pubs.acs.

org/JAFC Article

Cooperative Response of Pichia kudriavzevii and Saccharomyces

cerevisiae to Lactic Acid Stress in Baijiu Fermentation
Nan Deng, Hai Du,* and Yan Xu*
Cite This: J. Agric. Food Chem. 2020, 68, 4903−4911 Read Online

ACCESS Metrics & More Article Recommendations *

sı Supporting Information
See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

ABSTRACT: Lactic acid is a universal metabolite, as well as a growth inhibitor of ethanol producers in Baijiu fermentation.
Revealing the mechanism of lactic acid tolerance is essential for the yield of fermented foods. Here, we employed reverse
transcription-quantitative polymerase chain reaction to explore the degradation mechanism of lactic acid, based on the coculture of
Pichia kudriavzevii and Saccharomyces cerevisiae. Under high lactic acid stress, P. kudriavzevii decreased lactic acid from 40.00 to 35.46
g L−1 within 24 h. Then, S. cerevisiae restored its capacity to degrade lactic acid. Finally, lactic acid decreased to 26.29 g L−1.
Downloaded via CARLETON UNIV on July 13, 2020 at 12:43:37 (UTC).

Coculture significantly enhanced lactic acid consumption compared to the monoculture of P. kudriavzevii (90% higher) or S.
cerevisiae (209% higher). We found that lactate catabolism, H+ extrusion, and glycerol transport were the lactic acid tolerance
pathways in yeasts. This study reveals the novel acid tolerance mechanisms of microbiota and would provide new strategies for
ethanol production under acid stress.
KEYWORDS: Pichia kudriavzevii, lactic acid degrade, stress response pathway, coculture, Chinese Baijiu

■ INTRODUCTION
In fermented food and beverage industries, the yield and
fermentation.10 P. kudriavzevii has a considerable contribution
to the flavor of Chinese Baijiu, which can generate higher
quality of products are limited because of the generation of alcohols and volatile acids.11 P. kudriavzevii is also able to
some inhibitory compounds during the fermentation process.1 decrease the concentrations of unsafe compounds, such as
Lactic acid, a universal metabolite as well as a growth inhibitor, ethyl carbamate in Baijiu fermentation.12 Moreover, recent
studies have shown that P. kudriavzevii has significant effects
often appears in the fermentation process of fermented foods
on improving the product quality in other fermented food and
and beverages.2,3 For example, lactic acid is the highest organic
beverage industries. For example, the use of P. kudriavzevii in
acid formed during the Moutai-flavor Baijiu fermentation
the wheat sourdough bread making leads to the higher
process, up to 36.20 ± 6.20 g kg−1 fermented grain.4 As a
concentration of esters, aldehydes, and other aroma com-
major inhibitory compound, lactic acid can penetrate through
pounds.13 Moreover, the degradation of malic acid by P.
the cytomembrane and flow into the cytoplasm by simple
kudriavzevii was observed in wine fermentation.14 Previous
diffusion because the undissociated form of lactic acid is
studies have shown that P. kudriavzevii has a special capacity to
lipophilic.5 In the nearly neutral cytoplasm, lactic acid
resist environmental stress during the fermentation proc-
dissociates, releasing protons (H+) and lactate ions. Because
ess.15,16 For instance, P. kudriavzevii NG7, isolated from grape
these ions have electric charge, they cannot pass through the
skin, is quite resistant and can tolerate 4% lactic acid at 50
hydrophobic lipid cytomembrane bilayer. These ions accumu-
°C.17 The tolerance and response mechanisms to weak acid
late in the cell, leading to the change of intracellular pH (pHi)
stress have been widely studied in S. cerevisiae.5,18−20 However,
and the disruption of the cytoplasm anion pool. Then, the
different yeasts may have different responses, differing also
integrity of purine bases is affected, causing the vital enzymes
among weak acids.21 The tolerance mechanism of P.
to denature in the cells, which inhibits ethanol production
kudriavzevii to lactic acid accumulation is still a problem to
during Chinese Baijiu fermentation.6,7 Therefore, it is essential
solve. Moreover, identifying the interaction between P.
for fermented food and beverage industries to study the lactic
kudriavzevii and S. cerevisiae in response to lactic acid stress
acid tolerance and mechanisms of microorganisms.
is vital to ensure ethanol production in Baijiu fermentation.
Chinese Moutai-flavor Baijiu fermentation process is a
In this study, we explored the influence of lactic acid
typical spontaneous fermentation, involving Saccharomyces and
accumulation on core functional yeasts involving P. kudriavze-
various non-Saccharomyces yeasts to produce various alcohols
and aroma compounds.8 Among these yeasts, one of the most
significant species is Saccharomyces cerevisiae which contributes Received: December 19, 2019
considerably to the production of multiple alcohols (78,018 μg Revised: March 14, 2020
L−1) and esters (4023 μg L−1).9 In addition, Pichia is a Accepted: March 17, 2020
dominant yeast, which is the most abundant genus in fungi (on Published: March 17, 2020
average, accounting for 91.34 to 64.59% of fungi).4 Pichia
kudriavzevii is the dominant species of genus Pichia in Baijiu

© 2020 American Chemical Society https://dx.doi.org/10.1021/acs.jafc.9b08052

4903 J. Agric. Food Chem. 2020, 68, 4903−4911
Journal of Agricultural and Food Chemistry
Table 1. Primer Sequences for Gene Transcription Analysis in P. kudriavzevii
gene primer direction primer sequence (5′ → 3′)
ADH5 F GCTGCAACTAACGGTTTGGG
R CACCAGATGGCATACCGACA
lldD F AAAGTCCCTGTCGTGCCATT
R CCAACAGCAGGCTGAACAAC
VMA8 F AGCCCAAACGGGACATTCTT
R CACACGGCCCATCTTTCTCT
STL1 F GGTGCCGTCACTTCCTGTTA
R ATGACCTAAAGCCCAGTGGC
UBC6 F GTTTGCAGGGGCAAATGAGG
R CTCTTGTTGTCCAGCCGAGT
vii and S. cerevisiae in monoculture and coculture. Furthermore,
we revealed the gene transcriptions related to lactic acid
tolerance in P. kudriavzevii and S. cerevisiae and illustrated the
mechanisms of lactic acid tolerance in the P. kudriavzevii−S.
cerevisiae group. A new opinion on the function of P.
kudriavzevii was showed, which could provide guidance for
its effective use in food and beverage fermentation.
■
MATERIALS AND METHODS
Yeast Strains and Growth Medium. P. kudriavzevii C-16 and S.
cerevisiae C-3 were isolated from the Chinese Moutai-flavor Baijiu
fermentation process. The yeast strains were deposited in the China
General Microbiological Culture Collection Center with the accession
numbers CGMCC 19337 and 19336. The yeasts were stored at −80
°C in yeast peptone dextrose broth (YEPD) glycerol stock. For liquid
cultivation, the cells were pregrown on YEPD agar plates (1% yeast
extract, 2% bacto peptone, 2% glucose, and 2% agar).
Sorghum extract medium was used for fermentation and was
prepared according to the method below. One kilogram of ground
sorghum was added to 4 L of deionized water. Then, the mixture was
added with the moderate thermostable α-amylase solution (2 × 107 U
L−1) and cooked for 2 h. It was subsequently saccharified by
glucoamylase (5 × 107 U L−1) at 60 °C for 4 h. Finally, the above
mixture was filtered through two layers of gauze and centrifuged at
8000g for 5 min. The supernatant was collected as the sorghum
extract. The sugar content was measured with a Leica refractometer
(Fisher Scientific, Pittsburg, PA). The obtained sorghum extract was
diluted with water to provide a final sugar concentration of 8 ° Bx (55
± 5 g L−1).22 Each 100 mL of sorghum extract was dispensed in a 250
mL flask. The fermentation media were sterilized at 115 °C for 30
min before use.
Mono- and Coculture Fermentation. P. kudriavzevii and S.
cerevisiae were precultured in sorghum extract media at 30 °C
overnight, shaking at 200 rpm to obtain the seed culture. They were
then respectively inoculated into the fermentation media supple-
mented with different DL-lactic acid amounts (40 and 0 g L−1) at a cell
density of 2 × 107 cells mL−1. Cocultures were carried out under lactic
acid stress (40 g L−1 DL-lactic acid) with P. kudriavzevii/S. cerevisiae at
ratios of 107:107. Fermentation was performed at 30 °C for 72 h, with
shaking at 200 rpm. During fermentation, samples were taken at 12 h
intervals to quantify yeast biomass and analyze the concentration of
sugar, lactic acid, and ethanol. Uninoculated sorghum extract medium
was used as a negative control, and the experiments were performed
in triplicate.
Determination of Yeast Biomass. The biomass of different
yeasts in mono- and coculture fermentation was determined by
quantitative polymerase chain reaction (qPCR). Genomic DNA in
mono- and coculture fermentation was extracted using the DNAiso
reagent (TaKaRa, Dalian, China). All operations followed the
manufacturer’s instructions. Genomic DNA was used as the template
to amplify S. cerevisiae using primers SC1 and SC2 and P. kudriavzevii
using primers PK1 and PK2.23 qPCR was performed by a
StepOnePlus instrument (Applied Biosystems, Foster City, CA)
4904
pubs.acs.org/JAFC Article
primer size (bp) production size (bp)
20 127
20
20 152
20
20 109
20
20 171
20
20 143
20
with a commercial kit (AceQ Universal SYBR qPCR Master Mix;
Vazyme, Nanjing, China). Each reaction was performed in a reaction
volume of 20 μL containing 10 μL of SYBR mix, 0.4 μL of each
primer (10 mmol L−1), 1 μL of DNA template, and 8.2 μL of double-
distilled water. The qPCR thermocycling steps were set as follows: 95
°C for 5 min and 40 cycles of 95 °C for 10 s and 60 °C for 30 s.
Melting curve analysis, which was obtained by 0.5 °C s−1 increments
from 65 to 95 °C with continuous fluorescence collection, was
performed to determine the specificity of the PCR products.24 The
experiments were performed in triplicate.
HPLC Analysis. To analyze the concentrations of lactic acid,
glucose, and ethanol, the fermentation broths were centrifuged at
8000g for 10 min to remove the cells. Then, the supernatant was
filtered through a 0.22 μm syringe filter and quantified by high-
performance liquid chromatography (HPLC; Waters, Suzhou, China).
HPLC was performed using a Waters HPLC separation module (e-
2695) equipped with a refractive index (RI) detector (2414) kept at
35 °C and an Aminex HPX-87H ion exclusion column (300 mm ×
7.8 mm, 3 μm). The mobile phase was 5 mmol L−1 H2SO4 with a flow
rate of 0.6 mL min−1. The column temperature was 60 °C, and the
injection volume was 10 μL. The concentration of lactic acid, glucose,
and ethanol in the fermentation samples was determined by the peak
area of the standard samples.25
Transcription Analysis of Genes that Confer Tolerance for
Lactic Acid. Cells were collected from mono- and coculture by
centrifugation at 8000g at 4 °C for 5 min, immediately frozen in liquid
nitrogen, and stored at −80 °C.
RNA was extracted as follows: the cell pellets were crushed into
fine powders in a precooled mortar (China National Pharmaceutical
Group Corp., Shanghai, China). The sample powders were transferred
to RNase-free 1.5 mL centrifuge tubes, which were filled with 1 mL of
precooled RNAiso Plus reagent (TaKaRa, Dalian, China), mixed
immediately by pipetting, and then incubated at room temperature
(15−30 °C) for 5 min. After this, 200 μL of chloroform was added,
mixed upside down, incubated at room temperature for 5 min, and
then centrifuged at 12,000g at 4 °C for 15 min. Then, the supernatant
was mixed with 1 mL of isopropyl alcohol, mixed upside down,
incubated at room temperature for 10 min, and then centrifuged at
12,000g and 4 °C for 10 min. The obtained pellet was washed with 1
mL of 75% ethanol and centrifuged at 7500g and 4 °C for 5 min. The
pellets were dried at room temperature for 5 min and dissolved in 50
μL of RNase-free water. DNase treatment was conducted with 1 μg of
RNA sample in a 16 μL reaction mixture using HiScript II Q RT
SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China). All
the operations followed the manufacturer’s instructions. The ratios of
A260/A280 and A260/A230 were calculated to assess the RNA purity
using a NanoDrop ND-1000 microspectrometer (Thermo Scientific,
Wilmington, DE). The quality of the total RNA was analyzed by 1%
nondenaturing agarose gel electrophoresis.
Reverse transcription was conducted using the HiScript II Q RT
SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China)
immediately after RNA extraction. Reactions without both reverse
transcriptase and a template were used as negative controls. qPCR
was performed using a StepOnePlus instrument (Applied Biosystems,
Foster City, CA), according to the manufacturer’s instructions. Each
https://dx.doi.org/10.1021/acs.jafc.9b08052
J. Agric. Food Chem. 2020, 68, 4903−4911
Journal of Agricultural and Food Chemistry
Table 2. Primer Sequences for Gene Transcription Analysis in S. cerevisiae
gene primer direction primer sequence (5′ → 3′)
ADH5 F CTATATCCGGTGCATGCGGT
R TCGCTTGGCATTACCACCAT
lldD F GGTAACACGGGGTTGGTAGG
R TAGCTCCCAGATCCAACGGA
VMA8 F AAGCGTAAGTCTGAAGCCCT
R TGCATAGGAAACTTCGGCCA
STL1 F GAACACTAGACGACGCGGAT
R AGCTGCAATCAAAGCCCTCT
UBC6 F AGGACCTGCGGATACTCCTT
R GTGTTGGGCTTGAAACGTCC
Figure 1. Optical density at 600 nm of P. kudriavzevii (A) and S. cerevisiae (B), with and without lactic acid.
reaction was performed in a 20 μL reaction volume containing 1 μL of
cDNA, 0.4 μL of each primer (10 mmol L−1), 10 μL of the SYBR mix,
and 8.2 μL of double-distilled water. The amplification conditions
were as follows: preheating at 95 °C for 5 min, 40 cycles of 95 °C for
10 s, 60 °C for 30 s, and an increase of 0.5 °C every 5 s from 65 to 95
°C for melting curve analysis to confirm the specificity of the
amplification. The experiments were done in triplicate. Negative
controls were maintained with no SYBR mix, no template, and only
double-distilled water. For each gene, the cycle threshold (CT) values
of the technical and biological replicates were averaged. The CT values
of reference genes (UBC6) were then averaged. The relative
transcriptional levels of genes were quantified by the
2−ΔΔCTmethod.26 The primers for reverse transcription-quantitative
PCR (RT-qPCR) for the genes in P. kudriavzevii and S. cerevisiae are
listed in Tables 1 and 2, respectively.
Statistical Analysis. Each treatment was performed in triplicate.
All statistical analyses and data plots were performed with Microsoft
Office Excel 2016 (Microsoft, Redmond, WA), OriginPro 9.5
(OriginLab, Northampton, MA), and Adobe Illustrator CC 22.0
(Adobe Systems Incorporated, San Jose, CA). Differences were
considered significant when P values were lower than 0.05 in a two-
tailed, unpaired Student’s t test.
■ RESULTS
Effects of Lactic Acid on the Growth and Metabolic
Profiles of P. kudriavzevii and S. cerevisiae. There are
notable differences in the lactic acid tolerance between P.
kudriavzevii C-16 and S. cerevisiae C-3. During the first 12 h
culture, the growth rate of P. kudriavzevii C-16 without lactic
acid was 0.22 h−1, whereas it was 0.027 h−1 when it grew with
40 g L−1 lactic acid (Figure 1A). Compared to the control
(without lactic acid), the growth rate of P. kudriavzevii C-16
reduced by 88% when it grew with 40 g L−1 lactic acid during
the first 12 h culture. The final OD600 of P. kudriavzevii C-16
without lactic acid was 4.48 ± 0.27, whereas it was 2.41 ± 0.08
when it grew with 40 g L−1 lactic acid. The final OD600 reduced
by 46% in the lactic acid-treated cells in comparison to the
4905
pubs.acs.org/JAFC Article
primer size (bp) production size (bp)
20 101
20
20 193
20
20 126
20
20 158
20
20 126
20
control. The glucose consumption rate of P. kudriavzevii C-16
under 40 g L−1 lactic acid was 0.78 g L−1 h−1, whereas that of
control (without lactic acid) was 0.96 g L−1 h−1 (Figure S1A).
The glucose consumption rate of P. kudriavzevii C-16
decreased by 19.47% in lactic acid-treated cells in comparison
to the control.
In the presence of lactic acid (40 g L−1), the growth of S.
cerevisiae C-3 was severely inhibited (Figure 1B). S. cerevisiae
C-3 rarely grew under 40 g L−1 lactic acid, and the final OD600
was 0.080 ± 0.033. Correspondingly, Figure S1B shows that in
the absence of lactic acid (0 g L−1), S. cerevisiae C-3 could
deplete glucose during the 36 h culture. However, when it grew
with 40 g L−1 lactic acid, 33.09 ± 0.65 g L−1 glucose remained
after 72 h of fermentation. Also, the ethanol yield of S.
cerevisiae C-3 was greatly influenced by lactic acid (Figure
S1D). In the absence of lactic acid, the ethanol yield of S.
cerevisiae C-3 peaked at 23.99 ± 1.30 g L−1 at 24 h and then
reduced to 13.55 ± 0.85 g L−1 at 72 h. However, when S.
cerevisiae C-3 exposed to 40 g L−1 lactic acid, the final ethanol
concentration was only 4.66 ± 0.14 g L−1, which reduced by
65.61%. The ethanol production rate of S. cerevisiae C-3 was
1.00 ± 0.054 g L−1 h−1 at the first 24 h, whereas it reduced to
0.13 ± 0.0074 g L−1 h−1 under 40 g L−1 lactic acid, which
showed an 87.08% reduction.
Improvement of Lactic Acid Tolerance by P.
kudriavzevii and S. cerevisiae Coculture. Figure 2 shows
the biomass of P. kudriavzevii C-16 and S. cerevisiae C-3 in
mono- and coculture in the presence of lactic acid (40 g L−1).
At the initial stage, the biomass of P. kudriavzevii C-16 and S.
cerevisiae C-3 reduced in both mono- and coculture. At 12 h
culture, P. kudriavzevii C-16 achieved a minimum biomass of
3.8 × 106 copies mL−1 in monoculture and 2.8 × 106 copies
mL−1 in coculture. Then, it gradually increased as fermentation
progressed and finally achieved the maximum biomass of 5.7 ×
107 copies mL−1 in monoculture and 5.0 × 107 copies mL−1 in
https://dx.doi.org/10.1021/acs.jafc.9b08052
J. Agric. Food Chem. 2020, 68, 4903−4911
Journal of Agricultural and Food Chemistry
Figure 2. Biomass of P. kudriavzevii and S. cerevisiae in mono- and
cocultures under lactic acid stress.
coculture. No significant (P > 0.05) variation in the biomass
was observed in the monoculture and coculture for P.
kudriavzevii C-16 over the fermentation period. The minimum
biomass of S. cerevisiae C-3 reached 7.1 × 104 copies mL−1 at
48 h in monoculture, whereas S. cerevisiae C-3 showed a
shortened lag phase in coculture, and the minimum biomass
reached 5.0 × 105 copies mL−1 at 12 h. At 48 h, the biomass of
S. cerevisiae C-3 in coculture (9.6 × 105 copies mL−1) was 13
times that in monoculture. It showed that coculture could
increase the lactic acid tolerance of S. cerevisiae C-3.
At the end of fermentation, the ethanol yield of P.
kudriavzevii C-16 was 16.23 ± 0.78 g L−1, whereas that of S.
cerevisiae C-3 was only 4.66 g L−1. When P. kudriavzevii C-16
and S. cerevisiae C-3 were cultured together, the ethanol yield
(18.08 ± 0.71 g L−1) increased (Figure 3A). The ethanol
production rate of P. kudriavzevii C-16 was 0.26 g L−1 h−1 at 12
h culture and 0.30 g L−1 h−1 at 24 h culture, whereas that of S.
cerevisiae C-3 was 0.21 g L−1 h−1 at 12 h culture and 0.045 g
L−1 h−1 at 24 h culture. However, the ethanol production rate
of coculture was 0.42 g L−1 h−1 at 12 h culture and 0.38 g L−1
h−1 at 24 h culture, which was faster than that of P. kudriavzevii
C-16 and S. cerevisiae C-3 (Figure 3B). This result indicated
that coculture could increase the ethanol production rate of
yeast in the early stage of fermentation. Figure S2 shows that P.
kudriavzevii C-16 completely consumed glucose at 72 h
culture. In contrast, S. cerevisiae C-3 could not completely
exhaust the glucose in the medium, and 33.09 ± 0.65 g L−1
glucose remained after 72 h of fermentation. However, when
these two strains were cultured together, the glucose was
consumed at 48 h. This result indicated that the coculture of P.
kudriavzevii C-16 and S. cerevisiae C-3 enhanced the
consumption of glucose in the presence of lactic acid (40 g
L−1).
P. kudriavzevii C-16 showed a maximum consumption of
7.20 ± 1.41 g L−1 lactic acid at the end of fermentation,
Figure 3. Production of ethanol in mono- and cocultures in sorghum media with 40 g L−1 lactic acid.
4906
pubs.acs.org/JAFC Article
whereas S. cerevisiae C-3 showed a maximum consumption of
4.44 ± 0.72 g L−1 lactic acid (Figure 4A). Interestingly, when
these two strains were cultured together, the maximum
consumption of lactic acid (13.71 ± 0.63 g L−1) significantly
increased (P < 0.01). P. kudriavzevii C-16 showed a maximum
lactic acid consumption rate of 0.16 g L−1 h−1 at 24 h and S.
cerevisiae C-3 showed 0.15 g L−1 h−1 at 36 h (Figure 4B).
However, when these two strains were cultured together, the
maximum consumption rate of lactic acid was 0.32 g L−1 h−1 at
24 h, which was significantly increased. This result indicated
that the coculture of P. kudriavzevii C-16 and S. cerevisiae C-3
enhanced the consumption of lactic acid in the presence of
lactic acid (40 g L−1). Figure 5 shows that the pH was almost
constant and fluctuated around 2.5 during the mono- and
coculture of P. kudriavzevii C-16 and S. cerevisiae C-3.
Effects of Microbial Interactions on Gene Tran-
scriptions Associated with Lactic Acid Tolerance. As
shown in Figure 6, genes that we monitored involved in three
pathways. Pathway 1 (P1) was about lactate catabolism;
pathway 2 (P2) was about H+ extrusion and intracellular pH
recovery; and pathway 3 (P3) was about glycerol transport for
counteracting osmotic pressure in cells.
The transcription levels of each gene were significantly
different. Among these, ADH5 encodes alcohol dehydrogenase.
At 12 h, lactic acid decreased the transcription of ADH5 in P.
kudriavzevii C-16 in monoculture (7.98-fold) and coculture
(5.04-fold) compared with the control (0 g L−1, monoculture)
(Figure 7A). No significant (P > 0.05) variation in the
transcription of AHD5 was observed in monoculture and
coculture for P. kudriavzevii C-16. At 24 h, lactic acid
decreased the transcription of ADH5 (6.2-fold) in P.
kudriavzevii C-16 monoculture. Meanwhile, coculture signifi-
cantly increased the transcription of ADH5 under lactic acid
stress (P < 0.01). In coculture, the inhibiting effect of lactic
acid stress on P. kudriavzevii C-16 ADH5 was relieved at 24 h,
and its transcription level was similar to that of the control
group (1.07-fold). At 12 h, ADH5 in S. cerevisiae C-3 (40 g
L−1) was downregulated 3.75-fold (in monoculture) and 5.95-
fold (in coculture) compared with the control (0 g L−1,
monoculture). At 24 h, the transcription level of ADH5 in S.
cerevisiae C-3 under lactic acid stress was downregulated 5.86-
fold in monoculture, whereas it was only downregulated 1.72-
fold in coculture (Figure 8A). At 24 h, coculture significantly
increased the transcription of ADH5 under high lactic acid
stress (P < 0.05).
lldD (P1) encodes the enzyme converting lactic acid to
pyruvate. To tolerate lactic acid toxic effects, P. kudriavzevii C-
16 increased the transcription of lldD in monoculture (6.2-
https://dx.doi.org/10.1021/acs.jafc.9b08052
J. Agric. Food Chem. 2020, 68, 4903−4911
Journal of Agricultural and Food Chemistry
Figure 4. Consumption of lactic acid in mono- and cocultures in sorghum media with 40 g L−1 lactic acid.
Figure 5. pH in mono- and cocultures in sorghum media with 40 g
L−1 lactic acid.
Figure 6. Pathways of P. kudriavzevii and S. cerevisiae response to
lactic acid stress.
fold) at 24 h. Interestingly, in coculture, the transcription of
lldD (18.3-fold) (P < 0.001) significantly increased (Figure
7B). At 12 h, S. cerevisiae C-3 expressed lldD neither in
monoculture nor in coculture. However, at 24 h, lactic acid
stress increased the transcription of lldD in S. cerevisiae C-3
monoculture (2.3-fold) compared with the control (Figure
8B). In coculture, the transcription of lldD in S. cerevisiae C-3
was upregulated 3.9-fold compared to the control, which was
significantly increased than monoculture (P < 0.05).
Besides the increased transcription of the gene in lactate
catabolism, the transcription of the gene encoding the enzyme
pumping H+ also was upregulated. VMA8 (P2) encodes H+-
ATPase, which links ATP hydrolysis to H+ extrusion. At 24 h,
to respond to lactic acid, VMA8 in P. kudriavzevii C-16 was
upregulated 9.01-fold compared with the control (Figure 7C).
No significant (P > 0.05) variation in the transcription of
VMA8 was observed in monoculture and coculture for P.
kudriavzevii C-16. Figure 8C shows that VMA8 in S. cerevisiae
4907
pubs.acs.org/JAFC Article
C-3 in monoculture was not expressed at 12 h. Interestingly, at
12 h, coculture significantly increased the transcription of
VMA8 in S. cerevisiae C-3 under lactic acid stress (2.15-fold) (P
< 0.01). At 24 h, the lactic acid stress increased the
transcription of VMA8 in S. cerevisiae C-3 in monoculture
(1.59-fold), whereas it was significantly increased in coculture
(2.71-fold) (P < 0.05).
In addition, there is an osmotic pressure maintenance
mechanism in S. cerevisiae C-3. STL1 (P3) encodes glycerol
importer. Figure 7D shows that STL1 in P. kudriavzevii C-16
was not expressed in both monoculture and coculture. At 12 h,
S. cerevisiae C-3 increased the transcription of STL1 (11.55-
fold) in monoculture under lactic acid stress relative to the
control (Figure 8D). At 24 h, STL1 in S. cerevisiae C-3 was
upregulated 46.21-fold (40 g L−1, monoculture) and 6.14-fold
(40 g L−1, coculture) compared with the control. Under lactic
acid stress, coculture significantly downregulated the tran-
scription of STL1 in S. cerevisiae C-3 compared to monoculture
(P < 0.01).
■ DISCUSSION
Effects of Lactic Acid on the Growth and Metabolic
Profiles of P. kudriavzevii and S. cerevisiae. In Chinese
Moutai-flavor Baijiu production, the core yeasts encounter
considerable amounts of the stress of weak organic acids,
which affects ethanol production. Lactic acid represents one of
the important organic acids produced by microbial fermenta-
tion.27 In our previous study, we found that during the
fermentation of Chinese Moutai-flavor Baijiu, the concen-
tration of lactic acid was 28.05 ± 4.75−36.20 ± 6.20 g kg−1 of
fermented grain.4 Therefore, 40 g L−1 lactic acid was selected
as the concentration for lactic acid tolerance tests. In response
to acid stress, P. kudriavzevii C-16 and S. cerevisiae C-3 reduced
in biomass and growth rate compared with the control (Figure
1). This is consistent with the effects of other organic acids,
such as acetic acid, that have been reported.28,29 The reduction
in growth rate may be attributable to the decrease in protein
synthesis and the decline in glycolytic enzyme activity in
yeasts.30 In this work, we found that P. kudriavzevii C-16 could
tolerate 40 g L−1 lactic acid, whereas S. cerevisiae C-3 could not
grow and metabolize under 40 g L−1 lactic acid stress (Figure 1
and S1). This result suggested that P. kudriavzevii might be a
promising candidate for fermentation in high lactic acid
conditions.
Improvement of Lactic Acid Tolerance by P.
kudriavzevii and S. cerevisiae Coculture. Microbial
interaction is important for the fermented foods to successfully
obtain the desired product.8 We developed a P. kudriavzevii−S.
cerevisiae coculture system to explore their interaction in
https://dx.doi.org/10.1021/acs.jafc.9b08052
J. Agric. Food Chem. 2020, 68, 4903−4911
Journal of Agricultural and Food Chemistry pubs.acs.org/JAFC Article

Figure 7. Relative transcription ratios of genes associated with lactic acid tolerance in P. kudriavzevii with 40 g L−1 lactic acid as compared to the
control (0 g L−1, monoculture). These genes include alcohol dehydrogenase 5 (ADH5) (A), L-lactate dehydrogenase (cytochrome) (lldD) (B), V-
type H+-transporting ATPase subunit D (VMA8) (C), and glucose-inactivated glycerol proton symporter (STL1) (D).

Figure 8. Relative transcription ratios of genes associated with lactic acid tolerance in S. cerevisiae with 40 g L−1 lactic acid as compared to the
control (0 g L−1, monoculture). These genes include alcohol dehydrogenase 5 (ADH5) (A), L-lactate dehydrogenase (cytochrome) (lldD) (B), V-
type H+-transporting ATPase subunit D (VMA8) (C), and glucose-inactivated glycerol proton symporter (STL1) (D).

response to lactic acid stress. In our work, we found that the
biomass of S. cerevisiae C-3 was more in coculture than in
monoculture under lactic acid stress (Figure 2). Furthermore,
the production rate and yield of ethanol in coculture were
higher than that in monoculture (Figure 3). This result
confirmed that under lactic acid stress, coculture produced
4908
more ethanol than the monoculture of P. kudriavzevii C-16 or
S. cerevisiae C-3. In addition, one unanticipated finding was
that the concentration of lactic acid decreased in P. kudriavzevii
C-16 fermentation (Figure 4). The toxic effect of lactic acid,
and weak organic acids in general, involves the accumulation of
the weak acid counterion (RCOO−) in yeast cells. For
https://dx.doi.org/10.1021/acs.jafc.9b08052
J. Agric. Food Chem. 2020, 68, 4903−4911
Journal of Agricultural and Food Chemistry
example, previous studies showed that acetate caused
programmed cell death and increased reactive oxygen
species.18 Besides, sorbate has been shown to influence
membrane structure.31 P. kudriavzevii could metabolize lactic
acid, thereby reducing the lactic acid in the fermentation
system, which provided a relatively suitable environment for S.
cerevisiae to grow and produce ethanol.
Effects of Microbial Interactions on Gene Tran-
scriptions Associated with Lactic Acid Tolerance. The
undissociated form of lactic acid can enter yeast cells by simple
diffusion.5 Our findings assumed that the intracellular lactate
ion dissociated from lactic acid could be degraded by P.
kudriavzevii C-16 and S. cerevisiae C-3 to tolerate lactic acid
stress. It was reported that lactate could be converted to
pyruvate by lactate dehydrogenase (LldD).32 To maintain the
intracellular pH within physiological values, H+ dissociated
from lactic acid can be extruded out of cells by H+-transporting
ATPase, such as VMA8.33 The high concentration of lactic acid
causes an increase in osmotic pressure, which affects the
growth and metabolism of the cells. Glycerol, a recognized
compatible solute, can stabilize osmotic pressure in yeast
cells.34 STL1 encodes glycerol importer.35 To verify the
abovementioned hypothesis, we monitored the transcription
levels of genes associated with ethanol production and lactic
acid tolerance.
We observed the downregulation of the gene encoding
alcohol dehydrogenase (ADH5) under lactic acid stress,
whereas coculture significantly increased the transcription of
ADH5 in both yeasts under high lactic acid stress (P < 0.05)
(Figures 7 and 8A). These results confirmed that coculture
elevated the yield and production rate of ethanol. With the
synergistic metabolism of P. kudriavzevii and S. cerevisiae on
lactate and other lactic acid tolerance mechanisms, the
inhibition of lactic acid was gradually relieved, and the ethanol
production capacity of yeasts was gradually restored. More-
over, we found three independent pathways, including lactate
catabolism, H+ extrusion, and glycerol transport for counter-
acting osmotic pressure in cells (Figure 6). At 12 h, P.
kudriavzevii enhanced the transcription of gene lldD through
the pyruvate metabolism pathway to degrade a high
concentration of lactate to pyruvate (Figure 7B). At 24 h,
coculture significantly upregulated lldD in S. cerevisiae C-3
compared to monoculture (P < 0.05) (Figure 8B). This result
indicated that S. cerevisiae restored the capacity to catabolize
lactic acid when lactic acid decreased to 35.46 g L−1 in
coculture (at 24 h). Previous studies have reported that S.
cerevisiae can express LldD and utilize lactic acid as a carbon
source and energy source.36 Moreover, we found that lactic
acid increased the transcription of VMA8 (P2), encoding H+-
ATPase, in P. kudriavzevii C-16 and S. cerevisiae C-3 (Figures
7C and 8C). S. cerevisiae has been reported to use H+-ATPase
to control intracellular pH under weak acid stress.37 Other
yeasts also have developed this mechanism to tolerate weak
organic acid toxicity. For example, Pichia anomala can tolerate
low pH by H+-ATPases coupled with increased mitochondrial
ATP production.38 Candida krusei also showed higher
tolerance to lactic acid than S. cerevisiae, probably because of
a quicker H+-ATPase response.39 Interestingly, we found that
coculture significantly upregulated VMA8 in S. cerevisiae C-3
compared to monoculture (P < 0.05). H+ extrusion requires
ATP hydrolysis. In this study, the increased glucose
consumption rate in coculture lead to an increase in ATP
production, supporting the proton extrusion under lactic acid
4909
pubs.acs.org/JAFC Article
stress.1 Interestingly, STL1 encoding glycerol importer was
expressed in S. cerevisiae C-3 and not in P. kudriavzevii C-16.
Moreover, coculturing with P. kudriavzevii C-16 decreased its
transcription level (Figure 8D). This can be explained by the
dominance of lactate catabolism in P. kudriavzevii against lactic
acid stress, not glycerol. These results confirmed that the
osmotic pressure maintenance mechanism only occurred in S.
cerevisiae. Under lactic acid stress, coculture significantly
upregulated the transcription of ADH5, lldD, and VMA8 in
S. cerevisiae, compared with monoculture. These results
indicated that the interaction between P. kudriavzevii and S.
cerevisiae could upregulate the microbial metabolic activity of
ethanol and lactic acid in S. cerevisiae under lactic acid stress.
In this work, we revealed the synergistic lactic acid
degradation mechanism of P. kudriavzevii and S. cerevisiae.
Under a high concentration of lactic acid, P. kudriavzevii
reduced the concentration of lactic acid, thereby facilitating S.
cerevisiae to grow. Under a lower concentration of lactic acid, S.
cerevisiae and P. kudriavzevii could utilize lactic acid together.
In addition, P. kudriavzevii and S. cerevisiae resisted lactic acid
stress also through H+ extrusion and glycerol transportation. In
addition to these three pathways, other lactic acid tolerance
mechanisms have been reported in other yeasts.40 In the
future, we will use mRNA sequencing to comprehensively
examine the transcription level of key genes in the lactic acid
synthesis and degradation metabolic pathways, which can
facilitate the mechanisms of lactic acid more accurately and
comprehensively. This work reveals a novel synergistic effect of
core functional yeasts in the tolerance to lactic acid via three
independent pathways. Our findings can be used to enhance
the stability of yeasts in the fermentation of Chinese Moutai-
flavor Baijiu and provide a new approach to improve the
fermentation process of various fermented foods and
beverages.
■
*
ASSOCIATED CONTENT
sı Supporting Information
The Supporting Information is available free of charge at
https://pubs.acs.org/doi/10.1021/acs.jafc.9b08052.
Glucose consumption and ethanol production in the
monoculture of P. kudriavzevii and S. cerevisiae, with and
without lactic acid and glucose consumption in the
mono- and cocultures of P. kudriavzevii and S. cerevisiae
under lactic acid stress (PDF)
■
AUTHOR INFORMATION
Corresponding Authors
Hai Du − State Key Laboratory of Food Science and Technology,
Key Laboratory of Industrial Biotechnology of Ministry of
Education, School of Biotechnology, Jiangnan University, Wuxi,
Jiangsu 214122, China; Institute for Chinese Jiang-Flavor
Baijiu (Liquor), Renhuai, Guizhou 564500, China;
Email: duhai88@jiangnan.edu.cn
Yan Xu − State Key Laboratory of Food Science and Technology,
Key Laboratory of Industrial Biotechnology of Ministry of
Education, School of Biotechnology, Jiangnan University, Wuxi,
Jiangsu 214122, China; Institute for Chinese Jiang-Flavor
Baijiu (Liquor), Renhuai, Guizhou 564500, China;
orcid.org/0000-0002-7919-4762; Phone: +86-510-
85964112; Email: yxu@jiangnan.edu.cn; Fax: +86-510-
85918201
https://dx.doi.org/10.1021/acs.jafc.9b08052
J. Agric. Food Chem. 2020, 68, 4903−4911
Journal of Agricultural and Food Chemistry
Author
Nan Deng − State Key Laboratory of Food Science and
Technology, Key Laboratory of Industrial Biotechnology of
Ministry of Education, School of Biotechnology, Jiangnan
University, Wuxi, Jiangsu 214122, China
Complete contact information is available at:
https://pubs.acs.org/10.1021/acs.jafc.9b08052
Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS
This work was supported by the National Natural Science
Foundation of China (NSFC) (grants 31530055), National
Key R&D Program of China (2018YFC1604100,
2016YFD0400503), National First-Class Discipline Program
of Light Industry Technology and Engineering of China
(LITE2018-12), and the Program of Introducing Talents of
Discipline to Universities of China (111 Project) (grant 111-2-
06).
■
ABBREVIATIONS
HPLC, high-performance liquid chromatography; RT-qPCR,
reverse transcription-quantitative polymerase chain reaction.
■ REFERENCES
(1) Wu, C.; Zhang, J.; Chen, W.; Wang, M.; Du, G.; Chen, J. A
combined physiological and proteomic approach to reveal lactic-acid-
induced alterations in Lactobacillus casei Zhang and its mutant with
enhanced lactic acid tolerance. Appl. Microbiol. Biotechnol. 2012, 93,
707−722.
(2) Wang, S.; Wu, Q.; Nie, Y.; Wu, J.; Xu, Y. Construction of
synthetic microbiota for reproducible flavor metabolism in Chinese
light aroma type liquor produced by solid-state fermentation. Appl.
Environ. Microbiol. 2019, 85, e03090−18.
(3) Clément, H.; Prost, C.; Chiron, H.; Ducasse, M. B.; Della Valle,
G.; Courcoux, P.; Onno, B. The effect of organic wheat flour by-
products on sourdough performances assessed by a multi-criteria
approach. Food Res. Int. 2018, 106, 974−981.
(4) Song, Z.; Du, H.; Zhang, Y.; Xu, Y. Unraveling Core Functional
Microbiota in Traditional Solid-State Fermentation by High-
Throughput Amplicons and Metatranscriptomics Sequencing. Front.
Microbiol. 2017, 8, 1294.
(5) Mira, N. P.; Teixeira, M. C.; Sá-Correia, I. Adaptive response
and tolerance to weak acids in Saccharomyces cerevisiae: a genome-
wide view. OMICS: J. Integr. Biol. 2010, 14, 525−540.
(6) Warnecke, T.; Gill, R. T. Organic acid toxicity, tolerance, and
production in Escherichia coli biorefining applications. Microb. Cell
Factories 2005, 4, 25.
(7) Lambert, R. J.; Stratford, M. Weak-acid preservatives: modelling
microbial inhibition and response. J. Appl. Microbiol. 1999, 86, 157−
164.
(8) Jin, G.; Zhu, Y.; Xu, Y. Mystery behind Chinese liquor
fermentation. Trends Food Sci. Technol. 2017, 63, 18−28.
(9) Wu, Q.; Xu, Y.; Chen, L. Diversity of yeast species during
fermentative process contributing to Chinese Maotai-flavour liquor
making. Lett. Appl. Microbiol. 2012, 55, 301−307.
(10) Jiang, J.; Liu, Y.; Li, H.; Yang, Q.; Wu, Q.; Chen, S.; Tang, J.;
Xu, Y. Modeling and Regulation of Higher Alcohol Production
through the Combined Effects of the C/N Ratio and Microbial
Interaction. J. Agric. Food Chem. 2019, 67, 10694−10701.
(11) Liu, P.; Xiong, X.; Wang, S.; Miao, L. Population dynamics and
metabolite analysis of yeasts involved in a Chinese miscellaneous-
flavor liquor fermentation. Ann. Microbiol. 2017, 67, 553−565.
(12) Du, H.; Song, Z.; Xu, Y. Ethyl Carbamate Formation Regulated
by Lactic Acid Bacteria and Nonconventional Yeasts in Solid-State
4910
pubs.acs.org/JAFC Article
Fermentation of Chinese Moutai-Flavor Liquor. J. Agric. Food Chem.
2018, 66, 387−392.
(13) Xu, D.; Yin, Y.; Ali, B.; Zhang, Y.; Guo, L.; Xu, X. Isolation of
yeast strains from Chinese liquor Daqu and its use in the wheat
sourdough bread making. Food Biosci. 2019, 31, 100443.
(14) del Mónaco, S. M.; Barda, N. B.; Rubio, N. C.; Caballero, A. C.
Selection and characterization of a Patagonian Pichia kudriavzevii for
wine deacidification. J. Appl. Microbiol. 2014, 117, 451−464.
(15) Li, C.; Xu, Y.; Li, L.; Yang, X.; Wang, Y. Acid stress induces
cross-protection for cadmium tolerance of multi-stress-tolerant Pichia
kudriavzevii by regulating cadmium transport and antioxidant defense
system. J. Hazard. Mater. 2019, 366, 151−159.
(16) Sidari, R.; Martorana, A.; De Bruno, A. Effect of brine
composition on yeast biota associated with naturally fermented
Nocellara messinese table olives. LWT–Food Sci. Technol. 2019, 109,
163−170.
(17) Park, H. J.; Bae, J. H.; Ko, H. J.; Lee, S. H.; Sung, B. H.; Han, J.
I.; Sohn, J. H. Low-pH production of d-lactic acid using newly isolated
acid tolerant yeast Pichia kudriavzevii NG7. Biotechnol. Bioeng. 2018,
115, 2232−2242.
(18) Giannattasio, S.; Guaragnella, N.; Ž dralević, M.; Marra, E.
Molecular mechanisms of Saccharomyces cerevisiae stress adaptation
and programmed cell death in response to acetic acid. Front. Microbiol.
2013, 4, 33.
(19) Martani, F.; Marano, F.; Bertacchi, S.; Porro, D.; Branduardi, P.
The Saccharomyces cerevisiae poly(A) binding protein Pab1 as a target
for eliciting stress tolerant phenotypes. Sci. Rep. 2015, 5, 18318.
(20) Berterame, N. M.; Porro, D.; Ami, D.; Branduardi, P. Protein
aggregation and membrane lipid modifications under lactic acid stress
in wild type and OPI1 deleted Saccharomyces cerevisiae strains. Microb.
Cell Factories 2016, 15, 39.
(21) Stratford, M.; Steels, H.; Nebe-Von-Caron, G.; Novodvorska,
M.; Hayer, K.; Archer, D. B. Extreme resistance to weak-acid
preservatives in the spoilage yeast Zygosaccharomyces bailii. Int. J. Food
Microbiol. 2013, 166, 126−134.
(22) Meng, X.; Wu, Q.; Wang, L.; Wang, D.; Chen, L.; Xu, Y.
Improving flavor metabolism of Saccharomyces cerevisiae by mixed
culture with Bacillus licheniformis for Chinese Maotai-flavor liquor
making. J. Ind. Microbiol. Biotechnol. 2015, 42, 1601−1608.
(23) Zott, K.; Claisse, O.; Lucas, P.; Coulon, J.; Lonvaud-Funel, A.;
Masneuf-Pomarede, I. Characterization of the yeast ecosystem in
grape must and wine using real-time PCR. Food Microbiol. 2010, 27,
559−567.
(24) Xu, W.; Huang, Z.; Zhang, X.; Li, Q.; Lu, Z.; Shi, J.; Xu, Z.; Ma,
Y. Monitoring the microbial community during solid-state acetic acid
fermentation of Zhenjiang aromatic vinegar. Food Microbiol. 2011, 28,
1175−1181.
(25) Baek, S.-H.; Kwon, E. Y.; Bae, S.-J.; Cho, B.-R.; Kim, S.-Y.;
Hahn, J.-S. Improvement of D-Lactic Acid Production in Saccha-
romyces cerevisiae Under Acidic Conditions by Evolutionary and
Rational Metabolic Engineering. Biotechnol. J. 2017, 12, 1700015.
(26) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene
expression data using real-time quantitative PCR and the 2‑ΔΔCT
Method. Methods 2001, 25, 402−408.
(27) Kuanyshev, N.; Ami, D.; Signori, L.; Porro, D.; Morrissey, J. P.;
Branduardi, P. Assessing physio-macromolecular effects of lactic acid
on Zygosaccharomyces bailii cells during microaerobic fermentation.
FEMS Yeast Res. 2016, 16, fow058.
(28) Dong, Y.; Hu, J.; Fan, L.; Chen, Q. RNA-Seq-based
transcriptomic and metabolomic analysis reveal stress responses and
programmed cell death induced by acetic acid in Saccharomyces
cerevisiae. Sci. Rep. 2017, 7, 42659.
(29) Palma, M.; Dias, P. J.; Roque, F. C.; Luzia, L.; Guerreiro, J. F.;
Sá-Correia, I. The Zygosaccharomyces bailii transcription factor Haa1 is
required for acetic acid and copper stress responses suggesting
subfunctionalization of the ancestral bifunctional protein Haa1/Cup2.
BMC Genom. 2017, 18, 75.
(30) Pearce, A. K.; Booth, I. R.; Brown, A. J. P. Genetic manipulation
of 6-phosphofructo-1-kinase and fructose 2,6-bisphosphate levels
https://dx.doi.org/10.1021/acs.jafc.9b08052
J. Agric. Food Chem. 2020, 68, 4903−4911
Journal of Agricultural and Food Chemistry pubs.acs.org/JAFC Article

affects the extent to which benzoic acid inhibits the growth of

Saccharomyces cerevisiae. Microbiol 2001, 147, 403−410.
(31) Ullah, A.; Chandrasekaran, G.; Brul, S.; Smits, G. J. Yeast
adaptation to weak acids prevents futile energy expenditure. Front.
Microbiol. 2013, 4, 142.
(32) Lin, Y.-C.; Cornell, W. C.; Jo, J.; Price-Whelan, A.; Dietrich, L.
E. P. The Pseudomonas aeruginosa Complement of Lactate
Dehydrogenases Enables Use of D- and L-Lactate and Metabolic
Cross-Feeding. mBio 2018, 9, e00961−18.
(33) Pereira, F. B.; Teixeira, M. C.; Mira, N. P.; Sá-Correia, I.;
Domingues, L. Genome-wide screening of Saccharomyces cerevisiae
genes required to foster tolerance towards industrial wheat straw
hydrolysates. J. Ind. Microbiol. Biotechnol. 2014, 41, 1753−1761.
(34) Abbott, D. A.; Suir, E.; van Maris, A. J. A.; Pronk, J. T.
Physiological and transcriptional responses to high concentrations of
lactic acid in anaerobic chemostat cultures of Saccharomyces cerevisiae.
Appl. Environ. Microbiol. 2008, 74, 5759−5768.
(35) Mendes, F.; Sieuwerts, S.; de Hulster, E.; Almering, M. J. H.;
Luttik, M. A. H.; Pronk, J. T.; Smid, E. J.; Bron, P. A.; Daran-
Lapujade, P. Transcriptome-based characterization of interactions
between Saccharomyces cerevisiae and Lactobacillus delbrueckii subsp.
bulgaricus in lactose-grown chemostat cocultures. Appl. Environ.
Microbiol. 2013, 79, 5949−5961.
(36) Cássio, F.; Leão, C.; van Uden, N. Transport of lactate and
other short-chain monocarboxylates in the yeast Saccharomyces
cerevisiae. Appl. Environ. Microbiol. 1987, 53, 509−513.
(37) de Kok, S.; Yilmaz, D.; Daran, J.-M.; Pronk, J. T.; van Maris, A.
J. A. In vivo analysis of Saccharomyces cerevisiae plasma membrane
ATPase Pma1p isoforms with increased in vitro H + /ATP
stoichiometry. Antonie Leeuwenhoek 2012, 102, 401−406.
(38) Fletcher, E.; Feizi, A.; Kim, S.; Siewers, V.; Nielsen, J. RNA-seq
analysis of Pichia anomala reveals important mechanisms required for
survival at low pH. Microb. Cell Factories 2015, 14, 143.
(39) Halm, M.; Hornbæk, T.; Arneborg, N.; Sefa-Dedeh, S.;
Jespersen, L. Lactic acid tolerance determined by measurement of
intracellular pH of single cells of Candida krusei and Saccharomyces
cerevisiae isolated from fermented maize dough. Int. J. Food Microbiol.
2004, 94, 97−103.
(40) Ortiz-Merino, R. A.; Kuanyshev, N.; Byrne, K. P.; Varela, J. A.;
Morrissey, J. P.; Porro, D.; Wolfe, K. H.; Branduardi, P. Transcrip-
tional Response to Lactic Acid Stress in the Hybrid Yeast
Zygosaccharomyces parabailii. Appl. Environ. Microbiol. 2018, 84,
e02294−17.

4911 https://dx.doi.org/10.1021/acs.jafc.9b08052
J. Agric. Food Chem. 2020, 68, 4903−4911