogen
B (c) Depressant
cough toxin
(d) Stimulant
C Diphtheria (iii) Killed bacteria 40. The cell-mediated immunity inside the
D Polio (iv) Harmless human body is carried out by (2013)
bacteria (a) Erythrocytes
(b) T-lymphocytes
(a) A-(iv) B-(iii) C-(ii) D-(i) (c) B-lymphocytes
(b) A-(i) B-(ii) C-(iv) D-(iii) (d) Thrombocytes
(c) A-(ii) B-(i) C-(iii) D-(iv) 41. Infection of Ascaris usually occurs by
(d) A-(iii) B-(ii) C-(iv) D-(i) (2013)
35. HIV that causes AIDS, first starts (a) Mosquito bite
destroying (2015) (b) Drinking water containing eggs of
(a) Helper T - Lymphocytes Ascaris
(b) Thrombocytes (c) Eating imperfectly cooked port
(c) B - Lymphocytes (d) Tse-tse fly
(d) Leucocytes

604 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (b) S32. Ans. (c)

S2. Ans. (a) S33. Ans. (a)

S3. Ans. (a) S34. Ans. (a)

S4. Ans. (d) S35. Ans. (a)

S5. Ans. (d) S36. Ans. (c)

S6. Ans. (d) S37. Ans. (b)

S7. Ans. (a) S38. Ans. (d)

S8. Ans. (a) S39. Ans. (b)

S9. Ans. (c) S40. Ans. (b)

S10. Ans. (d) S41. Ans. (b)

S11. Ans. (a)

S12. Ans. (a)

S13. Ans. (a)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (b)

S15. Ans. (d)

S16. Ans. (d)

S17. Ans. (d)

S18. Ans. (b)

S19. Ans. (d)

S20. Ans. (b)

S21. Ans. (a)

S22. Ans. (c)

S23. Ans. (a)

S24. Ans. (b)

S25. Ans. (b)

S26. Ans. (a)

S27. Ans. (c)

S28. Ans. (d)

S29. Ans. (d)

S30. Ans. (a)

S31. Ans. (d)

605 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(b)
Both syphilis and trichomoniasis are
curable. Syphilis is a bacterial infection
and can be cured with antibiotics,
typically penicillin. Trichomoniasis, as
mentioned above, is a parasitic infection
that can also be cured with antibiotics.
S2. Ans.(a)
Gonorrhoea is a sexually transmitted
disease caused by the bacterium
Neisseria gonorrhoeae. It can be
effectively treated with antibiotics,
especially when detected early.
S3. Ans.(a)
The correct answer is option (a) because
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
using conventional methods of diagnosis
like serum and urine analysis, etc, do
not help in early diagnosis.
S4. Ans.(d)
HIV, or the Human Immunodeficiency
virus, primarily infects CD+4 Tcells,
which are a type of T cell. In the context
of the options given, TH cells, or T
helper cells, are a subset of CD+4 T
cells.
S5. Ans.(d)
– Heroin belongs to the category of
opioids and it is a depressant that
slows down body functions.
– Murijuana is known for its effect on
the cardiovascular system of the
body.
– Cocaine interferes with the transport
of the neuro transmitter dopamine.
Morphine is used is a sedative and
painkiller.
606 CHANNEL
JOIN TELEGRAM
S6. Ans.(d)
The diseases listed in List-I are caused
by the organisms listed in List-II:
– Ringworm is caused by the fungus
Trichophyton.
– Filariasis is caused by the parasite
Wuchereria bancrofti.
– Malaria is caused by the protozoan
Plasmodium species (including
Plasmodium vivax).
– Pneumonia can be caused by a
variety of organisms, including the
bacterium Haemophilus influenzae.
S7. Ans.(a)
Option (a) is the correct answer as the
body is able to differentiate between
‘self’ and ‘non-self’ and the cell-mediated
immune response is responsible for the
graft rejection.
S8. Ans.(a)
Option (a) is the correct answer because
cellular barriers include NK cells,
macrophages (monocytes) and
neutrophils (PMNL).
Cytokine barriers include interferons.
Physical barriers include mucus
membranes and skin.
Physiological barriers include HCl in
gastric juice, saliva and tears etc.
S9. Ans.(c)
Option (c) is the correct answer as
autoimmune disorder is a condition
where body defense mechanism
recognizes its own cells as foreign
bodies. Sometimes, due to genetic and
 other unknown reasons, the body
attacks self-cells.
S10. Ans.(d)
Option (d) is the correct answer as
acquired immunity is a specific type of
defence which is not present at the time
of birth.
S11. Ans.(a)
1. Filariasis-Wuchereria bancrofti
2. Ringworm-Entamoeba histolytica
3. Pneumonia-Haemophilus influenzae
4. Ringworm-Trichophyton
S12. Ans.(a)
Typhoid is caused by pathogenic
bacterium Salmonella typhi. Pneumonia
is caused by Haemophilus influenzae.
Filariasis is caused by the filarial worm,
Wuchereria bancrofti and Wuchereria
malayi. Malaria is caused by different
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
species of Plasmodium.
S13. Ans.(a)
Plasmodium enters the human body as
sporozoites (Infectious stage) through the
bite of infected female Anopheles
mosquito.
S14. Ans.(b)
Active immunity is slow and takes time
to give its full/effective response.
S15. Ans.(d)
The yellowish fluid colostrum secreted by
mother during the initial days of
lactation has abundant antibodies (IgA)
to protect the infant. The foetus also
receives some antibodies from their
mother through the placenta during
pregnancy. These are some examples of
passive immunity
S16. Ans.(d)
Colostrum, the yellowish fluid, secreted
by the mother during initial days of
lactation is very essential to impart
immunity to the new born infant because
it contains antibodies (immunoglobulin
A). It will provide naturally acquired
passive immunity to the newborn
S17. Ans.(d)
607 CHANNEL
JOIN TELEGRAM
T-cells help body to differentiate self and
non-self cells and the cell-mediated
response is responsible for graft rejection
provided by T-lymphocytes.
S18. Ans.(b)
Heroin, commonly called smack, is
chemically diacetylmorphine which is
obtained by acetylation of morphine.
S19. Ans.(d)
Salmonella typhi is the causative agent
of typhoid. Confirmatory test is Widal
test which is based on antigen antibody
reaction.
S20. Ans.(b)
Smack is a drug obtained from latex of
plant Papaver somniferum.
S21. Ans.(a)
Elephantiasis, also known as lymphatic
filariasis, marked by severe swelling in
limbs and genitals with inflammation of
lymphatic vessels.
S22. Ans.(c)
Alzheimer’s disease or dementia is a
chronic neurodegenerative disorder.
S23. Ans.(a)
MALT is Mucosa Associated Lymphoid
Tissue and it constitutes about 50
percent of the lymphoid tissue in human
body.
S24. Ans.(b)
T-lymphocytes (T-cells) mediate CMI
(cell-mediated response/cell-mediated
immunity). CMI causes graft rejection.
The body is able to differentiate self and
non-self. Tissue matching and blood
group matching are essential before
undertaking any graft/ transplant. After
this, the patient has to take immune-
suppressants all his life.
S25. Ans.(b)
Acquired immunity is pathogen specific
and is characterised by memory.
S26. Ans.(a)
Plasmodium - Malaria .
Wuchereria - Ringworm .
 Entamoeba - Amoebiasis . S34. Ans.(a)
Microsporum - Elephantiasis Tuberculosis - Harmless bacteria
S27. Ans.(c) Whooping cough- Killed bacteria
Diptheria - Inactivated toxin
Cholera (Vibrio cholera) and tetanus
(Clostridium tetani) is a sets of diseases Polio - Harmless virus
which is caused by bacteria. Dysentery,
S35. Ans.(a)
plague, diphtheria, etc., are some of the
other bacterial diseases in human. HIV penetrates helper T cells, replicates
S28. Ans.(d) and creates offspring viruses during the
ensuing attack on macrophages. The
HIV (human immuno deficiency virus) is virus’s offspring which are discharged
the causative agent of AIDS which have into the bloodstream target the other
an envelope enclosing the RNA genome. helper T cell.
It contains two identical molecules of S36. Ans.(c)
ssRNA and two molecules of reverse
transcriptase. Entamoeba histolytica is a protozoan
S29. Ans.(d) parasite that lives in the human large
intestine. Abdominal pain and cramps,
Mutations does not inhibit production of faeces with extra mucus and blood clots
telomerase. are all symptoms of this condition.
S30. Ans.(a) S37. Ans.(b)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
A wide range of organisms including Syphilis - Bacterium (Treponema
bacteria, viruses, fungi, protozoans, pallidum) Influenza - Rhinovirus
helminthes, etc., cause diseases in Babesiosis - Protozoan Blastomycosis -
plants and animals. Such disease Fungus
causing organisms are called pathogens.
S38. Ans.(d)
Pathogens are carried by vectors, which
can be insects or worms. When HIV causes a high number of T-
S31. Ans.(d) lymphocytes to be damaged, the immune
system becomes perverted. In such a
Polio drops that are injected into the situation, a person may get
body contain attenuated germs. toxoplasmosis.
S32. Ans.(c) S39. Ans.(b)
The body fights self-cells for genetic and Datura has hallucinatory
other unexplained reasons. Auto- characteristics.
immune disease is the result of this and
S40. Ans.(b)
it causes damage to the body.
Rheumatoid arthritis is an auto-immune T-lymphocytes are primarily responsible
illness that affects a large number of for cellmediated immunity (CMI).
people in modern society. S41. Ans.(b)
S33. Ans.(a)
Infection occurs when a person
Chikungunya is transmitted via the bite consumes contaminated food and water
of the Aedes aegypti mosquito which does containing Ascaris eggs.
not require direct contact with body
fluids such as blood, sperm or saline.

608 CHANNEL
JOIN TELEGRAM
 Chapter 28
Sankalp Bharat
Biotechnology Principles and Processes

1. Ligation of foreign DNA at which of the 6. Match List-I with List-II: (2022)
following site will result in loss of tetracyclin List-I List-II
resistance of pBR322 : (2023) Gene gun (i) Replacement of a
(a) Pst I A.
faulty gene by a
(b) Pvu I normal healthy
(c) EcoR I gene
(d) BamH I
B. Gene (ii) Used for transfer of
2. Which of the following is not a cloning therapy gene
vector? (2023)
(a) YAC C. Gene (iii) Total DNA in the
(b) pBR322 cloning cells of an
(c) Probe organism
(d) BAC D. Genome (iv) To obtain identical
copies of a
3. Given below are two statements: one is
particular DNA
labelled as Assertion (A) and the other is
molecule
labelled as Reason (R).
Assertion (A): When a particular restriction

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Choose the correct answer from the options
enzyme cuts strand of DNA, overhanging given below:
stretches or sticky ends are formed. (a) A-(ii), B-(iii), C-(iv), D-(i)
Reason (R): Some restriction enzymes cut (b) A-(ii), B-(i), C-(iv), D-(iii)
the strand of DNA a little away from the (c) A-(i), B-(iii), C-(ii), D-(iv)
centre of palindromic site. (d) A-(iv), B-(i), C-(iii), D-(ii)
In the light of the above statements, choose
7. Pathogenic bacteria gain resistance to
the correct answer from the options given
antibiotics due to change in their: (2022)
below: (2022)
(a) Nucleoid
(a) (A) is not correct but (R) is correct
(b) Cosmids
(b) Both (A) and (R) are correct abd (R) is the
(c) Plasmids
correct explanation of (A)
(d) Nucleus
(c) Both (A) and (R) are correct but (R) is not
the correct explanation of (A) 8. Which of the following methods is not
(d) (A) is correct but (R) is not correct commonly used for introducing foreign DNA
into the plant cell? (2022)
4. Separation of DNA fragments is done by a
(a) Bacteriophages
technique known as (2022)
(b) Agrobacterium mediated
(a) Gel electrophoresis
transformation
(b) Polymerase Chain Reaction
(c) Gene gun
(c) Recombinant technology
(d) ‘Disarmed pathogen’ vectors
(d) Southern blotting
9. Refer to the following statements for
5. The enzyme (a) is needed for isolating
agarose-gel electrophoresis: (2022)
genetic material from plant cells and
A. Agarose is a natural polymer obtained
enzyme (b) for isolating genetic material
from sea-weed.
from fungus. Choose the correct pair of
B. The separation of DNA molecules in
options from the following: (2022)
agarose-gel electrophoresis depends on
(a) (a) Cellulase (b) Lipase
the size of DNA.
(b) (a) Cellulase (b) Protease
C. The DNA migrates from negatively-
(c) (a) Cellulase (b) Chitinase
charged electrode to the positively-
(d) (a) Chitinase (b) Lipase
charged electrode.
615 CHANNEL
JOIN TELEGRAM
 D. The DNA migrates from positively- (b) Both Statement I and Statement II are
charged electrode to the negatively- incorrect
charged electrode. (c) Statement I is correct but Statement II
Choose the most appropriate answer from is incorrect
the options given below: (d) Statement I is incorrect but Statement II
(a) B, C and D only is correct
(b) A and B only 13. Which of the following is not a desirable
(c) A, B and C only feature of a cloning vector? (2022)
(d) A, B and D only (a) Presence of origin of replication
10. Given below are two statements : one is (b) Presence of a marker gene
labelled as Assertion (A) and the other is (c) Presence of single restriction enzyme
labelled as Reason (R). (2022) site
Assertion (A): Polymerase chain reaction is (d) Presence of two or more recognition
used in DNA amplification.
sites
Reason (R): The ampicillin resistant gene is
used as a selectable marker to check 14. Match the organism with its use in
transformation. biotechnology (2020)
In the light of the above statements, choose 1. Bacillus (i) Cloning
the correct answer from the options given thuringiensis vector
below: Thermus (ii) Construction
(a) Both (A) and (R) are correct and (R) is 2.
aquaticus of first rDNA
the correct explanation of (A) molecule

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Both (A) and (R) are correct but (R) is not
the correct explanation of (A) 3. Agrobacterium (iii) DNA
(c) (A) is correct but (R) is not correct tumefaciens polymerase
(d) (A) is not correct but (R) is correct 4. Salmonella (iv) Cry proteins
11. Which one of the following statement is not typhimurium
true regarding gel electrophoresis 1 2 3 4
technique? (2022) (a) (iv) (iii) (i) (ii)
(a) The process of extraction of separated (b) (iii) (ii) (iv) (i)
DNA strands from gel is called elution (c) (iii) (iv) (i) (ii)
(b) The separated DNA fragments are (d) (ii) (iv) (iii) (i)
stained by using ethidium bromide 15. In gel electrophoresis, separated DNA
(c) The presence of chromogenic substrate fragments can be visualised with the help of
gives blue coloured DNA bands on the (2017, 2020)
gel (a) Ethidium bromide in UV radiation
(d) Bright orange coloured bands of DNA (b) Acetocarmine in UV radiation
can be observed in the gel when exposed (c) Ethidium bromide in infrared radiation
(d) Acetocarmine in bright blue light
to UV light
16. The sequence that controls the copy
12. Given below are two statements: (2022)
number of the linked DNA in the vector is
Statement I : Restriction endonucleases
termed (2020)
recognize specific sequence to cut DNA
(a) Ori site
known as palindromic nucleotide sequence.
(b) Palindromic sequence
Statement II : Restriction endonucleases
(c) Recognition site
cut the DNA strand a little away from the
(d) Selectable marker
centre of the palindromic site.
In the light of the above statements, choose 17. The specific palindromic sequence which is
the most appropriate answer from the recognized by EcoRI is
options given below: (2020)
(a) Both Statement I and Statement II are (a) 5′ - GGAACC - 3′
correct 3′ - CCTTGG - 5′

616 CHANNEL
JOIN TELEGRAM
 (b) 5′ - CTTAAG - 3′ antigen-
3′ - GAATTC - 5′ antibody
(c) 5′ - GGATCC - 3′ reactio
3′ - CCTAGG - 5′ ELISA (iv) Amplification
(d) 5′ - GAATTC - 3′ 4.
of nu-cleic
3′ - CTTAAG - 5′ acids
18. Identify the wrong statement with regard to 1 2 3 4
restriction enzymes (2020) (a) (ii) (i) (iv) (iii)
(a) They cut the strand of DNA at (b) (iv) (iii) (ii) (i)
palindromic sites (c) (ii) (i) (iii) (iv)
(b) They are useful in genetic engineering (d) (iii) (ii) (iv) (i)
(c) Sticky ends can be joined by restriction
23. Spooling is (2020 Covid Re-NEET)
enzyme
(a) Cutting of separated DNA bands from
(d) Each restriction enzyme functions by
the agarose gel
inspecting the length of a DNA sequence (b) Transfer of separated DNA fragments to
19. First discovered restriction endonuclease synthetic membranes
that always cuts DNA molecule at a (c) Collection of isolated DNA
particular point by recognising a specific (d) Amplification of DNA
sequence of six base pairs is 24. Select the correct statement
(2020 Covid Re-NEET) (2020 Covid Re-NEET)
(a) Adenosine deaminase (a) The polymerase enzyme joins the gene

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Thermostable DNA polymerase of interest and the vector DNA
(c) Hind II (b) Restriction enzyme digestions are
(d) EcoRI performed by incubating purified DNA
20. In a mixture, DNA fragments are separated molecules with the restriction enzymes
by (2013, 2020 Covid Re-NEET) of optimum conditions
(a) Restriction digestion (c) PCR is used for isolation and separation
(b) Electrophoresis of gene of interest
(c) Polymerase chain reaction (d) Gel electrophoresis is used for
(d) Bioprocess engineering amplification of a DNA segment
21. In recombinant DNA technology, antibiotics 25. Which one of the following equipment is
are used (2020 Covid Re-NEET) essentially required for growing microbes on
(a) To detect alien DNA a large scale for industrial production of
(b) To impart disease-resistance to the host enzymes? (2019)
plant (a) BOD incubator
(c) As selectable markers (b) Sludge digester
(d) To keep medium bacteria-free (c) Industrial oven
22. Match the following techniques or (d) Bioreactor
instruments with their usage 26. DNA precipitation out of a mixture of
(2020 Covid Re-NEET) biomolecules can be achieved by treatment
1. Bioreactor (i) Separation of with (2019)
DNA (a) Isopropanol
fragments (b) Chilled ethanol
Electrophoresis (ii) Production of (c) Methanol at room temperature
2.
large (d) Chilled chloroform
quantities of 27. Following statements describe the
products characteristics of the enzyme restriction
3. PCR (iii) Detection of endonuclease. Identify the incorrect
pathogen, statement (2019)
based on
617 CHANNEL
JOIN TELEGRAM
 (a) The enzyme cuts DNA molecule at 33. Which of the following restriction enzymes
identified position within the DNA produces blunt ends? (2016 - II)
(b) The enzyme binds DNA at specific sites (a) Xho I
and cuts only one of the two strands (b) Hind III
(c) The enzyme cuts the sugar-phosphate (c) Sal I
backbone at specific sites on each (d) Eco RV
strand 34. Which of the following is not a component
(d) The enzyme recognizes a specific of downstream processing? (2016 - II)
palindromic nucleotide sequence in the (a) Preservation
DNA (b) Expression
(c) Separation
28. The correct order of steps in Polymerase (d) Purification
Chain Reaction (PCR) is
(2018) 35. A foreign DNA and plasmid cut by the same
(a) Extension, Denaturation, Annealing restriction endonuclease can be joined to
form a recombinant plasmid using
(b) Annealing, Extension, Denaturation
(c) Denaturation, Extension, Annealing (2016 - II)
(d) Denaturation, Annealing, Extension (a) Polymerase-III
(b) Ligase
29. What is the criterion for DNA fragments (c) EcoRI
movement on agarose gel during gel (d) Taq polymerase
electrophoresis? (2017)
(a) The larger the fragment size, the farther 36. Stirred-tank bioreactors have been
designed for (2016 - II)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
it moves
(b) The smaller the fragment size, the (a) Availability of oxygen throughout the
farther it moves process
(c) Positively charged fragments move to (b) Ensuring anaerobic conditions in the
farther end culture vessel
(d) Negatively charged fragments do not (c) Purification of product
(d) Addition of preservatives to the product
move
37. Which of the following is a restriction
30. The process of separation and purification endonuclease? (2016 - I)
of expressed protein before marketing is (a) Hind II
called (2017) (b) Protease
(a) Upstream processing (c) DNase I
(b) Downstream processing (d) RNase
(c) Bioprocessing
(d) Postproduction processing 38. Taq polymerase enzyme is obtained from
(2016 - I)
31. A gene whose expression helps to identify (a) Thermus aquaticus
transformed cell is known as (2017) (b) Thiobacillus ferroxidans
(a) Selectable marker (c) Bacillus subtilis
(b) Vector (d) Pseudomonas putida
(c) Plasmid
(d) Structural gene 39. Which of the following is not a feature of the
plasmids? (2016 - I)
32. Restriction endonucleases are (2017) (a) Independent replication
(a) Used in genetic engineering for ligating
two DNA molecules (b) Circular structure
(b) Used for in vitro DNA synthesis (c) Transferable
(c) Synthesised by bacteria as part of their (d) Single-stranded
defense mechanism
(d) Present in mammalian cell for 40. The DNA molecule to which the gene of
interest is integrated for cloning is called
degradation of DNA when the cell dies (2015 Re)

618 CHANNEL
JOIN TELEGRAM
 (a) Vector 44. The colonies of recombinant bacteria
(b) Template appear white in contrast to blue colonies of
(c) Carrier non-recombinant bacteria because of
(d) Transformer (2013)
41. The cutting of DNA at specific locations (a) Inactivation of glycosidase enzyme in
became possible with the discovery of recombinant bacteria
(2015 Re) (b) Non-recombinant bacteria containing
(a) Probes beta-galactosidase
(b) Selectable markers (c) Insertional inactivation of alpha-
(c) Ligases
galactosidase in non-recombinant
(d) Restriction enzymes
42. The introduction of T-DNA into plants bacteria
involves (2015 Re) (d) Insertional inactivation of beta-
(a) Altering the pH of the soil, then heat
galactosidase in recombinant bacteria
shocking the plants
(b) Exposing the plants to cold for a brief 45. Which of the following is not correctly
period matched for the organism and its cell wall
(c) Allowing the plant roots to stand in water degrading enzyme? (2013)
(d) Infection of the plant by Agrobacterium (a) Fungi - Chitinase
tumifaciens (b) Bacteria - Lysozyme
43. Which vector can clone only a small (c) Plant cells - Cellulase
fragment of DNA? (2014) (d) Algae – Methylase
(a) Cosmid

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Bacterial artificial chromosome
(c) Yeast artificial chromosome
(d) Plasmid

619 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (d) S31. Ans. (a)

S2. Ans. (c) S32. Ans. (c)

S3. Ans. (b) S33. Ans. (d)

S4. Ans. (a) S34. Ans. (b)

S5. Ans. (c) S35. Ans. (b)

S6. Ans. (b) S36. Ans. (a)

S7. Ans. (c) S37. Ans. (a)

S8. Ans. (a) S38. Ans. (a)

S9. Ans. (c) S39. Ans. (d)

S10. Ans. (b) S40. Ans. (a)

S11. Ans. (c) S41. Ans. (d)

S12. Ans. (a) S42. Ans. (d)

S13. Ans. (d) S42. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (a) S44. Ans. (d)

S15. Ans. (a) S45. Ans. (d)

S16. Ans. (a)

S17. Ans. (d)

S18. Ans. (c)

S19. Ans. (c)

S20. Ans. (b)

S21. Ans. (c)

S22. Ans. (a)

S23. Ans. (c)

S24. Ans. (b)

S25. Ans. (d)

S26. Ans. (b)

S27. Ans. (b)

S28. Ans. (d)

S29. Ans. (b)

S30. Ans. (b)

620 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(d)
BamH I – The BamH I site is within the
tetR gene. If foreign DNA is inserted at
this site, it would disrupt the
tetracycline resistance gene, causing a
loss of tetracycline resistance.
S2. Ans.(c)
Option (c) is correct answer because a
single stranded DNA or RNA tagged with
a radioactive molecule is called a probe
and it helps in the detection of mutated
gene.
S3. Ans.(b)
Option (b) is the correct answer because
when restriction enzymes cut the strand
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
of DNA a little away from the centre of
the palindrome sites, but between the
same two bases on the opposite strands,
then single stranded portions are left at
the ends. These overhanging stretches
on each strand are called sticky ends.
S4. Ans.(a)
Option (a) is the correct answer because
separation of DNA fragments which is
carried out after restriction enzyme
digestion, is done by a technique known
as gel electrophoresis.
S5. Ans.(c)
Option (c) is the correct answer because
cellulase is used to isolate genetic
material from plant cells and chitinase
is used to isolate genetic material from
fungal cells.
S6. Ans.(b)
Option (b) is the correct answer because
621 CHANNEL
JOIN TELEGRAM
– Gene gun or biolistics is a direct
gene transfer method suitable for
plant cell.
– Gene therapy involves replacement of
a faulty gene by a normal healthy
gene.
– Gene cloning is done to make
identical copies of a particular DNA
molecule.
– Genome is the total DNA in the cells
of an organism.
S7. Ans.(c)
Plasmid is small circular DNA outside
the genomic DNA. The plasmid DNA
confers certain unique phenotypic
characters to the bacteria such as
resistance to antibiotics.
S8. Ans.(a)
Option (a) is the correct answer because
bacteriophages act as a cloning vector
for bacterial cells, not the plant cells.
S9. Ans.(c)
Option (c) is the correct answer as the
most commonly used matrix in gel
electrophoresis is agarose which is a
natural polymer extracted from sea
weeds.
S10. Ans.(b)
Both the statements are correct but the
given reason is not the correct
explanation. Polymerase chain reaction
is used in DNA amplification.
Ampicillin resistance gene is a
selectable marker that helps to check
transformation by selection of
transformants.
S11. Ans.(c)
Option (c) is the incorrect statement, as
bright coloured bands of DNA can be
observed in the gel when EtBr (Ethidium
bromide) treated DNA is exposed to UV
light.
S12. Ans.(a)
Option (a) is the correct answer because
both the statements I and II are correct.
Each restriction endonuclease
recognizes a specific palindromic
nucleotide sequences in the DNA. It will
bind to the DNA and cut each of the two
strands of double helix at specific
points. Restriction enzymes cut the
strand of DNA a little away from the
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
centre of the palindrome site; but
between the same two bases on the
opposite strands. So both the
statements I and II are correct.
S13. Ans.(d)
Option (d) is the correct answer. Cloning
vectors are the carriers of the desired
gene in the host cell. The features
desirable in a cloning vector are :
– Presence of origin of replication
– Presence of marker genes
– Presence of very few, preferably
single recognition site for the
commonly used restriction enzymes
S14. Ans.(a)
Bacillus thuringiensis is a bacteria that
produces Cry proteins.
• Thermus aquaticus is a bacteria that
lives in water and a source of
thermostable DNA polymerase (Taq
polymerase).
622 CHANNEL
JOIN TELEGRAM
• Salmonella typhimurium – Used in the
production of the first rDNA molecule.
Agrobacterium tumefaciens – Cloning
vector.
S15. Ans.(a)
DNA fragments are created when
restriction endonucleases cleave the
DNA at restriction site. Gel
electrophoresis is a technique that can
be used to separate these fragments.
Only after dyeing the DNA with a
chemical called ethidium bromide and
then exposing it to UV and produce
bright orange coloured bands of DNA.
S16. Ans.(a)
Origin of replication (ori): This is a
sequence from which replication begins
and any fragment of DNA can be forced
to replicate within the host cells if it is
linked to this sequence. This sequence
is also regulate the quantity of copies of
linked DNA.
S17. Ans.(d)
Each restriction endonuclease
recognises nucleotide sequences in DNA
that are palindromic. EcoRI recognises
the palindromic sequence 5′ - GAATTC -
3′ 3′ - CTTAAG - 5′ as a distinct
palindromic sequence. The sticky ends
create hydrogen connections with their
complementary counterparts.
S18. Ans.(c)
Sticky ends are joined by DNA ligase
enzyme not by restriction enzymes. DNA
ligase seal the ends but restriction
enzymes cut the DNA at their restriction
site. Both are used to insert genes and
other pieces of DNA into plasmids
during DNA cloning.
S19. Ans.(c)
Five years later, the first restriction
endonuclease, Hind II, was isolated and
described. Its function was dependent
on a certain DNA nucleotide sequence.
Hind II always cut DNA molecules at a
specific location by recognising a six-
base pairs sequence.
5′ – G – T –C – G – A – C –3′
3′ – C – A –G – C – T – G –5′
S20. Ans.(b)
Gel electrophoresis is a technique that
can separate DNA fragments in a
mixture based on their size. DNA
samples are put into wells at one end of
a gel and an electric current is used to
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
down the samples through the gel.
Negatively charged DNA pieces move
toward the positive electrode (anode).
S21. Ans.(c)
Antibiotics are employed as selective
markers in recombinant DNA
technology. Selectable markers aid in
the identification and elimination of non
transformants as well as the selective
growth of transformants.
S22. Ans.(a)
• Bioreactor — A large-scale production
facility for items such as proteins.
• Electrophoresis is a technology that is
used to separate DNA fragments based
on their size.
• PCR (Polymerase Chain Reaction) —
This method is used to multiply nucleic
acids.
• ELISA (Enzyme-linked immunosorbent
test) is a pathogen detection method
623 CHANNEL
JOIN TELEGRAM
based on the antigen-antibody
interaction
S23. Ans.(c)
Using a glass rod or a wooden spooling
stick, gently push the ethanol down into
the DNA solution during DNA
extraction. Because the charged DNA
molecules migrate away from the
ethanol, they can be scooped up and
whirled around a glass rod or a wooden
spooling stick. This is referred to as
DNA spooling. Long strands of DNA can
be isolated from a solution via DNA
spooling.
S24. Ans.(b)
• In order to perform restriction enzyme
digestions, pure DNA molecules are
incubated with the restriction enzyme
under the best conditions for that
enzyme. To monitor the progress of
restriction enzyme digestion, agarose gel
electrophoresis is used.
• The gene of interest and the vector
DNA are joined by DNA ligase. The
technique of gel electrophoresis is used
to isolate and separate genes of interest.
• The PCR method is used to amplify a
DNA fragment.
S25. Ans.(d)
Bioreactors are essential for the large-
scale synthesis of enzymes. Bioreactors
are used in large-scale production.
S26. Ans.(b)
Chilled ethanol is used to precipitate
DNA during the isolation of a targeted
gene. In the suspension, this can be
viewed as a collection of fine threads.
S27. Ans.(b)
Restriction enzymes recognise a specific
sequence and cut DNA molecules at that
location. The length of a DNA sequence
is checked by each restriction
endonuclease. It will connect to the DNA
and cut each of the two strands of the
double helix at precise spots in their
sugar-phosphate backbone after found
its specific recognition sequence.
S28. Ans.(d)
Denaturation of double-stranded DNA is
followed by the annealing of short
oligonucleotide chains known as
primers and finally the DNA polymerase
extends or elongates the newly created
strand and amplifying the amount of
S32. Ans.(c)
• Restriction endonuclease recognises
and cleaves foreign DNA in the bacterial
cell, killing invading organisms.
• DNA polymerisation enzymes
Polymerase III and Taq polymerase add
deoxyribonucleotides to the primer in a
5′ to 3′ direction.
• EcoR I is an E.coli restriction enzyme
that digests DNA at 5′ - GAATTC - 3′
sites.
• The DNA ligase enzyme forms a
phosphodiester link between a 3′
hydroxyl at one end of one fragment and
a 5′ phosphate at the other end of
another fragment to connect two DNA

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
fragments together.
DNA.
• Using DNA ligase, foreign DNA and a
S29. Ans.(b)
plasmid with complementary ends can
The agarose gel’s sieving function
be ligated.
separates (resolves) the DNA fragments
according to their size. As a result, the S33. Ans.(d)

smaller the piece, the further it travels.

S30. Ans.(b)
• After the biosynthetic stage,
downstream processing involves a
variety of activities such as product
separation and purification.
S34. Ans.(b)
• The product is made with appropriate The procedures include separation and
preservatives. As with pharmaceuticals, purification, which are collectively
such formulations must go through referred to as downstream processing.
clinical testing. Each product must also
S35. Ans.(b)
undergo stringent quality control
The resultant DNA fragments have the
testing.
same kind of sticky-ends when cut by
S31. Ans.(a) the same restriction enzyme and they
Selectable marker (marker gene) aids in can be linked together (end-to-end)
the selection of transformants and the using DNA ligases.
elimination of nontransformants.
624 CHANNEL
JOIN TELEGRAM
S36. Ans.(a) S42. Ans.(d)
A bioreactor provides the best Agrobacterium tumifaciens, a pathogen
circumstances for producing the desired that affects a variety of dicot plants,
may transfer a piece of T-DNA into
product by allowing for optimal growth plant cells.
(temperature, pH, substrate, salts, S43. Ans.(d)
vitamins, oxygen). The stirrer ensures Plasmids can have one or two copies per
that the bioreactor is evenly mixed and cell. Plasmid is a DNA cloning vector
that only clones a short segment of
that oxygen is available throughout. DNA. Plasmids are circular
Stirring bioreactors are the most often extrachromosomal DNA replicate on
their own. They are the most often
utilised.
used and standard cloning vectors. The
S37. Ans.(a) pBR322 plasmid was one of the
first widely used cloning vectors.
Hind II was the first restriction
S44. Ans.(d)
endonuclease discovered.
In recombinant bacteria, beta-
S38. Ans.(a) galactosidase is inactivated due to
A thermostable DNA polymerase (Taq insertional inactivation and it would
not convert the chromogenic substrate
polymerase) is obtained from Thermus to blue coloured molecule. It will

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
aquaticus, a bacterium that remains produce white coloured colonies
and aids in the selection of
active under high temperature driven
recombinants from the non-
denaturation of double stranded DNA recombinant bacteria.
S39. Ans.(d) S45. Ans.(d)
Plasmid is a self-replicating, double The cell wall of algae is composed of
circular extrachromosomal DNA cellulose, which is degraded by
that replicates independently cellulase.
S40. Ans.(a)
Vectors are DNA molecules that can
carry foreign DNA (gene of interest) and
multiply inside host cells. Plasmids,
bacteriophages, cosmids, phagmids,
YAC.
S41. Ans.(d)
Two enzymes that limit the proliferation
of bacteriophages in bacteria were
found in 1963. The second enzyme
recognises a specific DNA sequence and
cuts the DNA molecule at a
specified location.

625 CHANNEL
JOIN TELEGRAM
 Chapter 27
Microbes in Human Welfare Sankalp Bharat

1. Match List-I with List-II. (2021) 5. For the commercial and industrial
List-I List-II production of Citric Acid, which of the
Aspergillus (i) Acetic Acid following microbes is used?
(A) (2020 Covid Re-NEET)
niger
Acetobacter (ii) Lactic Acid (a) Lactobacillus sp
(B) (b) Saccharomyces cerevisiae
aceti
(c) Clostridium butylicum
(C) Clostridium (iii) Citric Acid
(d) Aspergillus niger
butylicum
6. Match the following columns and select the
(D) Lactobacillus (iv) Butyric acid
correct option: (2020 Covid Re-NEET)
Choose the correct answer from the options Column-I Column-II
given below. Dragonflies (i)
1. Biocontrol
(a) A-i B-ii C-iii D-iv
agents of
(b) A-ii B-iii C-i D-iv
several plant
(c) A-iv B-ii C-i D-iii
(d) A-iii B-i C-iv D-ii pathogens
2. Which of the following is put into Anaerobic (ii) Get rid of
2. Bacillus

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
sludge digester for further sewage Aphids and
treatment? (2020) thuringiensis
mosquitoes
(a) Floating debris
3. Glomus (iii) Narrow
(b) Effluents of primary treatment
(c) Activated sludge spectrum
(d) Primary sludge insecticidal
3. Match the following columns and select the applications
correct option. (2020)
4. Baculoviruses (iv) Biocontrol
Column - I Column - II
agents of
1. Clostridium (i) Cyclosporin-A
lepidopteran
butylicum
2. Trichoderma (ii) Butyric acid plant pests
polysporum (v) Absorb
3. Monascus (iii) Citric acid
phosphorus
purpureus
from soil
4. Aspergillus (iv) Blood cholesterol
niger (1) (2) (3) (4)
lowering agent
(a) (ii) (i) (iii) (iv)
(1) (2) (3) (4) (b) (ii) (iii) (iv) (v)
(a) (ii) (i) (iv) (iii) (c) (ii) (iv) (v) (iii)
(b) (i) (ii) (iv) (iii) (d) (iii) (v) (iv) (i)
(c) (iv) (iii) (ii) (i) 7. Cyclosporin A, used as immuno-
(d) (iii) (iv) (ii) (i) suppression agent, is produced from:
4. Secondary metabolites such as nicotine, (2020 Covid Re-NEET)
strychnine and caffeine are produced by (a) Saccharomyces cerevisiae
plants for their: (2020) (b) Penicillium notatum
(a) Growth response (c) Trichoderma polysporum
(b) Defence action (d) Monascus purpureus
(c) Effect on reproduction 8. Match the following organisms with the
(d) Nutritive value products they produce (2019)

609 CHANNEL
JOIN TELEGRAM
 A. Lactobacillus (i) Cheese (d) Sludge treatment
Saccharomyces (ii) Curd 15. A genetically engineered bacterium first
B.
cerevisiae used for cleaning the oil spills, was a
C. Aspergillus niger (iii) Citric Acid species of: (2017)
Acetobacter aceti (iv) Bread (a) Rhizobium
D.
(b) Escherichia
(v) Acetic Acid
(c) Pseudomonas
Select the correct option. (d) Bacillus
(A) (B) (C) (D) 16. Match Column-I with Column-II and select
(a) (ii) (iv) (v) (iii) the correct option using the codes given
(b) (ii) (iv) (iii) (v) below (2016-II)
(c) (iii) (iv) (v) (i) Column-I Column-II
(d) (ii) (i) (iii) (v) Citric acid (i) Trichoderma
A.
9. Which of the following can be used as a
B Cyclosporin A (ii) Clostridium
biocontrol agent in the treatment of plant
disease? (2019) C. Statins (iii) Aspergillus
(a) Trichoderma
D. Butyric acid (iv) Monascus
(b) Chlorella
(c) Anabaena Codes:
(d) Lactobacillus (a) A-(i) B-(iv) C-(ii) D-(iii)
10. Which of the following is a commercial blood (b) A-(iii) B-(iv) C-(i) D-(ii)
cholesterol lowering agent? (2019) (c) A-(iii) B-(i) C-(ii) D-(iv)
(a) Cyclosporin A (d) A-(iii) B-(i) C-(iv) D-(ii)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Statin 17. Which of the following is wrongly matched
(c) Streptokinase in the given table? (2016-I)
(d) Lipases Microbe Product Application
11. Select the correct group of biocontrol (a) Trichoderma Cyclosp Immunosup
agents. (2019) orin A pressive
(a) Bacillus thuringiensis, Tobacco mosaic Monascus Statins Lowering of
(b)
virus, Aphids
(c) Streptococcus Strepto Removal of
(b) Trichoderma, Baculovirus, Bacillus kinase clot
thuringiensis
(c) Oscillatoria, Rhizobium, Trichoderma from blood
(d) Nostoc, Azospirillium, vessel
Nucleopolyhedrovirus (d) Clostridium Lipase Removal
12. Conversion of milk to curd improves its
butylicum
nutritional value by increasing the amount
of: (2018) 18. Match the following list of microbes and
(a) Vitamin D their importance: (2015 Re)
(b) Vitamin A A. Saccharomy (i) Production of
(c) Vitamin B12 ces Immunosuppre-
(d) Vitamin E cerevisiae ssiveagents
13. Which of the following is correctly matched Monascus (ii)
B. Ripening of Swiss
for the product produced by them? (2017) purpureus
(a) Acetobacter aceti : Antibiotics cheese
(b) Methanobacterium : Lactic acid C. Trichoderm (iii) Commercial
(c) Penicillium notatum : Acetic acid a production
(d) Saccharomyces cerevisiae : Ethanol
polysporum of ethanol
14. Which of the following in sewage treatment
removes suspended solids? (2017) D. Propionibac (iv) Production of blood
(a) Tertiary treatment terium cholesterol
(b) Secondary treatment sharmanii lowering
(c) Primary treatment agents

610 CHANNEL
JOIN TELEGRAM
 (a) A-(iv) B-(iii) C-(ii) D-(i)
(b) A-(iv) B-(ii) C-(i) D-(iii)
(c) A-(iii) B-(i) C-(iv) D-(ii)
(d) A-(iii) B-(iv) C-(i) D-(ii)
19. During sewage treatment, biogases are
produced which include: (2013)
(a) Hydrogen sulphide, nitrogen, methane
(b) Methane, hydrogen sulphide, carbon
dioxide
(c) Methane, oxygen, hydrogen sulphide
(d) Hydrogen sulphide, methane, sulphur
dioxide
20. A good producer of citric acid is: (2013)
(a) Saccharomyces
(b) Aspergillus
(c) Pseudomonas
(d) Clostridium

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

611 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (d)

S2. Ans. (c)

S3. Ans. (a)

S4. Ans. (b)

S5. Ans. (d)

S6. Ans. (c)

S7. Ans. (c)

S8. Ans. (b)

S9. Ans. (a)

S10. Ans. (b)

S11. Ans. (b)

S12. Ans. (c)

S13. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (c)

S15. Ans. (c)

S16. Ans. (d)

S17. Ans. (d)

S18. Ans. (d)

S19. Ans. (b)

S20. Ans. (b)

612 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(d)
A. (iii)
B. (i)
C. (iv)
D. (ii)
S2. Ans.(c)
The effluent is passed through a settling
tank after significant reduction of BOD
in sewage or waste water. In this tank,
the bacterial flocs are allowed to
settle. Activated sludge is the name for
this type of silt. To serve as the
inoculum, a small portion of the
activated sludge is fed back into the
aeration tank. The sludge that remains
is poured into enormous tanks known
as anaerobic sludge digesters.
S3. Ans.(a)
Butyric acid is produced by Clostridium
insects and other arthropods. These
viruses are ideal possibilities for
insecticidal applications that are
species-specific and have a restricted
scope.
S7. Ans.(c)
The fungus Trichoderma polysporum
produces cyclosporin A, a bioactive
chemical that is utilised as an
immunosuppressive treatment in organ
transplant patients.
S8. Ans.(b)
Microbes are employed in the
manufacturing of a variety of consumer
and industrial goods. Lactobacillus, for
example, is responsible for the
production of curd. Saccharomyces
cerevisiae is a yeast that is used to
make bread. Citric acid synthesis

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
butylicum. Cyclosporin-A from
Trichoderma polysporum Monascus
purpureus is a plant that lowers blood
cholesterol levels. Citric acid -
Aspergillus niger
S4. Ans.(b)
Plants produce secondary metabolites
such as nicotine, strychnine, and
caffeine as a defence mechanism
against grazers and browsers.
S5. Ans.(d)
Citric acid is produced commercially
and industrially by the fungus
Aspergillus niger.
S6. Ans.(c)
Aphids and mosquitoes can be
controlled with the help of dragonflies.
Bacillus thuringiensis is an example of
a microbial biocontrol agent that can be
used to control caterpillars of butterflies
and plant pests of lepidopterans.
Mycorrhizae are formed by many
species of the Glomus genus. In these
connections, the fungal symbiont
obtains phosphorus from the soil and
passes it on to the plant. Baculoviruses
are parasitic viruses that infect
by Aspergillus niger Acetobacter aceti is
a bacteria that produces acetic acid.
S9. Ans.(a)
The fungus Trichoderma is being
developed as a biological control agent
for the treatment of plant diseases.
S10. Ans.(b)
• Monascus purpureus is a yeast
(fungus) that produces statin.
• It works by competitively blocking the
Enzyme responsible for cholesterol
synthesis, and it has been
commercialised as a blood-
cholesterol- lowering drug.
S11. Ans.(b)
Biocontrol agents include Trichoderma
fungi, Baculoviruses (NPV), and Bacillus
thuringiensis. Biofertilisers such as
Rhizobium, Nostoc, Azospirillum, and
Oscillatoria are utilised, while
TMV is a disease and aphids are pests
that injure crop plants.
S12. Ans.(c)
Vitamin B12 content improves the
conversion of milk to curd.

613 CHANNEL
JOIN TELEGRAM
S13. Ans.(d) S17. Ans.(d)
Brewer’s yeast is the scientific name for Clostridium butylicum (a bacteria)
Saccharomyces cerevisiae. It induces generates butyric acid
carbohydrate fermentation, which S18. Ans.(d)
results in the production of Saccharomyces - Commercial
ethanol. cerevisiae production of
S14. Ans.(c) ethanol
Primary treatment is a physical Monascus - Production of blood
procedure that involves filtering and purpureus cholesterol lowering
sedimentation in a sequential order.
agents
S15. Ans.(c)
Trichoderma - Production of
A Pseudomonas species was the first
genetically modified bacterium used to polysporum immunosuppressive
clean up oil spills. agents
S16. Ans.(d) Propionibacterium - Ripening of Swiss
Citric acid is produced by Aspergillus sharmanii cheese
niger (a fungus), acetic acid is produced S19. Ans.(b)
by Acetobacter aceti (a bacterium), Biogas is a mixture of gases that mostly
butyric acid is produced by Clostridium consists of methane, hydrogen sulphide,
butylicum (a bacterium), and lactic acid and carbon dioxide.

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
is produced by Lactobacillus (a S20. Ans.(b)
bacterium).
A good producer of citric acid is
Statins, which are made by the yeast Aspergillus
Monascus purpureus, are used to
decrease blood cholesterol levels. It
works by blocking the enzyme
responsible for cholesterol synthesis in
a competitive manner. The fungus
Trichoderma polysporum produces
cyclosporin A, which is utilised as an
immunosuppressive medication in
organ transplant patients.

614 CHANNEL
JOIN TELEGRAM
 Chapter 29
Sankalp Bharat
Biotechnology and Its Application

1. Which of the following can act as molecular C. Isolation of desired DNA fragment
scissors? (2023) D. Amplification of gene of interest using
(a) Restriction enzymes PCR
(b) DNA ligase Choose the correct answer from the options
(c) RNA polymerase given below:
(d) DNA polymerase
(a) C, A, B, D
2. Match List-I with List-II: (2023) (b) C, B, D, A
List-I List-II (c) B, D, A, C
Gene therapy (i) Separation of (d) B, C, D, A
A.
DNA 6. Milk of transgenic ‘Cow Rosie’ was
fragments nutritionally more balanced product for
B. RNA (ii) Diagnostic human babies than natural cow milk
interference test for AIDS because it contained: (2022)
(a) Human enzyme Adenosine Deaminase
C. ELISA (iii) Cellular
(ADA)
defence
(b) Human protein -1-antitrypsin
D. Gel (iv) Allows

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) Human alpha-lactalbumin
Electrophoresis correction of a (d) Human insulin-like growth factor
gene defect
7. In the following palindromic base sequences
Choose the correct answer from the options of DNA, which one can be cut easily by
given below: particular restriction enzyme? (2022)
(a) A-(iv), B-(i), C-(ii), (iii) (a) 5’GATACT3′ ; 3′ CTATGA5′
(b) A-(iv), B-(ii), C-(iii), D-(i) (b) 5′ GAATTC3′ ; 3′ CTTAAG5′
(c) A-(iv), B-(iii), C-(ii), D-(i) (c) 5′ CTCAGT3′ ; 3′ GAGTCA5′
(d) A-(iv), B-(iii), C-(i), D-(ii) (d) 5′ GRATTC3′ ; 3′ CATAAG5′
3. During the purification process for 8. In gene therapy of Adenosine Deaminase
recombinant DNA technology, addition of (ADA) deficiency, the patient requires
chilled ethanol precipitates out (2023) periodic infusion of genetically engineered
(a) DNA lymphocytes because : (2022)
(b) Histones (a) Retroviral vector is introduced into
(c) Polysaccharides these lymphocytes
(d) RNA (b) Gene isolated from marrow cells
4. In gene gun method used to introduce alien producing ADA is introduced into cell s
DNA into host cells, microparticles of ______ at embryonic stages
metal are u (2023) (c) Lymphocytes from patient’s blood are
(a) Zinc growth in culture, outside the body
(b) Tungsten or gold (d) Genetically engineered lymphocytes are
(c) Silver not immortal cells
(d) Copper
9. Statements related to human Insulin are
5. Main steps in the formation of Recombinant given below. (2022)
DNA are given below. (2023) Which statements is/are correct about
A. Insertion of recombinant DNA into the genetically engineered Insulin?
host cell A. Pro-hormone insulin contain extra
B. Cutting of DNA at specific location by stretch of C-peptide.
restriction enzyme

626 CHANNEL
JOIN TELEGRAM
 B. A-peptide and B-peptide chains of 4. PCR (iv) Bacillus
insulin were produced separately in thuringiensis
E.coli, extracted and combined by
creating disulphide bond between them. 1 2 3 4
C. Insulin used for treating Diabetes was (a) (iii) (ii) (i) (iv)
extracted from Cattles and Pigs. (b) (ii) (iii) (iv) (i)
D. Pro-hormone Insulin needs to be (c) (i) (ii) (iii) (iv)
processed for converting into a mature (d) (iv) (i) (ii) (iii)
and functional hormone. 14. Bt cotton variety that was developed by the
E. Some patients develop allergic reactions introduction of toxin gene of Bacillus
to the foreign insulin. thuringiensis (Bt) is resistant to (2020)
Choose the most appropriate answer from (a) Fungal diseases
the options given below: (b) Plant nematodes
(c) Insect predators
(a) A, B and D only
(d) Insect pests
(b) B only
15. The laws and rules to prevent unauthorised
(c) C and D only
exploitation of bio-resources are termed as
(d) C, D and E only
(2020 Covid Re-NEET)
10. When gene targeting involving gene (a) Bioethics
amplification is attempted in an individual’s (b) Bioengineering
tissue to treat disease, it is known as (2021) (c) Biopiracy
(a) Gene therapy (d) Biopatenting
(b) Molecular diagnosis 16. RNA interference is used for which of the

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(c) Safety testing following purposes in the field of
(d) Biopiracy biotechnology? (2020 Covid Re-NEET)
11. Adenosine deaminase deficiency results (a) To develop a pest resistant plant against
into (2021) infestation by nematode
(a) Parkinson’s disease (b) To enhance the mineral usage by the
(b) Digestive disorder plant
(c) Addison’s disease (c) To reduce post harvest losses
(d) Dysfunction of Immune system (d) To develop a plant tolerant to abiotic
12. Which of the following statement is not stresses
correct? (2020) 17. Which of the following is true for Golden
(a) The proinsulin has an extra peptide rice? (2019)
called C-peptide (a) It is vitamin A enriched, with a gene from
(b) The functional insulin has A and B daffodil
chains linked together by hydrogen (b) It is pest resistant, with a gene from
bonds Bacillus thuringiensis
(c) Genetically engineered insulin is (c) It is drought tolerant, developed using
produced in E. coli Agrobacterium vector
(d) In man, insulin is synthesised as a (d) It has yellow grains, because of a gene
Proinsulin introduced from a primitive variety of
13. Match the following columns and select the rice
correct option (2020) 18. Which of the following is commonly used as
Column - I Column - II a vector for introducing a DNA fragment in
Bt cotton (i) Gene therapy human lymphocytes? (2018)
1.
(a) Retrovirus
2. Adenosine (ii) Cellular (b) Ti plasmid
deaminase defense (c) λ phage
deficiency (d) pBR322
3. RNAi (iii) Detection of
HIV infection

627 CHANNEL
JOIN TELEGRAM
19. In India, the organisation responsible for (d) Cotton produced by biotechnology using
assessing the safety of introducing restriction enzyme and ligases to resist
genetically modified organisms for public 25. Which kind of therapy was given in 1990 to
use is (2015, 2018) a four year old girl with adenosine
(a) Indian Council of Medical Research deaminase (ADA) deficiency? (2016 - II)
(ICMR) (a) Immunotherapy
(b) Council for Scientific and Industrial (b) Radiation therapy
Research (CSIR) (c) Gene therapy
(c) Research Committee on Genetic (d) Chemotherapy
Manipulation (RCGM) 26. Which part of the tobacco plant is infected
(d) Genetic Engineering Approval by Meloidogyne incognita? (2016-I)
Committee (GEAC) (a) Flower
20. A new variety of rice was patented by a (b) Leaf
foreign company though such varieties have (c) Stem
been present in India for a long time. This (d) Root
is related to (2018) 27. The two polypeptides of human insulin are
(a) Co-667 linked together by (2016-I)
(b) Sharbati Sonora (a) Hydrogen bonds
(c) Lerma Rojo (b) Phosphodiester bond
(d) Basmati (c) Covalent bond
21. Use of bioresources by multinational (d) Disulphide bridges
companies and organisations without 28. In Bt cotton, the Bt toxin present in plant
authorisation from the concerned country tissue as protoxin is converted into active

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
and its people is called (2018) toxin due to (2015, 2019)
(a) Bio-infringement (a) Action of gut micro-organism
(b) Biopiracy (b) Presence of conversion factors in insect
(c) Biodegradation gut
(d) Bioexploitation (c) Alkaline pH of the insect gut
22. Which technique helps to identify a (d) Acidic pH of the insect gut
bacterial or viral pathogen in a human body 29. Golden rice is a genetically modified crop
even when its concentration is very low and plant where the incorporated gene is meant
clinical symptoms are not yet visible? for biosynthesis of (2015 Re)
(2017) (a) Vitamin C
(a) Differential leucocyte count (b) Omega 3
(b) ELISA (c) Vitamin A
(c) Total leucocyte count (d) Vitamin B
(d) PCR 30. ADA is an enzyme which is deficient in a
23. In gene therapy to treat adenosine genetic disorder SCID. What is the full form
deaminase deficiency disorder, which of the of ADA? (2014)
patients blood cells are used? (2017) (a) Adenosine DeoxyAminase
(a) Thrombocytes (b) Adenosine Deaminase
(b) Erythrocytes (c) Aspartate Deaminase
(c) Lymphocytes (d) Arginine Deaminase
(d) Both Erythrocytes and Lymphocytes 31. In vitro clonal propagation in plants is
24. What is the meaning of Bt in Bt cotton? characterised by (2014)
(2017) (a) Microscopy
(a) Cotton seeds carrying an endotoxin gene (b) PCR and RAPD
from Bacillus thuringiensis against pink (c) Northern blotting
boll–worm (d) Electrophoresis and HPLC
(b) Baculovirus treated cotton seeds against 32. The first human hormone produced by
pink boll – worm recombinant DNA technology is (2014)
(c) Bigger thread of disease resistant cotton (a) Progesterone
with better tensile strength (b) Insulin

628 CHANNEL
JOIN TELEGRAM
 (c) Estrogen
(d) Thyroxin
33. Which of the following Bt crop is being
grown in India by the farmers? (2013)
(a) Soyabean
(b) Maize
(c) Cotton
(d) Brinjal

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

629 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (a) S32. Ans. (b)

S2. Ans. (c) S33. Ans. (c)

S3. Ans. (a)

S4. Ans. (b)

S5. Ans. (d)

S6. Ans. (c)

S7. Ans. (b)

S8. Ans. (d)

S9. Ans. (a)

S10. Ans. (a)

S11. Ans. (d)

S12. Ans. (b)

S13. Ans. (d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (d)

S15. Ans. (c)

S16. Ans. (a)

S17. Ans. (a)

S18. Ans. (a)

S19. Ans. (d)

S20. Ans. (d)

S21. Ans. (b)

S22. Ans. (d)

S23. Ans. (c)

S24. Ans. (a)

S25. Ans. (c)

S26. Ans. (d)

S27. Ans. (d)

S28. Ans. (c)

S29. Ans. (c)

S30. Ans. (b)

S31. Ans. (b)

630 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(a)
Restriction enzymes, also known as
restriction endonucleases, act as
molecular scissors in molecular biology.
They recognize specific DNA sequences
in a molecule and then cut the DNA at
these recognition sites. Different
restriction enzymes recognize and cut at
different DNA sequences.
S2. Ans.(c)
The correct answer is option (c).
The correct matching between List-I and
List-II is as follows:
(A) Gene therapy – (IV) Allows correction
of a gene defect.
several steps in specific sequence such
as isolation of DNA, fragmentation of
DNA by restriction endonucleases,
isolation of desired DNA fragment,
ligation of the DNA fragment into a
vector, transferring the recombinant
DNA into the host, culturing the host
cells in a medium at large scale and
extraction of the desired product.
S6. Ans.(c)
Option (c) is the correct answer because
the first transgenic cow Rosie produced
human protein-enriched milk. The milk
contained the human alpha-lactalbumin
and was nutritionally a more balanced

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
product for human babies than natural
Gene therapy is a technique that uses
cow milk.
genes to treat or prevent disease by
S7. Ans.(b)
either replacing damaged genes with
Option (b) is the correct answer as a
healthy ones, turning off harmful genes
palindromic DNA sequence is a DNA
or introducing new genes to fight
sequence of base pairs that reads same
disease.
on the two strands when orientation of
S3. Ans.(a)
reading is kept the same.
Option (a) is the correct answer as,
S8. Ans.(d)
during isolation of the genetic material,
Option (d) is the correct answer as
purified DNA ultimately precipitates out
genetically engineered lymphocytes are
after the addition of chilled ethanol.
not immortal cells and die after some
S4. Ans.(b)
time.
Option (b) is the correct answer because
S9. Ans.(a)
in gene gun method, microparticles of
The pro-hormone also needs to be
tungsten or gold are used. Gold or
processed before it becomes a fully
tungsten are inert in nature so they do
mature and functional hormone, which
not alter the chemical composition of
contains an extra stretch called the C
cells.
peptide.
S5. Ans.(d)
In 1983, Eli Lilly an American company
The correct answer is option (d) because
prepared two DNA sequences
recombinant DNA technology involves
corresponding to A and B, chains of
631 CHANNEL
JOIN TELEGRAM
 human insulin and introduced them in • Increasing efficiency of mineral usage
plasmids of E. Coli to produce insulin by plants that prevents early exhaustion
chains. of fertility of soil.

S10. Ans.(d) S14. Ans.(c)

Biotechnology is the process of There are three ways for improving food
producing biopharmaceuticals and production that can be considered: I.
biologicals on a large scale using Agriculture dependent on agrochemicals
genetically engineered microorganisms, II. Genetically altered crop-based
fungi, plants and animals. Therapeutics, agriculture III. Organic agriculture
diagnostics, genetically modified crops S15. Ans.(b)
for agriculture, processed food,
By genetic modification of plants,
bioremediation, waste management and
mineral usage efficiency of plants can be
energy production are all examples of
increased and thus the exhaustion of
biotechnology applications
fertility of soil is delayed.
S11. Ans.(d)
S16. Ans.(c)
Biotechnology’s three most important
GMO stands for Genetically modified
study topics are: organism.
I. Providing the best catalyst in the form S17. Ans.(d)

of a better organism, usually a microbe Foods containing genetically modified

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
genes can be harmful because they can
or pure enzyme. cause allergies, toxicity and disruptions
II. Using engineering to create ideal in metabolism due to antibiotic resistant
enzymes and the incorporation of
conditions for a catalyst to act. antibiotic resistance in humans.
III. Purification of the protein/organic S18. Ans.(a)
molecule using downstream processing The genetically-modified (GM) brinjal in
India has been developed for insect-
technologies. resistance.
S12. Ans.(a) S19. Ans.(d)
The rise in yield during the green Through transgenic techniques, crops
revolution was primarily due to improved can become more resistant to many
crop varieties by high yielding variety detrimental factors. As a result, pests
requires fertilisers, pesticides, irrigation are resistant to it, temperature can be
infrastructure and other modern adjusted and synthetic pesticides are
methods and advanced technology avoided. However, the crop or plant is
S13. Ans.(d) not completely organic.

Genetically modified organisms are S20. Ans.(d)

plants, bacteria, fungi and mammals
whose genes have been manipulated
(GMO). GM crops have following uses:
• Reducing reliance on chemical
pesticides.
• Developing pest-resistant crops.
Green biotechnology is described as the
use of plants and other photosynthetic
creatures to improve agricultural crops
or to produce industrially valuable
products in industries such as
detergents, paper, biofuels, textiles,
medicinal substances and so on.
Example of green biotechnology is Bt
corn and pest resistant plants.

632 CHANNEL
JOIN TELEGRAM
S21. Ans.(d)
Therapeutics, diagnostics, processed S27.
modified crops and animals for
agriculture, processed food,
bioremediation and waste treatment are
S28.
all examples of biotechnology
applications.
S22. Ans.(a)
The main technique involved in
S29.
agricultural biotechnology is called
tissue culture. Tissue culture is a
method of biological research that
involves transferring bits of tissue from
an animal or plant to an artificial
environment where they can survive
and function. S30.
S23. Ans.(b)
Biotechnology has helped maximum in
the field of medicine, e.g., preparation of
monoclonal antibodies, interferon, S31.
insulin and drug.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S24. Ans.(a)
• The soil plant pathogenic bacteria
Agrobacterium tumefaciens has the Ti
plasmid. It can insert a specific section
of the tumor-inducing (Ti) plasmid into
infected cells’ nuclei. The transferred T-
DNA is then integrated and transcribed
S32.
alongside the host genome.
• The ability of Agrobacterium
tumefaciens to transfer T-DNA into the
host genome is being investigated in
genetic engineering to transfer a desired
DNA segment of up to 25kb into the S33.
genome of selected species, carrying the
gene of interest.
S25. Ans.(b)
Tobacco was the first transgenic plant
to be released for commercial use.
S26. Ans.(d)
Cucumber is not a transgenic plant.
633 CHANNEL
JOIN TELEGRAM
Ans.(c)
Golden rice is a transgenic rice having
gene for β-carotene.
Ans.(d)
Golden rice is a transgenic crop of the
future with the following improved trait
have more vitamin A.
Ans.(d)
RNA interference/mRNA silencing is a
strategy used to inhibit nematode
infection of tobacco roots. In RNAi,
dsRNA is formed to silence the target
gene.
Ans.(c)
Transgenic Bt cotton was designed to
resist insect pests.
Ans.(d)
Some strains of Bacillus thuringiensis
(Bt for short) produce proteins that kill
certain insects such as:
1. Lepidopterans (tobacco budworm
armyworm)
2. Coelopterans (beetles)
3. Dipterans (flies, mosquitoes)
Ans.(a)
In bacteria, the toxin is present in an
inactive form called protoxins that
becomes active when it enters the body
of an insect.
Ans.(c)
The insecticidal protein (cry protein)
found in Bt cotton binds to insect
midgut epithelial cells.
 Chapter 30
Sankalp Bharat
Organisms and Populations

1. Plants offer rewards to animals in the form 5. While explaining interspecific interaction of
of pollen and nectar and the animals population, (+) sign is assigned for
facilitate the pollination process. This is an beneficial interaction, (-) sign is assigned for
example of: (2023) detrimental interaction and (0) for neutral
(a) Amensalism interaction. Which of the following
(b) Competition interactions can be assigned (+) for one
(c) Commensalism specifies and (-) for another specifies
(d) Mutualism involved in the interaction? (2022)
2. If there are 250 snails in a pond, and within (a) Predation
a year their number increases to 2500 by (b) Amensalim
reproduction. What should be their birth (c) Commensalism
rate per snail per year? (2023) (d) Competition
(a) 10 6. If '8' Drosophila in a laboratory population
(b) 9 of '80' died during a week, the death rate in
the population is week. individuals per
(c) 25
(d) 15 Drosophila per (2022)
(a) 0.1

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
3. Statement I: Gause's 'Competitive (b) 10
Exclusion Principle' states that two closely (c) 1.0
related species competing for the same (d) zero
resources cannot co-exist indefinitely and 7. Inspite of interspecific competition in
competitively inferior one will be eliminated nature, which mechanism the competing
eventually. species might have evolved for their
Statement II: In general, carnivores are survival? (2021)
more adversely affected by competition than (a) Competitive release
herbivores. (b) Mutualism
In the light of the above statements, choose (c) Predation
the correct answer from the options given (d) Resource Partitioning
below: (2023)
(a) Both Statement I and Statement II are 8. Amensalism can be represented as: (2021)
false. (a) Species A (+) ; Species B (+)
(b) Statement I is correct Statement II is (b) Species A (–) ; Species B (–)
false. (c) Species A (+) ; Species B (0)
(c) Statement I is incorrect but Statement II (d) Species A (–) ; Species B (0)
is true. 9. In the exponential growth equation
(d) Both Statement I and Statement II are 𝑁𝑡 = 𝑁0 𝑒 𝑟𝑡 , e represents: (2021)
true. (a) The base of exponential logarithms
(b) The base of natural logarithms
4. Which one of the following statements (c) The base of geometric logarithms
cannot be connected to Predation? (2022) (d) The base of number logarithms
(a) It helps in maintaining species diversity
in a community 10. Match List-I with List-II: (2021)
(b) It might lead to extinction of a species List-I List-II
(c) Both the integrating species are A. Allen’s Rule (i) Kangaroo rat
negatively impacted Physiological (ii) Desert lizard
B.
(d) It is necessitated by nature to maintain adaptation
the ecological balance

634 CHANNEL
JOIN TELEGRAM
 C. Behavioural (iii) Marine fish at (c) Positive
adaptation depth (d) Negative

D. Biochemical (iv) Polar seal 15. Match Column – I with column – II (2019)
adaptation Column-I Column-II
Choose the correct answer from the options A. Saprophyte (i) Symbiotic
given below. association of
(a) A-(iv), B-(i), C-(iii), D-(ii) fungi with plant
(b) A-(iv), B-(i), C-(ii), D-(iii) roots
(c) A-(iv), B-(iii), C-(ii), D-(i) Parasite (ii) Decomposition of
(d) A-(iv), B-(ii), C-(iii), D-(i) B.
dead organic
11. Assertion (A) : A person goes to high materials
altitude and experiences ‘altitude sickness’ Lichens (iii) Living on plants
with symptoms like breathing difficulty and C.
or animals
heart palpitations.
Reason (R) : Due to low atmospheric D. Mycorrhiza (iv) Symbiotic
pressure at high altitude, the body does not association of
get sufficient oxygen. algae and fungi
In the light of the above statements, choose Choose the correct answer from the option
the correct answer from the options given given below.
below. (2021) (A) (B) (C) (D)
(a) Both (A) and (R) are true but (R) is not (a) (i) (ii) (iii) (iv)
the correct explanation of (A) (b) (iii) (ii) (i) (iv)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) (A) is true but (R) is false (c) (ii) (i) (iii) (iv)
(c) (A) is false but (R) is true (d) (ii) (iii) (iv) (i)
(d) Both (A) and (R) are true and (R) is the
16. Niche is: (2018)
correct explanation of (A)
(a) All the biological factors in the organism
12. Which of the following is not an attribute of
environment
a population? (2020)
(b) The physical space where an organism
(a) Natality
live
(b) Mortality
(c) The range of temperature that the
(c) Species interaction
organism needs to live
(d) Sex ratio
(d) The functional role played by the
13. Match the items in Column I with those in organism where it lives
Column II: (2020 Covid Re-NEET) 17. Natality refers to: (2018)
Column-I Column-II (a) Death rate
1. Herbivores- (i) Commensalism (b) Birth rate
Plants (c) Number of individuals leaving the
habitat
2. Mycorrhiza- (ii) Mutualism
Plants (d) Number of individuals entering a
3. Sheep-Cattle (iii) Predation habitat
18. Which one of the following plants shows a
4. Orchid-Tree (iv) Competition
very close relationship with a species of
(1) (2) (3) (4) moth, where none of the two can complete
(a) (iii) (ii) (iv) (i) its life cycle without the other? (2018)
(b) (ii) (i) (iii) (iv) (a) Hydrilla
(c) (i) (iii) (iv) (ii) (b) Yucca
(d) (iv) (ii) (i) (iii) (c) Banana
14. The impact of immigration on population (d) Viola
density is: (2020 Covid Re-NEET) 19. In a growing population of a country:
(a) Both positive and negative (2018)
(b) Neutralized by natality
635 CHANNEL
JOIN TELEGRAM
 (a) Pre-reproductive individuals are more sign to neutral interaction, then the
than the reproductive individuals population interaction represented by ‘+’ ‘–’
(b) Reproductive individuals are less than refers to: (2016-II)
the post-reproductive individuals (a) Commensalism
(c) Reproductive and pre-reproductive (b) Parasitism
individuals are equal in number (c) Mutualism
(d) Pre-reproductive individuals are less (d) Amensalism
than the reproductive individuals 27. It is much easier for a small animal to run
20. Which one of the following population uphill than for a large animal, because:
interactions is widely used in medical (2016-I)
science for the production of antibiotics? (a) It is easier to carry a small body weight
(2018) (b) Smaller animals have a higher
(a) Commensalism metabolic rate
(b) Mutualism (c) Smaller animals have a lower O2
(c) Parasitism requirement
(d) Amensalism (d) The efficiency of muscles in large
21. Plants which produce characterstic animals is less than in the small
pneumatophores and show vivipary belong animals
to: (2017) 28. When does the growth rate of a population
(a) Mesophytes following the logistic model equal zero? The
(b) Halophytes logistic model is given as dN/dt = rN (1 –
(c) Psammophytes N/K): (2016-I)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) Hydrophytes (a) When N/K is exactly one
22. Mycorrhizae are the example of: (2017) (b) When N nears the carrying capacity of
(a) Fungistasis the habitat
(b) Amensalism (c) When N/K equals zero
(c) Antibiosis (d) When death rate is greater than birth
(d) Mutualism rate
29. Gause’s principle of competitive exclusion
23. Asymptote in a logistic growth curve is
states that: (2016-I)
obtained when: (2017)
(a) More abundant species will exclude the
(a) The value of ‘r’ approaches zero
less abundant species through
(b) K = N
competition
(c) K > N
(b) Competition for the same resources
(d) K < N
excludes species having different food
24. In a hypothetical population of 100 preferences
individual having ‘r’ = 0.5/female/year, (c) No two species can occupy the same
what will be the population size in 6 years niche indefinitely for the same limiting
(with e = 2.72) showing exponential rate of resources
growth? (2017) (d) Larger organisms exclude smaller ones
(a) 448 through competition
(b) 1212 30. Most animals are tree dwellers in a: (2015)
(c) 739 (a) Temperature deciduous forest
(d) 2012 (b) Tropical rain forest
25. The principle of competitive exclusion was (c) Coniferous forest
stated by: (2016-II) (d) Thorn woodland
(a) MacArthur 31. In which of the following interactions both
(b) Verhulst and Pearl partners are adversely affected?
(c) C. Darwin (2015 Re)
(d) G.F. Gause (a) Predation
26. If ‘+’ sign is assigned to beneficial (b) Parasitism
interaction, ‘–’ sign to detrimental and ‘0’ (c) Mutualism

636 CHANNEL
JOIN TELEGRAM
 (d) Competition 34. A biologist studied the population of rats in
32. Just as a person moving from Delhi to a barn. He found that the average natality
was 250, average mortality 240,
Shimla to escape the heat for the duration
of hot summer, thousands of migratory immigration 20 and emigration 30. The net
birds from Siberia and other extremely cold increase in population is: (2013)
northern regions move to: (2014) (a) Zero
(a) Keolado National Park (b) 10
(b) Western Ghat (c) 15
(c) Meghalaya (d) 05
(d) Corbett National Park 35. A sedentary sea anemone gets attached to
33. Which of the following are likely to be the shell lining of hermit crab. The
present in deep sea water? (2014) association is: (2013)
(a) Saprophytic fungi (a) Amensalism
(b) Archaebacteria (b) Ectoparasitism
(c) Eubacteria (c) Symbiosis
(d) Blue-green algae (d) Commensalism

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

637 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (d) S33. Ans. (b)

S2. Ans. (b) S34. Ans. (a)

S3. Ans. (b) S35. Ans. (c)

S4. Ans. (c)

S5. Ans. (a)

S6. Ans. (a)

S7. Ans. (d)

S8. Ans. (d)

S9. Ans. (b)

S10. Ans. (c)

S11. Ans. (d)

S12. Ans. (c)

S13. Ans. (a)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (c)

S15. Ans. (d)

S16. Ans. (d)

S17. Ans. (b)

S18. Ans. (b)

S19. Ans. (a)

S20. Ans. (d)

S21. Ans. (b)

S22. Ans. (d)

S23. Ans. (b)

S24. Ans. (d)

S25. Ans. (d)

S26. Ans. (b)

S27. Ans. (b)

S28. Ans. (a)

S29. Ans. (c)

S30. Ans. (b)

S31. Ans. (d)

S32. Ans. (a)

638 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(d)
This is an example of Mutualism.
Mutualism is a type of symbiotic
relationship in which both organisms
involved benefit. In this case, the plant
benefits by having its pollen dispersed by
the animal, thus facilitating pollination,
and the animal benefits by obtaining food
in the form of pollen and nectar.
S2. Ans.(b)
∆𝑁
Birth rate = 𝑁∆𝑡
Here, N = 250
t = 1 year
N = 2500 – 250 = 2250
2250
Birth rate = =9
250×1
S3. Ans.(b)
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Gause's 'Competitive Exclusion
Principle' states that two closely related
species competing for the same
resources cannot co-exist indefinitely
and the competitively inferior one will be
eliminated eventually. Thus, statement I
is correct.
Statement II is incorrect as in general,
herbivores and plants appear to be more
adversely affected by competition than
carnivores.
S4. Ans.(c)
One of the species in predation gains
benefit on the expense of the other.
Predators help in maintaining species
diversity in a community, by reducing
the intensity of competition among
competing prey species. If a predator is
too efficient and overexploits its prey,
then the prey might become extinct.
S5. Ans.(a)
In predation, one species is benefited
where as the other is harmed. It is (+-)
type of population interaction.
S6. Ans.(a)
639 CHANNEL
JOIN TELEGRAM
If 8 Drosophila in a laboratory
population of 80 died during a week, the
death rate in the population is 8/80=0.1
individuals per Drosophila per week.
S7. Ans.(d)
Species facing competition might evolve
mechanism that promote co-existence
rather than exclusion. One such
mechanism is ‘resource partitioning’.
S8. Ans.(d)
Amensalism, association between
organisms of two different species in
which one is inhibited or destroyed and
the other is unaffected.
S9. Ans.(b)
The integral form of the exponential
growth equation as Nt = N0 ert where,
Nt = Population density after time t
N0 = Population density at time zero
r = intrinsic rate of natural increase
e = the base of natural logarithms
(2.71828)
S10. Ans.(c)
Allen’s rule is an ecogeographical rule
which states that the limbs, ears and
other appendages of animals living in
colder climate are shorter than the
animals of same species living in
warmer regions. Desert lizard adapted to
desert climate. They require less water,
adapt to hide in soil and their mimicry.
Deep sea marine animal physiology
changed according to depth of sea like
biomolecule composition. These changes
are permanent.
S11. Ans.(d)
A person goes to high altitude and
experiences altitude sickness with
symptoms like breathing difficulty and
heat palpitations because in the low
atmospheric pressure of high altitudes,
the body does not get enough oxygen.
S12. Ans.(c)
Species interaction is not a population
trait.
S13. Ans.(a)
Herbivores are animals that eat plants
and are classified as such. Predation
can be seen in several situations.
Mycorrhizae are fungi that form
connections with the roots of higher S20.
plants. They demonstrate mutualism.
Because the sheep and cattle are
competing for food, this is an example of
competition interaction. Commensalism
is demonstrated by an orchid growing as
an epiphyte on a mango branch.
S21.
S14. Ans.(c)
The number of individuals of the same
species who arrived in the habitat from
elsewhere during the time period under
S22.
consideration is referred to as
immigration. The increase in population
density is aided by immigration.
S15. Ans.(d) S23.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Saprophytes are organisms that
decompose decaying organic matter.
Parasite are living on plants or animals.
S24.
Lichens- Symbiotic association of algae
and fungi
Mycorrhiza- Symbiotic association of
fungi with plant roots
S16. Ans.(d)
An ecological niche shows how an
organism or population reacts to
resource distribution and the overall
environment.
S17. Ans.(b)
The natality or birth rate is the ratio of
the number of births to the population
size.
S18. Ans.(b)
Yucca blossoms are pollinated by no S25.
other species except the moth, and
Yucca moth larvae eat exclusively on
Yucca seeds. As a result, they exhibit a
symbiotic interaction.
S19. Ans.(a)
Upright pyramid of population growth:
pre-reproductive > reproductive > post-
reproductive.
640 CHANNEL
JOIN TELEGRAM
Pre-reproductive > reproductive > post-
reproductive > stable population – Bell-
shaped pyramid Limiting Low
percentage of younger people and a
falling birth rate.
Ans.(d)
Amensalism (–, 0) is a sort of connection
in which one party gets damaged while
the other is untouched. Antibiotics are
damaging to germs, yet they have no
effect on humans.
Ans.(b)
In saline soils, halophytes demonstrate I
Vivipary (in-situ seed germination) and
(ii) Pneumatophores (gaseous exchange).
Ans.(d)
Mycorrhizae is a symbiotic interaction of
fungi with the roots of higher plants.
Ans.(b)
The logistic growth curve depicts a
population increasing in an environment
with restricted resources.
Ans.(d)
N = N ert is the exponential growth
equation. When we put the values in the
question together, we obtain N = 100
e(0.56)
A population growing in a habitat with
limited resources shows logistic growth
curve.
For logistic growth
𝑑𝑁 𝐾−𝑁
𝑑𝑡
= 𝑟𝑁 ( 𝐾
)
If K = N then
𝐾−𝑁
=0
𝐾
𝑑𝑁
∴ = 0,
𝑑𝑡
The population reaches asymptote.
Ans.(d)
G.F. Gause established the competitive
exclusion principle.
According to Gause’s ‘Competitive’
Exclusion Principle, ‘two closely related
species competing for the same
resources cannot coexist indefinitely,
and the competitively inferior species
will eventually be eliminated.
S26. Ans.(b) S31. Ans.(d)
Species + + Mutualism, – – Competition, Competition is a relationship in which
+ – Predation + – Parasitism, + 0 each population has a negative impact
Commensalism, – 0 Amensalism, A on the other in the quest for limited
Species B Name of Interaction resources.
S27. Ans.(b) S32. Ans.(a)
Because little animals have a faster Thousands of migratory birds from
metabolic rate than large animals, Siberia visit the famed Keolado national
running uphill is significantly easier for park (Bharatput) in Rajasthan every
them. winter.
S28. Ans.(a) S33. Ans.(b)
When N/K is exactly one, the population Archaebacteria thrive in hot springs and
growth rate using the logistic model is deep sea hydrothermal vents.
zero. S34. Ans.(a)
S29. Ans.(c) (B + I) – (D + E) = Population growth.
According to Gause’s ‘Competitive S35. Ans.(c)
Exclusion Principle,’ two closely related
The relationship between the sea
species competing for the same
anemone and the hermit crab is a sort
resources cannot coexist indefinitely,
of facultative mutualism known as
and the competitively inferior species

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
protocol-operation.
will eventually be eliminated.
S30. Ans.(b)
Many tree-dwelling animals live in
tropical rain forests.

641 CHANNEL
JOIN TELEGRAM
 Chapter 31
Sankalp Bharat
Ecosystem

1. Match List-l with List-II: E. Earthworms break down detritus into

List – I List – II smaller particles by a process called
Hydrarch (i) Gradual change in catabolism.
A
succession the species
Choose the correct answer from the options
composition
given below: (2023)
B Xerarch (ii) Faster and climax
(a) D, E, A only
succession reached quickly
(b) A, B, C only
C Ecological (iii) Lichens to mesic (c) B, C, D only
succession conditions (d) C, D, E only
D Secondary (iv) Phytoplankton to 5. In the equation GPP-R = NPP
succession mesic conditions
GPP is Gross Primary Productivity
Choose the correct answer from the options
NPP is Net Primary Productivity
given below: (2022)
(a) (A)-(IV), (B)-(II), (C)-(III), (D)-(I) R here is (2023)
(b) (A)-(III), (B)-(I), (C)-(IV), (D)-(II)
(a) Reproductive allocation
(c) (A)-(I), (B)-(IV), (C)-(II), (D)-(III)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(b) Photosynthetically active radiation
(d) (A)-(IV), (B)-(III), (C)-(I), (D)-(II)
(c) Respiratory quotient
2. The amount of nutrients such as carbon, (d) Respiratory loss
nitrogen, potassium and calcium present in 6. Which one of the following statements is
the soil at any given time is referred to as: NOT correct? (2023)
(2022)
(a) Algal blooms caused by excess of organic
(a) Standing state
matter in water improve water quality
(b) Standing crop
and promote fisheries
(c) Humus
(d) Detritus (b) Water hyacinth grows abundantly in
3. The species of plants that plays a vital role eutrophic water bodies and leads to an
in controlling the relative abundance of imbalance in the ecosystem dynamics of
other species in a community is called the water body
(2023) (c) The amount of some toxic substances of
(a) alien species industrial waste water increases in the
(b) endemic species organisms at successive trophic levels
(c) exotic species
(d) The micro-organisms involved in
(d) keystone species biodegradation of organic matter in a
4. Identify the correct statements: sewage polluted water body consume a
A. Detrivores perform fragmentation. lot of oxygen causing the death of
B. The humus is further degraded by some aquatic organisms
microbes during mineralization. 7. Match List I with List II: (2023)
List – I List – II
C. Water soluble inorganic nutrients go
down into the soil and get precipitated A Mutualism (i) +(A), 0(B)
by a process called leaching. B Commensalism (ii) -(A), 0(B)
D. The detritus food chain begins with C Amensalism (iii) +(A), -(B)
living organisms.
D Parasitsm (iv) +(A), +(B)

642 CHANNEL
JOIN TELEGRAM
 Choose the correct answer from the options In the light of the above statements, choose
given below: the correct answer from the options given
(a) A-IV, B-I, C-II, D-III below : (2022)
(b) A-IV, B-III, C-4, D-II (a) Both Statement I and Statement II are
(c) A-III, B-I, C-IV, D-II correct
(d) A-IV, B-II, C-1, D-III (b) Both Statement I and Statement II are
8. All successions irrespective of the habitat incorrect
proceed to which type of climax (c) Statement I is correct but Statement II
community? (2022) is incorrect
(a) Edaphic (d) Statement I is incorrect but Statement II
(b) Xeric is correct
14. Which one of the following will accelerate
(c) Mesic
phosphorus cycle? (2022)
(d) Hydrophytic (a) Burning of fossil fuels
9. The pioneer species in a hydrarch (b) Volcanic activity
succession are (2022) (c) Weathering of rocks
(a) Filamentous algae (d) Rain fall and storms
(b) Free-floating angiosperms 15. Detritivores breakdown detritus into
(c) Submerged rooted plants smaller particles. This process is called:
(d) Phytoplanktons (2022)
10. The species that come to appear in bare (a) Catabolism

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
area are called (2022) (b) Fragmentation
(a) Species of seral community (c) Humification
(b) Pioneer species (d) Decomposition
(c) Invasive species 16. The amount of nutrients, such as carbon,
(d) Competitive species nitrogen phosphorus and calcium present
11. The amount of biomass or organic matter in the soil at any given time is referred as:
produced per unit area over a time period (2021)
by plants during photosynthesis is called (a) Climax community
(2022) (b) Standing state
(a) Net primary production (c) Standing crop
(b) Secondary production (d) Climax
(c) Primary production 17. Which of the following statements is not
(d) Gross primary production correct? (2021)
12. Two butterfly species are competing for the (a) Pyramid of biomass in sea is generally
same nectar of a flower in a garden. To upright
survive and coexist together, they may avoid (b) Pyramid of energy is always upright
competition in the same garden by: (2022) (c) Pyramid of numbers in a grassland
(a) Predating on each other ecosystem is upright
(b) Feeding at the same time (d) Pyramid of biomass in sea is generally
(c) Choosing different foraging patterns inverted
(d) Increasing time spent on attacking each 18. In the equation GPP – R = NPP. (2021)
other R represents:
13. Statement I: Decomposition is a process in (a) Retaradation factor
which the detritus is degraded into simpler (b) Environment factor
substances by microbes. (c) Respiration losses
Statement II: Decomposition is faster if the (d) Radiant energy
detritus is rich in lignin and chitin. 19. Match the trophic levels with their correct
species examples in grassland ecosystem.
(2020)
643 CHANNEL
JOIN TELEGRAM
 Column-I Column-II 24. What type of ecological pyramid would
obtained with the following data? (2018)
1. Fourth trophic (i) Crow
level Secondary consumer : 120 g
Primary consumer : 60 g
2. Second trophic (ii) Vulture
level Primary producer : 10 g
3. First trophic level (iii) Rabbit (a) Inverted pyramid of biomass
(b) Pyramid of energy
4. Third trophic level (iv) Grass
(c) Upright pyramid of numbers
(1) (2) (3) (4) (d) Upright pyramid of biomass
(a) (iii) (ii) (i) (iv) 25. The region of Biosphere Reserve which is
(b) (iv) (iii) (ii) (i) legally protected and where no human
(c) (i) (ii) (iii) (iv) activity is allowed is known as: (2017)
(d) (ii) (iii) (iv) (i)
(a) Core zone
20. In relation to gross primary productivity (b) Buffer zone
and net primary productivity of an (c) Transition zone
ecosystem, which one of the following (d) Restoration zone
statements is correct? (2020) 26. Which ecosystem has the maximum
(a) Gross primary productivity is always biomass? (2017)
more than net primary productivity. (a) Forest ecosystem
(b) Gross primary productivity and net (b) Grassland ecosystem
primary productivity are one and same. (c) Pond ecosystem
(c) There is no relationship between Gross

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(d) Lake ecosystem
primary productivity and net primary 27. Presence of plants arranged into well
productivity. defined vertical layers depending on their
(d) Gross primary productivity is always height can be seen best in: (2017)
less than net primary productivity. (a) Tropical Savannah
21. Which of the following statements is (b) Tropical Rain Forest
incorrect? (2020 Covid Re-NEET) (c) Grassland
(a) Energy content gradually increases (d) Temperate Forest
from first to fourth trophic level 28. The sequential events from initial stage till
(b) Number of individuals decreases from climax stage in a succession are called:
first trophic level to fourth trophic level (2017)
(c) Energy content gradually decreases (a) Migration
from first to fourth trophic level (b) Ecesis
(d) Biomass decreases from first to fourth (c) Sere
trophic level (d) Nudation
22. The rate of decomposition is faster in the 29. Which of the following statements is not
ecosystem due to following factors EXCEPT: true? (2017)
(2020 Covid Re-NEET) (a) Energy pyramids of an ecosystem tend
(a) Warm and moist environment to diminish at higher trophic levels
(b) Presence of aerobic soil microbes (b) A single organism can feed at several
(c) Detritus richer in lignin and chitin trophic levels
(d) Detritus rich in sugars (c) Detritivores feed at all trophic levels
23. Which of the following ecological pyramids except the producer level
is generally inverted? (d) Primary consumers are herbivores
(a) Pyramid of number in grassland 30. Which of the following ecologists has tried
(b) Pyramid of energy to put price-tags on nautre’s life support
(c) Pyramid of biomass in a forest services? (2017)
(d) Pyramid of biomass in a sea (a) Robert May
(b) David Tilman

644 CHANNEL
JOIN TELEGRAM
 (c) Robert constanza (a) Net primary productivity
(d) Paul Ehrlich (b) Standing crop
31. The primary producers of the deep-sea (c) Gross primary productivity
hydrothermal vent ecosystem are: (d) Standing state
(2016-II) 39. Most animals that live in deep oceanic
(a) Blue-green algae waters are: (2015)
(b) Coral reefs (a) Secondary consumers
(c) Green algae (b) Tertiary consumers
(d) Chemosynthetic bacteria (c) Detritivores
32. Which of the following would appear as the (d) Primary consumers
pioneer organisms on bare rocks? 40. An association of individuals of different
(2016-I) species living in the same habitual and
(a) Lichens having functional interactions is: (2015 Re)
(b) Liverworts (a) Biotic community
(c) Mosses (b) Ecosystem
(d) Green algae (c) Population
33. The trm ecosystem was coined by: (2016-I) (d) Ecological niche
(a) E.P. Odum 41. In which of the following both pairs have
(b) A.G. Tansley correct combination? (2015 Re)
(c) E. Haeckel (a) Gaseous nutrient Carbon and
(d) E. Warming cycle Sulphur
34. Which one of the following is a

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
Sedimentary Nitrogen and
characteristic feature of cropland nutrient Phosphorus
ecosystem? (2016-I)
(b) Gaseous nutrient Nitrogen and
(a) Absence of soil organisms
cycle Sulphur
(b) Least genetic diversity
(c) Absence of weeds Sedimentary Carbon and
(d) Ecological succession nutrient cycle Phosphorus
35. In an ecosystem, the rate of production of (c) Gaseous nutrient Sulphur and
organic matter during photosynthesis is cycle Phosphorus
termed as: (2015) Sedimentary Carbon and
(a) Secondary productivity nutrient cycle Nitrogen
(b) Net productivity
(d) Gaseous nutrient Carbon and
(c) Net primary productivity
cycle Nitrogen
(d) Gross primary productivity
Sedimentary Sulphur and
36. Secondary succession takes place on/in: nutrient cycle Phosphorus
(2015)
(a) Newly created pond 42. During ecological succession: (2015 Re)
(b) Newly cooled lava (a) The establishment of a new biotic
(c) Bare rock community is very fast in its primary
(d) Degraded forest phase
37. Vertical distribution of different species (b) The numbers and types of animals
occupying different levels in a biotic remain constant
community is known as: (2015) (c) The changes lead to a community that
(a) Zonation is in near equilibrium with the
(b) Pyramid environment and is called pioneer
(c) Divergence community
(d) Stratification (d) The gradual and predictable change in
species composition occurs in a given
38. The mass of living material at a tropic level area
at a particular time is called: (2015)

645 CHANNEL
JOIN TELEGRAM
43. Given below is a simplified model of (c) Parasite
phosphorus cycling in a terrestrial (d) Consumer
ecosystem with four blanks (A-D). Identify 47. The second stage of hydrosere is occupied
the blanks. (2014) by plants like: (2013)
(a) Azolla
(b) Typha
(c) Salix
(d) Vallisneria
48. Which one of the following processes during
decomposition is correctly described?
(2013)
(a) Leaching : Water soluble inorganic
nutrients rise to the top layers of soil
(b) Fragmentation : Carried out by
A B C D organisms such as earthworm
Producers Litter fall Rock Detritus (c) Humification : Leads to the
(a)
minerals accumulation of a dark colored
Rock Detritus Litter fall Producers
(b) substance humus which undergoes
minerals
Litter fall Producers Rock Detritus microbial action at a very fast rate
(c)
mineral (d) Catabolism : Last step in the
Detritus Rock Producer Litter fall decomposition under fully anaerobic
(d)
minerals

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
condition
44. Match the following and select the correct 49. Natural reservoir of phosphorus is: (2013)
option: (2014) (a) Fossils
A. Earthworm (i) Pioneer (b) Sea water
species
(c) Animal bones
B. Succession (ii) Detritivores (d) Rock
C. Ecosystem (iii) Natality
service
D. Population (iv) Pollination
growth
A B C D
(a) (ii) (i) (iv) (iii)
(b) (i) (ii) (iii) (iv)
(c) (iv) (i) (iii) (ii)
(d) (iii) (ii) (iv) (i)
45. If 20J of energy is trapped at producer level,
then how much energy will be available to
peacock as food in the following chain?
Plant → Mice → Snake → Peacock (2014)
(a) 0.0002 J
(b) 0.02 J
(c) 0.002 J
(d) 0.2 J
46. Secondary productivity is rate of formation
of new organic matter by: (2013)
(a) Decomposer
(b) Producer

646 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (d) S33. Ans. (b)

S2. Ans. (a) S34. Ans. (b)

S3. Ans. (d) S35. Ans. (d)

S4. Ans. (b) S36. Ans. (d)

S5. Ans. (d) S37. Ans. (d)

S6. Ans. (a) S38. Ans. (b)

S7. Ans. (a) S39. Ans. (c)

S8. Ans. (c) S40. Ans. (a)

S9. Ans. (d) S41. Ans. (d)

S10. Ans. (b) S42. Ans. (d)

S11. Ans. (c) S43. Ans. (d)

S12. Ans. (c) S44. Ans. (a)

S13. Ans. (c) S45. Ans. (b)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S14. Ans. (c) S46. Ans. (d)

S15. Ans. (b) S47. Ans. (d)

S16. Ans. (b) S48. Ans. (b)

S17. Ans. (a) S49. Ans. (d)

S18. Ans. (c)

S19. Ans. (d)

S20. Ans. (a)

S21. Ans. (a)

S22. Ans. (c)

S23. Ans. (d)

S24. Ans. (a)

S25. Ans. (a)

S26. Ans. (a)

S27. Ans. (b)

S28. Ans. (c)

S29. Ans. (c)

S30. Ans. (c)

S31. Ans. (d)

S32. Ans. (a)

647 CHANNEL
JOIN TELEGRAM
 Solutions
S1. Ans.(d)
(A)-(IV), (B)-(III), (C)-(1), (D)-(II)
S2. Ans.(a)
"Standing state" is a term used in ecology
to denote the amount of nutrients such
as carbon, nitrogen, potassium, calcium,
etc., present in the soil at any given time.
It provides an estimate of the availability
of these nutrients in the ecosystem.
S3. Ans.(d)
A keystone species plays a crucial role in
maintaining the structure of an
S8.
ecological community, affecting many
other organisms in an ecosystem and
helping to determine the types and
numbers of various other species in the
community. The absence of a keystone
species can lead to a significant shift in
S9.
(+,+) Mutualism: In this interaction,
both the interacting species are
benefitted.
(+, 0) Commensalism: Only one species
is benefitted and the other species
remains unharmed.
(-, 0) Amensalism: Neither species is
benefitted. One remains unharmed and
the other is harmed.
(+, -) Parasitism: One species is
benefitted and other is negatively
effected.
Ans.(c)
Both hydrarch and xerarch succession
lead to medium water condition called
mesic condition. This condition is neither
too dry nor too wet.
Ans.(d)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
the ecosystem and a loss of biodiversity.
In primary succession in water, the
S4. Ans.(b)
pioneers are the small phytoplanktons,
The detritus food chain begins with which are replaced with time by rooted-
detritus that is dead organic matter. The submerged plants, rooted floating
saprotrophic bacteria and fungi angiosperms followed by free-floating
breakdown detritus into simpler plants, then reed-swamp, marsh-
inorganic substances by a process called meadow, scrub and finally trees.
catabolism. This statement is true.
S10. Ans.(b)
Microbes, including bacteria and fungi,
break down humus into inorganic The species that invade a bare area are
nutrients in a process called called pioneer species.
mineralization.
The individual transitional communities
S5. Ans.(d) in an ecological succession are termed as
seral stages or seral communities.
A considerable amount of GPP is
utilised by plants in respiration. Gross S11. Ans.(c)
primary productivity minus respiration
losses (R), is the net primary Productivity is the total amount of
productivity. biomass or organic matter produced per
unit area. Over a period of time by
So R = Respiratory loss plants. This is also called Primary
production.
S6. Ans.(a)
Productivity of consumer is called
Algal bloom imparts a distinct colour to
Secondary production.
the water bodies. It causes deterioration
of the water quantity and fish mortality. S12. Ans.(c)
S7. Ans.(a) Two individuals that are competing for
same resource can avoid competition by

648 CHANNEL
JOIN TELEGRAM
 choosing different times for feeding or
different foraging patterns.
S13. Ans.(c)
Decomposition is the process by which
decomposers breakdown complex
organic matter into inorganic
substances.
The rate of decomposition is controlled
by chemical composition of detritus and
climatic factors. Decomposition is slower
if detritus is rich in lignin and chitin and
quicker, if detritus is rich in nitrogen and
water soluble substances like sugars.
S14. Ans.(c)
Phosphorus cycle is a sedimentary cycle.
Reservoir pool of phosphorus in
ecosystem is the earth's crust or
lithosphere. Weathering of rocks
accelerate phosphorus cycle.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S15. Ans.(b)
(Detritivores break down detritus into
smaller particles) e.g. earthworm. This
process is called fragmentation.
S16. Ans.(b)
It is the amount of inorganic nutrient
found in an ecosystem.
S17. Ans.(a)
Pyramid of biomass in sea is inverted.
S18. Ans.(c)
NPP = GPP-Respiration.
S19. Ans.(d)
A terrestrial ecosystem is the grassland
ecosystem. At various trophic levels, it
includes the following species:
Gras (T1) is the first trophic level. Rabit,
second trophic level (T2) Crow is the
third trophic level (T3). Vulture (T4) is
the fourth trophic level.
S20. Ans.(a)
The rate at which organic matter is
produced during photosynthesis
determines an ecosystem’s gross
primary productivity. GPP minus
respiration loss equals net primary
649 CHANNEL
JOIN TELEGRAM
productivity. As a result, gross primary
productivity is always higher than net
primary productivity.
S21. Ans.(a)
Organisms occupy a specific place in the
food chain known as their trophic level
based on the source of their nutrition or
food. At each trophic level, the amount
of energy available decreases. From the
first to the fourth trophic level, the
energy content gradually decreases.
S22. Ans.(c)
Decomposition, for the most part, is an
oxygen dependent process. The chemical
composition of detritus and climatic
factors both influence the rate of
decomposition. If detritus is high in
nitrogen and water-soluble substances
like sugars, decomposition occurs more
quickly in a given climatic condition.
Decomposition is also aided by a warm,
moist environment.
S23. Ans.(d)
The biomass pyramid in the sea is
generally inverted because fish biomass
exceeds phytoplankton biomass.
S24. Ans.(a)
Because producers are at the bottom of
the pyramid and consumers are at the
top, an inverted pyramid will result.
S25. Ans.(a)
A biosphere reserve is a protected area
that can be used for a variety of
purposes.
It is divided into three zones:
(a) Core zone – no human intervention;
(b) Buffer zone – limited human activity;
(c) Transition zone – human settlement,
grazing cultivation, and other
activities are permitted.
S26. Ans.(a)
High-yield ecosystems include tropical
rain forests, coral reefs, estuaries, and
sugarcane fields.
S27. Ans.(b)
 On the basis of plant height, the tropical
rain forest is divided into five vertical
strata: ground vegetation, shrubs, short
canopy trees, tall canopy trees, and tall
emergent trees.
S28. Ans.(c)
The entire sequence of communities that
change in a given area is referred to as a
sere (s).
S29. Ans.(c)
Heterotrophic organisms, primarily
fungi and bacteria, are detrivores. They
get their energy and nutrients by
decomposing dead organic matter, also
known as detritus. They can be found at
the ‘lowest trophic level.’
S30. Ans.(c)
Robert Constanza and his colleagues
have attempted to value nature’s life-
sustaining services.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S31. Ans.(d)
Chemosynthetic bacteria are the
primary producers in the deep-sea
hydrothermal vent ecosystem.
S32. Ans.(a)
Pioneer species are those that invade a
bare patch of land. Lichens are the first
organisms to appear on bare rocks.
S33. Ans.(b)
A.G. Tansley coined the term ecosystem
(1935).
S34. Ans.(b)
A cropland ecosystem has the least
genetic diversity of any man-made
ecosystem.
S35. Ans.(d)
GPP refers to the rate at which organic
matter is produced during
photosynthesis. It’s measured in g–2 yr–1
or (Kcalm–2)y–1 units. The available
biomass for heterotrophic consumption
is referred to as net primary
productivity.
S36. Ans.(d)
Secondary succession takes place in
areas where natural biotic communities
650 CHANNEL
JOIN TELEGRAM
have been destroyed, such as
abandoned farmland, burned or cut
forests, and flooded lands.
S37. Ans.d()
Stratification is the vertical distribution
of distinct species occupying various
strata.
S38. Ans.(b)
At any given time, each tropic level
contains a certain mass of living
material known as the standing crop.
The mass of living creatures (biomass)
or the number in a unit area is used to
calculate the standing crop.
S39. Ans.(c)
Little or no light penetrates the deep
sea, and most organisms that live there
rely on falling organic materials
produced in the photic zone for survival
(or we can say dead bodies). Scavengers
or detritivores are organisms that live in
deep oceanic waters.
Crustaceans, polychaetes, and
microorganisms are among them.
S40. Ans.(a)
A biotic community is a collection of
diverse yet interacting populations of
different species that coexist peacefully
in a given area.
S41. Ans.(d)
There are two types of nutrient cycles:
Nitrogen and Carbon Cycle: Gaseous
Sulphur and phosphorus are
sedimentary elements.
S42. Ans.(d)
Changes that occur as a result of biotic
succession include:
– Transitioning from an unstable biotic
community to a stable biotic
community.
– Wet or dry environments to mesic
environments.
– Primary succession is slower than
secondary succession, and it ranges
from little to a lot of diversity.
Ecological succession refers to the
 gradual and relatively predictable
changes in species composition.
S43. Ans.(d) S47. Ans.(d)
A B C D The second stage of hydrosere is the
Detritus Rock Producer Litter submerged plant stage.
minerals fall Plants such as Vallisneria and Hydrilla
predominate.
S44. Ans.(a) S48. Ans.(b)
Detritivore Succession – Pioneer species Water-soluble inorganic nutrients leach
– Earthworm Service to the ecosystem – into the soil horizon and precipitate as
Cross – pollination Natality is a measure salts that are inaccessible. Detritus is
of population growth. degraded into simpler inorganic
S45. Ans.(b) compounds by bacterial and fungal
enzymes.
Plant Mice Snake Peacock
Humification happens at a glacial pace.
S46. Ans.(d)
S49. Ans.(d)
The rate at which consumers produce
new organic matter is referred to as The rock is a natural phosphorus
secondary productivity. reservoir.

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ

651 CHANNEL
JOIN TELEGRAM
 Chapter 32
Sankalp Bharat
Biodiversity and Conservation

1. Among The Evil Quartet', which one is d Amazon forest (iv) Khasi Hills in
considered the most important cause Meghalaya
driving extinction of species?
Choose the correct answer from the options
(2023)
given below:
(a) Co-extinctions
(a) (a)-(iv), (b)(iii), (c)-(ii), (d)-(i)
(b) Habitat loss and fragmentation
(b) (a)-(iv), (b)(iii), (c) (i), (d) (ii)
(c) Over exploitation for economic gain
(c) (a)-(ii), (b)(iv), (c)- (i), (d) - (iii)
(d) Alien species invasions
(d) (a)-(iv), (b)(i), (c)-(ii), (d) (ii)
2. The historic Convention on Biological
7. Frugivorous birds are found in large
Diversity, 'The Earth Summit' was held in
numbers in tropical forests mainly because
Rio de Janeiro in the year (2023)
of: (2022)
(a) 2002
(a) Temperature conducive for their
(b) 1985
breeding
(c) 1992
(b) Lack of niche specialisation
(d) 1986
(c) Higher annual rainfall
3. Which of the following is/are cause(s) of
(d) Availability of fruits throughout the year
biodiversity losses ? (2023)
8. Panspermia, an idea that is still a favourite

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
(a) Over-exploitation, habitat loss and
for some astronomers, means: (2022)
fragmentation.
(a) Transfer of spores as unit of life from
(b) Climate change only
other planets to Earth
(c) Over-Exploitation only
(b) Creation of life from dead and decaying
(d) Habitat loss and fragmentation only
matter
4. The 5-C compound formed during TCA
(c) Creation of life from chemicals
cycle is (2022)
(d) Origin of sperm in human testes
(a) Fumaric acid
9. Why CNG is considered better fuel than
(b) -ketoglutaric acid
diesel?
(c) Oxalo succinic acid
(d) Succinic acid (a) It cannot be adulterated.
5. The World Summit on sustainable (b) It takes less time to fill the fuel tank
development held in 2002 in Johannesburg, (c) It burns more efficiently.
South Africa pledged for (2022) (d) It is cheaper.
(a) Collection and preservation of seeds of (e) It is less inflammable.
different genetic strains of commercially Choose the most appropriate answer from
important plants. the options given below: (2022)
(b) A significant reduction in the current (a) (c), (d), (e) only
rate of biodiversity loss, (b) (a), (b), (c), (e) only
(c) Declaration of more biodiversity (c) (a), (c), (d) only
hotspots. (d) (a), (b), (d), (e) only
(d) Increase in agricultural production 10. Western Ghats have a large number of
6. Match List - I with List - II: (2022) plants and animal species that are not
List – I LIst – II found anywhere else. Which of the following
Sacred groves (i) Alien species term is used to notify such species? (2022)
a
(a) Vulnerable species
b Zoological park (ii) Release of large
quantity of (b) Threatened species
oxygen (c) Keystone species
(d) Endemic species
c Nile perch (iii) Ex-situ
conservation

652 CHANNEL
JOIN TELEGRAM
11. Which of the following are true about the conservation are given:
taxonomical aid 'key'? (2020 Covid Re-NEET)
(a) Keys are based on the similarities and A. In situ conservation – Biosphere Reserve
dissimilarities. B. Ex situ conservation – Sacred groves
(b) Key is analytical in nature. C. In situ conservation – Seed bank
(c) Keys are based on the contrasting D. Ex situ conservation – Cryopreservation
characters in pair called couplet. Select the option with correct match of
(d) Same key can be used for all taxonomic approach and method:
categories.
(a) A and D
(e) Each statement in the key is called
(b) B and D
Lead.
(c) A and B
Choose the most appropriate answer from (d) A and C
the options given below: (2022)
(a) (a), (c), (d) and (e) only 18. According to Alexander von Humboldt:
(b) (a), (b) and (c) only (2020 Covid Re-NEET)
(c) (b), (c), and (d) only (a) Species richness increases with
(d) (a), (b), (c) and (e) only increasing area, but only up to limit
12. Which of the following is not a method of ex (b) There is no relationship between species
situ conservation? (2023) richness and area explored
(a) A In vitro fertilization (c) Species richness goes on increasing
(b) National Parks with increasing area of exploration
(c) Micropropagation (d) Species richness decreases with
(d) Cryopreservation increasing area of exploration

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
13. Habitat loss and fragmentation, over 19. Which one of the following is not a method
exploitation, alien species invasion and co- of in situ conservation of biodiversity?
extinction are causes for: (2023) (2019)
(a) Population explosion (a) Biosphere Reserve
(b) Competition (b) Wildlife Sanctuary
(c) Biodiversity loss (c) Botanical Garden
(d) Natality (d) Sacred Grove
14. In-situ conservation refers to: (2023) 20. Which of the following is the most important
(a) Protect and conserve the whole cause for animals and plants being driven
ecosystem to extinction? (2019)
(b) Conserve only high-risk species (a) Habitat loss and fragmentation
(c) Conserve only endangered species (b) Drought and floods
(d) Conserve only extinct species (c) Economic exploitation
(d) Alien species invasion
15. Which of the following regions of the globe
exhibits highest species diversity? (2020) 21. The Earth Summit held in Rio de Janeiro in
(a) Madagascar 1992 was called (2019)
(b) Himalayas (a) To reduce CO2 emissions and global
(c) Amazon forests warming
(d) Western ghats of India (b) For conservation of biodiversity and
sustainable utilization of its benefits
16. According to Robert May, the global species
(c) To assess threat posed to native species
diversity is about: (2020)
by invasive weed species
(a) 20 million
(d) For immediate steps to discontinue use
(b) 50 million
of CFCs that were damaging the ozone
(c) 7 million
layer
(d) 1.5 million
22. All of the following are included in ‘ex-situ
17. In the following in each set a conservation conservation’ except: (2018)
approach and an example of method of (a) Wildlife safari parks
(b) Sacred groves

653 CHANNEL
JOIN TELEGRAM
 (c) Botanical gardens
(d) Seed banks
23. Which one of the following is related to ex-
situ conservation of threatened animals and
plants? (2017)
(a) Wildlife Safari parks
(b) Biodiversity hot spots
(c) Amazon rainforest
(d) Himalayan region
24. Alexander Von Humboldt described for the
first time: (2017)
(a) Ecological Biodiversity
(b) Laws of limiting factor
(c) Species area relationships
(d) Population Growth equation
25. Van Mahotsava is a festival of: (2017)
(a) Conservation of sacred groves
(b) Planting trees in open areas
(c) Taking oath to protect trees
(d) Worshipping trees
30. Which of the following is correctly matched?
(2016-II)
(a) Parthenium hysterophorus – Threat to
biodiversity
(b) Stratification – Population
(c) Aerenchyma – Opuntia
(d) Age pyramid – Biome
31. Which of the following is correct for r-
selected species? (2016-II)
(a) Small number of progeny with small size
(b) Small number of progeny with large size
(c) Large number of progeny with small size
(d) Large number of progeny with large size
32. How many hot spots of biodiversity in the
world have been identified till date by
Norman Myers? (2016-II)
(a) 34
(b) 43
(c) 17
(d) 25

26. Which scientist proposed ‘Rivet popper 33. Which of the following is the most important
cause of animals and plants being driven to

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
hypothesis’ related to biodiversity and
Ecosystem? (2017) extinction? (2016-I)
(a) Tansley (a) Over-exploitation
(b) Alexander von Humboldt (b) Alien species invasion
(c) Paul Ehrlich (c) Habitat loss and fragmentation
(d) David Tilman (d) Co-extinctions

27. Tree planting helps in reducing global 34. Cryopreservation of gametes of threatened
warming as trees (2017) species in viable and fertile condition can be
(a) Can respire in light referred to as : (2015)
(b) Give out O2 (a) In situ conservation by sacred groves
(c) Create shade thereby cooling the (b) In situ cryo-conservation of biodiversity
ground (c) In situ conservation of biodiversity
(d) Can sequester CO2 (d) Advanced ex-situ conservation of
biodiversity
28. Which of the following National Parks is 35. In which of the following both pairs have
home to the famous musk deer or hangul? correct combination? (2015)
(2017) (a) In situ conservation: Seed Bank
(a) Eaglenest Wildlife Sanctuary, Ex situ conservation: National Park
Arunachal Pradesh (b) In situ conservation: Tissue culture
(b) Dachigam National Park, Jammu & Ex situ conservation: Sacred groves
Kashmir (c) In situ conservation: National Park
(c) Keibul Lamjao National Park, Manipur Ex situ conservation: Botanical Garden
(d) Bandhavgarh National Park, Madhya (d) In situ conservation: Cryopreservation
Pradesh Ex situ conservation: Wildlife Sanctuary
29. Red list contains data or information on: 36. The species confined to a particular region
(2016-II) and not found elsewhere is termed as:
(a) Threatened species (2015 Re)
(b) Marine vertebrates only (a) Alien
(c) All economically important plants (b) Endemic
(d) Plants whose products are in (c) Rare
international trade
654 CHANNEL
JOIN TELEGRAM
 (d) Keystone
37. An example of ex situ conservation is: 39. A species facing extremely high risk of
extinction in the immediate future is called:
(2014)
(a) Sacred Grove (2014)
(b) National Park (a) Extinct
(c) Seed Bank (b) Vulnerable
(d) Wildlife Sanctuary (c) Endemic
(d) Critically Endangered
38. Given below is the representation of the
40. The organization which publishes the Red
extent of global diversity of invertebrates.
What groups the four portions (A-D) List of species is: (2014)
represent respectively? (2014) (a) WWF
(b) ICFRE
(c) IUCN
(d) UNEP
41. Which one of the following is not used for
ex-situ plant conservation? (2013)
(a) Botanical Gardens
(b) Field gene banks
(c) Seed banks
(d) Shifting cultivation
A B C D
42. Which of the following represent maximum
Insects Molluscs Crustace- Other
(a) number of species among global

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
ans animal
groups biodiversity? (2013)
(a) Mosses and Ferns
(b) Insects Crustace- Other Mollus-
ans animal cs (b) Algae
groups (c) Lichens
(c) Crustac- Insects Molluscs Other (d) Fungi
eans animal
groups

(d) Mollus- Other Crustac- Insects

cs animal aceans
groups

655 CHANNEL
JOIN TELEGRAM
 Answer Key
S1. Ans. (b) S32. Ans. (a)

S2. Ans. (c) S33. Ans. (c)

S3. Ans. (a) S34. Ans. (c)

S4. Ans. (b) S35. Ans. (c)

S5. Ans. (b) S36. Ans. (b)

S6. Ans. (b) S37. Ans. (c)

S7. Ans. (d) S38. Ans. (a)

S8. Ans. (a) S39. Ans. (d)

S9. Ans. (c) S40. Ans. (c)

S10. Ans. (d) S41. Ans. (d)

S11. Ans. (d) S42. Ans. (d)

S12. Ans. (b)

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S13. Ans. (c)

S14. Ans. (a)

S15. Ans. (c)

S16. Ans. (c)

S17. Ans. (a)

S18. Ans. (a)

S19. Ans. (c)

S20. Ans. (a)

S21. Ans. (b)

S22. Ans. (b)

S23. Ans. (a)

S24. Ans. (c)

S25. Ans. (b)

S26. Ans. (c)

S27. Ans. (d)

S28. Ans. (b)

S29. Ans. (a)

S30. Ans. (a)

S31. Ans. (c)

656 CHANNEL
JOIN TELEGRAM

S1. Ans.(b)
Habitat loss and fragmentation is the
most important cause driving animals
and plants to extinction.
S2. Ans.(c)
The historic convention on Biological
Diversity, "The Earth Summit" was held
in Rio de Janeiro in the year 1992. It
called upon all nations to take
appropriate measures for conservation
of biodiversity and sustainable
utilisation of its benefits.
S3. Ans.(a)
Over-exploitation, habitat loss
fragmentation.
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S4. Ans.(b)
In TCA cycle, the intermediate which is
a 5-C compound is x-ketoglutaric acid.
Oxalo succinic acid is a 6-C compound,
whereas succinic acid and fumaric are
4-C compounds.
S5. Ans.(b)
In the World Summit on sustainable
development held in 2002 in
Johannesburg, South Africa, 190
countries pledged their commitment to
achieve by 2010, a significant reduction
in the current rate of biodiversity loss at
global, regional and local levels.
S6. Ans.(b)
Khasi Hills in Meghalaya are sacred
groves. Zoological Park is an ex-situ
conservation strategy.
Amazon forest releases large quantity of
O₂.
Nile perch is an alien species.
S7. Ans.(d)
Frugivorous birds are fruit eating birds
found in large number in tropical forest
mainly because of availability of fruits
throughout the year.
JOIN TELEGRAM
Solutions
S8. Ans.(a)
Option (a) is the correct answer because
some scientists believe that life came
from outside. Early Greek thinkers
thought units of life called spores were
transferred to different planets
including earth. This transfer of spores
was termed Panspermia.
S9. Ans.(c)
CNG is better fuel than diesel and petrol
because
(1) It burns more efficiently than diesel
or petrol
(2) It is cheaper
(3) It cannot be adulterated
and
S10. Ans.(d)
Endemic species are those species
which are confined to a particular area,
such as, species found in Western
Ghats are not found anywhere else.
S11. Ans.(d)
Key is taxonomical aid used for
identification of plants and animals
based on the similarities and
dissimilarities. The keys are based on
the contrasting characters generally in a
pair called couplet. Each statement in
the key is called a lead. Separate
taxonomic keys are required for each
taxonomic category such as family,
genus and species for identification
purposes. Keys are generally analytical
in nature.
S12. Ans.(b)
In-situ conservation means on site
conservation i.e. when we conserve and
protect the whole ecosystem, its
biodiversity at all levels is protected.
National parks are type of in-situ
conservation.
Whereas, micropropagation,
cryopreservation and in-vitro
fertilization are methods of ex-situ
conservation.
657 CHANNEL
S13. Ans.(c)
Habitat loss and fragmentation, over
exploitation, alien species invasion and
co-extinction are causes for biodiversity
loss.
S14. Ans.(a)
When we conserve and protect the
whole ecosystem, its biodiversity at all
levels is protected. This is in-situ or on
site conservation strategy.
S15. Ans.(c)
The Amazonian rain forest in south
America, which is mostly tropical, has
the world’s greatest biodiversity.
S16. Ans.(c)
According to Robert May, the world’s
species diversity is estimated to be
around 7 million.
S17. Ans.(a)
Ex-situ conservation is the preservation
ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
of biological diversity components
outside of their natural habitats. It is
accomplished through the preservation
of genetic resources, as well as wild and
cultivated species. Cryopreservation,
gene banks, zoological parks, botanical
gardens, and wildlife safari parks are
just a few examples.
Conservation of species in their natural
habitats is known as in situ
conservation. It is most effective means
of preserving biodiversity. Sacred
grooves, biosphere reserves, national
parks, and sanctuaries are some
examples.
S18. Ans.(a)
Within a region, Alexander von
Humboldt discovered that species
richness increased with increasing
explored area, but only up to a point.
S19. Ans.(c)
Botanical gardens are an example of ex-
situ (off-site) conservation, in which
living plants (flora) are preserved in a
human-managed environment.
S20. Ans.(a)
658 CHANNEL
JOIN TELEGRAM
The most important factor driving
animals and plants to extinction is
habitat loss and fragmentation. For
example, the loss of tropical rainforest
has reduced forest cover from 14% to
6%.
S21. Ans.(b)
All nations were urged to take
appropriate measures for biodiversity
conservation and sustainable use of its
benefits at the 1992 Earth Summit in
Rio de Janeiro.
S22. Ans.(b)
Sacred groves are communally protected
forest fragments of various sizes. It
exemplifies in-situ conservation.
S23. Ans.(a)
Ex-situ conservation refers to the
preservation of organisms outside of
their natural habitats. Genetic resource
centres, zoological parks, botanical
gardens, gene banks, and other
institutions are examples.
S24. Ans.(c)
Within a region, species richness
increases with increasing explored area,
but only up to a point, according to
Alexander von Humboldt’s (German
naturalist and geographer) study in
south American jungles. For a wide
range of taxa, the relationship between
species richness and area yields a
rectangular hyperbola.
S25. Ans.(b)
Van Mahotsava is a festival aimed at
igniting public interest in forest
conservation and tree planting.
S26. Ans.(c)
It is a hypothesis that describes the
conditions of an ecosystem in which the
loss of a substantial number of species
has an impact on the functions and
variety of an ecological community. Paul
Ehrlich proposed this idea, using an
aeroplane to explain the ecosystem and
the passengers as the ecosystem’s rivet.
Because communities are made up of
 relatively specialized species with
limited ability to compensate for one
another, the disappearance of a certain
species is critical to the ecosystem’s
functionality. The rate of extinction has
an impact on the ecological unit’s entire
function. According to the Rivet
hypothesis, each species loss to an
ecological unit can reduce ecosystem
services, however the decline is gradual
as more species are gone. Any loss of
diversity is immediately visible in this
illustration.
S27. Ans.(d)
Trees sequester CO2 directly in their
stems and leaves as they grow.
S28. Ans.(b)
The famous musk deer or hangul can be
found in Jammu & Kashmir’s Dachigam
National Park.
Ex-situ conservation has come a long
way in recent years. Keeping
endangered species in enclosures is a
good idea. Cryopreservation procedures
can be used to preserve the gametes of
endangered species.
S35. Ans.(c)
Ex situ conservation – zoological parks,
botanical gardens, and animal safari
parks, seed banks, and so on; in situ
conservation-hotspots, biosphere
reserves, national parks, and
sanctuaries.
S36. Ans.(b)
Endemic species are species that can
only be found in a certain natural
habitat and are not found elsewhere.
S37. Ans.(c)
Ex-situ zoological park, botanical
gardens, and seed collection banks.

ᶳᶪᶪᶹᶴᶽᶵᶭᶮᶱᶱᶮᶨ
S29. Ans.(a)
S38. Ans.(a)
In the last 500 years, the IUCN Red List
Insects are A, mollusks are B,
records the extinction of 784 species
crustaceans are C, and other animals
(including 338 vertebrates, 359
are D.
invertebrates, and 87 plants).
S39. Ans.(d)
S30. Ans.(a)
Critically endangered species are those
Carrot grass (Parthenium), Lantana, and
that are in grave danger of extinction.
water hyacinth (Eichhornia) are invasive
weed species that pose a threat to our Extinction in the not-too-distant future.
native species. S40. Ans.(c)
S31. Ans.(c) The Red List of species is published by
For r-selected species, a large number of the IUCN.
progeny of small size is appropriate. S41. Ans.(d)
S32. Ans.(a) Deforestation occurs as a result of
Initially, 25 biodiveristy hotspots were shifting farming.
identified, but 9 more have since been S42. Ans.(d)
added, bringing the total number of The overall number of fungal species in
biodiversity hotspots worldwide to 34. the globe exceeds the total number of
S33. Ans.(c) fish, amphibians, reptiles, and
mammals combined.
The most critical factor driving animals
and plants to extinction is habitat loss
and fragmentation. Tropical rain forests
provide the most severe examples of
habitat loss.
S34. Ans.(c)

659 CHANNEL
JOIN TELEGRAM