Genetics: From Genes to Genomes

(International Edition) seventh ed

Michael Goldberg
Visit to download the full and correct content document:
https://ebookmass.com/product/genetics-from-genes-to-genomes-international-edition
-seventh-ed-michael-goldberg/
 SEV ENTH E D ITI O N

Genetics
From Genes to Genomes

Michael L. Goldberg
CORNELL UNIVERSITY

Janice A. Fischer
THE UNIVERSITY OF TEXAS AT AUSTIN

Leroy Hood
THE INSTITUTE FOR SYSTEMS BIOLOGY

Leland H. Hartwell
FRED HUTCHISON CANCER CENTER
GENETICS

Published by McGraw Hill LLC, 1325 Avenue of the Americas, New York, NY 10121. Copyright ©2021
by McGraw Hill LLC. All rights reserved. Printed in the United States of America. No part of this publication
may be reproduced or distributed in any form or by any means, or stored in a database or retrieval system,
without the prior written consent of McGraw Hill LLC, including, but not limited to, in any network or other
electronic storage or transmission, or broadcast for distance learning.

Some ancillaries, including electronic and print components, may not be available to customers outside the
United States.

This book is printed on acid-free paper.

1 2 3 4 5 6 7 8 9 LWI 24 23 22 21 20

ISBN 978-1-260-57582-8
MHID 1-260-57582-9

Cover Image: ©H Art/Shutterstock

All credits appearing on page or at the end of the book are considered to be an extension of the copyright page.

The Internet addresses listed in the text were accurate at the time of publication. The inclusion of a website
does not indicate an endorsement by the authors or McGraw Hill LLC, and McGraw Hill LLC does not
guarantee the accuracy of the information presented at these sites.

mheducation.com/highered
 About the Authors

Dr. Michael Goldberg is a Professor at Cornell University, where he teaches

introductory genetics and human genetics. He was an undergraduate at Yale University
and received his Ph.D. in biochemistry from Stanford University. Dr. Goldberg per-
formed postdoctoral research at the Biozentrum of the University of Basel
(Switzerland) and at Harvard University, and he received an NIH Fogarty Senior
International Fellowship for study at Imperial College (England) and fellowships
from the Fondazione Cenci Bolognetti for sabbatical work at the University of Rome
©Michael Goldberg
(Italy). His current research uses the tools of Drosophila genetics and the biochem-
ical analysis of frog egg cell extracts to investigate the mechanisms that ensure proper
cell-cycle progression and chromosome segregation during mitosis and meiosis.

Dr. Janice Fischer is a Professor at The University of Texas at Austin, where she
is an award-winning teacher of genetics and Director of the Biology Instructional
Office. She received her Ph.D. in biochemistry and molecular biology from Harvard
University, and did postdoctoral research at The University of California at Berkeley,
Harvard University, and The Whitehead Institute at MIT. In her research, Dr. Fischer
used Drosophila first to study how tissue-specific transcription works, and then to
examine the roles of ubiquitin and endocytosis in cell signaling during development.
©Janice Fischer

Dr. Lee Hood received an M.D. from The Johns Hopkins University School of
Medicine and a Ph.D. in biochemistry from the California Institute of Technology.
His current research interests include cancer biology, the development of biological
instrumentation (for example, the protein sequencer and the automated fluorescent
DNA sequencer), genomics, systems biology and systems medicine. His early research
played a key role in unraveling the mysteries of antibody diversity. More recently he
has pioneered systems approaches to biology and medicine and has pioneered scien-
tific (quantitative) wellness and the analyses of individuals with genomics/phenomics.
©Lee Hood
Dr. Hood has taught molecular evolution, immunology, molecular biology,
genomics, biochemistry, and systems biology and has coauthored textbooks in
biochemistry, molecular biology, immunology, and systems biology and medicine, as
well as The Code of Codes—a monograph about the Human Genome Project. He was
one of the first advocates for the Human Genome Project and directed one of the
federal genome centers that sequenced the human genome. Dr. Hood is currently a
Professor and cofounder of the cross-disciplinary Institute for Systems Biology in
Seattle, Washington.
Dr. Hood is also Senior Vice President and Chief Science Officer of Providence
St. Joseph Health. Dr. Hood has received a variety of awards, including the Albert
Lasker Award for Medical Research (1987), the Distinguished Service Award from
the National Association of Teachers (1998), and the Lemelson/MIT Award for
Invention (2003). He is the 2002 recipient of the Kyoto Prize in Advanced
Biotechnology—an award recognizing his pioneering work in developing the protein
and DNA synthesizers and sequencers that provided the technical foundation of mod-
ern biology. He received the Medal of Science from President Obama in 2011. He is
deeply involved in K–12 science education. His hobbies include running, exercise,
and reading.

iii
Brief Contents

Preface ix

PART I 15 Ploidy 460

Basic Principles: How Traits Are Transmitted 1 16 Bacterial Genetics 478
1 Mendel’s Principles of Heredity 1 17 Organellar Inheritance 511
2 Extensions to Mendel’s Laws 28
3 Chromosomes and Inheritance 68 PART V
4 Sex Chromosomes 91 How Genes Are Regulated 535
5 Linkage, Recombination, and Gene 18 Gene Regulation in Prokaryotes 535
Mapping 118
19 Gene Regulation in Eukaryotes 570
20 Epigenetics 599
PART II
What Genes Are and What They Do 165
PART VI
6 DNA Structure, Replication, and
Recombination 165 Using Genetics 619

7 Mutation 203 21 Manipulating the Genomes of Eukaryotes 619

8 Using Mutations to Study Genes 229

22 Genetic Analysis of Development 648

9 Gene Expression: The Flow of Information

23 The Genetics of Cancer 683
from DNA to RNA to Protein 257
PART VII
PART III Beyond the Individual Gene and Genome 714
Analysis of Genetic Information 303 24 Variation and Selection in Populations 714
10 Digital Analysis of DNA 303 25 Genetic Analysis of Complex Traits 747

11 Genome Annotation 327

Guidelines for Gene Nomenclature A-1
12 Analyzing Genomic Variation 352 Brief Answer Section B-1
Glossary G-1
Index I-1
PART IV
How Genes Travel on Chromosomes 395

13 The Eukaryotic Chromosome 395

14 Chromosomal Rearrangements 425
iv
 Contents

About the Authors iii 4.2 Gametogenesis 96

Preface ix 4.3 Sex Linkage 98
Acknowledgments xvi 4.4 Sex-Linked and Sexually Dimorphic Traits in
Humans 102
PART I 4.5 Human Intersexuality 106
■ Fast Forward: Transgenic Mice Prove that SRY
Basic Principles: How Traits Is the Maleness Factor 94
Are Transmitted 1 ■ Fast Forward: Visualizing X-Chromosome
Inactivation in Transgenic Mice 105

Lawrence Manning/Corbis chapter 5

chapter 1 Linkage, Recombination, and Gene Mapping 118
Mendel’s Principles of Heredity 1 5.1 Gene Linkage and Recombination 119
5.2 Recombination: A Result of Crossing-Over
1.1 The Puzzle of Inheritance 2
During Meiosis 123
1.2 Genetic Analysis According to Mendel 4
5.3 Mapping: Locating Genes Along a
1.3 Mendelian Inheritance in Humans 14 Chromosome 128
5.4 The Chi-Square Test and Linkage Analysis 137
chapter 2 5.5 Tetrad Analysis in Fungi 141
Extensions to Mendel’s Laws 28 5.6 Mitotic Recombination and Genetic
2.1 Extensions to Mendel for Single-Gene Mosaics 149
Inheritance 29 ■ Fast Forward: Mapping the Crossovers that

2.2 Extensions to Mendel for Two-Gene Generate the Chromosomes of Individual

Inheritance 38 Human Sperm 135
2.3 Extensions to Mendel for Complex Trait ■ Fast Forward: Gene Mapping Has Led to
Inheritance 48 Treatments for Cystic Fibrosis 137
2.4 A Comprehensive Example: Dog Coat Color ■ Tools of Genetics: The Chi-Square Test for
Genes 52 Goodness of Fit 140
■ Genetics and Society: Mitotic Recombination
chapter 3 and Cancer 151
Chromosomes and Inheritance 68
3.1 Chromosomes: The Carriers of Genes 69
PART II
3.2 Mitosis: Cell Division that Preserves What Genes Are and What
Chromosome Number 72 They Do 165
3.3 Meiosis: Cell Divisions that Halve
Chromosome Number 77
■ Genetics and Society: Prenatal Genetic
Diagnosis 71 Adrian Neal/Getty Images

chapter 6
chapter 4 DNA Structure, Replication, and
Sex Chromosomes 91 Recombination 165
4.1 Sex Chromosomes and Sex 6.1 Experimental Evidence for DNA as the Genetic
Determination 92 Material 166

v
vi Contents

6.2 The Watson and Crick Double Helix Model of

DNA 170 PART III
6.3 Genetic Information in Nucleotide
Analysis of Genetic
Sequence 176
Information 303
6.4 DNA Replication 178
6.5 Homologous Recombination at the DNA
Level 185
6.6 Site-Specific Recombination 193 ©CBS Photo Archive/Getty Images

chapter 10
chapter 7
Digital Analysis of DNA 303
Mutation 203
10.1 Fragmenting DNA 304
7.1 Mutations: Primary Tools of Genetic 10.2 Cloning DNA Fragments 309
Analysis 204
10.3 Sequencing DNA 313
7.2 Molecular Mechanisms that Alter DNA
10.4 Sequencing Genomes 317
Sequence 209
■ Tools of Genetics: Serendipity in Science: The
7.3 DNA Repair Mechanisms 218
Discovery of Restriction Enzymes 306
■ Fast Forward: Trinucleotide Repeat
Diseases 216
chapter 11
chapter 8 Genome Annotation 327
Using Mutations to Study Genes 229 11.1 Finding the Genes in Genomes 328
11.2 Genome Architecture and Evolution 333
8.1 What Mutations Tell Us About Gene
Structure 230 11.3 Bioinformatics: Information Technology and
Genomes 341
8.2 What Mutations Tell Us
About Gene Function 238 11.4 A Comprehensive Example: The Hemoglobin
Genes 342
8.3 A Comprehensive Example: Mutations that
Affect Vision 245
chapter 12
chapter 9 Analyzing Genomic Variation 352
Gene Expression: The Flow of 12.1 Variation Among Genomes 353
Information from DNA to RNA 12.2 Genotyping a Known Disease‑Causing
to Protein 257 Mutation 357
9.1 The Genetic Code 258 12.3 Sampling DNA Variation in
a Genome 362
9.2 Transcription: From DNA
to RNA 267 12.4 Positional Cloning 368
9.3 Translation: From mRNA to Protein 275 12.5 The Era of Whole-Genome
Sequencing 374
9.4 Differences in Gene Expression
■ Fast Forward: Genetic Genealogy 366
Between Prokaryotes and
Eukaryotes 283 ■ Tools of Genetics: The Lod Score
9.5 The Effects of Mutations on Gene Expression Statistic 372
and Function 286
■ Genetics and Society: HIV and Reverse
Transcription 271

PART IV
How Genes Travel on
Chromosomes 395
(left): Texas A&M University/FEMA/HandoutGetty Images;
(right): ©Alpha/ZUMAPRESS/Newscom
chapter 13
The Eukaryotic Chromosome
13.1 Chromosomal DNA and Proteins 396
13.2 Chromosome Structure and Compaction 397
13.3 Chromosomal Packaging and Gene
Expression 402
13.4 Replication of Eukaryotic Chromosomes 408
13.5 Chromosome Segregation 411
13.6 Artificial Chromosomes 414
chapter 14
Chromosomal Rearrangements 425
14.1 Rearrangements of Chromosomal DNA 426
14.2 The Effects of Rearrangements 430
14.3 Transposable Genetic Elements 440
14.4 Genome Restructuring and Evolution 447
■ Fast Forward: Programmed DNA Rearrangements
and the Immune System 428
chapter 15
Ploidy 460
15.1 Aberrations in Chromosome Number:
Aneuploidy 461
15.2 Variation in Number of Chromosome Sets:
Euploidy 464
15.3 Whole-Genome Duplication as a Driver of
Evolution 470
chapter 16
Bacterial Genetics 478
16.1 The Enormous Diversity of Bacteria 479
16.2 Bacterial Genomes 480
16.3 Bacteria as Experimental Organisms 485
16.4 Gene Transfer in Bacteria 487
16.5 Using Genetics to Study Bacterial Life 499
Contents vii
16.6 A Comprehensive Example: How N. gonorrhoeae
Became Resistant to Penicillin 501
■ Genetics and Society: The Human Microbiome
Project 484
chapter 17
Organellar Inheritance 511
17.1 Mitochondria and Their Genomes 512
17.2 Chloroplasts and Their Genomes 515
395 17.3 The Relationship Between Organellar and
Nuclear Genomes 517
17.4 Non-Mendelian Inheritance of Mitochondria
and Chloroplasts 519
17.5 Mutant Mitochondria and Human Disease 524
■ Fast Forward: Mitochondrial Eve 524
PART V
How Genes Are
Regulated 535
©Courtesy of Mattias Ormsestad
and Eric Roettinger/Kahi Kai
chapter 18
Gene Regulation in Prokaryotes 535
18.1 The Elements of Prokaryotic Gene
Expression 536
18.2 Regulation of Transcription Initiation via DNA-
Binding Proteins 537
18.3 RNA-Mediated Mechanisms of Gene
Regulation 549
18.4 Discovering and Manipulating Bacterial Gene
Regulatory Mechanisms 553
18.5 A Comprehensive Example: Control of
Bioluminescence by Quorum Sensing 558
chapter 19
Gene Regulation in Eukaryotes 570
19.1 Overview of Eukaryotic Gene Regulation 571
19.2 Control of Transcription Initiation Through
Enhancers 571
19.3 Regulation After Transcription 582
19.4 A Comprehensive Example: Sex Determination
in Drosophila 587
■ Tools of Genetics: The Gal4/UASG Binary Gene
Expression System 578
viii Contents
chapter 20
Epigenetics 599
20.1 Genomic Imprinting 600
20.2 Inheritance of Programmed Gene Repression
Through Cell Division 604
20.3 Transgenerational Epigenetic
Inheritance 607
20.4 A Comprehensive Example: Epigenetic
Inheritance in Mice 609
PART VI
Using Genetics 619
©Michael Goldberg, Cornell
University, Ithaca, NY
chapter 21
Manipulating the Genomes of
Eukaryotes 619
21.1 Creating Transgenic Organisms 620
21.2 Uses of Transgenic Organisms 623
21.3 Targeted Mutagenesis 627
21.4 Human Gene Therapy 634
■ Tools of Genetics: Cloning by Somatic Cell
Nuclear Transfer 625
■ Tools of Genetics: How Bacteria Use CRISPR/
Cas9 to Vaccinate Themselves Against
Viruses 633
■ Genetics and Society: Should We Alter Human
Germ-Line Genomes? 638
chapter 22
Genetic Analysis of Development 648
22.1 Model Organisms: Prototypes for
Developmental Genetics 649
22.2 Mutagenesis Screens 650
22.3 Determining Where and When Genes
Act 656
22.4 Ordering Genes in a Pathway 659
22.5 A Comprehensive Example: Body Plan
Development in Drosophila 661
chapter 23
The Genetics of Cancer 683
23.1 Characteristics of Cancer Cells 684
23.2 The Genetic Basis of Cancers 686
23.3 How Cell Division Is Normally Controlled 689
23.4 How Mutations Cause Cancer 695
23.5 Personalized Cancer Treatment 701
■ Tools of Genetics: Analysis of Cell-Cycle
Mutants in Yeast 693
PART VII
Beyond the Individual Gene
and Genome 714
©Sue Flood/Oxford
Scientific/Getty Images
chapter 24
Variation and Selection in Populations 714
24.1 The Hardy-Weinberg Law: Predicting
Genetic Variation in “Ideal” Populations 715
24.2 What Causes Allele Frequencies to
Change in Real Populations? 721
24.3 Ancestry and the Evolution of Modern
Humans 731
chapter 25
Genetic Analysis of Complex Traits 747
25.1 Heritability: Genetic Versus Environmental
Influences on Complex Traits 748
25.2 Mapping Quantitative Trait Loci (QTLs) 757
■ Tools of Genetics: The Chi-Square Test for
Independence 764
Guidelines for Gene Nomenclature A-1
Brief Answer Section B-1
Glossary G-1
Index I-1

A Note from the Authors
The science of genetics is less than 150 years old, but its
accomplishments within that short time have been aston-
ishing. Gregor Mendel first described genes as abstract
units of inheritance in 1865; his work was ignored and
then rediscovered in 1900. Thomas Hunt Morgan and his
students provided experimental verification of the idea
that genes reside within chromosomes during the years
1910–1920. By 1944, Oswald Avery and his coworkers
had established that genes are made of DNA. James
Watson and Francis Crick published their pathbreaking
structure of DNA in 1953. Remarkably, less than 50 years
later (in 2001), an international consortium of investiga-
tors deciphered the sequence of the 3 billion nucleotides in
the h­ uman genome. Twentieth-century genetics made it
possible to identify individual genes and to understand a
great deal about their functions.
Today, scientists are able to access the enormous
amounts of genetic data generated by the sequencing of
many organisms’ genomes. Analysis of these data will re-
sult in a deeper understanding of the complex molecular
interactions within and among vast networks of genes, pro-
teins, and other molecules that help bring organisms to life.
Finding new methods and tools for analyzing these data will
be a significant part of genetics in the twenty-first century.
Our seventh edition of Genetics: From Genes to Genomes
emphasizes both the core concepts of genetics and the
cutting-edge discoveries, modern tools, and analytical meth-
ods that will keep the science of genetics moving forward.
The authors of the seventh edition have worked to-
gether in revising every chapter in an effort not only to
provide the most up-to-date information, but also to pro-
vide continuity and the clearest possible explanations of
difficult concepts in one voice.
Our Focus—An Integrated Approach
Genetics: From Genes to Genomes represents a new approach
to an undergraduate course in genetics. It reflects the way
we, the authors, currently view the molecular basis of life.
We integrate:
∙∙ Formal genetics: the rules by which genes are
transmitted.
∙∙ Molecular genetics: the structure of DNA and how it
directs the structure of proteins.
∙∙ Digital analysis and genomics: recent technologies
that allow a comprehensive analysis of the entire gene
set and its expression in an organism.
Preface
Last A-Head ix
∙∙ Human genetics: how genes contribute to health and
diseases, including cancer.
∙∙ The unity of life-forms: the synthesis of information
from many different organisms into coherent models.
∙∙ Molecular evolution: the molecular mechanisms by
which biological systems, whole organisms, and
populations have evolved and diverged.
The strength of this integrated approach is that students
who complete the book will have a strong command of
­genetics as it is practiced today by both academic and cor-
porate researchers. These scientists are rapidly changing
our understanding of living organisms, including ourselves.
Ultimately, this vital research may create the ability to re-
place or correct detrimental genes—those “inborn errors of
metabolism,” as researcher Archibald Garrod called them
in 1923, as well as the later genetic alterations that lead to
the many forms of cancer.
The Genetic Way of Thinking
Modern genetics is a molecular-level science, but an under-
standing of its origins and the discovery of its principles is
a necessary context. To encourage a genetic way of think-
ing, we begin the book by reviewing Mendel’s principles
and the chromosomal basis of inheritance. From the outset,
however, we aim to integrate organism-level genetics with
fundamental molecular mechanisms.
Chapter 1 ties Mendel’s studies of pea trait inheritance
to the actions of enzymes that determine whether a pea is
round or wrinkled, yellow or green, etc. In the same chapter,
we point to the relatedness of the patterns of ­heredity in all
organisms. Chapters 2 through 5 cover extensions to
Mendel, chromosomes and inheritance, and the fundamen-
tals of gene linkage and mapping. Starting in Chapter 6, we
focus on the physical characteristics of DNA, on mutations,
and on how DNA encodes, copies, and transmits biological
information.
Beginning in Chapter 10, we move into the digital rev-
olution in DNA analysis with a look at modern genetic
techniques, including gene cloning, PCR, microarrays, and
high-throughput genome sequencing. We explore how
­bioinformatics, an emergent analytical tool, can aid in dis-
covery of genome features. This section concludes in
Chapter 12 with case studies leading to the discovery of
human disease genes.
The understanding of molecular and computer-based
techniques carries into our discussion of chromosome
specifics in Chapters 13 through 17, and also informs our
ix
x Preface

analysis of gene regulation in Chapters 18 through 20. Figure illustrations break down complex processes
Chapter 21 describes the most recent technology that sci- into ­step-by-step illustrations that lead to greater
entists can use to manipulate genomes at will—for research student understanding. All illustrations are rendered
and practical purposes including gene therapy. Chapter 22 with a consistent color theme—for example, all
explains the use of genetic tools at the molecular level to presentations of phosphate groups are the same color,
uncover the complex interactions of eukaryotic develop- as are all presentations of mRNA.
ment. In Chapter 23, we explain how our understanding of ∙∙ Accessibility Our intention is to bring cutting-edge
genetics and the development of molecular genetic tech- content to the student level. A number of more
nologies is enabling us to comprehend cancer and in some complex illustrations are revised and segmented to
cases to cure it. help the student follow the process. Legends have been
Chapters 24 and 25 cover population genetics, with a streamlined to highlight only the most important ideas,
view of how molecular tools have provided information on and throughout the book, topics and examples have
species relatedness and on genome changes at the molecular been chosen to focus on the most crucial information.
level over time. In addition, we explain how bioinformatics ∙∙ Problem Solving Developing strong problem-solving
can be combined with population genetics to trace ­human skills is vital for every genetics student. The authors
ancestry and to identify the genes that control complex traits. have carefully created problem sets at the end of each
Throughout our book, we present the scientific reason- chapter that allow students to improve their problem-
ing of some of the ingenious researchers of the field—from solving abilities, often in the context of current
Mendel, to Watson and Crick, to the collaborators on the discoveries in genetics.
Human Genome Project. We hope student readers will see ∙∙ Solved Problems These cover topical material with
that genetics is not simply a set of data and facts, but also a complete answers that provide insight into the step-
human endeavor that relies on contributions from excep- by-step process of problem solving.
tional individuals. ∙∙ Problems More than 700 questions involving a variety
of levels of difficulty develop excellent problem-
solving skills. The problems are organized by chapter
Student-Friendly Features section and in order of increasing difficulty within
each section for ease of use by instructors and
As digital components of the text become more and more
students. The companion online Study Guide and
crucial, we are very excited that Janice Fischer, a textbook
Solutions Manual, completely revised for the seventh
author, will continue in the seventh edition in a dual role as
edition by Michael Goldberg and Janice Fischer,
Digital Editor! Janice will ensure the important consistency
provides detailed analysis of strategies to solve all of
between text and digital.
the end-of-chapter problems. Many of the more
We have taken great pains to help the student make the
difficult problems could be adapted easily for use
leap to a deeper understanding of genetics. Nu­merous
as case studies in the classroom. Solved Problems 223
­features of this book were developed with that goal in mind.
∙∙ One Voice
Genetics Genes to Genomes S O LV E D P R O B L E M S
has a friendly, engaging
reading style that helps Solved Problem I Depending on its tautomeric state, 5-BU can some-
students master the concepts The DNA sequence of one strand of a gene from three in- times behave like thymine and sometimes like cyto-
throughout this book. The dependently isolated mutants is given here (5′ ends are at sine. 5-BU is a two-way mutagen. A reversion (C⋮G
left). Using this information, what is the sequence of the → T:A) can occur if 5-BU is incorporated into DNA
writing style provides the wild-type gene in this region? in the C-like state (the DNA will have a 5-BU⋮G)
student with the focus and mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCG
base pair, and then 5-BU acts like a T during the next
round of replication, resulting in a 5-BU:A base pair.
continuity required to make mutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCG Following the next round of DNA replication, the
the book successful in the mutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG result will be T:A.
classroom. b. Hydroxylamine changes C to hydroxylated C (C* in
Answer Fig. 7.13b), and C* can pair only with A. As shown in
∙∙ Visualizing Fig. 7.13b, hydroxylamine can cause a C⋮G →T:A
Each independently derived mutation will be caused by a
Genetics The highly different single base change. When you find a base that dif- substitution. Because it cannot modify a T:A base
specialized art program fers in only one of the three sequences, that different base pair, hydroxylamine is a one-way mutagen.
is the mutation. Determine the wild-type sequence by find- c. Ethylmethane sulfonate (EMS) modifies (ethylates)
developed for this book ing the base that is present at that position in the other two G within a DNA molecule. Figure 7.13b shows that if
integrates photos and line art sequences (underlined in the following). The wild-type ethylated G (G*) pairs with T during replication, a
sequence is therefore: G⋮C → A:T substitution results in the next round of
in a manner that provides replication. Because it cannot modify an A:T base
the most engaging visual 5′ ACCGTAGTCGACTGGTAAACTTTGCGCG 3′
pair, EMS is a one-way mutagen.
presentation of genetics Solved Problem II
d. Nitrous acid changes C to U and also A to hypoxan-
thine (H), a base that pairs C. Figure 7.13b shows
available. Our Feature So-called two-way mutagens can induce both a particular how these nitrous acid-induced alterations can cause
mutation and (when added subsequently to cells whose (after DNA replication) both C⋮G → T:A and
chromosomes carry this mutation) a true reversion of the T:A → C⋮G substitutions; either of these changes
mutation that restores the original DNA sequence. In con- can revert the other. Thus, nitrous acid is a two-way
trast, one-way mutagens can induce mutations but not exact mutagen.
reversions of these mutations. Based on Fig. 7.13, which of e. Proflavin can add any single base pair or delete any
 Changes in the Seventh Edition:
A Chapter-by-Chapter Summary
The seventh edition has been revised and modernized sig-
nificantly as compared with the sixth edition. We scruti-
nized the entire text and clarified the language wherever
possible. In total, we created more than 30 new figures and
tables, and revised many more in addition. We also wrote
more than 100 new end-of-chapter problems, and revised
many other problems for clarity.
Based on user feedback, we eliminated Chapter 1 in the sev-
enth edition, which allowed space to split three long chapters
in the sixth edition into two separate chapters, and to create a
new chapter. Chapter 4 in the sixth edition became Chapter 3
(Chromosomes and Inheritance) and Chapter 4 (Sex
Chromosomes) in the seventh edition. Chapter 7 in the sixth
edition became Chapter 7 (Mutation) and Chapter 8 (Using
Mutations to Study Genes) in the seventh edition. Chapter 13
in the sixth edition became Chapter 14 (Chromosomal
Rearrangements) and Chapter 15 (Ploidy) in the seventh edi-
tion. And a new Chapter 20 (Epigenetics) contains expanded
coverage of this fast-moving field. The entire Solutions
Manual and Study Guide was corrected and revised for clarity.
Along with the numerous text changes, Janice Fischer spent
a great deal of time helping to update the test bank and ques-
tion bank content to align with the new edition. Author
Janice Fischer recorded video tutorials for the sixth edition
that will be included with the seventh edition. These tutori-
als explain topics that are often difficult to understand.
Every chapter of the seventh edition was improved signifi-
cantly from the sixth edition. The most important changes in
the seventh edition are summarized below:
Chapter 4 Sex Chromosomes
∙∙ New section Human Intersexuality.
Chapter 5 Linkage, Recombination, and Gene Mapping
∙∙ Clarified analysis of three-point testcrosses.
Chapter 9 Gene Expression
∙∙ Updated Wobble rules.
Chapter 10 Digital Analysis of DNA
∙∙ Clarified explanation of whole-genome shotgun
sequencing.
Chapter 11 Genome Annotation
∙∙ Clarified overview of DNA sequence organization of
chromosomes.
Chapter 12 Analyzing Genomic Variation
∙∙ New coverage of genetic genealogy.
∙∙ New explanation of Illumina high-throughput DNA
sequencing technology.
Chapter 13 The Eukaryotic Chromosome
∙∙ New coverage of the role of condensins in shaping
chromosomes.
∙∙ Updated information about the mechanism of
X-chromosome inactivation.
∙∙ Updated coverage of yeast synthetic chromosomes.
Chapter 19 Gene Regulation in Eukaryotes
∙∙ New coverage of topologically associating domains
(TADs) and chromatin conformation capture
technology.
∙∙ Epigenetics section moved in revised form into new
Chapter 20.
Chapter 20 Epigenetics (New!)
∙∙ Genomic imprinting in mammals.
∙∙ Transmission of programmed gene repression through
cell division.
∙∙ Transgenerational epigenetic inheritance.
∙∙ Intergenerational inheritance of acquired traits in
mammals.
Chapter 21 Manipulating the Genomes of Eukaryotes
∙∙ Updated coverage of CRISPR/Cas9 technology.
∙∙ Updated material on transgenic animals for human
drug production and consumption.
∙∙ Updated coverage of human gene therapy.
Chapter 23 The Genetics of Cancer
∙∙ Coverage of new cancer therapies that strengthen the
body’s immune surveillance (CAR-T cell therapy and
PD-1/PD-L1 antibody treatment).
Chapter 25 Genetic Analysis of Complex Traits
∙∙ Clarified and updated material on human GWAS
analysis.
xi
 of20
Guided Tour
chapterMammalian Cells Retain Memories
Inactivated X Chromosomes
ze
In Chapters 4 and 13, you saw that when early embryos of

t is
Epigenetics
mammalian females contain approximately 500–1000
cells, a random one of the two X chromosomes becomes
ere. facultative heterochromatin—a Barr body—in each cell.
With the exception of a few genes (mostly in the pseudoau-
e
tosomal regions), the entire Barr body chromosome is
en Integrating
silenced. Genetic Concepts
Genetics:You will From recall
Genesthat totheGenomes
long noncoding takes anRNA (lncRNA)
integrated approach in its presentation of genetics, thereby giving students a
Courtesy Randy L. Jirtle, Ph.D. Originally published in B. Weinhold,
Xist is command
strong key to Barr body formation.
of genetics The Xist
as it is practiced lncRNA
today
“Color byby is Linkedand
Soy:academic
Genistein corporate
to Epigenetic Effects,” researchers.
Environ Health Principles are related through-
transcribed
out the text from the one essays,
in examples, X chromosome that Perspect.
case histories, will
andbecome
2006 Apr., 114(4): A240. Environews, Science Selections
connections sections toVYmake sure students fully understand the rela-
the Barr body.
tionships between Thetopics.
Xist lncRNA binds the X chromosome Despite having the same agouti genotype (A a), the coat
colors of these mice differ. In the yellow (mutant) mouse, the AVY
from which it was transcribed, spreads along its length,
epiallele and
is unmethylated, while in the gray (normal) mouse, AVY
recruits histone modifying enzymes to the chromatin (re-
is hypermethylated.
call Fig. 13.16). Consequently, the chromatin of the inac-
tiveChapter
X is covered Outline
with histone marks such as H3K9me c h a pt e r o u t l i n e
and
H3K27me
Every chapter thatopens
closewith chromatin and recruit DNMTs
a brief outline ● 20.1 Genomic that Imprinting
THE SEQ methylate
U EofN the O FCpG
C E chapter DNA islands.
contents.
base pairs in genes is the ● 20.2 Inheritance of Programmed Gene
ultimate, but Remarkably,
not only, carrierinofallgenetic information. of each ofRepression
the descendants those Through Cell Division
Geneticists have known for a long time that somatic cells 20.3 Transgenerational Epigenetic Inheritance
original 500–1000 female embryonic cells, the same
●

or gametes can also transmit information between genera- 20.4 A Comprehensive Example: Epigenetic
X chromosome (either the maternal X or the paternal X) at the A Locus in Mice
●

tions of cells or organisms—information not contained in Inheritance

becomes
the base-pair sequencethe Barr body
of DNA—about the following
levels at whicheach cell division
genes are(revisit
expressed.Fig. Such 4.13).
information What is the
transfers agent of this cellular
are known
as epigenetic
memory? phenomena: heritable, self-perpetuating inactive (“off” in the normal 604 grayChapter mouse). 20 The Epigenetics
remark-
changes in gene expression not caused by mutation in the able differences in phenotype result from the fact that the
We do not yet know the answer to “on”
base-pair sequence of DNA.
this orimportant
“off” information obtained from the egg is cop-
question.
The two mice in the One possibility
photograph have anisidentical
that the gen- inactive
ied in all X ofmighta mouse’s somatic cells. Keep in mind that
otype: In transmit
addition to “off” information at have
the replication thefork through
a null allele (a), they both a gain- base-pair
20.2 Inheritance of Programmed
sequence of the AVY allele is the same in the The answe
continued association of Xist with the chromosome. How- What is different is heritable epigene-
two mice pictured.
VY
of-function mutant allele of the agouti gene (A ) that causes cells are newly
normally gray
ever,mice to todate,
be yellow and obese.
scientists haveYet the
obviously look different. The mutant AVY allele is caused by
nottwo mice
determined tic information
whether the about whether
promoter in the mutant allele is active.
or notGene Repression Through Cell
the retrotransposon
information ab
XistoflncRNA
the insertion dissociates
a retrotransposon near thefrom normalthe geneDNAA duringTwo replica-
themes emerge in this chapter. Division
First, transmission of generations of
promoter.tion. Learning
The Another
retrotransposon Objectives
possibility
has its own is that CpG
promoter andmethylation
a “cellular marksmemory” of a gene’s expression state usually they should be
on Learning
transcriptional the inactive
regulatory X DNA
region.
Objectives Theappear arebefore
phenotypiccopied atsection,involves collaboration
the replication
differences
each and are care- fork, between three factors: modified cyto- depending on
between the two mice reflect whether A gene transcription sine residues in DNA, modified l earhistone
n i n gtail amino
ectiacids
vesin made in the ne
andfullythatwritten
a feedback
to clearlyloopoutlinesimilar to that shown
­expectations. in Figure
chromatin, and small RNA molecules. Second, epigenetic
o bj
is driven by the normal A gene promoter or by the stronger the same on/of
promoter 20.9b reconstructs the
of the retrotransposon. In therepressive
yellow and obesehistone information—the
modifications.combination of these molecular factors that
1. Describe the epigenetic phenomenon that helps
Whatever
mouse at the the mechanism
left, the retrotransposon’s promoter ofis the
activememory,
and it probably
determines whether a gene is “on” or “off”—can change. cause activator
differentiated cells maintain their fates through cell
needs
“takes over” to allow
transcription of the transcription
A gene,
Xist because Xist
causing overproduc- Some transcripts
changes in epigenetic information are programmed: that cytoplasm can
divisions.
tion of thearegene product
likely in pigment-making
needed cells and mis-
to help reinitiate is, theyformation
Barr body are predetermined events during an organism’s devel- after DNA rep
hyl-
expression in the brain. In the normal gray mouse, the opment. Other epigenetic changes, 2. Discuss mechanisms
like variations by which the memory of
in the on/off ever, an epigen
after DNA replication. information at AVY, are initiated byconstitutive
chance or byheterochromatin
the environ- is transmitted through cell
NA
retrotransposon’s promoter is silenced (repressed long-term) lular memory
so ment. For this reason, scientists aredivisions.fascinated by the possibil-
othA gene transcription occurs from its normal promoter. ity that our individual human experiences—for example, what that repress tra
Information transmitted to the mice from their mothers 3. Speculate as to how the memory of the inactive
in.
through
essen tial con cepts
the eggs determines whether the retrotransposon’s
20.2 we eat or how we are treated by others—may alter epigenetic
vi- information that could be passed X chromosome
on to future generations.may be retained in the somatic cells of
promoter is active (“on” in the yellow, obese mouse) or
• Some histone marks that cause gene repression can be mammalian females. Establishmen
ory.
copied, though inefficiently, at the replication fork
re- because the enzyme that modifies the histone protein One well-stud
599
tes also binds the mark it makes. Marks retained by histones Hox (homeobo
to- In the previous section, you saw that genomic imprinting Hox genes enc
recycled at the replication fork attract the same
ies modifying enzymes, which then copy the mark onto
occurs before fertilization in germ-line cells of a parent. that set up the
use unmarked histones. The marked chromosomes transmit the cellular memory each segment
the (in the formConcepts
Essential of methylated cytosines in DNA) to progeny “know” which
• Feedback loops between DNA methylation and histone
ed- via the gametes. It is important to understand that imprint- lar combinatio
methylation help provide a cellular memory of After each section, the most important points of content are now
m- programmed gene silencing in heterochromatin.
ing affects only a few genes with sex-specific ICRs; it is This method fo
provided in concise, bulleted statements to reinforce crucial
rare for a gene to be inherited through gametes with infor- cells depends c
concepts and learning objectives for students.
mation about whether it should be expressed. of Hox genes i
In this section, we discuss several important epigenetic Many Hox
phenomena in which genes can transmit information about DNA sequenc
their silenced transcriptional status to subsequent genera- ment), which b
tions of cells through mitosis, but not to subsequent genera- repressor pro
tions of individuals through the gametes. However, just as repressive com
xii
in genomic imprinting, the cellular memories in all of these subunits is a hi
cases are “programmed,” meaning that transmission of a specific lysi
these memories is not specific to any one individual, but the specific h
 Guided Tour xiii
484 Chapter 16 Bacterial Genetics

GENETICS AND SOCIETY

Genetics and Society Essays
The Human Microbiome Project
Established in 2008 and funded by the U.S. National Institutes
Dramatic essays explore the social and ethical
of Health, the Human Microbiome Project (HMP) is one of sev- ­issues created by the multiple applications of
eral international consortia aiming to understand the complex
relationship between our bodies and the trillions of microorgan- modern genetic ­research.
isms that inhabit them.
The HMP has already achieved its first goal of describing
the diversity of the organisms that make up the human microbi-
ome. Investigators analyzed the microbial metagenomes lo-
cated at several different sites in the bodies of more than
250 people from around the globe. These studies focused on
the sequence of the gene encoding the 16S rRNA of the ribo-
somal small subunit of these bacteria, because these sequences
diverge substantially in different bacterial species and thus
serve as markers for those species. The results showed that a
single person can harbor up to 1000 different bacterial species, Anna Smirnova/Alamy
but people vary widely in the types of bacteria that make up
their microbiome. It appears that, worldwide, more than 10,000 raised in sterile environments. Surprisingly, germ-free mice can
different bacterial species colonize human bodies. The research- survive although they are not normal: They have altered immune
ers of the HMP have already sequenced the complete genomes systems, poor skin, and they need to eat more calories than do
of many of these kinds of bacteria. normal mice to maintain a normal body weight. Researchers can
The second phase of the HMP began in 2014, and is populate germ-free mice with a single bacterial species or a
TOOLS OF GENETICS
aimed ultimately at determining whether changes in the mi- complex microbial community, and thus determine how microbi-
crobiome are the causes or effects of diseases or other im-
portant traits in humans. Diseases potentially linked to Vaccinate
How Bacteria the
omes influence physiological states. Problem 8 at the end of this
chapter will allow youAgainst
Themselves to exploreViruses
this approach
withby discussing an
CRISPR/Cas9
Tools of
microbiome include cancer, acne, psoriasis, diabetes, obesity,
and inflammatory bowel disease; some investigators have
experiment performed with germ-free mice that asks if the mi-
At the CRISPR locus of bacterial genomes, short direct repeats are
crobiome plays a causal role in human obesity.
interrupted at regular intervals by unique spacer sequences (Fig. A).
and the Cas9 enzyme cooperate to cleave the viral genome
(Fig. A). The 5' end of the crRNA base pairs with its target DNA
Genetics Essays
suggested that the composition of microbiomes could also If microbial communities indeed contribute to disease
The spacers are fragments of bacteriophage genomes captured by
influence the mental health of their hosts. The first step in
in the bacteriophage chromosome, while the 3' end of the
states in humans, then future therapeutics might aim to alter Current readings explain
the host cell and integrated into the host genome by the action of crRNA base pairs with tracrRNA. A stem loop in the tracrRNA
these studies will be to establish whether statistical correla- resident microbiomes. Thus, the flip side of the HMP is to inves-
two bacterially encoded proteins (Cas1 and Cas2). The repeats
tions exist between specific kinds of microbial communities
binds to Cas9. Thus, the crRNA and tracrRNA together bring
tigate how human interventions might change bacterial com-
various techniques and
within the CRISPR arrays are added by these endonucleolytic
and disease states. How can researchers establish whether a
Cas9 enzyme to the target sequence in the viral genome. Cas9
munities. How effective are dietary changes or dietary additives
enzymes during the capture and integration process (not shown). cleaves the phage chromosome, preventing infection. tools used by geneticists,
statistical correlation between microbiomes and diseases re- such as probiotics in effecting long-lasting alterations in micro-
flects a cause or an effect?
Viral immunity begins with transcription of the CRISPR ar-
biomes? If acute infections are treated with
ray into long RNA molecules called pre-crRNAs that are pro-
Notice that the crRNAs are always adjacent to PAM sites in
antibiotics, how will
the invading bacteriophage DNAs. However, the Cas1 and
including examples of
One powerful method for establishing the cause
cessed
of microbiome changes is the use of germ-free
into and effect
short
mice born
(24–48 bacterial
and
nt) CRISPR
are already
communities changeThis
RNAs (crRNAs).
exploring
over time? Several
Cas2 HMP
proteins projects excluded the PAM sites from the viral
specifically applications in biology
chopping-up of the large RNA requires anotherthese
smallimportant
RNA questions.
genome fragments that were integrated into the CRISPR array
called tracrRNA (trans-acting CRISPR RNA) that is transcribed as spacers. In this way, Cas9 cleaves only invading viral DNA, and medicine.
from a gene in the host genome (Fig. A). The tracrRNA forms but not the CRISPR locus in the bacterial chromosome.
complementary base pairs with the repeat sequences in the For editing the chromosomes of eukaryotic organisms, re-
The human microbiome pre-crRNA. These double-strandedgut microbes helpare
RNA regions cause obesity,
cleaved by inflammatory
searchers join thediseases
crRNA andof tracrRNA together in a single RNA
RNAse III (at the black triangles) to produce the short crRNAs. molecule (anGenetics
sgRNA) that brings Cas9 to the site of interest in
The U.S. National Institutes of Health has undertaken
When an invadinga virustheinjects
digestive system, and even cancer.
its double-stranded DNA
The and
the eukaryotic genome (Fig. 21.13).
metagenomic analysis of the bacteria chromosome
that live on intothethe Society box The Human Microbiome Project discusses the
hu-host cell, a specific crRNA, the Chapter 12 Analyzing Genomic Variation
tracrRNA,
366
man body—the Human Microbiome Project. In one of progress of this endeavor in more detail.
Figure
the first experiments in this project, bacterial samples A The CRISPR/Cas9 locus vaccinates Streptococcus pyogenes bacteria against viruses.
were
taken from different tissues like gut and skin on and in the Extremophile metagenomes CRISPR
Repeats Spacers

bodies of 242 healthy individuals. This analysis revealed tracrRNA Scientists also cas9
analyzeFthe
A Smetagenomes
T F O R WA of Rbacteria
D that
more than 10,000 different bacterial species in total, and as live in extreme environments (extremophiles) because they
many as 1000 on a single individual. The most striking cas9 mRNAof genes for proteins that work under
harbor an abundance 3′
conclusion from this study is that individuals vary widely3′ unusual 5′conditions. These Genetic Genealogy
proteins
5′ can sometimes be use- Pre-crRNA

in the species of bacteria that they carry.
A major current goal of the microbiome project is to
determine how human microbiomes affect important traits
RNase III
of their hosts. Strong evidence already exists that human
5′
ful in the laboratory. For example,
Between 1976 and DNA
Taq1986, the polymerase,
so-called “Golden State Killer” The degree of genetic relatedness between any two individ-
committed at least 50 rapes and 12 murders in California. This uals can be estimated by the fraction of their (autosomal) DNA
the enzyme usedCas9
for PCR because it can withstand the hot
40-year-old cold case was reopened in 2018 as a consequence that they share (Fig. B). For example, your DNA comes from half
temperatures that denature DNA, comes from the bacterial
of people’s natural fascination with their genealogy; that is, in- of your mother’s DNA (in an egg) and half of your father’s DNA (in
species Thermus aquaticus,
formation first
aboutdiscovered
their ancestryinand thecurrent-day
hot relatives. a sperm); therefore, you share 50% of your DNA with each of your
Genealogy companies—the largest and best known of these parents. You also share 50% of your DNA with each of your sib-
being 23andMe and Ancestry.com—use microarray technology lings, on average: Each parent has two alleles of each SNP, and
similar to that shown in Fig. 12.15 to analyze the genomic DNA each child inherits a random one of those two SNP alleles.
submitted in the saliva of their clients to determine which alleles The power of genetic genealogy comes from two sources:
3′ 3′ Pre-crRNA processing
of many3′SNP loci they carry. 3′ First, microarrays look at a very large number of SNPs; and
5′ 5′ The basis of genetic 5′ genealogical analysis
5′ is that relatives second, companies performing genetic genealogy have de-
share haplotype blocks. You will see in Chapter 25 that haplotype 3′ veloped giant databases that catalog the SNP analysis of mil-
blocks are segments of DNA with particular sets of linked SNP lions of people. If you think about it, this information is more
alleles that tend to travel together from one generation to another massive than that in the CODIS database, which is restricted to
because they are flanked by recombination hotspots. (In other a small number of SSR loci in a smaller sample of people (indi-
words, the DNA within the haplotype block contains no hotspots
crRNAs viduals arrested for or convicted of crimes). It is therefore not
for crossing-over.) You learned in Chapter 5 that during spermato- surprising that law enforcement agencies are very interested
genesis in humans, on average one crossover occurs per chromo- in employing the power of genealogical databases.
some, and during oogenesis about two crossovers per In the case of the Golden State Killer, when investigators
chromosome (Fig. A, left). It therefore makes sense that the more compared samples of the suspect’s DNA taken from the crime
closely related two
tracrRNA people are, the more haplotype blocks they scenes with the database of a small genealogy company called
share, andcrRNA
the longer are their uninterrupted shared DNA seg- GEDmatch, they found matches with two individuals. The degree
ments (Fig. A, right). of relatedness indicated that these two people were likely the

Figure A Shared segments of autosomes among relatives. One pair of autosomes are shown for each individual. At left, the
colors indicate segments of chromosomes that could be passed down through two generations. Because of crossing-over during gamete
formation, one of your homologs
Viralcan contain segments from all four of your maternal grandparents’ homologs, and your other homolog can
chromosome
contain segments from all four of your paternal grandparents’ homologs. At right, the same information is presented in a different way;
5′ NGGblack indicates chromosomal segments shared by you and each of your relatives. Note that long stretches of shared haplotypes are the
PAM site
best evidence of genetic relatedness.
Homologous chromosomes can recombine You share more SNP alleles and longer DNA segments
in each
Viralgeneration.
DNA cleavage with closer relatives.

Maternal Maternal Paternal Paternal Maternal Maternal Paternal Paternal

Fast Forward
Grandmother Grandfather Grandmother Grandfather Grandmother Grandfather Grandmother Grandfather

This feature is one of the methods used to

integrate the Mendelian principles introduced
early in the content with the molecular content Aunt/Uncle Mother Father Aunt/Uncle Aunt/Uncle Mother Father Aunt/Uncle

that will follow.

You Sibling You Sibling

xiv Guided Tour

Visualizing Genetics
Full-color illustrations and photographs bring the printed word to life. These visual reinforcements support and further
clarify the topics discussed throughout the text.

F E AT U R E F I G U R E 1 0 . 7

Automated Sanger Sequencing

(a) Hybridization of template and primer. Many copies of a
cloned recombinant DNA are denatured (melted into single strands), Vector
using heat to break apart the hydrogen bonds joining the two strands.
One of these strands serves as the template. The recombinant DNA
is mixed with many molecules of an oligonucleotide primer (made in
Recombinant plasmid
a DNA synthesizer) whose sequence is complementary to ~20 bases
in the vector portion of the template strand. As the temperature is low-
ered, the templates and primers anneal (hybridize).
Human
DNA insert
Feature Figures
(b) Generating a nested set of
fragments. The hybrid template/ Special multipage spreads integrate line art, photos,
Melt into single strands
primer molecules are now mixed with
DNA polymerase, large amounts of the Hybridize with primer
and text to summarize in detail important genetic
four dNTPs, and much smaller amounts
of the four ddNTPs. Each ddNTP has a
concepts.
different-colored fluorescent tag. DNA
polymerase synthesizes a DNA strand Template
complementary to the template by add- Insert
ing nucleotides sequentially onto the 3′ Vector
C A C C G T C G
end of the primer. Synthesis terminates G T A G
when a dideoxynucleotide is added. A T
G C
The reaction generates a nested set of C C A G 3′ G
fragments, each with the same 5′ end
G C T + DNA polymerase 5′
A G Primer
but a different 3′ end. The terminating 5′ + dATP, dCTP, dGTP, dTTP
dideoxynucleotide at the 3′ end color- 3′ + ddATP, ddCTP, ddGTP, ddTTP
codes each product. After melting apart
the newly synthesized DNA and the
template, these products are electro-
phoresed on a special gel that can sep-
arate DNAs that differ in size by a (c) Dideoxynucleotide structure.
single nucleotide. As each fragment Because ddNTPs lack an -OH group on the
moves past a laser, the color of the deoxyribose 3′ carbon atom, DNA poly- (e) Image of a sequencing gel.
– Red dye merase cannot add any nucleotides onto a (d) Analyzing nested sets of Each lane displays the sequence of a
terminal base is detected.
H chain with a dideoxynucleotide at the 3′ end. products on gels. separate sample.
G C T C A G T Dideoxynucleotide Gel 3′
5′ H 3′ ddATP
G Gel
– Yellow dye A Adenine
H C
– O– O–
G C T C A G T G TO CH2
5′ H 3′ –
5′
O P
C O P O P O CH2
O
Direction of electrophoresis

O O O 4′ 1′
CH HC
H G DNA fragments
HC C2′
G C T C A G T G G 3′ electrophorese
5′ H 3′ A down the gel
H H
– Purple dye C No 3′–OH, Photomultiplier
H so terminates chain tube
G C T C A G T G G C
5′ H 3′ G dATP
Filter
– Green dye Adenine Output to wheel
H computer
G–
G C T C A G T G G C A O O– O– CH2
5′ H 3′ –O
5′
Scanning
P O P O P O CH2
O laser excites
T
O O O 4′
CH 1′ fluorescent dye
H HC
Detector HC C2′
G C T C A G T G G C A G 3′
5′ H 3′
5′ OH H
Primer Complementary to
(Sequence of 3′–OH needed
template strand of
newly synthesized for chain elongation
insert
DNA)

(continued)

314

(f) A DNA sequence trace from one gel lane. Yellow is pseudocolored as black for easier visualization. Base-calling software reads
out the sequence of the newly synthesized DNA strand.

5′ T G G C A G C T C A G C G G C T G G G C A A G C G C G T G 3′

Smaller Fragment size Larger

(e): ©Jean Claude Revy/Phototake; (f): Courtesy of Joshua J. Filter, Cornell University, Ithaca, New York

315
 Guided Tour xv
3.3 Meiosis: Cell Divisions that Halve Chromosome Number 85

TABLE 3.2 How Chromosome Behavior During Meiosis Explains Mendel’s Laws
(a) The Law of Segregation (b) The Law of Independent Assortment

F1 Homologous pair Homologous pair

F1 for seed color for seed shape
R r
(Y ) Yellow Round (R)
(y ) Green Wrinkled (r )

R R r r R R r r
Meiosis I
Anaphase
R R r r
Meiosis I Comparative Figures
Anaphase
OR
Comparison illustrations lay out the basic
Solved Problems 471

Y Y y y y y Y Y differences of often confusing principles.

essential concepts 15.3
Meiosis II • Many modern-day plant species have blocks of similar • Since the whole-genome duplication, the two copies of the
Meiosis
genes II in similar order on two different
repeated genes have mutated independently such that their base-
chromosomes. This fact suggests that the the entire pair sequences are no longer identical and their functions
Possible genome of an ancestral species became duplicated. may have diverged.
gametes Yellow Green Green Yellow
Possible
gametes round wrinkled round wrinkled
(Y R ) (y r ) (y R ) (Y r)
Round (R ) Wrinkled (r )
S O LV E D P R O B L E M S

Solved Problem I males have aberrant dosages of ~10-fold fewer genes

Some aneuploid XYY men are completely normal, while than XO or XXY individuals do.
F2 other individuals have a variety of symptoms to varying c. Because all Y chromosomes must come from the
F2 degrees. These include greater-than-average height, devel- male parent, an XYY man must be the result of a
R r opmentalY delays,
R and
Y r learning
y R disorders.
yr YY sperm fertilizing an X egg. Nondisjunction (NDJ)
of the Y chromosome in meiosis II in the male germ
a. What would cause these symptoms in XYY males? line would generate YY gametes, as shown in the
Yb.R Females with Turner syndrome (XO) and males with
YY RR YY Rr Yy RR Yy Rr accompanying diagram. In contrast, NDJ during
R RR Rr Klinefelter syndrome (XXY) are sterile. In contrast, meiosis I in the male germ line would generate an
XYY males usually have normal fertility. Explain the XY gamete, not a YY gamete.
Y r difference.
YY Rr YY rr Yy Rr Yy rr Solved Problem II
r Rr rr c. Explain how mistakes during meiosis can lead to XYY
aneuploidy. Would the mistake occur in the male germ A company called AquaBounty Technologies created a vari-
ety of Atlantic salmon that grows faster than normal salmon
y R lineYy
orRR
in theYy
female
Rr germ
yy RRline?yy
Can
Rr you tell if the mis-
take occurred during meiosis I or meiosis II? because its genome contains a transgene—a modified
In an F1 hybrid, the round pea allele (R) is found on one
growth hormone gene made in the laboratory and inserted
chromosome, and the wrinkled pea allele (r) is on the
into the salmon’s genome. (You will learn in Chapter 21
homologous chromosome. The pairing between the two yr
Answer
Yy Rr Yy rr yy rR yy rr
how transgenic fish and other animals are made.) These
homologous chromosomes from prophase I through metaphase I
ensures that the homologs will separate to opposite spindle
Remember that aneuploidy affects phenotype through ab- AquAdvantage® salmon are the first transgenic animals ap-
One pair of homologous errant gene dosage.carries
chromosomes Effectstheofseed
geneshape
dosage in two other proved for human consumption (in 2019) by the U.S. Food
poles during anaphase I. The conclusion of meiosis II yields two
types of gametes: Half have R, and half have r, but no gametes
human
gene (alleles R and r). A secondaneuploidies—Turner syndrome and Klinefelter
pair of homologous chromosomes and Drug Administration. AquaBounty Technologies pro-
have both alleles. Thus, the separation of homologous carries the seed colorsyndrome—are
gene (alleles Yexplained in Fig.
and y). Each 15.1.
homologous vides only triploid females to fish farmers who raise AquAd-
chromosomes at meiosis I corresponds to the segregation of pair aligns at random at the metaphase plate during meiosis I, vantage® salmon. Should any transgenic fish escape into the
a. XYY males sometimes have an abnormal phenotype
independently of the other homologous pair. Thus, any two
alleles. As the Punnett square shows, fertilization of 50% R and wild, the transgene will not be transmitted to the natural
because
chromosome pairs can migrate they have
toward an extra
the poles dose of Y-linked genes in
during
50% r eggs with the same proportion of R and r sperm leads to diploid salmon population.
Mendel’s 3:1 ratio in the F2 generation. anaphase I in either of twoallequally
of theirlikely
somatic andAs
ways. germ-line
a result,cells.
a Like males
dihybrid individual will generate four equally likely types ofXYY males are
with Klinefelter syndrome (XXY), a. Explain how the use of triploid females prevents the
gametes. The Punnett squarelikelyaffirms
taller than
thataverage because their somatic cells
independent spread of the transgene. (Refer to Fig. 15.5b.)
have
assortment of traits carried by an extra dose of thechromosomes
nonhomologous PAR gene SHOX. b. In Atlantic salmon, x = 29. At what frequency would
b. Because
produces Mendel’s 9:3:3:1 ratio. the Y chromosome has only about one-tenth the triploid AquAdvantage® salmon produce balanced
as many genes as reside on the X chromosome, XYY gametes?
Normal Meiosis NDJ in Meiosis I NDJ in Meiosis II

XY XY XY
Meiosis I
(2 chromatids
per chromosome) X Y XY X Y
Meiosis II

Gametes
(1 chromatid
X X Y Y XY XY X X YY
per chromosome)

Figure for Solved Problem Ic

Solving Genetics Problems

The best way for students to assess and increase their un-
Solved Problems
derstanding of genetics is to practice through problem- Solved problems offer step-by-step guidance needed to
understand the problem-solving process.
solving. Found at the end of each chapter, problem sets
assist students in evaluating their grasp of key concepts and
allow them to apply what they have learned to real-life
issues. Problems
Problems are organized by chapter section and in order of
increasing difficulty to help students develop strong
problem-solving skills. Brief answers to the odd-numbered
problems can be found in the back of this text.
Acknowledgments

The creation of a project of this scope is never solely the
work of the authors. We are grateful to our colleagues who
answered our numerous questions, or took the time to share
with us their suggestions for improvement of the previous
edition. Their willingness to share their expertise and
expectations was a tremendous help to us.
∙∙ Eric Alani, Cornell University
∙∙ Preston Aldrich, Benedictine University
∙∙ Charles Aquadro, Cornell University
∙∙ James T. Arnone, William Paterson University
∙∙ Daniel Barbash, Cornell University
∙∙ Christine M. Beatty, Loyola University Chicago
∙∙ Andrew Clark, Cornell University
∙∙ Steven Fenster, Fort Lewis College
∙∙ Wayne Forrester, Indiana University
∙∙ Tom Fox, Cornell University
∙∙ Kathryn Gardner, University of Pittsburgh
∙∙ Jamie S. Lyman Gingerich, University of Wisconsin–
Eau Claire
∙∙ Shubha Govind, The City College of City University
of New York
∙∙ Nancy Hollingsworth, Stony Brook University
∙∙ Enamul Huq, The University of Texas at Austin
∙∙ Vishy Iyer, The University of Texas at Austin
∙∙ Alyssa Johnson, Louisiana State University
∙∙ Mark Kirkpatrick, The University of Texas at Austin
∙∙ Henry Lerner, Harvard Medical School
∙∙ Paul Macdonald, The University of Texas at Austin
∙∙ Kyle Miller, The University of Texas at Austin
∙∙ Debra Nero, Cornell University
∙∙ Kristin Patterson, The University of Texas at Austin
∙∙ Leslie Pick, University of Maryland
∙∙ Hong Qiao, The University of Texas at Austin
∙∙ Maureen Sanz, Molloy College
∙∙ Inder Saxena, The University of Texas at Austin
∙∙ Len Seligman, Pomona College
∙∙ Heidi Sleister, Drake University
∙∙ Sebastian M. Spencer, Pensacola Christian College
∙∙ Sibum Sung, The University of Texas at Austin
∙∙ James Thompson, University of Oklahoma
∙∙ Steve Vokes, The University of Texas at Austin
∙∙ Alain Bopda Waffo, Alabama State University
∙∙ Blerta Xhemalce, The University of Texas at Austin
Janice Fischer and Michael Goldberg would also like to
thank their genetics students at The University of Texas at
Austin and Cornell University for their amazing questions.
Many of their ideas have influenced the seventh edition. A
special thank-you to Mike McGee for his extensive feed-
back on this seventh edition. We would also like to thank
the highly skilled publishing professionals at McGraw-Hill
who guided the development and production of the seventh
edition of Genetics: From Genes to Genomes: Ian
Townsend and Michelle Vogler for their support; Elizabeth
Sievers for her organizational skills and tireless work to tie
up all loose ends; and Vicki Krug and the entire production
team for their careful attention to detail and ability to move
the schedule along.

xvi
 Guided Tour xvii

New to Connect®

Remote Proctoring & Browser-Locking Capabilities

New remote proctoring and browser-locking capabilities, hosted by Proctorio within Connect, provide control of the as-
sessment environment by enabling security options and verifying the identity of the student.

Seamlessly integrated within Connect, these services allow instructors to control students’ assessment experience by re-
stricting browser activity, recording students’ activity, and verifying students are doing their own work.

Instant and detailed reporting gives instructors an at-a-glance view of potential academic integrity concerns, thereby avoid-
ing personal bias and supporting evidence-based claims.

Writing Assignment
Available within McGraw-Hill Connect® and McGraw-Hill Connect® Master, the Writing Assignment tool delivers a
learning experience to help students improve their written communication skills and conceptual understanding. As an in-
structor you can assign, monitor, grade, and provide feedback on writing more efficiently and effectively.
Instructors: Student Success Starts with You
Tools to enhance your unique voice
Want to build your own course? No problem. Prefer to use our
turnkey, prebuilt course? Easy. Want to make changes throughout the
65%
Less Time
semester? Sure. And you’ll save time with Connect’s auto-grading too.
Grading

Study made personal

Incorporate adaptive study resources like
SmartBook® 2.0 into your course and help your
students be better prepared in less time. Learn
more about the powerful personalized learning
experience available in SmartBook 2.0 at
www.mheducation.com/highered
/connect/smartbook
Laptop: McGraw Hill; Woman/dog: George Doyle/Getty Images

Affordable solutions, Solutions for

added value your challenges
Make technology work for you with A product isn’t a solution. Real
LMS integration for single sign-on access, solutions are affordable, reliable,
mobile access to the digital textbook, and come with training and
and reports to quickly show you how ongoing support when you need
each of your students is doing. And with it and how you want it. Visit www.
our Inclusive Access program you can supportateverystep.com for videos
provide all these tools at a discount to and resources both you and your
your students. Ask your McGraw Hill students can use throughout the
representative for more information. semester.

Padlock: Jobalou/Getty Images Checkmark: Jobalou/Getty Images

Students: Get Learning that Fits You
Effective tools for efficient studying
Connect is designed to make you more productive with simple, flexible, intuitive tools that maximize
your study time and meet your individual learning needs. Get learning that works for you with Connect.

Study anytime, anywhere “I really liked this

Download the free ReadAnywhere app and access your app—it made it easy
online eBook or SmartBook 2.0 assignments when it’s to study when you
convenient, even if you’re offline. And since the app don't have your text-
automatically syncs with your eBook and SmartBook 2.0
assignments in Connect, all of your work is available book in front of you.”
every time you open it. Find out more at
www.mheducation.com/readanywhere - Jordan Cunningham,
Eastern Washington University

Everything you need in one place

Your Connect course has everything you need—whether reading on
your digital eBook or completing assignments for class, Connect makes
it easy to get your work done.

Calendar: owattaphotos/Getty Images

Learning for everyone

McGraw Hill works directly with Accessibility Services
Departments and faculty to meet the learning needs
of all students. Please contact your Accessibility
Services Office and ask them to email
accessibility@mheducation.com, or visit
www.mheducation.com/about/accessibility
for more information.

Top: Jenner Images/Getty Images, Left: Hero Images/Getty Images, Right: Hero Images/Getty Images
Genetics
From Genes to Genomes
PART I B asic P rinciple s: How Traits Are Transmitted
chapter
1
Mendel’s Principles
of Heredity
A Q U I C K G L A N C E at a family portrait reveals children
who resemble one parent or the other, or who look like
a combination of the two. Some children, however, look
unlike any of the assembled relatives and more like a
great-great-grandparent. What causes the similarities
and differences of appearance and the skipping of
­generations?
The answers lie in our genes, the basic units of bio-
logical information, and in heredity, the way genes trans-
mit traits from parents to offspring. Each of us starts out
as a single fertilized egg cell that develops, by division
and differentiation, into a mature adult made up of 1014
(a hundred trillion) cells that carry out all of our body’s
functions and control our outward appearance. Genes,
passed from one generation to the next, underlie the for-
mation of every heritable trait. Your genome—all the
genes you possess—controls traits as diverse as a cleft
chin; balding as you age; your hair, eye, and skin color;
and even your susceptibility to certain diseases. All such
traits run in families in predictable patterns that impose
some possibilities and exclude others.
Genetics, the science of heredity, pursues an expla-
nation of the mechanisms that determine inheritance.
Sometimes the relationship between gene and trait is
remarkably simple. A single change in a single gene, for
example, results in sickle-cell disease, a condition in
which the hemoglobin molecule found in red blood cells
is defective. In other cases, the correlations between genes
Lawrence Manning/Corbis
Although Mendel’s laws can predict the probability that an indi-
vidual will have a certain genetic makeup, the chance meeting of
particular male and female gametes determines an individual’s
genetic fate.
chapter outline
●● 1.1 The Puzzle of Inheritance
●● 1.2 Genetic Analysis According to Mendel
●● 1.3 Mendelian Inheritance in Humans
and traits are bewilderingly complex. One example is that
many genes interact to generate the characteristics we rec-
ognize as a friend’s face.
Gregor Mendel (1822–1884; Fig. 1.1), an Augustinian
monk and expert plant breeder, discovered the basic prin-
ciples of genetics in the mid-­nineteenth century. He pub-
lished his findings in 1866, just seven years after Darwin’s
On the Origin of Species appeared in print. Mendel worked
in a monastery in Austria (Fig. 1.2), where he examined
the inheritance of clear-cut alternative traits in pea plants,
such as purple versus white flowers or yellow versus green
seeds. In so doing, he inferred genetic laws that allowed
him to make verifiable predictions about which traits
would appear, disappear, and then reappear, and in which
generations.
Mendel’s laws are based on the hypothesis that
observable traits are determined by independent units of
inheritance that we now call genes. Today, a gene is rec-
ognized as a region of DNA that specifies a particular
protein or RNA. To Mendel, however, a gene was an
abstraction—an imagined particle that worked by an
unknown ­mechanism.
Four general themes emerge from our detailed dis-
cussion of Mendel’s work. First, variation in traits is
widespread in nature, reflecting immense genetic diver-
sity that provides the raw material for the continuous
1
2 Chapter 1   Mendel’s Principles of Heredity
evolution of life on the earth. Sec- Figure 1.1 Gregor Mendel.
ond, variation is essential for fol- Photographed around 1862
holding one of his experimental
lowing genes from one generation plants. Science Source
to the next. Third, variation is
inherited according to patterns—
Mendel’s genetic laws—that explain
why individuals in the same fam-
ily are similar in some traits but
different in others. Fourth, the laws
Mendel discovered about heredity
apply equally well to all sexually
reproducing organisms, whether
they are peas or people.
1.1 The Puzzle of Inheritance
learnin g objectiv es
1. Relate how Mendel’s experimental approach is similar
to the process of modern scientific inquiry.
2. Describe how Mendel cross-fertilized and self-fertilized
pea plants.
3. Explain why Mendel included reciprocal crosses within
his controlled breeding program of pea plants.
4. Predict the type of progeny produced by Mendel’s
crosses between pure-breeding plants with discrete,
antagonistic traits, such as purple versus white
flowers.
Gregor Mendel was the first person to combine data col-
lection, analysis, and theory in a successful pursuit of the
true basis of heredity. For many thousands of years before
that, the only genetic practice was the selective breeding
of domesticated plants and animals with desirable charac-
teristics. This process, called artificial selection, was of
immense importance to human history. For example, by
choosing plants that grew better or were easier to cultivate
as parents for the next generation, people gradually con-
verted weedlike species into rice, wheat, corn, and toma-
toes. Similar breeding schemes developed valuable herds
of sheep, pigs, and cattle, as well as hundreds of breeds
of dogs.
Despite its many achievements, artificial selection was
limited by its hit-or-miss nature: Parents chosen for their
desired characteristics did not always produce offspring
whose qualities were more, or even equally, favorable to
Figure 1.2 Mendel’s garden.
Biophoto Associates/Science Source
those of their parents. This unpredictability was not sur-
prising, because prior to Mendel, many misconceptions
clouded people’s thinking about heredity.
Mendel Devised a New Experimental
Approach
Two errors in interpreting the results of selective breeding
were particularly misleading. The first was the idea that
one parent contributes most to an offspring’s inherited fea-
tures. Nicolaas Hartsoeker, one of the earliest microsco-
pists, contended in 1694 that it was the male, by way of a
fully formed homunculus inside the sperm (Fig. 1.3). An-
other deceptive notion was the concept of blended inheri-
tance, the idea that parental traits become mixed and
forever changed in the offspring, as when blue and yellow
pigments merge to green on a painter’s palette. The theory
of blending may have grown out of a natural tendency for
parents to see a combination of their own traits in their
offspring. While blending could account for children who
look like a combination of their parents, it could not ex-
plain obvious differences between biological brothers and
sisters nor the persistence of variation within extended
families.
What did Mendel do differently from those who
preceded him? First, he chose the garden pea (Pisum
sativum) as his experimental organism (Fig. 1.4a and b).
Each pea flower has both male and female organs, which
made it easy to self-fertilize or cross-fertilize plants. In
self-fertilization (or selfing), both egg and pollen come
from the same plant, often from the same flower. Peas nor-
mally self-fertilize because of the proximity of egg and
pollen. To cross-fertilize (cross) two plants, Mendel
removed the male sex organs from the flowers of one plant
 1.1 The Puzzle of Inheritance 3

Figure 1.3 The homunculus: A misconception. Well into the
nineteenth century, many prominent microscopists believed they saw
a fully formed, miniature fetus crouched within the head of a sperm.
Klaus Guldbrandsen/SPL/Science Source
(to prevent selfing), and then he brushed pollen from the
other plant onto the female organs of the first plant
(Fig. 1.4c). Peas offered yet another advantage. For each
successive generation, Mendel could obtain large numbers
of individuals within a relatively short growing season.
Second, Mendel examined the inheritance of clear-cut
alternative states of particular traits—purple versus white
flower color, yellow versus green pea color. He could trace
unambiguously the transmission of such either-or traits, be-
cause no intermediate forms existed. (The opposite of these
so-called discrete traits are continuous traits, such as
height and skin color in humans. Continuous traits show
many intermediate forms.)
Third, Mendel collected and perpetuated lines of peas
that bred true. Matings within such pure-breeding
(or true-breeding) lines produce offspring carrying spe-
cific parental characteristics that remain constant from
generation to generation. These lines are also called
inbred because they have been mated only to each other
for many generations. Plants with white flowers always
produced offspring with white flowers; plants with purple
flowers produced only offspring with purple flowers.
Mendel called constant but mutually exclusive alterna-
tives, such as purple versus white flowers or yellow versus
green seeds antagonistic pairs, and he settled on seven
such pairs for his study (Fig. 1.5). In his experiments,
Mendel cross-fertilized pairs of plants to produce hybrids,
offspring of genetically dissimilar parents, for each an-
tagonistic pair. Figure 1.5 shows the a­ ppearance of the
hybrids he studied.
Fourth, Mendel made reciprocal crosses, in which
he reversed the characteristics of the male and female
parents, thus controlling whether a particular characteris-
tic was transmitted via the egg cell within the ovule or via
a sperm cell within the pollen. For example, he could use
pollen from a purple flower to fertilize the eggs of a white
flower and also use pollen from a white flower to fertilize
the eggs of a purple flower. Because the progeny of these

Figure 1.4 Mendel’s experimental organism: The garden pea. (a) Pea plants with white flowers. (b) The anthers produce pollen,
which generates sperm. Mature pollen lands on the stigma, a structure connected to the ovary (which becomes the pea pod). The pollen
then grows a tube that extends through the stigma to one of the ovules (immature seeds), allowing fertilization. (c) To prevent self-fertilization,
breeders remove the anthers from the female parents (here, the white flower) before the plant produces mature pollen. A paintbrush is used
to transfer pollen from the anthers of the male parent (here, the purple flower) to the female parent’s stigma. Each fertilized ovule becomes
an individual pea (mature seed) that can grow into a new pea plant. All of the peas produced from one flower are encased in the same pea
pod, but these peas form from different pollen grains and ovules. (a): Andrea Jones Images/Alamy

Cross-
fertilization:

pollen
transferred Anthers
onto stigma removed
Stigma of recipient previously
Anthers
( )
Seed
Ovules formation
( ) within
ovary
Seed
germination

(a) Pisum sativum (b) Pea flower anatomy (c) Cross-pollination

4 Chapter 1   Mendel’s Principles of Heredity

Figure 1.5 The mating of parents with antagonistic reciprocal crosses were similar, Mendel demonstrated
characteristics produces hybrids. Note that each of the hybrids that the two parents contribute equally to inheritance.
for the seven antagonistic pairs studied by Mendel resembles only Fifth, Mendel worked with large numbers of plants,
one of the parents. The parental characteristic that shows up in the
hybrid is the dominant characteristic.
counted all offspring, subjected his findings to numerical
Antagonistic Pairs Appearance of Hybrid
analysis, and then compared his results with predictions
(dominant characteristic) based on his models. He was the first person to study in-
heritance in this quantitative manner. Mendel’s careful
Seed color (interior) numerical analysis revealed patterns of transmission that
reflected basic laws of ­heredity.
Finally, Mendel was a brilliant practical experimental-
Yellow Green Yellow ist. When comparing tall and short plants, for example, he
made sure that the short ones were out of the shade of the
Seed shape tall ones so their growth would not be stunted. In short,
Mendel purposely set up a simplified black-and-white ex-
perimental system and then figured out how it worked. He
Round
looked at discrete traits that came in two mutually exclu-
Round Wrinkled
sive forms and asked questions that could be answered by
observation and computation.
Flower color

essential concepts 1.1

• Mendel established pure-breeding lines of peas in which

a specific characteristic would remain constant from one
generation to the next.
• When Mendel crossed pure-breeding lines with
alternative characteristics, the hybrid progeny always had
Purple White Purple the characteristics of one parent.
• In Mendel’s experiments, the hybrid progeny produced by
Pod color (unripe) reciprocal cross-fertilizations had the same
characteristics; it did not matter which parent was male
and which was female.

Green Yellow Green

1.2 Genetic Analysis According

Pod shape (ripe)
to Mendel

Round Pinched Round

learning objectives

1. Explain Mendel’s law of segregation and how it predicts

Stem length the 3:1 dominant-to-recessive phenotypic ratio among
the F2 generation of a monohybrid cross.
2. Distinguish between a monohybrid cross and a testcross.
3. Explain Mendel’s law of independent assortment and
how the 9:3:3:1 phenotypic ratio among the F2 of a
dihybrid cross provides evidence for this law.
Long Short Long
4. Interpret phenotypic ratios of progeny to infer how
particular traits are inherited.
Flower position 5. Predict the genotypic and phenotypic ratios among
progeny of complex multihybrid crosses using simple
rules of probability.
6. Cite the most common molecular explanations for
dominant and recessive alleles.
Along stem At tip of stem Along stem

In 1866, Gregor Mendel published in an obscure journal a
paper titled “Experiments on Plant Hybrids.” In it, Mendel
describes the transmission of visible characteristics in pea
plants, defines unseen but logically deduced units (genes)
that determine when and how often these traits appear, and
analyzes the behavior of genes in simple mathematical
terms to reveal previously unsuspected principles of hered-
ity. The paper would eventually become the cornerstone of
modern genetics. Let us examine its insights.
Monohybrid Crosses Reveal
the Law of Segregation
Once Mendel had isolated pure-breeding lines for several
sets of characteristics, he carried out a series of matings
between individuals that differed in only one trait, such as
seed color or stem length. In each cross, one parent has one
form of the trait, and the other parent has the antagonistic
characteristic. Figure 1.6 illustrates one such mating.
Mendel planted pure-breeding green peas and pure-
breeding yellow peas and allowed them to grow into the
parental (P) g­ eneration. When the plants had flowered,
he brushed the stigma of green-pea plant flowers with pol-
len from yellow-pea plants. He also performed the recipro-
cal cross, dusting yellow-pea plant stigmas with green-pea
pollen. He found that in both cases, the peas produced were
all yellow.
These yellow peas, progeny of the P generation, were
the first filial (F1) generation. To learn whether the green
characteristic had disappeared entirely or remained intact
Figure 1.6 A monohybrid cross. Crosses of pure-breeding
parental plants produce F1 hybrids, all of which resemble one of the
parents. Self-pollination of F1 plants yields an F2 generation with a
3:1 ratio of individuals resembling the two original parental types.
For simplicity, we do not show the plants that produce the peas or
that grow from the planted peas.
Generation
Parental (P)
(pure-breeding) Yellow peas Green peas
( : sperm) ( : eggs)
First filial (F1)
All yellow
Self-fertilization
Second filial (F2)
6022 yellow : 2001 green
3:1
1.2 Genetic Analysis According to Mendel 5
but hidden in these F1 yellow peas, Mendel planted them to
obtain mature F1 plants that he allowed to self-fertilize.
Such experiments involving hybrids for a single trait are
called monohybrid crosses. He then harvested and counted
the peas of the resulting second filial (F2) generation,
progeny of the F1 generation. The progeny of one series of
F1 self-fertilizations were 6022 yellow and 2001 green
F2 peas, an almost perfect ratio of 3 yellow : 1 green.
F1 plants derived from the reciprocal of the original cross
produced a similar 3:1 ratio of yellow to green F2 progeny.
Reappearance of the recessive characteristic
The presence of green peas in the F2 generation was irre-
futable evidence that blending had not occurred. If it had,
the information necessary to make green peas would have
been lost irretrievably in the F1 hybrids. Instead, the infor-
mation remained intact and was able to direct the forma-
tion of 2001 green peas in the second filial generation.
These green peas were indistinguishable from their green
grandparents.
Mendel concluded that two types of yellow peas must
exist: those that breed true like the yellow peas of the
P generation, and those that can yield some green offspring
like the yellow F1 hybrids. This second type somehow con-
tains latent information for green peas. He called the char-
acteristic that appeared in all the F1 hybrids—in this case,
yellow seeds—dominant (see Fig. 1.5) and the antagonis-
tic ­green-pea characteristic that remained hidden in the
F1 hybrids but reappeared in the F2 generation recessive. But
how did he explain the 3:1 ratio of yellow to green F2 peas?
Genes: Discrete units of inheritance
To account for his observations, Mendel proposed that for
each trait, every plant carries two copies of a unit of in-
heritance, receiving one from its maternal parent and the
other from the paternal parent. Today, we call these units of
inheritance genes. The pea plants in Mendel’s collection
had two copies of a gene for seed color, two copies of an-
other for seed shape, two copies of a third for stem length,
and so forth.
Mendel further proposed that each gene comes in alter-
native forms, and combinations of these alternative forms
determine the contrasting characteristics he was studying.
Today we call the alternative forms of a single gene alleles.
The gene for pea color, for example, has yellow and green
alleles; the gene for pea shape has round and wrinkled al-
leles. In Mendel’s monohybrid crosses, one allele of each
gene was dominant, the other recessive. In the P generation,
one parent carried two dominant alleles of the gene under
consideration; the other parent, two recessive alleles. The
F1 generation hybrids carried one dominant and one reces-
sive allele of the gene. Individuals having two different al-
leles of a single gene are monohybrids.
6 Chapter 1   Mendel’s Principles of Heredity

The law of segregation
If a plant has two copies of every gene, how does it pass
only one copy of each to its progeny? And how do the off-
spring then end up with two copies of these same genes,
one from each parent? Mendel answered these questions in
terms of the two biological mechanisms behind reproduc-
tion: gamete formation and the random union of gametes at
fertilization.
Gametes are the specialized cells—eggs within the
ovules of the female parent and sperm cells within the
pollen grains—that carry genes between generations.
Mendel imagined that during the formation of eggs and
sperm, the two copies of each gene in the parent separate
(or segregate) so that each gamete receives only one allele
for each trait (Fig. 1.7a). Thus, each egg and each sperm
receives only one allele for pea color (either yellow or
green).
At fertilization, a sperm with one or the other allele
unites at random with an egg carrying one or the other al-
lele, restoring the two copies of the gene for each trait in the
fertilized egg, or zygote (Fig. 1.7b). If the sperm carries
Figure 1.7 The law of segregation. (a) The two identical
alleles of pure-breeding plants separate (segregate) during gamete
formation. As a result, each sperm or egg carries only one of each
pair of parental alleles. (b) Cross-fertilization between pure-breeding
parents with antagonistic characteristics results in F1 hybrid zygotes
with two different alleles. For the seed color gene, a Yy hybrid
zygote will develop into a yellow pea.
(a) The two alleles for each trait separate during gamete
formation.
Gametes
(sperm or eggs)
Y
Grows into plant Gamete
formation
YY yellow pea Y Figure 1.8 The Punnett square: Visual summary of a cross.
from a pure-breeding
stock
y
Grows into plant Gamete
formation
yy green pea y P
from a pure-breeding
stock
(b) Two gametes, one from each parent, unite at random
at fertilization.
yellow and the egg green, the result will be a hybrid yellow
pea like the F1 monohybrids that resulted when pure-
breeding parents of opposite types mated. If the yellow-
carrying sperm unites with a yellow-carrying egg, the
result will be a yellow pea that grows into a pure-breeding
plant like those of the P generation that produced only
yellow peas. And finally, if sperm carrying the allele for
green peas f­ ertilizes a green-carrying egg, the progeny will
be a pure-breeding green pea.
Mendel’s law of segregation encapsulates this gen-
eral principle of heredity: The two alleles of each gene
separate (segregate) during gamete formation, and then
unite at random, one from each parent, at fertilization.
Throughout this book, the term segregation refers to such
equal segregation in which one allele, and only one allele,
of each gene goes to each gamete. Note that the law of
segregation makes a clear distinction between the somatic
cells (body cells) of an organism, which have two copies
of each gene, and the gametes, which bear only a single
copy of each gene.
The Punnett square
Figure 1.8 shows a simple way of visualizing the results of
the segregation and random union of alleles during gamete
formation and fertilization. Mendel invented a system of
symbols that allowed him to analyze all of his crosses in the
same way. He designated dominant alleles with a capital A,
B, or C and recessive ones with a lowercase a, b, or c.
­Modern geneticists have adopted this convention for nam-
ing genes in peas and many other organisms, but they often
choose a symbol with some reference to the trait in question—
a Y for yellow or an R for round. Throughout this book, we
present gene symbols in italics. In Fig. 1.8, we denote the
This Punnett square illustrates the combinations that can arise when
an F1 hybrid undergoes gamete formation and self-fertilization. The F2
generation has a 3:1 ratio of yellow to green peas.
YY yy
Gametes Y y

Gametes Zygote F1 Hybrid F1 (all identical) Yy Yy

(one sperm, one egg)

Seed Sperm 1/2 1/2

Y
Fertilization development F2
Yy Y y Each box:
Eggs 1/2 × 1/2 = 1/4
y Yy = yellow pea
showing 1/2 Y YY Yy
dominant trait
Y = yellow-determining allele of pea color gene 1/2 y yY yy
y = green-determining allele of pea color gene

dominant yellow allele with a capital Y and the recessive
green allele with a lowercase y. The pure-breeding plants
of the parental generation are either YY (yellow peas) or
yy (green peas). The YY parent can produce only Y gametes,
the yy parent only y gametes. You can see in Fig. 1.8 why
every cross between YY and yy produces exactly the same
result—a Yy hybrid—no matter which parent (male or
­female) contributes which particular allele.
Next, to visualize what happens when the Yy hybrids
self-fertilize, we set up a Punnett square (named after the
British mathematician Reginald Punnett, who introduced it
in 1906; Fig. 1.8). The square provides a simple and con-
venient method for tracking the kinds of gametes produced,
as well as all the possible combinations that might occur at
fertilization. As the Punnett square shows in the first col-
umn and the first row, each hybrid produces two kinds of
gametes, Y and y, in a ratio of 1:1. Thus, half the sperm and
half the eggs carry Y, while the other half of each gamete
type carries y.
Each box in the Punnett square in Fig. 1.8 containing
a colored pea represents one possible fertilization event.
At fertilization, 1/4 of the progeny will be YY, 1/4 Yy,
1/4 yY, and 1/4 yy. Because the gametic source of an al-
lele (egg or sperm) for the traits Mendel studied had no
influence on the allele’s effect, Yy and yY are equivalent.
This means that 1/2 of the progeny are yellow Yy hy-
brids, 1/4 YY true-breeding yellows, and 1/4 true-
breeding yy greens. The diagram illustrates how the
segregation of alleles during gamete formation and the
random union of egg and sperm at fertilization can
produce the 3:1 ratio of yellow to green that Mendel ob-
served in the F2 generation.
Mendel’s Results Reflect Basic
Rules of Probability
Though you may not have realized it, the Punnett square
illustrates two simple rules of probability—the product
rule and the sum rule—that are central to the analysis of
genetic crosses. These rules predict the likelihood that a
particular combination of events will occur.
The product rule
The product rule states that the probability of two or more
independent events occurring together is the product of the
probabilities that each event will occur by itself. With inde-
pendent events:
Probability of event 1 and event 2 =
Probability of event 1 × probability of event 2
Consecutive coin tosses are obviously independent
events; a heads in one toss neither increases nor decreases
1.2 Genetic Analysis According to Mendel 7
the probability of a heads in the next toss. If you toss two
coins at the same time, the results are also independent
events. A heads for one coin neither increases nor decreases
the probability of a heads for the other coin. Thus, the prob-
ability of a given combination is the product of their inde-
pendent probabilities. For example, the probability that
both coins will turn up heads is:
1/2 × 1/2 = 1/4
Similarly, the formation of egg and sperm are independent
events; in a hybrid plant, the probability is 1/2 that a given
gamete will carry Y and 1/2 that it will carry y. Because
fertilization happens at random, the probability that a par-
ticular combination of maternal and paternal alleles will
occur simultaneously in the same zygote is the product of
the independent probabilities of these alleles being pack-
aged in egg and sperm. Thus, to find the chance of a Y egg
uniting with a Y sperm, you simply multiply 1/2 × 1/2
to get 1/4. This is the same fraction of YY progeny seen in
the Punnett square of Fig. 1.8, which demonstrates that the
Punnett square is simply another way of depicting
the product rule. It is important to realize that each box
in the Punnett square represents an equally likely outcome
of the cross only ­because each of the two types of sperm
and eggs (Y and y) are produced at equal frequencies.
The sum rule
While we can describe the moment of random fertilization
as the simultaneous occurrence of two independent events,
we can also say that two different fertilization events are
mutually exclusive. For instance, if Y combines with Y, it
cannot also combine with y in the same zygote. A second
rule of probability, the sum rule, states that the probability
of either of two mutually exclusive events occurring is the
sum of their individual probabilities. With mutually exclu-
sive events:
Probability of event 1 or event 2 =
Probability of event 1 + probability of event 2
To find the likelihood that an offspring of a Yy hybrid
self-fertilization will be a hybrid like the parents, you add
1/4 (the probability of maternal Y uniting with paternal y)
and 1/4 (the probability of the mutually exclusive event
where paternal Y unites with maternal y) to get 1/2, again
the same result as in the Punnett square.
In another use of the sum rule, you could predict the
ratio of yellow to green F2 progeny. The fraction of F2 peas
that will be yellow is the sum of 1/4 (the event producing
YY) plus 1/4 (the mutually exclusive event generating Yy)
plus 1/4 (the mutually exclusive event producing yY)
to get 3/4. The remaining 1/4 of the F2 progeny will be
green. So the yellow-to-green ratio is 3/4 to 1/4, or more
simply, 3:1.
8 Chapter 1   Mendel’s Principles of Heredity
Further Crosses Verify
the Law of Segregation
The law of segregation was a hypothesis that explained the
data from simple crosses involving monohybrid peas, but
Mendel needed to perform additional experiments to check
its validity. Mendel’s hypothesis, summarized in Fig. 1.8,
made the testable prediction that the F2 should have two
kinds of yellow peas (YY and Yy) but only one kind of green
pea (yy). In addition, his hypothesis predicted that the YY
and Yy yellow peas in the F2 should be present in a ratio of
1 YY : 2 Yy.
To verify these expectations, Mendel allowed self-­
fertilization of all the plants in the F2 generation and
counted the types of F3 progeny (Fig. 1.9). He found
that the plants that developed from F2 green peas all
produced only green peas in the F3, and when the result-
ing F3 plants self-­fertilized, the next generation (the F4)
also produced green peas (not shown). This is what we
would expect of pure-breeding yy lines carrying two
copies of the recessive allele. The yellow peas were a
different story. When Mendel allowed 518 F2 plants that
developed from yellow peas to self-fertilize, he ob-
served that 166, roughly 1/3 of the total, were
pure-breeding yellow through several generations, but
the other 352 (2/3 of the total ­yellow F2 plants) were
hybrids because they gave rise to yellow and green
F3 peas in a ratio of 3:1. Therefore, as Mendel’s theory antic-
ipated, the ratio of YY to Yy among the 518 F2 yellow
pea plants was ­indeed 1:2.
It took Mendel years to conduct such rigorous exper-
iments on seven pea traits, but in the end, he was able to
conclude that the segregation of dominant and recessive
alleles during gamete formation and their random union
at fertilization could indeed explain the 3:1 ratios he ob-
served whenever he allowed hybrids to self-fertilize. His
results, however, raised yet another question, one of some
importance to future plant and animal breeders. Plants
Figure 1.9 Yellow F2 peas are of two types: Pure
breeding and hybrid. The distribution of Y and y alleles after
two generations of self-fertilization. The homozygous individuals of
each generation breed true, whereas the hybrids do not.
F1 Yy
Self-
fertilization
F2 YY Yy Yy
Self-
fertilization 3:1 3:1
F3 YY YY Yy Yy yy YY Yy Yy
(All)
showing a dominant characteristic, such as yellow peas,
can be either pure-breeding (YY) or hybrid (Yy). How can
you distinguish one from the other? For self-fertilizing
plants, the answer is to observe the appearance of the
next generation. But how would you distinguish
pure-breeding from hybrid individuals in species that do
not self-fertilize?
Testcrosses: A way to establish genotype
Before describing Mendel’s answer, we need to define a
few more terms. An observable characteristic, such as yel-
low or green pea seeds, is a phenotype, while the pair of
alleles present in an individual is its genotype. A YY or a yy
genotype is called homozygous, because the two copies of
the gene that determine the particular trait in question are
the same. In contrast, a genotype with two different alleles
for a trait is heterozygous; in other words, it is a hybrid for
that trait (Fig. 1.10). An individual with a homozygous
genotype is a homozygote; one with a heterozygous geno-
type is a heterozygote.
Note that the phenotype of a heterozygote (that is, of a
hybrid) defines which allele is dominant: Because Yy peas
are yellow, the yellow allele Y is dominant to the green y
allele. If you know the genotype and the dominance rela-
tion of the alleles, you can predict the phenotype accu-
rately. The reverse is not true, however, because some
phenotypes can derive from more than one genotype. For
example, the phenotype of yellow peas can result from
­either the YY or the Yy genotype.
With these distinctions in mind, we can look at the
method Mendel devised for deciphering the unknown gen-
otype responsible for a dominant phenotype. We’ll call this
genotype Y–; the dash represents the unknown second al-
lele, either Y or y. This method, called the testcross, is a
mating in which an individual showing the dominant phe-
notype, for instance, a Y– plant grown from a yellow pea, is
Figure 1.10 Genotype versus phenotype in homozygotes
and heterozygotes. The relationship between genotype and
phenotype with a pair of contrasting alleles where one allele (Y)
shows complete dominance over the other (y).
Genotype for the Seed Phenotype
Color Gene
YY
Homozygous dominant Yellow
yy Dominant Recessive
allele allele
Yy Yellow
Heterozygous
yy yy yy
Green
(All) Homozygous recessive
Another random document with
no related content on Scribd:
LP43735.
Kid Blue. Marvin Schwartz Productions, Inc. Released by
Twentieth Century-Fox Film Corporation. 100 min., sd., color, 35
mm. © Twentieth Century-Fox Film Corporation; 23May73;
LP43735.

LP43736.
Sleuth. Palomar Pictures International, Inc. Released by Twentieth
Century-Fox Film Corporation. 138 min., sd., color, 35 mm. Based on
the play by Anthony Shaffer. © Palomar Pictures International, Inc.;
24Feb72; LP43736.

LF43737.
Celebration at Big Sur. A Ted Mann Productions presentation. 9
reels, sd., color, 35 mm. © Ted Mann Productions; 28Apr71;
LP43737.

LP43738.
The Heartbreak kid. Palomar Pictures International, Inc. Released
by Twentieth Century-Fox Film Corporation. 104 min., sd., color, 35
mm. Based on, A Change of plan, by Bruce Jay Friedman. © Palomar
Pictures International, Inc.; 17Dec72; LP43738.

LP43739.
The Apprenticeship of Duddy Kravitz. International Cinemedia
Center, Ltd. Released by Paramount Pictures Corporation. Produced
in cooperation with Canadian Film Development Corporation, Welco
United Canada, Ltd., Famous Players, Ltd. & Astral Bellevue-Pathe,
Ltd. 121 min., sd., color, 35 mm., Panavision. Based on Mordecai
Richler’s novel. Appl. au: The Duddy Kravitz Syndicate. © The
Duddy Kravitz Syndicate & Famous Players, Ltd.; 12Apr74; LP43739.

LP43740.
 The Neptune factor. Conquest of the Deeps, Ltd. and Company & a
Quadrant Films, Ltd. & Bellevue Pathe, Ltd. film. Released by
Twentieth Century-Fox Film Corporation. 97 min., sd., color, 35
mm., Panavision. © Conquest of the Deeps, Ltd. and Company;
25Jul73; LP43740.

LP43741.
McQ. Warner Brothers, Inc. 111 min., sd., color, 35 mm.,
Panavision. © Warner Brothers, Inc.; 1Feb74; LP43741.

LP43742.
The Castaway cowboy. Walt Disney Productions. Distributed by
Buena Vista Distribution Company, Inc. 91 min., sd., color, 35 mm.
© Walt Disney Productions; 31Jul74; LP43742.

LP43743.
The Midnight man. A Norlan production. 119 min., sd., color, 35
mm. Based upon the novel, The Midnight lady and the mourning
man, by David Anthony. Appl. au: Universal Pictures. © Universal
Pictures; 10May74; LP43743.

LP43744.
Blazing saddles. Warner Brothers, Inc. 93 min., sd., color, 35 mm.,
Panavision. © Warner Brothers, Inc.; 7Feb74; LP43744.

LP43745.
Zandy’s bride. A Harvey Matofsky production. Distributed by
Warner Communications Company. 97 min., sd., color, 35 mm.,
Panavision. Based on The Stranger, by Lillian Bos Ross. Appl. au:
Warner Brothers, Inc. © Warner Brothers, Inc.; 19May74; LP43745.

LP43746.
 Place to place. Xerox Films. Made by Davidson Films. Distributed
by Xerox Films. 14 min., sd., color, 16 mm. (Exploring mathematics)
© Xerox Corporation; 7Apr72; LP43746.

LP43747.
Lost in the mish-mosh. Xerox Films. Made by Davidson Films.
Distributed by Xerox Films. 14 min., sd., color, 16 mm. (Exploring
mathematics) © Xerox Corporation; 14Mar72; LP43747.

LP43748.
Noah’s ark; or, Multiplying with fractions. Xerox Films. Made by
Davidson Films. Distributed by Xerox Films. 9 min., sd., color, 16
mm. (Exploring mathematics) © Xerox Corporation; 20May71;
LP43748.

LP43749.
Probableman. Xerox Films. Made by Davidson Films. Distributed
by Xerox Films. 13 min., sd., color, 16 mm. (Exploring mathematics)
© Xerox Corporation; 12Aug71; LP43749.

LP43750.
Zero: something for nothing. Xerox Films. Made by Davidson
Films. Distributed by Xerox Films. 8 min., sd., color, 16 mm.
(Exploring mathematics) © Xerox Corporation; 21Oct71; LP43750.

LP43751.
Dinosaurs’ dilemma, the meaning of the variable. Xerox Films.
Made by Davidson Films. Distributed by Xerox Films. 12 min., sd.,
color, 16 mm. (Exploring mathematics) © Xerox Corporation;
19Mar71; LP43751.

LP43752.
 Prime time. Xerox Films. Made by Davidson Films. Distributed by
Xerox Films. 9 min., sd., color, 16 mm. (Exploring mathematics) ©
Xerox Corporation; 19May71; LP43752.

LP43753.
The Weird number (rational numbers) Xerox Films. Made by
Davidson Films. Distributed by Xerox Films. 13 min., sd., color, 16
mm. (Exploring mathematics) © Xerox Corporation; 24Sep71;
LP43753.

LP43754.
The Case of the missing chickcows (adding positive and negative
integers) Xerox Films. Made by Davidson Films. Distributed by
Xerox Films. 9 min., sd., color, 16 mm. (Exploring mathematics) ©
Xerox Corporation; 20Jan72 (in notice: 1971); LP43754.

LP43755.
The Gravy train. A Tomorrow Entertainment production. A
Columbia Pictures release. 96 min., sd., color, 35 mm. © Tomorrow
Entertainment, Inc.; 16Jun74; LP43755.

LP43756.
The Greenhouse jungle. Universal City studios, Inc. Distributor:
MCA-TV. 80 min., sd., color, 35 mm. (Columbo) (Mystery movie) ©
Universal City Studios, Inc.; 13Oct72; LP43756.

LP43757.
Our time. A Richard A. Roth production. Released by Warner
Brothers. 96 min., sd., color, 35 mm. © Warner Brothers, Inc.;
10Apr74; LP43757.

LP43758.
 Harold’s fairy tale. Weston Woods. 8 min., sd., color, 16 mm.
Based on the book by Crockett Johnson. © Weston Woods a.a.d.o.
Weston Woods Studios, Inc.; 20Mar74; LP43758.

LP43759.
The Nurture of Nell; or, Food for feeling fit. Dairy Council, Inc. 12
min., sd., color, 16 mm. © Dairy Council, Inc.; 5Nov73; LP43759.

LP43760.
I love you, Frank. Ron Sandilands, Inc. 27 min., sd., color, 16 mm.
© American Medical Association; 15Apr74; LP43760.

LP43761.
The Education of Sonny Carson. Paramount Pictures Corporation.
104 min., sd., color, 35 mm. Based on the book by Sonny Carson. ©
Paramount Pictures Corporation; 5Jul74; LP43761.

LP43762.
The Take. Columbia Pictures presents a World Film Services
production. 93 min., sd., color, 35 mm. Based on the novel Sir you
bastard by G. F. Newman. © Columbia Pictures Corporation, Ltd.;
24Apr74; LF43762.

LP43763.
99 and 44/100% dead. Joe Wizan-Vashon Productions. Released
by Twentieth Century-Fox Film Corporation. 98 min., sd., color, 35
mm., Panavision. © Twentieth Century-Fox Film Corporation;
26Jun74; LP43763.

LP43764.
Mame. A Warner Communications company in association with
the American Broadcasting Companies. Distributed by Warner
Brothers. 131 min., sd., color, 35 mm., Panavision. Based on the
Broadway musical by Jerome Lawrence, Robert E. Lee & Jerry
Herman, the novel by Patrick Dennis & the stage play, Auntie Mame,
by Lawrence & Lee. © Warner Brothers, Inc.; 7Mar74; LP43764.

LP43765.
Pink aye. Mirisch-Geoffrey-DePatie-Freleng. Released through
United Artists Corporation. 7 min., sd., color, 35 mm. (Pink Panther)
Mirisch-Geoffrey-DePatie-Freleng; 16May74; LP43765.

LP43766.
Trail of the lonesome Pink. Mirisch-Geoffrey-DePatie-Freleng.
Released through United Artists Corporation. 7 min., sd., color, 35
mm. (Pink Panther) © Mirisch-Geoffrey-DePatie-Freleng; 27Jun74;
LP43766.

LP43767.
The Giving tree. Stephen Bosustow Productions. Released by
United Artists Corporation. 11 min., sd., color, 35 mm. Based on the
book & drawings by Shel Silverstein. © Stephen Bosustow
Productions; 10Aug73 (in notice: 1972); LP43767.

LP43768.
The Sugarland Express. Universal Pictures. 110 min., sd., color, 35
mm., Panavision. © Universal Pictures; 31Mar74; LP43768.

LP43769.
Newman’s law. Universal Pictures. 98 min., sd., color, 35 mm. ©
Universal Pictures; 8May74; LP43769.

LP43770.
The Black windmill. Universal Pictures, Ltd. 106 min., sd., color,
35 mm., Panavision. From Seven days to a killing by Clive Egleton. ©
Universal Pictures, Ltd.; 16May74; LP43770.
LP43771.
The Most marvelous cat. Xerox Films. 11 min., sd., color, 16 mm.
(Desire to read) Based on a story by Gloria Wiener. Appl. au: Xerox
Corporation, employer for hire. © Xerox Corporation; 18Apr73;
LP43771.

LP43772.
The Longest yard. Long Road Productions. Produced in
association with Albert S. Ruddy Productions. Released by
Paramount Pictures Corporation. 121 min., sd., color, 35 mm. Based
on the story by Albert S. Ruddy. © Long Road Productions; 29Jul74;
LP43772.

LP43773.
The Girl who couldn’t say no. Twentieth Century-Fox Film
Corporation. 82 min., sd., color, 35 mm. © Twentieth Century-Fox
Film Corporation; 12Nov69; LP43773.

LP43774.
Cover me, babe. Twentieth Century-Fox Film Corporation. 89
min., sd., color, 35 mm. © Twentieth Century-Fox Film Corporation;
31Dec69; LP43774.

LP43775.
Bring me the head of Alfredo Garcia. Optimus Productions &
Estudios Churubusco. Released by United Artists. 112 min., sd.,
color, 35 mm. © United Artists Corporation; 23Jul74; LP43775.

LP43776.
Jesus Christ Superstar. Universal Pictures. 107 min., sd., color, 35
mm., Todd-AO 35. Based upon the rock opera. © Universal Pictures;
27Jun73; LP43776.
LP43777.
Privilege. World Film Services, Ltd. & Memorial Enterprises, Ltd.
Released by Universal Pictures. 101 min., sd., color, 35 mm. © World
Film Services, Ltd.; 7Oct67; LP43777.

LP43778.
The Fox. Claridge Pictures, Inc. & Warner Brothers, Inc. Produced
in association with Motion Pictures International, Inc. 109 min., sd.,
color, 35 mm. From the novella by D. H. Lawrence. © Claridge
Pictures, Inc.; 29Dec67; LP43778.

LP43779.
The Bears and I. Walt Disney Productions. Distributed by Buena
Vista Distribution Company, Inc. 89 min., sd., color, 35 mm. Based
on the book by Robert Franklin Leslie. © Walt Disney Productions;
30Jul74; LP43779.

LP43780.
Wild in the sky. Bald Eagle Productions, Inc. An American
International Pictures release. 87 min., sd., color, 35 mm. © Bald
Eagle Productions, Inc.; 15Mar72 (in notice: 1971); LP43780.

LP43781.
Wild science. Lee Mendelson Productions. 52 min., sd., color, 16
mm. © Lee Mendelson Productions; 26Apr74; LP43781.

LP43782.
Memories within Miss Aggie. Inish Kae, Ltd. 74 min., sd., color, 35
mm. Appl. author: Gerard Damiano & Oxford Amusement
Corporation d.b.a. The Memory Company. © Inish Kae, Ltd.;
1May74; LP43782.

LP43783.
 Heist and seek. A DePatie-Freleng production. Produced in
association with the Mirisch-Cinema Company, Inc. Released by
United Artists Corporation. 7 min., sd., color, 35 mm. (The
Dogfather) © United Artists Corporation; 4Oct74; LP43783.

LP43784.
The Goose that laid a golden egg. A DePatie-Freleng production.
Produced in association with the Mirisch-Cinema Company, Inc.
Released by United Artists Corporation. 7 min., sd., color, 35 mm.
(The Dogfather) © United Artists Corporation; 4Oct74; LP43784.

LP43785.
Amazing Grace. United Artists Corporation. 99 min., sd., color, 35
mm. © United Artists Corporation; 7Jun74; LP43785.

LP43786.
The Day of the jackal. Warwick Film Productions, Ltd. & Universal
Productions France, S.A. Released by Universal Studios. 142 min.,
sd., color, 35 mm. From the book by Frederick Forsyth. © Warwick
Film Productions, Ltd.; 17May73; LP43786.

LP43787.
The Terminal man. Warner Brothers, Inc. 104 min., sd., color, 35
mm. Based upon a novel by Michael Crichton. © Warner Brothers,
Inc.; 19Jun74; LP43787.

LP43788.
Black Belt Jones. A Weintraub-Heller production. Released by
Warner Brothers, Inc. 87 min., sd., color, 35 mm. © Warner
Brothers, Inc.; 16Jan74; LP43788.

LP43789.
 O lucky man! Memorial Enterprises-SAM. Released by Warner
Brothers, Inc. 165 min., sd., color, 35 mm. © Warner Brothers, Inc.;
3May73; LP43789.

LP43790.
Magnum force. A Malpaso Company film. Released by Warner
Brothers, Inc. 121 min., sd., color, 35 mm. Based on original material
by Harry Julian & R. M. Fink. © Warner Brothers, Inc.; 13Dec73;
LP43790.

LP43791.
Enter the dragon. Warner Brothers, Inc.-Concord Productions,
Inc. 99 min., sd., color, 35 mm. © Warner Brothers, Inc.; 15Aug73;
LP43791.

LP43792.
Sisters. Pressman-Williams Enterprises. Released by American
International. 92 min., sd., color, 35 mm. From an original story by
Brian De Palma. © Pressman-Williams Enterprises, Inc.; 18Apr73
(in notice: 1972); LP43792.

LP43793.
Yankee Doodle Cricket. Chuck Jones Enterprises. 25 min., sd.,
color, 35 mm. Appl. au.: Charles M. Jones (Chuck Jones) © Chuck
Jones Enterprises; 6May74; LP43793.

LP43794.
Miracle at Oakmont—The 1973 U.S. Open. United States Golf
Association. Made by International Sports Productions, Inc. & W and
W Films. 31 min., sd., color, 16 mm. Add. ti.: Miller’s miracle at
Oakmont. © United States Golf Association; 4Sep73; LP43794.

LP43795.
 Benji. Mulberry Square Productions, Inc. 87 min., sd., color, 35
mm. © Mulberry Square Productions, Inc.; 22May74 (in notice:
1973); LP43795.

LP43796.
Shanks. William Castle Productions, Inc. Released by Paramount
Pictures Corporation. 93 min., sd., color, 35 mm. © Paramount
Pictures Corporation; 9Oct74; LP43796.

LP43797.
The Flying deuces. Film Archives Company. 69 min., sd., b&w, 16
mm. NM: revisions & editing. © Film Archives Company; 16Apr74;
LP43797.

LP43798.
The Faces of peril. An Alfra production. Produced in association
with M-G-M TV. 60 min., sd., color, 16 mm. (Medical Center) ©
Metro-Goldwyn-Mayer, Inc.; 23Sep74; LP43798.

LP43799.
Adults only. An Alfra production. Produced in association with M-
G-M TV. 60 min., sd., color, 16 mm. (Medical Center) © Metro-
Goldwyn-Mayer, Inc.; 9Sep74; LP43799.

LP43800.
Three-cornered cage. An Alfra production. Produced in association
with M-G-M TV. 60 min., sd., color, 16 mm. (Medical Center) ©
Metro-Goldwyn-Mayer, Inc.; 30Sep74; LP43800.

LP43801.
The Demi-god. An Alfra production. Produced in association with
M-G-M TV. 60 min., sd., color, 16 mm. (Medical Center) © Metro-
Goldwyn-Mayer, Inc.; 16Sep74; LP43801.
LP43802.
Fever in Rio. Wolrab Productions. Released by United Artists. 15
min., sd., color, 35 mm. © Wolrab Productions; 18Jun73; LP43802.

LP43803.
Cool million. Westward Productions. Released by MCA-TV. 106
min., sd., color, 35 mm. (World premiere) © Westward Productions;
14Oct72; LP43803.

LP43804.
Savage. Universal City Studios, Inc. Released by MCA-TV. 80 min.,
sd., color, 35 mm. (World premiere) © Universal City Studios, Inc.;
31Mar73 (in notice: 1972); LP43804.

LP43805.
Hitched. Universal City Studios, Inc. Released by MCA-TV. 80
min., sd., color, 35 mm. (World premiere) © Universal City Studios,
Inc.; 31Mar73 (in notice: 1972); LP43805.

LP43806.
Guns of a stranger. Marty Robbins Enterprises. Released by
Universal. 91 min., sd., color, 35 mm. © Marty Robbins Enterprises;
18Jul73; LP43806.

LP43807.
Country music. Marty Robbins Enterprises. Released by Universal.
94 min., sd., color, 35 mm. © Marty Robbins Enterprises; 2Aug72;
LP43807.

LP43808.
Play it as it lays. F. P. Films, Inc. Released by Universal. 99 min.,
sd., color, 35 mm. From the novel by Joan Didion. © F. P. Films,
Inc.; 29Oct72; LP43808.

LP43809.
Daredevil men. Cinema International Corporation, N. V. Released
by Universal. 3 reels, sd., color, 35 mm. © Cinema International
Corporation, N. V.; 21Sep72 (in notice: 1971); LP43809.

LP43810.
Uptown Saturday night. Verdon Productions, Ltd., The First
Artists Production Company, Ltd. & Warner Brothers, Inc. 104 min.,
sd., color, 35 mm. © Verdon Productions, Ltd., The First Artists
Production Company, Ltd. & Warner Brothers, Inc.; 16Jun74:
LP43810.

LP43811.
Badlands. Pressman-Williams, Badlands, Ltd. Distributed by
Warner Brothers. 94 min., sd., color, 35 mm. © Pressman-Williams,
Badlands, Ltd.; 24Mar74 (in notice: 1973); LP43811.

LP43812.
Black eye. Pat Rooney Productions & Warner Brothers, Inc. 98
min., sd., color, 35 mm. From Jeff Jack’s novel, Murder on the wild
side. © Pat Rooney Productions; 1May74 (in notice: 1973); LP43812.

LP43813.
The New land. A Svensk Filmindustri production. Released by
Warner Brothers, Inc. 161 min., sd., color, 35 mm. From a novel by
Vilhelm Moberg. NM: editorial revision, translation & additions. ©
Warner Brothers, Inc.; 2Aug73; LP43813.

LP43814.
Hookman. Leonard Freeman Productions. Produced in association
with the CBS Television Network. 60 min., sd., color, 16 mm.
(Hawaii Five-O) © Columbia Broadcasting System, Inc.; 4Sep73;
LP43814.

LP43815.
Draw me a killer. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
11Sep73; LP43815.

LP43816.
One big happy family. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
25Sep73; LP43816.

LP43817.
The Sunday torch. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
2Oct73; LP43817.

LP43818.
Murder is a taxing affair. Leonard Freeman Productions. Produced
in association with the CBS Television Network. 60 min., sd., color,
16 mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
9Oct73; LP43818.

LP43819.
Tricks are not treats. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
16Oct73; LP43819.
LP43820.
A Bullet for el diablo. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
6Nov73; LP43820.

LP43821.
The Finishing touch. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
13Nov73; LP43821.

LP43822.
Anybody can build a bomb. Leonard Freeman Productions.
Produced in association with the CBS Television Network. 60 min.,
sd., color, 16 mm. (Hawaii Five-O) © Columbia Broadcasting
System, Inc.; 20Nov73; LP43822.

LP43823.
Try to die on time. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
27Nov73; LP43823.

LP43824.
The $100,000 nickel. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
4Dec73; LP43824.

LP43825.
The Flip side is death. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
11Dec73; LP43825.

LP43826.
The Banzai Pipeline. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
25Dec73; LP43826.

LP43827.
Death with Father. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
15Jan74; LP43827.

LP43828.
Murder with a golden touch. Leonard Freeman Productions.
Produced in association with the CBS Television Network. 60 min.,
sd., color, 16 mm. (Hawaii Five-O) © Columbia Broadcasting
System, Inc.; 22Jan74; LP43828.

LP43829.
Nightmare in blue. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
29Jan74; LP43829.

LP43830.
Mother’s deadly helper. Leonard Freeman Productions. Produced
in association with the CBS Television Network. 60 min., sd., color,
16 mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
5Feb74; LP43830.
LP43831.
Killer at sea. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
12Feb74; LP43831.

LP43832.
30,000 rooms and I have the key. Leonard Freeman Productions.
Produced in association with the CBS Television Network. 60 min.,
sd., color, 16 mm. (Hawaii Five-O) © Columbia Broadcasting
System, Inc.; 19Feb74; LP43832.

LP43833.
One born every minute. Leonard Freeman Productions. Produced
in association with the CBS Television Network. 60 min., sd., color,
16 mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
1Jan74 (in notice: 1973); LP43833.

LP43834.
Secret witness. Leonard Freeman Productions. Produced in
association with the CBS Television Network. 60 min., sd., color, 16
mm. (Hawaii Five-O) © Columbia Broadcasting System, Inc.;
8Jan74 (in notice: 1973); LP43834.

LP43835.
Walter’s holiday. A Bud Yorkin-Norman Lear production. 30 min.,
sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.; 20Sep73;
LP43835.

LP43836.
Stitch in time. Pt. 1. A Bud Yorkin-Norman Lear production. 30
min., sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.;
26Sep73; LP43836.
LP43837.
Stitch in time. Pt. 2. A Bud Yorkin-Norman Lear production. 30
min., sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.;
6Oct73; LP43837.

LP43838.
Florida’s affair. A Bud Yorkin-Norman Lear production. 30 min.,
sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.; 9Oct73;
LP43838.

LP43839.
Maude takes a job. A Bud Yorkin-Norman Lear production. 30
min., sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.;
20Oct73; LP43839.

LP43840.
Maude’s double standard. A Bud Yorkin-Norman Lear production.
30 min., sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.;
24Oct73; LP43840.

LP43841.
Vivian’s problem. A Bud Yorkin-Norman Lear production. 30
min., sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.;
31Oct73; LP43841.

LP43842.
The Maude musical. A Bud Yorkin-Norman Lear production. 30
min., sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.;
7Nov73; LP43842.

LP43843.
 The Will. A Bud Yorkin-Norman Lear production. 30 min., sd.,
b&w, 16 mm. (Maude) © Tandem Productions, Inc.; 21Nov73;
LP43843.

LP43844.
Carol’s problem. A Bud Yorkin-Norman Lear production. 30 min.,
sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.; 28Nov73;
LP43844.

LP43845.
Music hath charms. A Bud Yorkin-Norman Lear production. 30
min., sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.;
8Dec73; LP43845.

LP43846.
The Lovebirds. A Bud Yorkin-Norman Lear production. 30 min.,
sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.; 26Dec73;
LP43846.

LP43847.
Arthur’s wedding. A Bud Yorkin-Norman Lear production. 30
min., sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.;
23Jan74; LP43847.

LP43848.
Florida’s goodbye. A Bud Yorkin-Norman Lear production. 30
min., sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.;
30Jan74; LP43848.

LP43849.
The Tax audit. A Bud Yorkin-Norman Lear production. 30 min.,
sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.; 7Feb74;
LP43849.
LP43850.
The Investment. A Bud Yorkin-Norman Lear production. 30 min.,
sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.; 14Feb74;
LP43850.

LP43851.
Phillip’s problem. A Bud Yorkin-Norman Lear production. 30
min., sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.;
20Feb74; LP43851.

LP43852.
Maude’s guest. A Bud Yorkin-Norman Lear production. 30 min.,
sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.; 3Jan74 (in
notice: 1973); LP43852.

LP43853.
Maude’s revolt. A Bud Yorkin-Norman Lear production. 30 min.,
sd., b&w, 16 mm. (Maude) © Tandem Productions, Inc.; 17Jan74 (in
notice: 1973); LP43853.

LP43854.
Women for sale. Pt. 1. A CBS Television production. 60 min., sd.,
color, 16 mm. (Gunsmoke) Appl. au: CBS, Inc., formerly Columbia
Broadcasting System, Inc. © Columbia Broadcasting System, Inc.;
3Sep73; LP43854.

LP43855.
Women for sale. Pt. 2. A CBS Television production. 60 min., sd.,
color, 16 mm. (Gunsmoke) Appl. au: CBS, Inc., formerly Columbia
Broadcasting System, Inc. © Columbia Broadcasting System, Inc.;
10Sep73; LP43855.

LP43856.