Lesson Title: B13.

4 DNA and the Human Genome project

Answers:
Connector: Questions on prior learning
linked to todays lesson:
Recall and retention
Use a diagram to explain how genetic
information is arranged in the cell.
Start from the largest CELL to the
smallest base

Challenge: What can cause changes in

your DNA and what is the impact of this
on the body. Can you think of any
specific diseases

https://www.youtube.com/watch?time_continue=7&v=pYko8i1kEGw&f
eature=emb_logo
 AQA spec link:
• 6.1.4 Students should be able to describe the
• structure of DNA and define genome. The genetic material in the nucleus
of a cell is composed of a chemical called DNA.
• DNA is a polymer made up of two strands forming a double helix. The DNA
is contained in structures called chromosomes.
• A gene is a small section of DNA on a chromosome. Each gene codes for a
particular sequence of amino acids, to make a specific protein.
• The genome of an organism is the entire genetic material of that
organism. The whole human genome has now been studied and this will
have great importance for medicine in the future.
• Students should be able to discuss the importance of understanding the
human genome.
• This is limited to the:
• search for genes linked to different types of disease
• understanding and treatment of inherited disorders
• use in tracing human migration patterns from the past.
 Learning Outcomes
Aiming for Grade 8:
Describe the relationship between DNA, genes, and chromosomes.
Describe what the Human Genome Project was
Describe some of the benefits of studying the human genome.
Explain why genome projects are costly and take a long time
Explain why the cost of genome sequencing has reduced since it was
started.
Explain why knowledge of the genomes of other species is useful.
Discuss possible issues surrounding genome sequencing.
 The section of your
Checklist we are covering
today
 How is the DNA arranged in the cell

09:26
What are chromosomes?

Chromosomes are long strands of genetic information

located in the nuclei of cells.

Chromosomes are most visible

during cell division when they
replicate and look like this…

You will see chromosomes represented both ways.

Homologous chromosomes

In most cells chromosomes are matched in pairs based on their size and
shape.

chromosome from chromosome from

female parent male parent

homologous
chromosomes
Matching pairs of chromosomes are called homologous chromosomes.
Where do homologous chromosomes come from?

Each pair of homologous chromosomes contains one chromosome that has been
inherited from each parent.
X and Y chromosomes

There are two types of sex chromosome with names that are very easy to
remember!

X chromosome Y chromosome

Females have two X chromosomes, one from

each parent.

XX
Males have one X chromosome
and one Y chromosome.
Which parent does a baby boy
inherit its Y chromosome from?

XY
What are chromosomes made of?

Chromosomes carry the genetic information for making all living things –
everything from a human to a gerbil!

Why are chromosomes known as “instructions for life”?

What are these “instructions for life” made of?

What is DNA?
What is DNA?

Chromosomes and their genes are made of a molecule

called DNA.

DNA stands for

deoxyribonucleic
acid.

Each chromosome
is a very long molecule
of tightly coiled DNA.

DNA molecules carry the code that controls what your cells are made of and
what they do.

Which part of a DNA molecule holds this information?

Structure of DNA
 Learning Activities
• Using the key words Nucleotide • Adenine
describe to the person
next to you the structure
Chromosome • Guanine
Double helix •
of DNA, they must draw Cytosine
Cell
it exactly how you tell
Nucleus • Thymine
them
DNA • Phosphate
• Swap roles
• Write a deception in
Double helix • Sugar
your book using as many • Bond
of the key words as • Gene
possible
09:26
 Task 1 Feedback

09:26
 Keywords:
Demonstrate your Learning Adenine, guanine,
for Outcome 1 cytosine, thymine,
phosphate, sugar,
double helix,
chromosomes, DNA
Create

Apply (C)
Evaluate
How is DNA used to
determine your Analyse (B)
characteristics? Analyse
How is the genetic material
arranged inside your cell?

Apply

Understand (D)
Understand
How are the bases paired

Remember
09:26
 Triple only

New Information

Proteins are made of long chains of amino acids. There are

20 different types of amino acid from which to make proteins.

protein
molecule 1

amino acids
What happens if the amino acids are in a different order?

protein
molecule 2

Different
09:26 combinations of amino acids make different proteins.
Triple only

New Information

A three-base (triplet/ codon) sequence codes for each

amino acid. base sequence amino acid

09:26
 Triple only

New Information

• If a gene changes, the cell makes a different

protein.
 Triple only

New Information for Learning Outcome 2

• The genetic code is the sequence of bases that code for each
amino acid
• There are 20 amino acids.

• How many amino acids make up the following code:

• AAATATCTCCCCGCATGGTACTCCTTTTGACGC

09:26
 New Information for Learning Outcome 2

• The genetic code is the sequence of bases that code for each
amino acid
• There are 20 amino acids.

• How many amino acids make up the following code:

• AAATATCTCCCCGCATGGTACTCCTTTTGACGC

09:26
 Triple only

New Information for Learning Outcome 2

• Use the Table to find the

amino acid sequence for
the following code:

• AAATATCTCCCCGCATGGTA
CTCCTTTTGACGC

09:26
 Triple only
New Information for Learning Outcome 2
OPTIONAL
• Working in pairs or threes create a model to show the structure of
DNA
• Ensure it has bases (spelt correctly), sugar, phosphate, double helix.

• Challenge:
• How can you use your model explain the DNA molecules control how
amino acids join together to form proteins in a cell?

09:26
 Keywords:
Demonstrate your Learning Bases, genetic code,
for Outcome 2 sequence, triplet,
complementary,
amino acid

Create
Analyse (B)
Apply (C) Evaluate The order of bases determines
Explain what is meant by the protein that is produced,
the triplet in genetics why?
Analyse

Apply
Understand (D)
Write down the
Understand
complementary base
sequence for
ATGGCCAATCHATCA
Remember
09:26
 The Human Genome Project
Why is it important that we know about all the human
genes?

https://www.youtube.com/watch?v=MvuYATh7Y74&feature=emb_logo
 Genome
• All the DNA of an organism.
• It includes all the genes that carry all the
genetic information to making all the proteins
required by the organism

• Use interactive human genome project

animation on kerboodle
 What is the HGP?
• International Scientific Research Project: at least 18 countries
US, UK, Japan, France, China, Germany, India, Cananda, NZ
• 13 years long (1990-2003)
• $3 billion project
• Collected blood (female) and sperm (male)
• Some people may view this as a waste of time and money
• The information could help doctors to work out their risk of
developing certain diseases e.g., cancer or heart disease and
possibly prescribe personalised medicines.
• However, some people are concerned that in the future they
could be asked to reveal this information in other situations
(e.g., when applying for a job).
 Aims of the HGP
• Identify all the approximately 20,000-25,000 genes in human DNA

• Determine the sequences of the 3 billion chemical base pairs that make
up human DNA

• To find the location of all the genes.

• To find the functions of different genes.

• To publish the results on a public database.

• Store this information in databases

• Improve tools for data analysis

 Task
• Complete Why does the genome matter
worksheet 13.4
 Exam question:
Explain the aims of the human genome (4
marks)

Extra challenge: Why do you think scientists also

sequenced the genomes of animals used for medical
research?
 Self-assessment: Model answer
• To identify all the genes in the human
genome.
• To find the location of all the genes.
• To determine the sequences of the base pairs
that make up the human DNA.
• To find the functions of different genes.
• To publish the results on a public database.
 Benefits of HGP
• Discovery of new genes • Forensics
linked to a disease
• Establish paternity
• Better medical management
• Pharmacogenomics
of genetic disorders >3000
disorders
• Better diagnostic tools
• Helps to trace human • Improved technology
migration patterns which will
help people discover their
ancestry
• Drug discovery/ gene therapy
• Insight into molecular
evolution
 Pharmacogenomics
• Definition: the study of how an individual's genetic inheritance
affects the body's response to drugs.
• Promise of tailor-made drugs

• Benefits might be:-

– More Powerful Medicines
– Better, Safer Drugs the First Time
– More Accurate Methods of Determining Appropriate Drug Dosages
– Advanced Screening for Disease
– Better Vaccines
– Improvements in the Drug Discovery and Approval Process
– Decrease in the Overall Cost of Health Care
 Ethical issues
List the key ethical issues raised by the Human
genome project.
 Ethical/Moral Issues
• Fairness in the use of genetic information
• Privacy and confidentiality
• Psychological impact and stigmatization
• Reproductive issues
• Clinical issues
• Uncertainties
• Conceptual and philosophical implications
• Health and environmental issues
• Commercialization of products
Potential disadvantages or ethical objections
posed by the HGP
• People may be put under undue pressure to not have
children or terminate pregnancies
• Increases pressure for germ line therapy to prevent
children inheriting genetic conditions
• Embryo has no choice/say in the matter
• May lead to discrimination with jobs
• May lead to serious issues with insurance
(life/medical/car etc.)
• May lead to ‘designer babies’ with selection for
specific fashionable/on a whim characteristics
Potential disadvantages or ethical objections
posed by the HGP
• Knowing something might happen may cause
psychological stress/ some may not want to know
(easier to cope if you don’t know in advance?)
• Human rights/personal freedom: intrusion,
infringement of civil liberties; who decides who
should have genetic tests? Who decides who has
access to/should have potentially expensive
treatment
• Data protection issues: who has access to your
genetic information?
 Exam Practice
• Explain why the Human Genome Project has helped
scientists come closer to developing genetic
engineering as a form of treatment for inherited
diseases like cystic fibrosis. 4 marks
• Challenge – Evaluate the uses of the Human Genome
project to society?
• It now only takes a few days to sequence a genome
and the technology is getting quicker and cheaper.
Ask the students to discuss in groups whether they
would want their genome sequenced and why?
 Exam Practice Feedback
• The human genome project sequenced all of the
genes in human DNA (1 mark)
• This allows us to compare a healthy person's DNA
with that of someone suffering from an inherited
condition, like cystic fibrosis (1 mark)
• If we can find the genes that have mutations in
them that have led to the disease (1 mark)
• These can be replaced with non-faulty versions so
that the disease can be cured (1 mark)
 Homework
Outcomes of the HGP
Using page 137-138 and the human genome
website:
http://www.genome.gov/25019879

Fill in your table about the outcomes of the human

genome project

• Due date:
 Plenary
Past paper questions:

1) The HGP is making it possible to identify people who may

be at risk of developing medical conditions such as heart
disease, cancer or diabetes. Reasons why identifying
people at risk might be of benefit to the people who are
tested. (2 marks)

2) Suggest two reasons why carriers of breast cancer genes

should not face discrimination when applying for jobs or
insurance. (2 marks
 Check your answers
1) To warn people at risk to make life style changes, e.g. quit
smoking, eat less saturated fat, do more exercise
• Gives people a more informed choice in how to plan their
lives
• To plan medical provision/monitoring for the individual
• To target drug treatment to delay onset/reduce symptoms
• To determine healthcare priorities

2) It is not their fault that they have the gene

• Most of us would prefer a society where such economic risks
were spread across all of us
• Such discrimination would reduce the encumber o people
going for testing, which could be fatal for them
• Having the gene does not mean you will necessarily develop
the disease.
 Outcomes Explanation

Detailed information about the

genome

Identification of new genes

Identification of new drug targets

Preventative medicine and

improved drug treatment

Understanding basic biology

Investigating evolution
 Outcomes of the HGP; Summary
Detailed information 30 000 – 40 000 genes
about the genome average human gene contains

3000 bases
non-coding sequences (junk DNA)

makes of 50%
1.4 millions locations of single

nucleotide polymorphisms
Identification of new breast cancer gene
genes total colour blindness gene

genes analysed for mutations

causing disease
Identification of new a molecule that a drug interacts


drug targets with

Preventative variation in base sequences may account
medicine and for why some people experience side
improved drug effects from drug therapies
treatment identification of mutations associated

with a particular disease allows patient to

make lifestyle changes or adopt
preventative drug therapy
Understanding receptor proteins in the sense of taste
basic biology post-production processing of proteins

Investigating repeat sequences replicate and insert

evolution themselves into the DNA modifying,
reshuffling and creating new genes
comparisons with the genome of other

organisms establishes evolutionary

pathways
 Resources
• http://www.teachersdomain.org/resource/tdc02.sci.life.gen.l
p_hgpwhat/
• http://www.ornl.gov/sci/techresources/Human_Genome/proj
ect/about.shtml
• http://www.ornl.gov/sci/techresources/Human_Genome/proj
ect/benefits.shtml
• http://www.genome.gov/25019879
• http://www.bio.davidson.edu/courses/genomics/method/sho
tgun.html
• http://www.ornl.gov/sci/techresources/Human_Genome/me
dicine/pharma.shtml
DNA & the Genome
Highlight key words in the information below:

DNA molecules are large and complex. They carry the

genetic code that determines the characteristics of a
living organism. Except for identical twins, each
person’s DNA is unique. This is why people can be
identified using DNA fingerprinting. DNA can be cut
up and separated, forming a sort of 'bar code' that is
different from one person to the next.

As embryos develop, some genes in cells are

turned off and some genes are turned on. This
allows cells to become specialised for particular
functions. What is a gene?
________________________________________
________________________________________
________________________________________
________________________________________
Describe where DNA is found in a human cell.
________________________________________
________________________________________
Complete the following sentence.
The letters A, C, G and T in the diagram represent
four different compounds called
________________________________________
Highlight key words in the information below:
Highlight key words in the information below:
Each strand of DNA is made of chemicals called
bases. Note that these are different to bases in
relation to acids and alkalis in chemistry. There are
four different bases in DNA:
• thymine, T
• adenine, A
• guanine, G
• cytosine, C
There are chemical cross-links between the two
strands in DNA, formed by pairs of bases. They
always pair up in a particular way, called
complementary base pairing:
• thymine pairs with adenine (T–A)
• guanine pairs with cytosine (G–C)

The genome of an organism is the entire genetic

material of that organism. Each of your diploid body
cells (not sperm, eggs or red blood cells) has one
copy of your entire genome.
The Human Genome Project started in 1990 and was
completed in 2003. Hundreds of scientists from
different universities all over the world collaborated
together to determine the sequence of base pairs
that made up the genome of a random man and
woman. There are more than three billion of these!
This was a huge moment in the history of biology,
and one that showed the importance of working
together and sharing scientific information.
The mapping of the whole human genome has great
importance for medicine. In order to exploit its
secrets, it is vital that the human genome is fully
understood.
What is the human genome project?
________________________________________
_______________________________________
Describe what we can find out from the human
genome project
________________________________________
________________________________________
________________________________________
________________________________________
________________________________________
________________________________________
________________________________________
________________________________________