Textbook Cellular Senescence Methods and Protocols Marco Demaria Ebook All Chapter PDF

Cellular Senescence: Methods and
Protocols Marco Demaria

Visit to download the full and correct content document:
https://textbookfull.com/product/cellular-senescence-methods-and-protocols-marco-d
emaria/
More products digital (pdf, epub, mobi) instant
download maybe you interests ...
Bacterial Pangenomics Methods and Protocols Second

Edition Alessio Mengoni Editor Giovanni Bacci Editor
Marco Fondi Editor
https://textbookfull.com/product/bacterial-pangenomics-methods-
and-protocols-second-edition-alessio-mengoni-editor-giovanni-
bacci-editor-marco-fondi-editor/
Zebrafish Methods and Protocols Koichi Kawakami
https://textbookfull.com/product/zebrafish-methods-and-protocols-
koichi-kawakami/
SNAREs: Methods and Protocols Rutilio Fratti
https://textbookfull.com/product/snares-methods-and-protocols-
rutilio-fratti/
Epitranscriptomics: Methods and Protocols Narendra

Wajapeyee
https://textbookfull.com/product/epitranscriptomics-methods-and-
protocols-narendra-wajapeyee/
Phytoplasmas: Methods and Protocols Rita Musetti
https://textbookfull.com/product/phytoplasmas-methods-and-
protocols-rita-musetti/
Metalloproteins: Methods and Protocols Yilin Hu
https://textbookfull.com/product/metalloproteins-methods-and-
protocols-yilin-hu/
Nanotoxicity: Methods and Protocols Qunwei Zhang
https://textbookfull.com/product/nanotoxicity-methods-and-
protocols-qunwei-zhang/
Autoantibodies: Methods and Protocols Gunnar Houen
https://textbookfull.com/product/autoantibodies-methods-and-
protocols-gunnar-houen/
Oligodendrocytes: Methods and Protocols David Lyons
https://textbookfull.com/product/oligodendrocytes-methods-and-
protocols-david-lyons/
Methods in
Molecular Biology 1896
Marco Demaria Editor
Cellular
Senescence
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire AL10 9AB, UK
For further volumes:

http://www.springer.com/series/7651
Cellular Senescence
Methods and Protocols
Edited by
Marco Demaria
ERIBA, University Medical Center Groningen, Groningen, Groningen, The Netherlands
Editor
Marco Demaria
ERIBA
University Medical Center Groningen
Groningen, Groningen, The Netherlands
ISSN 1064-3745 ISSN 1940-6029 (electronic)

ISBN 978-1-4939-8930-0 ISBN 978-1-4939-8931-7 (eBook)
https://doi.org/10.1007/978-1-4939-8931-7
Library of Congress Control Number: 2018962411
© Springer Science+Business Media, LLC, part of Springer Nature 2019

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.
The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
This Humana Press imprint is published by the registered company Springer Science+Business Media, LLC, part of
Springer Nature.
The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.
Preface
Cellular senescence is a state of irreversible growth arrest. Originally described as the

mechanism mediating the limited replicative lifespan of somatic cells, cellular senescence is
now recognized as a potent tumor-suppressive mechanism. Moreover, in recent years
advancements in the phenotypical characterization of senescent cells unraveled additional
functional roles, from development to aging. This book aims at describing current methods
for the identification and characterization of the major hallmarks of senescent cells. A strong
focus relies on the high heterogeneity of the senescence-associated phenotypes, and tech-
niques to induce and identify specific senescence programs. Moreover, it describes cellular
and mouse models in which it is possible to study the complex cell and non-cell autonomous
functions of senescent cells.
Groningen, Groningen, NL Marco Demaria
v
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
1 Detecting Cellular Senescence in Reprogramming . . . . . . . . . . . . . . . . . . . . . . . . . . 1

Coralie Cazin, Mathieu von Joest, and Han Li
2 DNA Damage In Situ Ligation Followed by Proximity Ligation
Assay (DI-PLA). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
Alessandro Galbiati and Fabrizio d’Adda di Fagagna
3 Reactive Oxygen Species Detection in Senescent Cells . . . . . . . . . . . . . . . . . . . . . . . 21
Stella Victorelli and João F. Passos
4 Cellular Identification and Quantification of Senescence-Associated
β-Galactosidase Activity In Vivo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Bennett G. Childs, Tyler J. Bussian, and Darren J. Baker
5 Relative Human Telomere Length Quantification by Real-Time PCR . . . . . . . . . 39
A. Vasilishina, A. Kropotov, I. Spivak, and A. Bernadotte
6 Assessing Functional Roles of the Senescence-Associated Secretory
Phenotype (SASP) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
Nicolas Malaquin, Véronique Tu, and Francis Rodier
7 Measuring the Inflammasome in Oncogene-Induced Senescence . . . . . . . . . . . . . 57
Irene Fernández-Duran, Núria Tarrats, Priya Hari,
and Juan Carlos Acosta
8 Alarmin Detection in Senescent Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71
Dong Eun Kim and Albert R. Davalos
9 IMR90 ER:RAS: A Cell Model of Oncogene-Induced Senescence . . . . . . . . . . . . 83
Andrew J. Innes and Jesús Gil
10 Genotoxic Stress-Induced Senescence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93
Dorothy N. Y. Fan and Clemens A. Schmitt
11 A Multiparametric Assay to Evaluate Senescent Cells . . . . . . . . . . . . . . . . . . . . . . . . 107
Hilah Gal, Ziv Porat, and Valery Krizhanovsky
12 A Novel Quantitative Method for the Detection of Lipofuscin,
the Main By-Product of Cellular Senescence, in Fluids . . . . . . . . . . . . . . . . . . . . . . 119
Sophia V. Rizou, Konstantinos Evangelou, Vassilios Myrianthopoulos,
Iordanis Mourouzis, Sophia Havaki, Aikaterini Athanasiou,
Panagiotis V. S. Vasileiou, Aggelos Margetis, Athanassios Kotsinas,
Nikolaos G. Kastrinakis, Petros Sfikakis, Paul Townsend,
Emmanuel Mikros, Constantinos Pantos, and Vassilis G. Gorgoulis
13 Measurement of Metabolite Changes in Senescent Cells
by Mass Spectrometry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 139
Christopher D. Wiley, Sonnet Davis, and Arvind Ramanathan
vii
viii Contents
14 Quantification of Autophagy During Senescence . . . . . . . . . . . . . . . . . . . . . . . . . . . 149

Joon Tae Park, Young-Sam Lee, and Sang Chul Park
15 Quantification of Aneuploidy in Mammalian Systems. . . . . . . . . . . . . . . . . . . . . . . . 159
Hilda van den Bos, Bjorn Bakker, Aaron Taudt, Victor Guryev,
Maria Colomé-Tatché, Peter M. Lansdorp, Floris Foijer,
and Diana C. J. Spierings
16 Identification of Genomic Alterations Through Multilevel
DNA Structural Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
Ryan K. Shultzaberger and John Dresios
17 Mouse Models of Accelerated Cellular Senescence . . . . . . . . . . . . . . . . . . . . . . . . . . 203
Matthew J. Yousefzadeh, Kendra I. Melos, Luise Angelini,
Christin E. Burd, Paul D. Robbins, and Laura J. Niedernhofer
18 Methods to Quantify the NF-κB Pathway During Senescence . . . . . . . . . . . . . . . . 231
Lei Zhang, Jing Zhao, Aditi Gurkar, Laura J. Niedernhofer,
and Paul D. Robbins
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
Contributors
JUAN CARLOS ACOSTA Edinburgh Cancer Research UK Centre, Institute of Genetics and
Molecular Medicine, University of Edinburgh, Edinburgh, UK
LUISE ANGELINI Institute on the Biology of Aging and Metabolism, University of Minnesota,
Minneapolis, MN, USA; Department of Biochemistry, Molecular Biology and Biophysics,
University of Minnesota, Minneapolis, MN, USA; Department of Molecular Medicine, The
Scripps Research Institute, Jupiter, FL, USA
AIKATERINI ATHANASIOU Department of Obstetrics and Gynecology, Weill Cornell Medicine,
New York, NY, USA
DARREN J. BAKER Department of Biochemistry and Molecular Biology, Mayo Clinic,
Rochester, MN, USA; Department of Pediatric and Adolescent Medicine, Mayo Clinic,
Rochester, MN, USA
BJORN BAKKER European Research Institute for the Biology of Ageing (ERIBA), University
of Groningen, University Medical Center Groningen, Groningen, The Netherlands
A. BERNADOTTE Faculty of Mechanics and Mathematics, Lomonosov Moscow State
University, Moscow, Russian Federation; Federal Research and Clinical Center of
Physical-Chemical Medicine of Federal Medical Biological Agency, Laboratory of Simple
Systems, Moscow, Russian Federation
CHRISTIN E. BURD Department of Molecular Genetics, The Ohio State University,
Columbus, OH, USA; Department of Cancer Biology and Genetics, The Ohio State
University, Columbus, OH, USA
TYLER J. BUSSIAN Department of Biochemistry and Molecular Biology, Mayo Clinic,
Rochester, MN, USA
CORALIE CAZIN Cellular Plasticity and Disease Modeling, Department of Developmental
and Stem Cell Biology, CNRS UMR 3738, Institut Pasteur, Paris, France
BENNETT G. CHILDS Department of Biochemistry and Molecular Biology, Mayo Clinic,
Rochester, MN, USA
MARIA COLOMÉ-TATCHÉ European Research Institute for the Biology of Ageing (ERIBA),
University of Groningen, University Medical Center Groningen, Groningen, The
Netherlands; Institute for Computational Biology, Helmholtz Zentrum München,
Neuherberg, Germany
ALBERT R. DAVALOS Buck Institute for Research on Aging, Novato, CA, USA
SONNET DAVIS Buck Institute for Research on Aging, Novato, CA, USA
FABRIZIO D’ADDA DI FAGAGNA IFOM-Foundation, The FIRC Institute of Molecular
Oncology Foundation, Milan, Italy; Istituto di Genetica Molecolare, Consiglio Nazionale
delle Ricerche, Pavia, Italy
JOHN DRESIOS Leidos Inc., San Diego, CA, USA
KONSTANTINOS EVANGELOU Molecular Carcinogenesis Group, Department of Histology and
Embryology, Medical School, National and Kapodistrian University of Athens, Athens,
Greece; Department of Anatomy-Histology-Embryology, Medical School, University of
Ioannina, Ioannina, Greece
DOROTHY N. Y. FAN Department of Hematology, Oncology and Tumor Immunology,
Molekulares Krebsforschungszentrum–MKFZ, Charité–University Medical Center, Berlin,
Germany; German Cancer Research Center (Deutsches Krebsforschungszentrum [DKFZ]),
ix
x Contributors
Heidelberg, Germany; Deutsches Konsortium für Translationale Krebsforschung (German

Cancer Consortium), Partner Site Berlin, Berlin, Germany
IRENE FERNÁNDEZ-DURAN Edinburgh Cancer Research UK Centre, Institute of Genetics
and Molecular Medicine, University of Edinburgh, Edinburgh, UK
FLORIS FOIJER European Research Institute for the Biology of Ageing (ERIBA), University
of Groningen, University Medical Center Groningen, Groningen, The Netherlands
HILAH GAL Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot,
Israel
ALESSANDRO GALBIATI Oncology IMED, AstraZeneca UK Ltd, Cambridge, UK
JESÚS GIL MRC London Institute of Medical Sciences (LMS), London, UK; Faculty of
Medicine, Institute of Clinical Sciences (ICS), Imperial College London, London, UK
VASSILIS G. GORGOULIS Molecular Carcinogenesis Group, Department of Histology and
Greece; Faculty Institute for Cancer Sciences, Manchester Academic Health Sciences Centre,
University of Manchester, Manchester, UK; Biomedical Research Foundation, Academy of
Athens, Athens, Greece; Center for New Biotechnologies and Precision Medicine, Medical
School, National and Kapodistrian University of Athens, Athens, Greece
ADITI GURKAR Department of Molecular Medicine and Center on Aging, The Scripps
Research Institute, Jupiter, FL, USA; Aging Institute, Division of Geriatric Medicine,
Department of Medicine, University of Pittsburgh, Pittsburgh, PA, USA
VICTOR GURYEV European Research Institute for the Biology of Ageing (ERIBA),
Netherlands
PRIYA HARI Edinburgh Cancer Research UK Centre, Institute of Genetics and Molecular
Medicine, University of Edinburgh, Edinburgh, UK
SOPHIA HAVAKI Molecular Carcinogenesis Group, Department of Histology and Embryology,
Medical School, National and Kapodistrian University of Athens, Athens, Greece
ANDREW J. INNES MRC London Institute of Medical Sciences (LMS), London, UK; Faculty
of Medicine, Institute of Clinical Sciences (ICS), Imperial College London, London, UK;
Faculty of Medicine, Centre for Haematology, Imperial College London, London, UK
NIKOLAOS G. KASTRINAKIS Molecular Carcinogenesis Group, Department of Histology and
Greece
DONG EUN KIM Buck Institute for Research on Aging, Novato, CA, USA
ATHANASSIOS KOTSINAS Molecular Carcinogenesis Group, Department of Histology and
Greece
VALERY KRIZHANOVSKY Department of Molecular Cell Biology, Weizmann Institute of
Science, Rehovot, Israel
A. KROPOTOV Institute of Cytology, Russian Academy of Sciences, Saint-Petersburg, Russian
Federation
PETER M. LANSDORP European Research Institute for the Biology of Ageing (ERIBA),
Netherlands; Terry Fox Laboratory, BC Cancer Agency, Vancouver, BC, Canada;
Department of Medical Genetics, University of British Columbia, Vancouver, BC, Canada
YOUNG-SAM LEE Well Aging Research Center, DGIST, Daegu, South Korea; Department of
New Biology, DGIST, Daegu, South Korea
Contributors xi
HAN LI Cellular Plasticity and Disease Modeling, Department of Developmental and Stem
Cell Biology, CNRS UMR 3738, Institut Pasteur, Paris, France
NICOLAS MALAQUIN Centre de Recherche du CHUM (CRCHUM) and Institut du Cancer
de Montréal, Montreal, QC, Canada
AGGELOS MARGETIS Molecular Carcinogenesis Group, Department of Histology and
Greece
KENDRA I. MELOS Department of Molecular Medicine, The Scripps Research Institute,
Jupiter, FL, USA
EMMANUEL MIKROS Division of Pharmaceutical Chemistry, School of Pharmacy, National
and Kapodistrian University of Athens, Athens, Greece; PharmaInformatics Unit, Athena
Research Center, Athens, Greece
IORDANIS MOUROUZIS Department of Pharmacology, Medical School, National and
Kapodistrian University of Athens, Athens, Greece
VASSILIOS MYRIANTHOPOULOS Division of Pharmaceutical Chemistry, School of Pharmacy,
National and Kapodistrian University of Athens, Athens, Greece; PharmaInformatics
Unit, Athena Research Center, Athens, Greece
LAURA J. NIEDERNHOFER Institute on the Biology of Aging and Metabolism, University of
Minnesota, Minneapolis, MN, USA; Department of Molecular Medicine and Center on
Aging, The Scripps Research Institute, Jupiter, FL, USA
CONSTANTINOS PANTOS Department of Pharmacology, Medical School, National and
Kapodistrian University of Athens, Athens, Greece
JOON TAE PARK Division of Life Sciences, College of Life Sciences and Bioengineering,
Incheon National University, Incheon, South Korea
SANG CHUL PARK Well Aging Research Center, DGIST, Daegu, South Korea; The Future
Life and Society Research Center, Chonnam National University, Gwangju, South Korea
JOÃO F. PASSOS Newcastle University Institute for Ageing, Newcastle University, Newcastle
upon Tyne, UK; Institute for Cell and Molecular Biosciences, Newcastle University,
Newcastle upon Tyne, UK; Ageing Research Laboratories, Campus for Ageing and Vitality,
Newcastle University, Newcastle upon Tyne, UK
ZIV PORAT Flow Cytometry Unit, Life Sciences Core Facilities, Weizmann Institute of
Science, Rehovot, Israel
ARVIND RAMANATHAN Buck Institute for Research on Aging, Novato, CA, USA
SOPHIA V. RIZOU Molecular Carcinogenesis Group, Department of Histology and
Greece
PAUL D. ROBBINS Institute on the Biology of Aging and Metabolism, University of
Minnesota, Minneapolis, MN, USA; Department of Biochemistry, Molecular Biology and
Biophysics, University of Minnesota, Minneapolis, MN, USA; Department of Molecular
Medicine and Center on Aging, The Scripps Research Institute, Jupiter, FL, USA
FRANCIS RODIER Centre de Recherche du CHUM (CRCHUM) and Institut du Cancer de
Montréal, Montreal, QC, Canada; Département de Radiologie, Radio-Oncologie et Mé
decine Nucléaire, Université de Montréal, Montreal, QC, Canada
CLEMENS A. SCHMITT Department of Hematology, Oncology and Tumor Immunology,
Molekulares Krebsforschungszentrum–MKFZ, Charité–University Medical Center, Berlin,
Germany; Deutsches Konsortium für Translationale Krebsforschung (German Cancer
Consortium), Partner Site Berlin, Berlin, Germany; Max-Delbrück-Center for Molecular
Medicine, Berlin, Germany
xii Contributors
PETROS SFIKAKIS First Department of Propaedeutic Internal Medicine and Rheumatology

Unit, Medical School, National and Kapodistrian University of Athens, Athens, Greece
RYAN K. SHULTZABERGER Leidos Inc., San Diego, CA, USA
DIANA C. J. SPIERINGS European Research Institute for the Biology of Ageing (ERIBA),
Netherlands
I. SPIVAK Institute of Cytology, Russian Academy of Sciences, Saint-Petersburg, Russian
Federation
NÚRIA TARRATS Edinburgh Cancer Research UK Centre, Institute of Genetics and
Molecular Medicine, University of Edinburgh, Edinburgh, UK
AARON TAUDT European Research Institute for the Biology of Ageing (ERIBA), University
of Groningen, University Medical Center Groningen, Groningen, The Netherlands;
Institute for Computational Biology, Helmholtz Zentrum München, Neuherberg, Germany
PAUL TOWNSEND Faculty Institute for Cancer Sciences, Manchester Academic Health
Sciences Centre, University of Manchester, Manchester, UK
VÉRONIQUE TU Centre de Recherche du CHUM (CRCHUM) and Institut du Cancer de
Montréal, Montreal, QC, Canada
HILDA VAN DEN BOS European Research Institute for the Biology of Ageing (ERIBA),
Netherlands
PANAGIOTIS V. S. VASILEIOU Molecular Carcinogenesis Group, Department of Histology and
Greece
A. VASILISHINA Institute of Cytology, Russian Academy of Sciences, Saint-Petersburg,
Russian Federation
STELLA VICTORELLI Newcastle University Institute for Ageing, Newcastle University,
Newcastle upon Tyne, UK; Institute for Cell and Molecular Biosciences, Newcastle
University, Newcastle upon Tyne, UK; Ageing Research Laboratories, Campus for Ageing
and Vitality, Newcastle University, Newcastle upon Tyne, UK
MATHIEU VON JOEST Cellular Plasticity and Disease Modeling, Department of
Developmental and Stem Cell Biology, Institut Pasteur, Paris, France
CHRISTOPHER D. WILEY Buck Institute for Research on Aging, Novato, CA, USA
MATTHEW J. YOUSEFZADEH Institute on the Biology of Aging and Metabolism, University of
Minnesota, Minneapolis, MN, USA; Department of Biochemistry, Molecular Biology and
Biophysics, University of Minnesota, Minneapolis, MN, USA; Department of Molecular
Medicine, The Scripps Research Institute, Jupiter, FL, USA
LEI ZHANG Department of Molecular Medicine and Center on Aging, The Scripps Research
Institute, Jupiter, FL, USA
JING ZHAO Department of Molecular Medicine and Center on Aging, The Scripps Research
Institute, Jupiter, FL, USA; Disease Biology and Cellular Pharmacology, Recursion
Pharmaceuticals, Salt Lake, UT, USA
Chapter 1
Detecting Cellular Senescence in Reprogramming

Coralie Cazin, Mathieu von Joest, and Han Li
Abstract
Cellular senescence has been suggested to facilitate tissue regeneration via promoting cellular plasticity.
Here, we describe multiple systems, both in vitro and in vivo, to detect senescence in the context of cellular
reprogramming.
Key words Cellular senescence, Reprogramming, Cellular plasticity, SA-β-Gal
1 Introduction
Cellular senescence is a stable cell cycle arrest caused by stresses

during various biological and pathological conditions [1–3]. Inter-
estingly, these cells remain metabolically active and secrete a vast
number of factors including cytokines, chemokines as well as
growth factors, which is collectively termed as SASP (senescence
associated secretory phenotype). Senescent cells have multifaceted
capabilities and are involved in a wide range of physiological and
pathological processes, such as development, cancer, and aging
[2, 4, 5]. More recently, growing evidence indicates that senescent
cells might facilitate tissue repair and regeneration [6, 7].
Cellular plasticity is the capacity of a cell to change its identity.
Nuclear reprogramming presents one of the best examples of cellu-
lar plasticity. Somatic cells can be reprogrammed into a pluripotent
stage via forced expression of the Yamanaka factors (Oct4, Sox2,
Klf4, and c-Myc (OSKM)). The induced pluripotent stem cells
(iPSCs) can be obtained both in vitro and in vivo [8, 9].
Senescence is important for cellular plasticity. It is a cell-
intrinsic barrier for reprogramming [10]. However, recent studies
suggest senescent cells could promote cellular plasticity extrinsically
to facilitate tissue regeneration via SASPs [11–13].
Coralie Cazin and Mathieu von Joest contributed equally and should be considered co-first authors.
Marco Demaria (ed.), Cellular Senescence: Methods and Protocols, Methods in Molecular Biology, vol. 1896,
https://doi.org/10.1007/978-1-4939-8931-7_1, © Springer Science+Business Media, LLC, part of Springer Nature 2019
1
2 Coralie Cazin et al.
Taken together, the emerging data highlights the importance

of investigating cellular senescence, particularly in vivo senescence,
in a context-dependent manner. Here, we present various protocols
to investigate the impact of cellular senescence on cellular plasticity,
both in vitro and in vivo. First, we will introduce the system to
study the impact of cellular senescence on in vitro reprogramming.
Next, we will describe how to detect senescent cells in two tissues
with different susceptibility to in vivo reprogramming: liver (per-
missive) and skeletal muscle (nonpermissive) [11, 12]. SA-β-Gal
assay and antibody immunostaining are used together to detect
senescent cells. Nanog, a marker of pluripotency, is used to evaluate
in vivo reprogramming in the liver and skeletal muscle.
2 Materials
Prepare all the solutions using sterile water. All the reagents are
prepared and stored at room temperature (unless indicated
otherwise).
2.1 Generation 1. Mouse Embryonic Fibroblasts (MEFs) [14].

of Senescent Cells 2. Mouse embryo fibroblast (MEF) Medium: Dulbecco’s mod-
ified Eagle Medium (DMEM) with high glucose (4.5 g/L),
10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin.
3. Phosphate-buffered saline (PBS), autoclaved.
4. 0.05% trypsin–EDTA solution
5. 1 mg/mL mitomycin C (MMC) stock solution, filtered and
stored at 20 C.
6. X-ray irradiator (Optional).
7. 0.2 μm filters
8. Tissue culture plates: 100-mm and150-mm.
9. Conical centrifuge tubes: 15-mL and 50-mL.
10. Centrifuge.
11. Phase-contrast inverted light microscope.
12. CO2 tissue culture incubator.
13. Laminar flow hood with standard tissue culture setup.
2.2 In Vitro 1. Reprogramming medium: Dulbecco’s modified Eagle Medium

Reprogramming (DMEM) with high glucose (4.5 g/L), 15% Knock-Out Serum
Replacement (KSR), 2 mm GlutaMAX, 0.1 mm nonessential
amino acids, 0.1 mm 2-mercaptoetanol, 100 U/mL penicillin,
and 100 μg/mL streptomycin, 1000 U/mL mouse leukemia
inhibitory factor (LIF).
2. HEK 293T cells.
3. Wild-type (WT) MEFs.
Detecting Cellular Senescence in Reprogramming 3
4. 1 mg/mL doxycycline.
5. X-tremeGene HP DNA transfection reagent (Roche).
6. Polybrene stock solution (8 mg/mL).
7. Retroviral vectors: pMXs-c-Myc, Addgene: 13375; pMXs-
Klf4, Addgene: 13370; pMXs-Sox2, Addgene: 13367; pMXs-
Oct3/4, Addgene: 13366), pCL-Eco, Addgene: 12371; con-
trol retroviral vector containing GFP.
8. Syringes.
9. 0.45 μm filters.
10. Aluminum foil.
11. Lab Rocker.
12. 4% paraformaldehyde (PFA)
13. Alkaline phosphatase detection kit.
2.3 SA-β-Gal 1. SA-β-Gal fixation solution: 2% formaldehyde and 0.2% glutar-

Staining aldehyde in PBS.
2. 0.4 m citric acid/phosphate buffer (pH ¼ 6.0): resuspend
sodium phosphate dibasic (Na2HPO4) and citric acid mono-
hydrate in water. Add 36.85 mL of 0.1 m citric acid to
63.15 mL 0.2 m dibasic sodium phosphate. Mix and adjust
pH to 6 with citric acid if necessary (see Note 1).
3. X-Gal: Dissolve the X-Gal powder in dimethylformamide
(DMF) and store in 20 C (see Note 2).
4. X-Gal solution: 40 mm Citric acid/phosphate buffer, 150 mm
NaCl, 2 mm MgCl2 (Store at RT.), 4 mm K3Fe(CN)6 (Store at
4 C), 4 mm K4Fe(CN)6 ((Store at 4 C), 1 mg/mL X-Gal in
water, freshly made upon usage in a tube wrapped with alumi-
num foil (see Note 3).
5. X-Gal solution-muscle specific: 4 mm K3Fe(CN)6, 4 mm K4Fe
(CN)6, 2 mm MgCl2, 0.01% NP-40, and 400 μg/mL X-Gal in
PBS, pH ¼ 5.5 in a tube wrapped with aluminum foil
(see Note 4).
6. 0.2% (Eosin) (see Note 5).
7. 37 C incubator.
2.4 ARF and Ki67 1. PFA fixation solution: PBS containing 4% paraformaldehyde.
Staining 2. Permeabilization solution: 0.1% NaCitrate, 0.5% Triton X-100
in water (see Note 4).
3. Blocking solution: 10% FBS, 3% BSA, 0.5% Triton X-100 in
PBS. Stored at 4 C (see Note 5).
4. PBS-0.5% Tween 20: PBS containing 0.5% Tween 20.
5. Antibodies: Ki67 (Abcam, ab15580); p19Arf (Santa Cruz Bio-
technology, 5-C3-1).
6. 3,30 -diaminobenzidine (DAB) dilution: dilute the 3,30 -diamino-

benzidine (DAB) in the buffer solution from the kit
(DAB+ + substrate buffer). 20 μL of DAB for 1 mL of buffer
solution.
2.5 NANOG Staining 1. PFA fixation solution: PBS containing 4% paraformaldehyde.

2. Permeabilization solution: 0.1% NaCitrate, 0.1%Triton X-100
in water. Store at RT.
3. Blocking solution: 5% FBS in PBS (see Note 6).
4. Nanog antibody (Cell Signaling, 8822S).
5. EnVision+ Kits (HRP. Rabbit. DAB+) Dako K4010.
2.6 In Vivo 1. Reprogrammable mouse model [8].

Reprogramming 2. Doxycycline (1 mg/mL) (Sigma 24390-14-5).
3. Cardiotoxin (Lotaxan Valence, France). Stock solution
(40 μm): 1 mg in 3676 μL of 0.9% NaCl, 50 μL/aliquot,
store at 20 C. Working solution (10 μm): add 150 μL of
0.9% NaCl to 50 μL stock aliquot on ice at the day of the injury.
Inject 40 μL /TA.
4. 0.3 mL needles: 29G 1/200 –0.33 12 mm.
3 Methods
3.1 Evaluation Caution: All steps have to be performed in a sterile flow hood.
the Impact of Cellular
Senescence on In Vitro
Reprogramming
3.1.1 Generating 1. Culture and expand MEFs: Thaw one vial of MEFs in one
Senescent MEFs 100-mm tissue culture plate. Once cells are confluent, pass
them into one 150-mm tissue culture plate. Pass cells again
into five 150-mm tissue culture plates. When cells are conflu-
ent, induce senescence either with MMC treatment or
irradiation.
2. MMC treatment induced senescence: Add 1 mg/mL MMC
stock solution directly into the MEF medium to a final concen-
tration of 10 μg/mL. Treat the cells with MMC for 3 h in the
incubator.
3. Washing the cells with PBS twice to remove MMC. Trypsinize
the cells and resuspend them in MEF medium and count.
4. Seed the cells at the density of 2.8 104 cells/cm2 (for exam-
ple seed 1.5 106 cells in 100-mm tissue culture plate) and
culture in MEF medium. Cells will become senescence after
48 h and can be confirmed by SA-β-Gal staining.
5. γ-Irradiation induced senescence (Optional): After step 1, cells

can also be trypsinized and resuspended in MEF medium,
adjusting the concentration to 2–6 107 cells/mL. Gently
mix the cells and irradiate them for total 3000 rad. After the
irradiation, cells can be used directly as step 4, or kept frozen
for future use.
3.1.2 SA-β-Gal Staining 1. Remove medium and wash MEFs twice with PBS. Add
SA-β-Gal fixation solution to the plate and make sure the
solution covers the surface completely. Incubate at room tem-
perature for 15 min.
2. Aspirate the fixation solution and wash three times with PBS.
Incubate cells with freshly made SA-β-Gal solution overnight at
37 C, protected from light.
3. Remove the solution completely and wash the plates with
running water. Plates can be stored in PBS at 4 C up to
1 week, protected from light.
3.1.3 In Vitro 1. Generating senescence conditional Medium (CM): Incubate

Reprogramming senescent cells with reprogrammable medium w/o LIF
with Senescence- (10 mL medium for 100-mm plate). Collect the CM every
Conditional Medium 24 h and replace with 10 mL fresh reprogrammable medium
w/o LIF. CM can be collected for 5 days. Filter the collected
CM using 0.2 μm filter. CM can be used directly or kept at
20 C.
2. Reprogramming MEFs with retroviral infection: in vitro repro-
gramming is performed as described previously [15]. Day 1:
Seed 5 106 293T cells in one 100-mm plate.
3. Day 2: Transfect 293T cells using X-treme Gene HP transfec-
tion reagent and pMXs-vectors. Mix 4 μg of individual pMXs
plasmid or control vector (e.g., pMSCV Puro IRES GFP) with
4 μg of pCLEco. Incubate the plasmids mix with 8 μL of
X-treme Gene HP transfection reagent and 594 μL of
DMEM (DNA: transfection reagent ¼ 1:1) at RT for 30 min.
Add one plasmids mix onto one plate of 293T cells.
4. Day 3: Change the medium of HEK293T cells using MEF
medium. On the same day, seed 5 105 WT MEFs/100-mm
plate in MEF medium.
5. Day 4–5: retrovirus infection of MEFs. Collect medium from
every 293T plate in separate falcon tubes and replace with
10 mL of fresh MEF medium. Centrifuge the collected
medium at 250 g for 5 min at RT. Pass the medium through
0.45 μm filters and add Polybrene to the final concentration of
8 μg/mL. Mix the factors (2 mL of every factor/plate) first in a
falcon tube then add the mix onto WT MEFs. Perform four
rounds of infection in total, 12 h interval.
6. Day 6: Seed the infected MEFs onto 35-mm plates in MEF

medium. The amount of MEFs seeded should yield 20–40
clones per plate, which dependent on the infection and repro-
gramming efficiency. It is advised to determine these para-
meters prior to the experiment.
7. Day 7: Replace the medium to CM medium supplemented
with LIF (1000 U/mL) to start reprogramming.
8. Change the medium every 2 days. iPSCs colonies should be
clearly visible under the microscope after 2 weeks.
9. Quantification of iPSCs: Once the colonies are clearly visible,
the plates are processed for alkaline phosphatase (AP) staining
according to the manufacturer’s protocol. Quantification can
be done either manually or with image J software.
3.2 Evaluation 1. Fix the sections for 4 min in fixation solution, at RT (see Note
the Impact of Cellular 7). Wash the sections with PBS three times, 5 min each time.
Senescence on In Vivo 2. Incubate the sections in the X-gal solution at 37 C overnight
Reprogramming (see Note 8). Wash the sections with PBS three times, 10 min
3.2.1 SA-β-Gal Staining
each time.
on Frozen Liver Section 3. Post-fixed in 1% paraformaldehyde in PBS for 30 min, at RT
(see Note 7). Wash the sections with PBS three times, 10 min
each time.
4. Mount the slides with PBS containing 20% glycerol.
3.2.2 SA-β-Gal Staining The tibialis anterior (TA) muscles of reprogrammable mice are
on Frozen Muscle injured with cardiotoxin and treated with doxycycline (1 mg/mL)
Section [16] in the drinking water for 7 days to induce both senescence and
reprogramming in vivo. TA muscles are harvested and prepared as
described elsewhere [16].
1. Fix the sections for 4 min in fixation solution, at RT (see Note
7). Wash the sections with PBS three times, 5 min every time.
2. Incubate sections for 30 min in PBS pH ¼ 5.5 (see Note 9).
3. Incubate sections in the X-gal solution muscle specific at 37 C
for at least 24 h protected from light (see Note 10). Wash the
sections with PBS three times, 10 min every time.
If only SA-β-Gal staining is desired, continue with the next steps.
If costaining with Ki67 is desired, please forward to Subheading
3.2.4. If costaining with Nanog is desired, please forward to Subhead-
ing 3.2.5.
4. Post-fix in 1% paraformaldehyde in PBS for 30 min, at RT (see
Note 7). Wash the sections with PBS three times, 10 min
each time.
5. Counterstain with 0.2% eosin at RT. Immerse the slides in the

eosin solution for 1 min and rinse them with water briefly (see
Note 11).
6. Mount the slides with PBS containing 20% glycerol (see Note 12).
7. Post-fix in 1% paraformaldehyde in PBS for 30 min, at RT (see
Note 7). Wash the sections with PBS three times, 10 min
every time.
8. Counterstain with 0.2% eosin at RT. Immerse the slides in the
eosin solution for 1 min and rinse them with water briefly (see
Note 11).
9. Mount the slides with PBS containing 20% glycerol (see Note 12).
3.2.3 Immunostaining 1. Fix the slides with PFA fixation solution for 10 min at RT (see
Using Anti-p19ARF Note 7). Wash the sections with PBS three times, 10 min
each time.
2. Add 200 μL of the permeabilization solution directly onto the
slides and incubate at RT for 5 min. Wash the sections with
PBS-Tween 20 twice, 5 min each time.
3. Add 200 μL of blocking solution directly on the slides for
30 min at RT.
4. Incubate with the primary antibodies: 2 μg/mL of Ki-67 or
0.8 μg/mL of p19Arf overnight at 4 C in the blocking solu-
tion (see Note 13). Wash the sections with PBS, 10 min
each time.
5. Wash with 200 μL PBS containing 0.25% BSA on slides at RT
for 5 min (see Note 14).
6. Incubate with the secondary antibody in blocking solution for
1 h at RT (see Note 15). Wash the sections with PBS for three
times, 5 min each time.
7. Mount the slides with aqueous nonfluorescing mounting
medium.
3.2.4 Immuno- 1. Fix the slides with PFA fixation solution for 10 min at RT (see
histochemistry Using Note 7). Wash the sections with PBS three times, 10 min
Anti-Ki67 each time.
2. Add 200 μL of the permeabilization solution directly onto the
slides and incubate at RT for 5 min. Wash the sections with
PBS-0.5% Tween 20 twice, 5 min each time.
3. Add 200 μL of blocking solution directly on the slides for
30 min at RT.
4. Adding 100 μL of rAb-HRP from Dako kit (ready to use) for
45 min at RT (see Note 15). Wash the sections with PBS three
times, 5 min each time.
5. Dilute DAB in the buffer solution (see Note 16).
6. Visualization: add 100 μL of DAB previously diluted (see Note

16) on every slide up to 10 min at RT. Observe the slides under
the microscope (see Note 17). Stop the reaction by washing
with water.
3.2.5 Immuno- 1. Fix the slides with PBS containing 4% paraformaldehyde for
histochemistry Using 10 min, at RT (see Note 7). Wash the sections with PBS twice,
Anti-NANOG Antibody 10 min each time.
on Frozen Tissue Sections 2. Add 200 μL of the permeabilization solution directly onto the
slides and incubate at RT for 5 min. Wash the sections with PBS
twice, 5 min each time.
3. Wash the sections with 200 μL PBS containing 0.25% BSA
directly on slides at RT for 5 min (see Note 14).
4. Incubate the slides with 1.25 μg/mL of Nanog antibody over-
night at 4 C in PBS containing 5% FBS (see Note 15). Wash
the sections with PBS twice, 10 min each time.
5. Wash with 200 μL PBS containing 0.25% BSA on the slides at
RT for 5 min (see Note 14).
6. Incubate with the secondary antibody by adding 100 μL of
rAb-HRP from Dako kit for 45 min at RT (see Note 15). Wash
the sections with PBS three times, 5 min each time.
7. Dilute DAB in the buffer solution (see Note 16).
8. Visualization: add 100 μL of DAB solution on every slide up
to 10 min at RT. Observe the slides under the microscope (see
Note 17). Stop the reaction by washing with water.
9. Counterstain with Fast red solution for 20 min, at RT (see
Note 11). Wash with water briefly.
10. Dehydrate with 95% ethanol for 5 min followed with 100%
ethanol, 2 5 min.
11. Mount the slides with quick-hardening mounting medium.
4 Notes
1. The citric acid–phosphate buffer can be stored at 4 C. Adjust-

ing the pH is a crucial step for staining.
2. The X gal can be stored in aliquot, protected from light, at
20 C up to 6 months.
3. The K3Fe(CN)6 solution and K4Fe(CN)6 solution can be
stored at 4 C but they need to be protected from light.
4. We find that this solution works better for the muscle
cryosections.
5. Eosin solution can be kept at RT and reused after filtering if

necessary.
6. Blocking solutions can be filtered through a 0.45 μm filter,
aliquoted and stored at 20 C. It can be stored at 4 C for
6 months.
7. Perform the fixation under the hood. Do not fix longer to
maintain a proper staining and let the enzymatic reactions
occur for a proper SA-β-Gal staining. It is essential to perform
the post-fixation for SA-β-Gal staining alone for a good con-
servation of the staining.
8. Make sure that the temperature is at 37 C and that slides are
protected from light overnight.
9. Adjusting the pH is a crucial step for staining. Use a magnetic
stir bar to obtain the correct pH of the final solution.
10. The incubation requires minimal 24 h and can last for 48 h to
maximize the SA-β-Gal signal. The solution needs to be
changed after 24 h incubation.
11. Eosin solution and fast red solution can be kept at RT and
reused after filtering if necessary. Incubation time can be
adjusted depending on the intensity wanted. Slides should be
analyzed quickly after mounting for eosin counterstaining
because the eosin is soluble in water and the counterstaining
will be weaker with time. We choose eosin because SA-β-Gal
staining is not stable in water.
12. For a longer conservation, you can mount the slides with
aqueous nonfluorescing mounting medium.
13. Incubate slides in a box with wet paper towel to prevent
evaporation.
14. We find that it is best to prepare this fresh each time.
15. Incubate slides in a box with wet paper towel to prevent
evaporation and protect from light.
16. Freshly prepared and the diluted DAB solution is stable up to
1 week at 4 C.
17. The incubation time can be adjusted to minimize the back-
ground but have to be the same for all the slides.
References
1. Baker DJ, Wijshake T, Tchkonia T, LeBrasseur 2. Munoz-Espin D, Canamero M, Maraver A,

NK, Childs BG, van de Sluis B, Kirkland JL, Gomez-Lopez G, Contreras J, Murillo-Cuesta-
van Deursen JM (2011) Clearance of S, Rodriguez-Baeza A, Varela-Nieto I,
p16Ink4a-positive senescent cells delays Ruberte J, Collado M, Serrano M (2013) Pro-
ageing-associated disorders. Nature 479 grammed cell senescence during mammalian
(7372):232–236. https://doi.org/10.1038/ embryonic development. Cell 155
nature10600 (5):1104–1118. https://doi.org/10.1016/j.
cell.2013.10.019
3. Serrano M, Lin AW, McCurrach ME, Beach D, M (2009) The Ink4/Arf locus is a barrier for
Lowe SW (1997) Oncogenic ras provokes pre- iPS cell reprogramming. Nature 460
mature cell senescence associated with accumu- (7259):1136–1139. https://doi.org/10.
lation of p53 and p16INK4a. Cell 88 1038/nature08290
(5):593–602 11. Chiche A, Le Roux I, von Joest M, Sakai H,
4. Liu D, Hornsby PJ (2007) Senescent human Aguin SB, Cazin C, Salam R, Fiette L,
fibroblasts increase the early growth of xeno- Alegria O, Flamant P, Tajbakhsh S, Li H
graft tumors via matrix metalloproteinase (2017) Injury-induced senescence enables
secretion. Cancer Res 67(7):3117–3126. in vivo reprogramming in skeletal muscle. Cell
https://doi.org/10.1158/0008-5472.CAN- Stem Cell 20(3):407–414 e404. https://doi.
06-3452 org/10.1016/j.stem.2016.11.020
5. van Deursen JM (2014) The role of senescent 12. Mosteiro L, Pantoja C, Alcazar N, Marion RM,
cells in ageing. Nature 509(7501):439–446. Chondronasiou D, Rovira M, Fernandez-
https://doi.org/10.1038/nature13193 Marcos PJ, Munoz-Martin M, Blanco-
6. Demaria M, Ohtani N, Youssef SA, Rodier F, Aparicio C, Pastor J, Gomez-Lopez G, De
Toussaint W, Mitchell JR, Laberge RM, Vijg J, Martino A, Blasco MA, Abad M, Serrano M
Van Steeg H, Dolle ME, Hoeijmakers JH, de (2016) Tissue damage and senescence provide
Bruin A, Hara E, Campisi J (2014) An essential critical signals for cellular reprogramming
role for senescent cells in optimal wound heal- in vivo. Science 354(6315). https://doi.org/
ing through secretion of PDGF-AA. Dev Cell 10.1126/science.aaf4445
31(6):722–733. https://doi.org/10.1016/j. 13. Ritschka B, Storer M, Mas A, Heinzmann F,
devcel.2014.11.012 Ortells MC, Morton JP, Sansom OJ, Zender L,
7. Yun MH, Davaapil H, Brockes JP (2015) Keyes WM (2017) The senescence-associated
Recurrent turnover of senescent cells during secretory phenotype induces cellular plasticity
regeneration of a complex structure. Elife and tissue regeneration. Genes Dev 31
4. https://doi.org/10.7554/eLife.05505 (2):172–183. https://doi.org/10.1101/gad.
8. Abad M, Mosteiro L, Pantoja C, Canamero M, 290635.116
Rayon T, Ors I, Grana O, Megias D, 14. Conner DA (2001) Mouse embryo fibroblast
Dominguez O, Martinez D, Manzanares M, (MEF) feeder cell preparation. Curr Protoc
Ortega S, Serrano M (2013) Reprogramming Mol Biol Chapter 23:Unit 23 22. https://doi.
in vivo produces teratomas and iPS cells with org/10.1002/0471142727.mb2302s51
totipotency features. Nature 502 15. Han L, Strati K, Domı́nguez V, Martı́n J,
(7471):340–345. https://doi.org/10.1038/ Blasco M, Serrano M, Ortega S (2001)
nature12586 Induced pluripotency: generation of iPS cells
9. Takahashi K, Yamanaka S (2006) Induction of from mouse embryonic fibroblasts. ISTT man-
pluripotent stem cells from mouse embryonic ual Chapter 23. doi: https://doi.org/10.
and adult fibroblast cultures by defined factors. 1007/978-3-642-20792-1_20
Cell 126(4):663–676. https://doi.org/10. 16. Cazin C, Chiche A, Li H (2017) Evaluation of
1016/j.cell.2006.07.024 injury-induced senescence and in vivo repro-
10. Li H, Collado M, Villasante A, Strati K, gramming in the skeletal muscle. J Vis Exp
Ortega S, Canamero M, Blasco MA, Serrano (128). https://doi.org/10.3791/56201
Chapter 2
DNA Damage In Situ Ligation Followed by Proximity

Ligation Assay (DI-PLA)
Alessandro Galbiati and Fabrizio d’Adda di Fagagna
Abstract
Cells have evolved DNA repair mechanisms to maintain their genetic information unaltered and a DNA
damage response pathway that coordinates DNA repair with several cellular events. Despite a clear role for
DNA damage in the form of DNA double-strand breaks (DSBs) in several cellular processes, the most
commonly used methods to detect DNA lesions are indirect, and rely on antibody-based recognition of
DNA damage-associated factors, leaving several important questions unanswered. Differently, here we
describe DNA damage In situ ligation followed by Proximity Ligation Assay (DI-PLA), that allows sensitive
detection of physical DSBs in fixed cells, through direct labeling of the DSBs with biotinylated oligonu-
cleotides, and subsequent signal amplification by PLA between biotin and a partner protein in the proximity
of the DNA break.
Key words DI-PLA, PLA, Single-cell, Imaging, DNA damage response (DDR), DNA damage, DNA
double-strand break (DSB)
1 Introduction
Genomes are constantly subjected to a plethora of stimuli that can

lead to DNA damage, which, in turn, alters the genomic structure
and the genetic information encoded within. Among the different
types of DNA lesions, DNA double-strand breaks (DSBs) are par-
ticularly cytotoxic, because, if unrepaired before cell division, can
lead to the loss of critical genetic information and to chromosomal
rearrangements. In order to repair different kind of lesions, cells
have developed finely tuned DNA repair mechanisms and a signal-
ing cascade known as DNA damage response (DDR) that coordi-
nates several cellular events, including a transient arrest of cell
proliferation to prevent the propagation of altered genomic infor-
mation to the daughter cells [1]. DNA damage accumulation has a
key role in pathological events such as cancer onset and organismal
aging [2], cellular differentiation [3], cellular reprogramming [4],
and transcription modulation [5].
Marco Demaria (ed.), Cellular Senescence: Methods and Protocols, Methods in Molecular Biology, vol. 1896,
https://doi.org/10.1007/978-1-4939-8931-7_2, © Springer Science+Business Media, LLC, part of Springer Nature 2019
11
12 Alessandro Galbiati and Fabrizio d’Adda di Fagagna
Despite the importance of DNA damage, the well-established

methods to detect DNA damage accumulation in cells and tissues
(immunostaining and chromatin immunoprecipitation—ChIP) are
based on antibody recognition of chromatin modifications asso-
ciated with DNA damage or of proteins involved in DDR signaling
or repair. This approach might result in artifactual DNA damage
detection, since some reports suggest that uncoupling between
DDR markers accumulation and DNA damage presence is possible
under particular circumstances. For example, it has been observed
that heterochromatic regions are partially resistant to DDR markers
accumulation [6], and that some cell types, such as astrocytes, lack a
full DDR activation in the presence of DNA damage [7]. Vice versa,
activation of DDR in the absence of physical DNA damage is also
possible [8].
A few alternatives to immunostaining and ChIP for DDR
markers are available. Recently, several methods have been devel-
oped to directly map DSB accumulation at genome-wide level with
single-nucleotide resolution [5]. However, these methods are lim-
ited by their low sensitivity and can only be applied to detect
recurring DSBs in a population of cells. Instead, to study DNA
damage presence in single-cells, the only alternatives to immuno-
fluorescence are terminal deoxynucleotide transferase dUTP nick
end labeling (TUNEL) [9] and COMET assay [10]. TUNEL relies
on the enzymatic modification of exposed DNA ends, with the
addition of biotinylated dNTPs: this allows physical detection of
DSBs using with fluorophore-conjugated anti-biotin antibodies.
Differently, in the COMET assay, a suspension of cells is mixed
with agarose and spread onto a microscope glass slide. Cells are
then lysed and DNA unwinding by electrophoresis is carried out at
neutral or alkaline pH. When subjected to an electric field, the
DNA fragments migrate out of the nucleoid, toward the anode,
appearing like a “comet”: the size and shape of the comet and the
distribution of DNA within the comet correlate with the extent of
DNA damage [11]. However, both methods have low sensitivity,
thus their application is usually limited to study massive DNA
damage, as in the case of cells committing to apoptosis; moreover,
TUNEL cannot distinguish between single strand breaks (SSBs)
and DSBs, while COMET cannot be easily applied in combination
with other immunostainings.
Here we describe a recently published method, DNA damage
In situ ligation followed by proximity ligation assay (DI-PLA), to
detect physical DSBs in proximity of a target protein in individual
cells (Fig. 1). Briefly, adherent cells are grown on glass coverslips,
fixed, and permeabilized to allow enzymatic modification of geno-
mic DNA. Specifically, exposed genomic DNA ends of DSBs are
blunted in situ and ligated to a double-strand hairpin-shaped bio-
tinylated DNA oligonucleotide, which permanently tags all DSBs
in the cell. Then, proximity ligation assay (PLA) [12], is performed
DI-PLA 13
Cell fixation and

permeabilization
DNA ends blunting

and ligation to the
biotinylated linker
Incubation with
primary antibodies
against biotin and a
protein of interest
PLA
Fig. 1 DI-PLA workflow. Cells are first fixed in paraformaldehyde and permeabilized. Then, exposed DNA ends
are blunted in situ and ligated to hairpin-shaped biotinylated DNA oligonucleotides (green). Next, cells are
incubated with antibodies raised against biotin (red) and a partner protein in the proximity (light blue) of the
break. Finally, PLA produces fluorescent signals (yellow dots) at the site of break, which can be detected by
microscopy
using an antibody recognizing the biotin and a partner antibody

raised against a protein in the proximity of the break, such as a DDR
marker. With this strategy, it is possible to obtain single-molecule
sensitivity, required to detect the biotin on the DNA oligonucleo-
tide tagging the DSB, which would be otherwise undetectable by
standard immunostaining with an anti-biotin antibody.
By exploiting this technique we proved the presence of physical
DSBs in the proximity of activated DDR markers in senescent cells
[13]. Interestingly, besides probing for the presence of physical

DSBs in the proximity of DDR factors, DI-PLA could also be
adapted to detect DSB at specific loci that can be identified by a
specific set of proteins, such as centromeres or telomeres. Further-
more, it is possible to use, as biotin partner, a widespread chromatin
marker, such as a core histone, to achieve DNA damage detection in
single cells without relying on any DDR marker.
2 Materials
Prepare all solutions using pure, deionized water and molecular

biology grade reagents. Dithiothreitol (DTT)-containing solutions
(NEB2 buffer, blunting buffer, and ligation buffer) should be
prepared fresh daily.
2.1 Solutions 1. Fixing solution: paraformaldehyde (PFA), 4% in Dulbecco’s

phosphate buffered saline (DPBS) 1.
2. Permeabilization buffer: DPBS 1, 0.2% Triton X-100 (see
Note 1).
3. NEB2 Buffer: 50 mM NaCl, 10 mM Tris–HCl, 10 mM
MgCl2, 1 mM DTT, 0.1% Triton X-100, pH 8 at 25 C.
4. Blunting buffer: 100 mM Tris–HCl, 50 mM NaCl, 10 mM
MgCl2, 5 mM DTT, 0.025% Triton X-100 pH 7.5 at 25 C.
5. Ligation buffer: 50 mM Tris–HCl, 10 mM MgCl2, 1 mM ATP,
10 mM DTT, pH 7.5 at 25 C.
6. Blocking buffer (PBG): 0.5% BSA, 0.2% gelatin from cold fish
in DPBS; (see Note 2).
7. PLA hybridization mix: dilute Duolink In situ PLA Probes
PLUS and MINUS (Sigma) to the working concentration 1
in Duolink Antibody Diluent (Sigma); (see Note 3).
8. PLA ligation mix: dilute Duolink Ligation buffer and Duolink
Ligase (Sigma) to the working concentration 1 in pure water;
(see Note 4).
9. PLA amplification mix: dilute Duolink Amplification buffer
and Duolink Polymerase (Sigma) to the working concentration
1 in pure water; (see Note 5).
10. DAPI: 40 -6-Diamidino-2-phenylindole 0.2 μg/mL in DPBS;
(see Note 6).
2.2 Dedicated 1. Blunting enzyme: provided in the Quick Blunting kit (NEB,
Reagents Cat. No. E1201L).
2. T4 Ligase, 400,000 U/mL (NEB, Cat. No. M0202L).
3. Mowiol or similar mounting media.
4. Duolink Wash buffer (Sigma, cat No. DUO82049) (see Note 7).
DI-PLA 15
5. DI-PLA Linker: DNA oligonucleotide diluted in water with

the following sequence (see Note 8):
ID Sequence
DI-PLA TACTACCTCGAGAGTTACGCTAGGGATAACAGGGTAA
Linker TATAGTTT[BtndT]TTTCTATATTACCCTGTTATCCC
TA GCGTAACTCTCGAGGTAGTA
2.3 Antibodies 1. Anti-biotin, rabbit (Abcam, Cat. No. AB53494), working dilu-
tion 1:2000.
2. Anti-biotin, mouse (Sigma, Cat. No. B7653), working dilution
1:2000.
The partner antibody used in combination with the anti-biotin
antibody is dependent on DI-PLA application. Here, we suggest
two validated DDR antibodies that can be used in combination
with biotin as benchmarks:
3. Anti-γH2AX, mouse (Millipore, Cat. No. 05-636), working
dilution 1:2000.
4. Anti-53BP1, rabbit (Bethyl, Cat. No. A300-272A), working
dilution 1:2000.
2.4 Dedicated 1. 24-well plastic multiwells.

Equipment 2. Glass coverslips.
3. Glass slides.
4. Tweezers (see Note 9).
5. Parafilm.
3 Method
Carry out all procedures at room temperature (RT), unless other-

wise specified. For 13 mM coverslips (see Note 10), put the cover-
slips in a 24-well plate and perform all washes with at least 300 μL
of buffer.
All enzymatic reactions and antibodies incubations are carried
out in a humidified sealed chamber (see Note 11). Grow adherent
cells on the glass coverslips.
3.1 Fixation and 1. After the treatment of interest, cells are fixed with the fixing
Permeabilization solution for 10 min.
2. Coverslips are washed twice in DPBS, then are incubated for
10 min in the permeabilization buffer (see Note 12).
3. Coverslips are washed twice in DPBS for 5 min.
3.2 DNA Ends 1. Coverslips are washed twice in NEB2 buffer for 5 min.
Blunting and Linker 2. Coverslips are washed twice in blunting buffer for 5 min.
Ligation
3. Prepare 35 μL of Blunting reaction mix for each coverslip:
1 mM dNTPs, 3.5 μL Blunting Buffer 10, 0.2 mg/mL
BSA, 0.7 μL Blunting Enzyme, add H2O to reach the final
volume. Spot 35 μL of blunting reaction on Parafilm and
incubate each coverslip, with cells facing the reaction mix (see
Note 13), for 1 h in a humidified sealed chamber.
4. Coverslips are washed twice in NEB2 buffer for 5 min.
5. Coverslips are washed twice in Ligation Buffer for 5 min.
6. Prepare 50 μL of Ligation reaction for each coverslip: 0.5 μM
DI-PLA Linker, 5 μL Ligation buffer 10, 1 mM ATP,
0.2 mg/mL BSA, 1.5 μLT4 Ligase, add H2O to reach the
final volume. Spot 50 μL of ligation reaction on Parafilm and
incubate each coverslip, with cells facing the reaction mix (see
Note 13), in a humidified sealed chamber, overnight at 16 C.
3.3 Blocking and 1. Coverslips are washed twice in DPBS for 10 min.
Incubation with 2. Coverslips are blocked for 1 h in 500 μL PBG at RT.
Primary Antibodies
3. Prepare primary antibodies mix (see Note 14). Spot 50 μL of
antibody mix on Parafilm and incubate each coverslip, with
cells facing the mix in a humidified sealed chamber for 1 h at
RT or overnight at +4 C.
3.4 Proximity 1. Coverslips are washed twice in PBG for 5 min.

Ligation Assay 2. Prepare 35 μL of PLA hybridization mix for each coverslip.
Spot the mix on Parafilm and incubate each coverslip, with cells
facing the mix, in a dark humidified chamber for 1 h min at
37 C.
3. Coverslips are washed twice in Duolink Wash buffer A 1 for
5 min.
4. Spot the mix on Parafilm and incubate each coverslip, with cells
facing the mix (see Note 13), in a dark humidified chamber for
30 min at 37 C.
5. Coverslips are washed twice in Duolink Wash buffer A 1 for
2 min.
6. Prepare 35 μL of PLA Amplification mix for each coverslip.
Spot the mix on Parafilm and incubate each coverslip, with cells
facing the mix (see Note 13), in a dark humidified chamber for
90 min at 37 C.
7. Coverslips are washed twice in Duolink Wash buffer B for
10 min.
8. Coverslips are incubated in DAPI for 3 min.
DI-PLA 17
a CTRL IR b
80
n dots per nuc leus

60
40
20
IR
L
TR
C
Fig. 2 Typical DI-PLA output. (a) U2OS cells either untreated or exposed to 2 Gy ionizing radiation and fixed 1 h
after irradiation. DI-PLA with antibodies against biotin and γH2AX. DNA stained by DAPI. Quantifications are
shown in panel (b)
9. Coverslips are washed in DPBS.

10. Coverslips are washed in pure water to remove any remaining
salts.
11. Coverslips are dried and mounted on microscope glass slides
with Mowiol or similar mounting media.
12. Let coverslips dry in the dark for a few hours at RT before
acquiring images at the microscope (see Note 15).
3.5 Imaging Analysis 1. Perform image acquisition with a fluorescent microscope, at a

suggested magnification of 20–60. For each field acquire the
408 channel (to visualize the nuclei stained by DAPI) and the
appropriate channel corresponding to the Duolink detection
reagent used (for example acquire Cy3 if the Orange detection
reagent has been used); (see Note 16). To compare different
experimental conditions, acquire all images with identical para-
meters. A typical DI-PLA experiment result is show in Fig. 2.
2. Quantify the number of DI-PLA dots in each nucleus, using an
imaging software such as CellProfiler [14]; (see Note 17).
4 Notes
1. Prepare a stock solution of 10% Triton X-100 diluted in pure

water. The stock solution can be stored at RT.
2. Prepare a stock solution of 10 PBG and store at 20 C.
Avoid freeze—thaw cycles. The working solution 1 PBG can
be stored at +4 C for a few days.
3. Duolink probes are secondary antibodies conjugated with oli-
gonucleotides that are used to prime the PLA reaction. Use a
combination of Duolink In situ PLA probes PLUS and MINUS

as needed. The anti-biotin antibody and the partner antibody
against a protein of interest must be raised in different species.
For example, if an anti-biotin antibody raised in rabbit is used in
combination with an anti-γH2AX antibody raised in mouse, a
combination of Mouse PLUS (Sigma, cat No. DUO92001)
and Rabbit MINUS (Sigma, cat No. DUO92005) probes
must be used. Probes are available also for antibodies raised in
goat. Prepare the mix in ice, just before use.
4. The PLA ligation reaction adds a connector oligonucleotide to
one of the Duolink probes to generate a single strand DNA
circle that serves as template for the subsequent PLA reaction.
The PLA ligation reagents are part of the Duolink detection
reagents. Prepare the mix in ice, just before use.
5. The Duolink amplification reactions is a rolling circle amplifi-
cation (RCA) reaction that is primed by one of Duolink probes
and uses, as template, the circle strand DNA circle ligated to
the other Duolink probe. Due to spatial constraints, the reac-
tion can only take place where the two target proteins are in
close proximity (<40 nm). To generate a detectable signal, the
Duolink amplification buffer contains fluorescent conjugated
probes that hybridize to the RCA product. According to the
Duolink detection reagent chosen, it is possible to generate
fluorescent DI-PLA signals in the color of interest. This is a
feature that may prove useful when doing a costaining with
immunofluorescence for a particular protein, or when using
cells expressing fluorescence-tagged proteins. However, we
observed that the Orange detection reagent (Sigma, Cat.
No. DUO92007) provides the best signal to noise ratio and
is more resistant to photobleaching compared to the other
available detection reagents. Prepare the mix in ice just
before use.
6. Store in the dark to avoid fading.
7. Store the Wash buffers at +4 C, up to 6 months. It is critical to
equilibrate the wash buffer at RT before use.
8. DI-PLA linker can be ordered with a standard desalt purifica-
tion method. HPLC or SDS-PAGE purification methods yield
a purer linker population, thus the amount of oligo used for
each ligation reaction can be reduced up to 10 times. Dilute in
pure water to obtain a 100 μM stock solution. Avoid repeated
freeze–thaw cycles.
9. Tweezers are used to handle the coverslips.
10. If larger glass coverslips are used, washing and reaction
volumes must be scaled up proportionally.
11. It is critical that the humidified chamber is well sealed and well
humidified to avoid evaporation of the reaction mixes.
Another random document with
no related content on Scribd:
“Here you are, sir. Follow me!” This from one of the men, who had
brought a wooden, rope-handled bucket of steaming water.
Ingomar was conducted to the half-deck, and, when he emerged, but for
his romantic dress of skins, no one would have known him.
The skin, even of his hands, was now as white as a lady’s, and his
complexion perfect.
And his every action, movement, and sentence were those of a well-bred
man of the world.
He looked about ten years younger than he did when he stepped on
board.
“By the way, Captain—eh——”
“Mayne Brace,” said Charlie.
“Captain Mayne Brace, I have been dreaming for weeks in my tent, far
away over the hills yonder, that I was sailing southwards in a British
barque. The fact is, sir, though life in these regions may have a spice of
romance about it, one gets tired after a time of the winter’s darkness; and a
diet of dried fish, seal-mutton, and whale-blubber becomes irksome at last,
even if a bear-steak is now and then added to the menu.
“Do you know, sir,” he added, interrupting himself, “that if your tailor
could make me a serge suit of some sort, and if I had my hair cut, I’d really
have the audacity to ask you to grant me a passage back to temperate
regions with you?”
“We will be delighted, Ingomar,” from the captain.
“Oh, that isn’t my name, but the name of the play in which I last took
part in a Chicago theatre. But I should be glad to tell you who and what I
am after I have munched a ship biscuit.”
As they went below to dinner, Captain Brace leaving orders for the man
in the sledge and the dogs also, to be fed, Charlie found time to seize
Ingomar’s hand again and pull himself up, while he whispered—
“Don’t have your hair cut, and don’t wear a serge suit. You look ever so
much better in skins.”
* * * * *
After dinner Ingomar consented to sit in an easy-chair, but well away
from the fire.
He lit his cigar.
“I’m very happy, Captain Brace,” he said.
“So pleased!” said Brace.
“You promised to tell us your story,” said Charlie.
“Well, yes,” returned the stranger, “and for your sake I’m sorry it must
be brief. But, Captain Brace, may I first go and give Humpty Dumpty his
orders, if I am to sleep on board all night?”
“Humpty Dumpty, as you call him, is perhaps, like yourself, an
Englishman?”
“Oh, pardon me, captain, but neither Humpty nor I have the honour to be
English. I am an American, sir, born and bred, and so is my mate. I don’t
drawl, and I don’t ‘guess’ and ‘calculate,’ and I don’t use my nose much to
talk with. Humpty does a little. But Humpty Dumpty was only a man before
the mast when we became first acquainted. I’ll run up and speak to him
over the side.”
“No, no,” cried the captain. “We’ll have Humpty down here for a
minute.”
“What a strange name!” said Walt.
“Well, yes, but it fits him. It fits his shape and build. His real name is a
deal too—a—aristocratic, don’t you call it, for him. Hampden is his
surname, so I call him Humpty Dumpty for short.”
“Hullo, here he is!”
Humpty stood in the doorway, cap in hand.
He was about five feet or less in height, and in his Eskimo dress, with his
tremendous breadth of shoulder, shaped somewhat like the capital letter V.
“You called me, sir?”
“Um, yes, Humpty. You are to drive back to our tribe, and tell them they
must get away over the horizon again and camp there, but to return to-
morrow before sunrise, because I believe these young gentlemen would like
to ride in a dogsledge, and see the village of which I am king.”
“Oh!” from both boys.
“Right, sir; I’m off straight’s an arrow.”
“One minute, Mr. Hampden. You’ll have a glass of wine?”
“Excuse me, capen, but I’ve tasted it before, I reckon. Yes, sirree, once I
took a thimbleful too much, and next day, sez I to myse’f, ‘No more liquor
for Dumpty.’ ”
In a minute or two after this Dumpty was dashing over the snow to the
spot where his tribe had been left.
The doctor entered now.
The steward had kept his dinner hot.
“The Teelies have gone back, sir, and peace is restored.”
He bowed and smiled to Ingomar, then sat down to dinner; but while he
ate, only ordinary subjects were talked about.
Then Wright joined the circle round the fire, and, having cleared away,
the steward considered himself privileged to stand in the doorway for a
short time to listen.
For on board Arctic ships faithful servants are allowed quite a deal of
freedom, which, by the way, I have never known them abuse.
“Well, my friends,” said Ingomar, “you must excuse my shortcomings as
a story-teller. I suppose I’m not old enough to tell fibs, so my yarn, if short
and stupid, has at least truthfulness in its favour.”
“Heave round, sir,” said Captain Mayne Brace.
And Ingomar, smiling, obeyed.
CHAPTER III
“MY PRIDE WARRED AGAINST MY BETTER FEELINGS”
“Well, gentlemen, Ingomar being merely my stage name because I played

in that piece more than in any other, I ought at the very offset to tell you my
baptismal one. That was Hans, and my father being an Armstrong, I very
naturally adopted his surname. Hans Armstrong, then; and here you have
me clad in skins, of which rig-out I am beginning to be slightly ashamed.”
“Pardon me,” said Captain Brace, “you tell us that you belonged to
Chicago. Do you happen to have any personal acquaintance with the Dutch-
American millionaire Armstrong?”
“I have known that gentleman, sir, since I was eighteen inches long. He
wasn’t much of a millionaire then. I do myself the honour of believing that
it was I who brought all the good luck to that well-known family; and
although when I was a child Mrs. A. occasionally showed her extreme
affection by spanking me, I loved and love her very much. If alive, young
gentlemen, she is my mother; if dead, she is a saint in heaven. They have
just one other child, a girl, my dear sister Marie, years younger than myself,
and she will fall heir some day, I suppose, to all my father’s millions.”
“But you yourself, Hans?”
“Well, sir, I—I suppose I am a fool, sir, or, more probably, a born idiot. I
am likewise the prodigal son. For the last six months and over I have not
certainly been eating husks with the swine. It would be wrong and cowardly
in me to allude to my friends the Yak-Yaks as swine; but I have been living,
as I have already told you, in a somewhat unrefined way.
“The Armstrongs, I think I have heard my father say, first went to Britain
and settled there, then across the sea to America, and fought against you
during the War of Independence. But that has nothing whatever to do with
me. My parents have been very, very good to me, and my education has
been quite up to the Boston standard. Only when I reached the advanced
age of seventeen—I am now two and twenty—I began to grow reckless.
Civilization was not good enough for me. It was too much in the same
groove. I determined therefore to shake the dust of Chicago off my shoes—
there is a good deal of dust in Chicago—and find my way into regions
remote, where, if the people were not rich, they were at least honest. My
sister’s wild entreaties, my mother’s tears, prevailed not against my
headstrong self.
“My adventures among the Rocky Mountains and forests of the Far West
would fill a book. I thought seriously of living in the wilds for life, and
marrying the daughter of a chief.
“He was ugly enough to have stopped a clock, but a splendid warrior,
and his braves were all that braves should be. Cheena, the daughter, was but
a child of twelve. But she interested and amused me, and perhaps captivated
me with her beauty and her innocent ways. One of these innocent ways was
to play with snakes. She even taught me to boldly touch and handle the
rattler.
“No wild beast would harm Cheena, and she went fearlessly into the
dens of even grizzly bears, and played with their puppies as if they had been
dolls.
“I lived in the wilds with this wandering tribe for nearly three happy
years. Cheena knew English, and I taught her more. Shakespeare was my
constant companion. Better perhaps had it been my Bible. But Cheena and I
played many a scene together in glades of the beautiful forest.
“I must hurry over all this, though.
“Well, one day, with three men and two tame wolves, I went away on a
big shoot. When we returned, I found that a warlike tribe had attacked the
chief’s camp, and that he and his braves had been defeated and scattered.
“I never saw him again, nor poor Cheena, though I wandered about in
search of them for three long, dreary months.
“Then one day I returned to my father’s house. It was late at night, but I
climbed up into my own old bedroom, just as I used to do when a lad.
“Nothing was changed. Everything had been kept sacred as a temple.
“I went quietly to bed, and when next morning I coolly rang for water
and old Roberts entered, he shook with fear so that he would have fallen
had I not supported him.
“ ‘Is—it—you, Master Hans?’ he quavered, ‘and not a dead—go—go—
ghost?’
“ ‘Is that like the hand of a dead go—go—ghost, Roberts?’ I said,
grasping his arm with my forest-hardened fingers.
“ ‘Oh—no—no,’ he almost shrieked. ‘Lor, sir, how you’ve growed! Your
mother and Sissie will be skeered, I guess, when they sees you.’
“ ‘And they are all well?’
“ ‘That’s so, Master Hans; and the old man too.’
“ ‘Well, some hot water, Roberts. I’ll wash and come downstairs to
breakfast.’
“I was down before anybody, and sitting quietly in a rocker, smoking
one of dad’s best Havanas, when Sissie and mother entered.
“You may judge what followed, boys.”
“But,” pleaded Charlie, “you’re not making the story half long enough.”
“I settled down now, sir, to the hardest work ever I had in my life.”
“And that was?”
“Doing nothing. But I couldn’t keep it up. It was ruining my fine
constitution.
“I was always fond of the stage, and took Marie to see Ingomar one
evening.
“She was delighted. I was not. Ingomar was not written by Shakespeare,
I believe, but it was a pet play of mine, and I knew I could act the part
better.
“But somehow I went back several nights running. Then, as my good or
my bad fortune would have it, one evening the excited manager rushed
before the screen to announce that, to his grief and chagrin, the principal
actor had been taken suddenly ill, and that the play could not be put on. Yes,
of course, he added, the gate-money would be refunded.
“After this, some impulse seized me. I stood boldly up in the box, and
shouted with arm extended—
“ ‘Stay, I know the part, and if the manager will but give me a chance, I
will try my best.’
“Every eye was turned towards my box, while Sissie shrank behind the
curtain. I am told, sir, that I am not bad looking, and my figure is fairly
good.
“There was a wild ‘Hooray!’ now, at all events, and that evening found
me before the footlights.
“I played with heart and soul. I had the people with me, and felt I had;
and when at the end of the first act I was called before the curtain, I
received an ovation that would have satisfied a far better actor than I.
“Hardly thinking about the disgrace my people would imagine I was
bringing on them, I accepted the manager’s terms to play for three weeks.
“I told them that night what I had done. Mother was silent, Sissie looked
frightened; and when next morning we all met at breakfast, I could see that
both had been crying.
“Scarcely a word was said, but that forenoon my father asked me into his
sanctum.
“ ‘Boy, boy,’ he began, ‘why this madness? Do you wish to bring my
grey hairs down with sorrow to the grave?’
“I sat quietly down that our eyes might be more on a level, for I am very
tall.
“ ‘Dear father,’ I said, ‘I am foolish enough to think that I shall be an
honour to you as an actor.’
“ ‘Honour! Actor!’ he cried.
“ ‘It is a noble profession,’ I said quietly; ‘and when you come to listen
to my interpretation of Hamlet, you will believe that God has gifted your
son with genius. There will be no sorrow then, dear daddy.
“ ‘Besides,’ I added mischievously, ‘you haven’t got a single solitary
grey hair in head or whiskers.’
“Some people are hard to convince. My father is one of them.
“ ‘I will cut you off with a dollar,’ he thundered, ‘if you do not give up
this disgraceful fad. If you do I will take you into partnership.’
“Then I told him grandiosely that the resolution I had taken was fixed,
immutable; but that rather than bring disgrace upon him, I would change
my name as soon as this engagement was over, and go into a far country to
act where no one would know me.
“ ‘I began life,’ he said, as he sunk back in his chair, ‘with fourpence in
my pocket.’
“ ‘And I, daddy,’ I replied, ‘am beginning life without a penny, but
possessed of one of the dearest old fathers that ever a young man was gifted
with.’
“He was softened.
“ ‘Boy,’ he said, after a pause, ‘I am wealthy, but your sister must be my
heir. If you must go—then go. I will place a trifle at your disposal in my
bank at New York. You will have that to fall back upon, when your fad and
folly leave you. Good-bye. I may never see you more.’
“He started from his chair and marched straight out of the room.
“Here, boys, ends the second act of the prodigal son.
“Just two months after this I found that my father’s words were coming
true. I had attempted Hamlet, but was playing to very poor houses.
“When I came home one evening and found a very humble dinner
waiting for me, I became very sad indeed.
“But worse was to follow, for in a week’s time my engagement at the
theatre was over, and I was politely told I was not good business, and could
not be retained.
“I went quietly and, I thought, calmly away; but happening to enter a
club that evening where my presence had always been welcome before, I
found only coldness. When a rival actor taunted me as to my success, I
completely lost control of myself. I flew at the fellow, picked him up,
armchair and all, and threw him to the other side of the room.
“I heard no more of the matter, but in a week’s time I found myself alone
in my dingy lodgings without a copper in my pocket.
“I was alone with my pride. I might beg, but never again, I told myself,
would I darken my father’s door.
“It was two days after this when, while strolling along near to the docks,
I was met by a French seafaring man. He looked at me and I at him.
“ ‘Do you want work?’ he asked.
“ ‘That I do. I’ll do anything.’
“ ‘Well, you look a likely sportsman. I’m off in a day or two on a curious
kind of cruise to the very far north.’
“ ‘I’ll go with you,’ I answered, ‘if the wages are not starvation.’
“ ‘Come with me now,’ he said. ‘We will soon settle matters.’
“He had a boat, and we were both rowed off to a strange-looking but
strong and sturdy brig.
“Every man on board except this same Humpty Dumpty was French.
What cared I? Surely I could hold my own in a fight against a score of little
sailors.
“ ‘You are not a sailor,’ said my new friend, when we were together in
his little cabin.
“ ‘No,’ I said; ‘but I can shoot, and wield an axe, and I can fish.’
“ ‘You’re my man. But I must explain. We are engaged by a celebrated
firm of chemists to go to Greenland waters and fish for sharks. The oil of
the livers is not only finer and richer but more abundant than that of the
cod, and it is considered an infallible cure for consumption.
“ ‘You’ll have to rough it,’ he added. “ ‘Thank God to have the chance.’
“And the bargain was speedily made, and the articles signed.
“I was to join in two days’ time.
“That night it suddenly occurred to me to visit my father’s bank here. I
still had his letter, and by its aid could identify myself.
“I must confess that I went to that bank in bitterness of spirit against my
poor daddy. But I felt sure that the trifle he had deposited to my credit,
would be but the traditional dollar with which prodigal sons are often cut
off. I meant to bore a hole in it, and wear it round my neck.
“I had no sooner made myself known than the manager, to my great
surprise, shook me by the hand.
“ ‘Come into my room,’ he said. ‘Your father has sent me your
photograph, so that there is no need for identification. And the cheque is a
handsome one.’
“ ‘I hope, sir,’ I said, ‘you will not tantalize me. I expect nothing from
my father except one dollar.’
“ ‘The cash standing to your credit,’ he said, ‘is two millions sterling.’
“I answered scarcely a word. I was too dazed to speak. This, then, was
the dollar with which my father had cut me off.
“I arose from my chair, and, hardly taking time to shake hands with this
business-like banker, I walked straight out, and away home to my dingy,
dismal lodgings.
“I wanted to think, and to be alone.
“ ‘My poor father!’ These were the first words I said to myself. And at
this moment I would have given a good deal to be sitting once more in our
old-fashioned parlour, with mother and sister near me, and my father
studying the markets as he sat in his chair.
“But evil thoughts began to take the place of good, and my pride warred
against my better feelings.
“These two millions were a million times more than I deserved, though it
would leave him but little poorer. This was true, but nevertheless I felt that I
was cut off.
“ ‘Here is thy portion, boy,’ he seemed to have said. ‘Get thee away into
a far country, and come not near us again.’
“I was banished. I would keep to my engagement with the French shark-
hunter strictly and to the letter. My millions might lie there. I would not
draw a cheque even for a dollar. I was proud, and my pride bred bitterness
of heart.
“I wrote at least half a dozen letters to Sissie and mother, read them over,
and tore them up as soon as penned. For somehow that bitterness of heart
breathed all through each one of them.
“Then, when calmer, I wrote one simple, loving letter, bidding all good-
bye. And it ended thus: ‘When I am worthy to be my good old father’s son I
will return.’ ”
* * * * *
“Ah, gentlemen,” he continued, after a pause of silence that no one cared
to break, “my long banishment to this dreary country, though self-inflicted,
has done me good and changed my mind. Before, I could see men but as
trees walking, now I can read all my father’s motives. Like all our forbears,
he is proud, but he is true, and—well, I must confess I love him. There!
“My adventures since I left home are too numerous to tell you. Our ship
was wrecked, and Dumpty and I alone were saved. Then I joined a band of
wandering Eskimos—the Yak-Yaks. I did not care what became of me. I felt
I was running away from myself, from my evil, prideful nature, and so here
I am, a changed and, I trust, a better man.
“One thing, however, I have determined upon. I will not return to my
father’s house, until I have done something which shall show him that I
possess some of the sand and grit in me, which has descended to us from
the old fighting Armstrongs.
“But, I say,” he added comically, “you will get me that serge suit, won’t
you? And you will let me and Humpty Dumpty join your ship, and let me
have my hair cut, and—well, and just share your adventures, won’t you?”
“By all means,” replied Captain Mayne Brace.
“One minute before you finally decide,” said Ingomar. “For all you
know, I may be a mere adventurer or a madman. But see, I have some
business-like method in my madness.”
He pulled from an inside pouch a bundle of papers.
“I have kept these, Captain Brace. I place them before you, and, unless
you promise me you will glance over them, I shall return to-morrow to my
igloo among the Yak-Yaks, and trouble you no more.”
“I will take them to my cabin, young sir, though I think there is no need
to. I can read honesty in your eyes.”
Ingomar’s manner changed now at once. He was brimful of happiness
apparently, and addressed himself more to the boys than the others.
“I say, lads,” he cried, “won’t we have a day of it to-morrow, if your
good captain will permit you to cross the mountains with me?”
“Oh, we shall enjoy it!” cried Charlie.
“Won’t we just,” said Walt.
“I’ve never driven dogs, but I think I could if I tried.”
“Hurrah!”
And the evening passed very happily away.
CHAPTER IV
THE AGREEMENT DRAWN UP AND SIGNED
Like all men who are ever likely to do any good in this world, and leave
footsteps in the sands of time, Captain Mayne Brace was an early riser.
The stars were still glowing like diamonds in the sky, then, and the
merry dancers—the aurora—were still at their revels when he turned out to
have his bath. A quarter of an hour after this found him on deck.
Here, to his surprise, he met young Ingomar. He stood on the poop, his
face skywards and to the north.
“Is it not a grand sight, sir?” he said. “How near and how brightly these
stars and planets burn! It seems as if one could touch them with one’s rifle
or fishing-rod. And the aurora-gleams—the positive magnetism that comes
from the far-off Southern Pole—how beautiful their transparency of
colours! Those ribbons of light seem to me like living things. And in the
stillness of this early morning do you not hear them talking? Shsh—shs—
shs—shs! Oh, sir, is it not God Himself who is speaking there—the God of
power, the God we know so little of, the God whom in our pride of
knowledge we sometimes venture to impugn, to correct, to criticize!
Forgive me, sir, for speaking thus before an older man than myself. But oh,
sir, there is a glamour about that sky, about these northern solitary wilds,
which gets around the heart and soul, and makes one feel one is really face
to face with the Creator—Maker not alone of this puny earth, but of yonder
universe—of infinity itself!”
He scarcely gave Captain Brace time to reply.
“Down in one’s bunk,” he continued, “one belongs to this world. Up
here among the stars and aurora one is with God. But down below last
night, sir, I was thinking of my father, my mother, and sister. To say that I
was not longing a little for home would be to insinuate that I was more than
a young man. Yet my resolution has not been one whit shaken. When I can
do something that no one else has ever yet done, or at least made an attempt
to do this something, the prodigal son will return to his father’s house; not
till then. My father is a very Napoleon of finance. In that line I may never,
can never, hope to equal him, nor do I desire to do so. Yet I may become a
great explorer, and help to add to the world’s fund of knowledge for the
world’s benefit.
“I had made up my mind never to finger a frank of those two millions,
but I shall, and will gladly, spend one million, if need be, for the furtherance
of a plan I have in view, and have well thought out. It is an ambitious one,
sir. I feel I ought to blush even to mention it.”
“You need not, young sir, if it be honourable,” said Brace.
Ingomar, as we may continue to call him, had been walking up and down
the deck so rapidly, that it was difficult to keep pace with his gigantic
strides.
But he hove to now suddenly, and confronted the captain.
“Listen,” he said. “The Americans have done as much as any other
nation save Britain to solve the mystery that hangs around the Pole yonder.
The veil will soon be raised. I would go farther; I would venture to aid in
the attempts that are now about to be made by you Britishers and by the
Germans, to wrench its secrets from the Great Unknown, from the Antarctic
itself, to force it to tell what it knows of the story of the earth.”
“The ambition,” said the captain, “is a noble one, certainly, and even I
have had thoughts of bringing the knowledge I have gained in regions
round our own North Pole to bear upon the South. Indeed, I was almost
thinking of joining the expedition when I got home.”
“But I,” said Ingomar, “would not join any expedition. No, no, sir, and a
thousand ‘No’s.’ I should fit out my own. And if I were to die in the
attempt, why, I should die in a worthy cause; and to youth death does not
seem so very dreadful if surrounded by a halo of noble adventure.
“And would you believe it,” he went on, “while in my lonesome igloo
over the hills yonder, I have for months been forming all my plans for
future operation. I would rather lay these before older and more skilled and
scientific men than myself, and all I should do, all the honour I might
obtain, would be that of finding the money for the expedition.
“Well, now, it may seem an abrupt question to ask, but I think that as
long as a fellow keeps a clear brain and a good look-out ahead, abruptness
is no great sin. Can you, then, or will you, sell me your ship?”
“This barque is not my own, alas! or, after having been so singularly
unfortunate in ‘making a voyage,’[B] and presuming that you are sincere, I
would gladly do so on the understanding that my services as master mariner
of the Walrus should be retained. But come down below. The fire is well
alight, and we can talk uninterruptedly for a good hour yet before the others
turn out.”
Although the acquaintance with each other of these two men was so very
recent, there was a something—call it by any scientific name you please—
that seemed to draw them together.
Captain Mayne Brace was very favourably impressed by the prodigal
son, as he would insist upon calling himself. The coincidence that had
brought them together was certainly strange, but Fate moves in a
mysterious way, and Brace determined to take advantage of the meeting
between Ingomar and himself.
He candidly opened his mind to the young millionaire.
“I am bound,” he said, “to do all I can to secure a good voyage during
the spring fishery. Nothing could prevent me from attempting this for the
benefit of my owners; and if I must return ‘a clean ship,’ then I shall have to
steel my nerves to encounter my owners. The ship is well—too well—
insured, and it was hinted to me that if I failed in making a paying voyage,
no questions would be asked if I cast her away. There would be little chance
of that, for even after a rough-and-tumble life at sea for so many years, I
have a little honour left me, a clean heart, and a clear conscience.
“But, Mr. Armstrong——”
“Call me not Armstrong yet, sir—just Ingomar, and hang the ‘Mr.’ ”
“Well, Ingomar, I have no doubt my owners would be willing to sell the
Walrus, and therefore, if you choose now to sign articles, I shall rate you as
harpooner, and shall be perfectly willing to ship for you, before we leave
these regions, the Yak-Yaks, the dogs, and young bears you say would be
necessary to make our expedition a success.
“We are a sturdy ship and good sailer, and we have plenty of room, if we
do not make a voyage, for you and your pets.”
“You have made me very happy, sir. Let us make the agreement at once.”
“Just one moment, young sir. You have told me that the Walrus will be
the auxiliary vessel carrying extra stores, the dogs, the Yak-Yak hunters,
sledges, etc., and that you would build or buy and fit out a special ship for
the actual scientific exploration. Now, I am a plain man—under what flag
should we sail?”
“The Stars and Stripes?” said Ingomar.
This was more like a question than an answer, and Brace replied sturdily
—
“No, sir. I will sail under no flag except the British.
‘The flag that braved a thousand years

The battle and the breeze.’
But,” he added, half regretfully, “if you succeed in purchasing this good
barque—and a better never sailed to the Sea of Ice—she will belong to you,
and you can hoist your Stars and Stripes; only——”
“I understand,” said Ingomar, “and honour your sentiment. Well, you
must be captain of the Walrus, that is clear. But everything else must be
made clear, and I am certain we will not quarrel about the flag displayed.”
He considered a moment.
“Let us have the two in one,” he said. “Not one beneath the other, else
we should quarrel worse than ever.”
He laughed at his own quaint notion, as he added—
“Why not have the two flags tacked together, so that their united ensign
should show from one side the Bird of Freedom—the eagle, and on the
other your British batch of Lions?”
It was Captain Brace’s turn to laugh now, and he did so right heartily.
“ ‘Pon my soul,” he said, “the conceit is a good one. I see that you and I,
sir, are united, anyhow—just as the British and the Americans should ever
be.”
Then the agreement was drawn up and signed by both, and so this
memorable interview came to a close.
“I feel so happy now, captain,” said young Ingomar, “that—that I could
cry.”
“Rather an original method of showing happiness, isn’t it?”
“Rather effeminate, anyhow. But now I feel at home here; and within the
last four and twenty hours my prospects in life have brightened, and my sky
is clear; the star of hope is shining as brightly as the Pole star yonder. I’m
young, you see, sir, and—— Well, I can’t help that, can I, Captain Brace?
But I don’t mean to fail, anyhow.”
“No; and you have nothing to be ashamed of, Ingomar. As to failure—
‘In the lexicon of youth which fate reserves

For a bright manhood, there is no such word
As Fail.’ ”
* * * * *
True to time—in fact, a little before it—the Yak-Yaks were seen
returning to the barque, yelling and whooping, the dogs stretched out, and
apparently hugging the snow as they sped onwards like a hairy hurricane
across the level stretch of bay.
It was arranged that Nick and Nora both should accompany this tour
inland, but as they could not be expected to keep pace with these trained
Arctic dogs, one was taken up into Captain Brace’s sledge, and the other
with the boys themselves in Ingomar’s.
Food was not forgotten, you may be well sure, nor tobacco and
knickknacks for the natives.
The journey was a long one, and many a halt had to be made on hill-
tops, and even in the valleys beneath.
No one who has not travelled in a real Eskimo well-appointed dog-sleigh
can have the faintest notion of the speed obtained on good snow.
To-day it seemed as if the drivers were bent upon making a record, and it
was one that I would defy any motor-car to make over the same track. The
dogs needed to rest now and then, to lie down and pant a little, and refresh
themselves by gulping down mouthfuls of the pure snow that was within
easy reach.
Then they were fit again once more.
Though it was but little past one o’clock p.m., the sun was already going
down when the halt for luncheon was called; and it need hardly be said that
under so bracing a sky our travellers made each a hearty meal.
They were high up on a rounded hill, and the view all around from the
rugged mountains of the west to the east, where lay the rough and rugged
sea of ice, was indescribably beautiful.
Even the Yak-Yaks themselves seemed impressed with the transcendent
loveliness of this marvellous Arctic sunset, and those moments of such
stillness and silence that one might have heard a snowflake fall.
It was night and starlight before they reached the Eskimo village.
A moon by this time had risen solemnly over the hills, and flooded all
the country with its strange, mysterious light—- a light the like of which I
have seen in no land save the Arctic, a light that seems mystic and
positively holy.
All the inhabitants turned out to welcome our heroes, and a wild, strange
welcome it was.
This was a wandering tribe, and consequently a more brave and fearless
people than the inhabitants of the igloo villages around the coast.
But they were safe; and they looked upon Ingomar as their sun-king, as
in their musical, labial language they expressed it.
This tribe might have numbered altogether some six or seven hundred
souls, and I may as well tell the truth about them—they never fished for
blubber themselves, but levied blackmail on their humbler and more
industrious neighbours who lived along the shores of gulfs and bays.
They had very large stores of frozen blubber, however, thousands of
skins, and plenty of stored fish, and flesh of every sort, from seagulls’ to
whales’.
Stimulants in the shape of rum or brandy I do not believe they ever
tasted, but they seemed all the more happy in consequence.
Ingomar strode round among them, and even the children ran towards
him to kiss his hand. Nay, more, the very dogs danced about him, but
“down-charged” whenever he lifted his hand.
It was a queer sight to see the splendid jet-black Newfoundland standing
close by his Nora’s side and defying the whole howling pack, turning his
head sideways now and then to give Nora a lick, as much as to say, “Don’t
be afraid, my dear; they’re only ignorant savages. I could fight them six at a
time.”
The night was to be one of hard frost; but these nomads, much to our
heroes’ astonishment, lit a great fire of ancient pine wood, which they had
excavated from a hillside not far off, and so John Frost was defied for once.
The arrival of real “Eengleeshmen” at their winter camp was an event
that no one would ever forget.
Though, in a manner of speaking, warlike in comparison to the ordinary
Eskimos, these Yak-Yaks seemed very gentle and tractable, and did all in
their power to entertain their guests. They sang queer little musical ditties,
and the men and women joined in every chorus, clapping knees and brows
with their palms in quite a funny way.
Then some of the head hunters gave a kind of dramatic performance,
spear-armed; and even Charlie and Walter could see that this represented
every phase of a great bear-hunt, even to the slaying of Bruin, and the death
of one of the hunters.
Then Ingomar himself took the snowy stage, and if he had been listened
to with the same rapt attention in New York that he was to-night by these
semi-savages, the probability is that he never would have left his own
country.
Ingomar’s igloo was a very large one, and in it burned two huge lamps,
giving plenty of heat and light. There was no smoke, because that which
arose from the oil was carried right up through, and though all the whites
slept here in their bear and seal-skins, there was not a particle of discomfort
felt.
And all slumbered well till eight o’clock next morning.
The fire was now replenished, and smoked fish made a right dainty
addition to the breakfast. The menu was certainly not so extensive as that of
a Glasgow or London hotel, but our heroes sat down to it with hearty
appetites, and that is more than most people can boast of in gloomy London
town.
A surprise was awaiting them this morning, of which Ingomar had given
the visitors no previous hint.
CHAPTER V
THE SHIP’S BEARS: GRUFF, AND GROWLEY, AND GRUMPEY, AND MEG
The surprise was this: no fewer than four young Greenland bears[C] were
led forth, and attached or harnessed to a hugely large sledge, and seemed so
perfectly quiet and well broken, that neither Charlie nor Walt hesitated for a
moment to take their seats.
This sleigh could accommodate as many as ten men.
But these bears, although they moved not with half the rapidity of a team
of dogs, never varied their pace, and never needed rest until they had
covered a distance of not less than twelve miles.
Both the Newfoundlands had been shut up in an igloo. This was a
precautionary measure, for although the bears never attempted to molest the
Yak-dogs, they might not have objected to a mouthful or two of fine, fresh
Newfoundland.
And the end of it all was that Captain Mayne Brace considered himself
quite justified in purchasing these noble animals, for if anything came of the
proposed Antarctic expedition, there was no reason why they should not be
taken south with the force.
The days grew longer and longer now, fresh snow fell, softer winds
began to blow, and at long last, with noises that are indescribable, the ice all
around began to crack and break with the force of great waves that rolled in
beneath them from the Eastern ocean.
Previous to this, however, peace had been established between the Yak-
Yaks and the Teelies. The former had encamped close to the bay, and plenty
of provisions and necessaries having been landed, Humpty Dumpty himself
was left in charge of the whole—a kind of white king, in fact, who
considered himself of no small importance. He had orders to keep the peace
until the Walrus should return after the spring fishing.
The sun was now shining nineteen hours out of the twenty-four, and
soon it would rise not to set again for months; and so one glorious morning
sail was set, and the Walrus, scorning the lesser baybergs, went ploughing
her way slowly seawards, and in good time reached the whaling grounds.
If Captain Mayne Brace had come to these northern seas merely for
sport and pleasure, he might have had plenty of both. There were seals
enough, though rather scattered; there were bears in abundance, strolling
defiantly on their native ice, or buffeting the billows in search of pastures
new; there were bladder-noses, sharks in scores—oh, in shoals sometimes
—walruses on the ice and in the water, lonely unicorns, and those
marvellous narwhals that go plunging about, and always seem to be going
somewhere on particular business, but never getting there. Yet glorious
times of it the beasts have for all that when they reach shoal water, and can
spear with their wonderful weapons the flat fish and skates that there do
dwell. For my own part I should rather like to be a narwhal for a month or
two in summer. Hammer-headed sharks, too, there were, those hideous
zygænas, and birds in millions; but, alas, for Brace’s pretty barque and her
greedy owners, hardly ever was a true Greenland whale seen or tackled.
And so when the season was waxing to a close, and these monster
whales had babies of their own with which they departed southward to
warmer seas, for their children’s sake, Captain Brace determined one
morning that it was time to bear up once more for Britain’s shores.
Of course the men were down-hearted, because many of them had
families to provide for, and did not want to return with empty pockets. But
“better luck next” is the motto of your Arctic sailor; and when Brace, their
well-beloved skipper, told them that there was considerable probability that
many of them—if they chose to volunteer—would be engaged for an
expedition to the Southern Pole, they regained heart, and made the welkin
ring with their lusty cheers.
When the Walrus arrived at last at Incognita Bay, and the anchor was let
go in a cosy corner, as near to the shore as they could venture with safety,
preparations were immediately commenced, first, for the shipment of huge
blocks of fresh-water ice, and afterwards, for the embarkation of the dogs
and Yak-Yaks they were to take southwards with them.
The bears were going to be the great difficulty. They were splendidly
trained, it is true. But then they were but young; and who could say that
they might not, when at sea, kick over the traces, eat their Yak-Yak keepers,
and become frantically unmanageable?
The whole of the fo’cas’le was turned into a huge bear-den for their
accommodation, and seal-meat in abundance was lowered into an ice-tank,
that, during their long voyage, they might not starve.
It was a happy thought of Slap-dash, a brave Innuit and chief keeper of
the bears, to have trained three of the Yak-dogs to sleep with his monster
pets. The bears had become very fond of these, and growled a good deal at
each other over them at night, but never actually fought.
But for these honest dogs the shipment of the Bruins would have
presented far greater difficulties.
I must describe how this shipment was actually effected. To have roped
the poor beasts would have rendered them savage, and this would have been
rather indiscreet, to say the least. So a large raft was constructed, as well as
a sort of inclined plane of wood, similar to a horse’s ladder. This last was
made fast to the fo’cas’le bulwark above, while the other end was held in its
place, on the sea below, by means of floats and beams from the ship’s
water-line.
The three pet dogs, the bears’ favourites, were easily got on to the raft,
and the Bruins followed. The Innuit himself kept feeding them as they were
being towed all the way to the ship, and while the raft was made fast to the
inclined plane. Then up sprang Slap-dash, and called the dogs to follow.
“Oh,” said the biggest bear, whose name was Gruff, “if that’s your game,
here’s for after.”
And up he went.
In less time than it takes me to write these lines all the lot were
comfortably caged.
They were not quite satisfied with their lot to begin with, however.
They had never been to sea or on board ship before in their lives, though
they had been permitted to swim about the bay many times and oft, and
even to stalk seals for themselves. But to be placed in a den with strong iron
stanchions before it, was a trifle more than they had bargained for.
Slap-dash was a very good master to them, however, and tried to comfort
them in every way that he could. And so did the dogs.
Before I go any further let me mention that bears are almost, if not quite,
as sagacious, in their own way, as cats. Yet the ways of bears are a little
peculiar, and as pets—well, they are not altogether satisfactory. The reason

Textbook Cellular Senescence Methods and Protocols Marco Demaria Ebook All Chapter PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Textbook Cellular Senescence Methods and Protocols Marco Demaria Ebook All Chapter PDF

Uploaded by

Copyright:

Available Formats

Cellular Senescence: Methods and

Protocols Marco Demaria

Bacterial Pangenomics Methods and Protocols Second

Zebrafish Methods and Protocols Koichi Kawakami

SNAREs: Methods and Protocols Rutilio Fratti

Epitranscriptomics: Methods and Protocols Narendra

Metalloproteins: Methods and Protocols Yilin Hu

Nanotoxicity: Methods and Protocols Qunwei Zhang

Autoantibodies: Methods and Protocols Gunnar Houen

Oligodendrocytes: Methods and Protocols David Lyons

Marco Demaria Editor

For further volumes:

Methods and Protocols

ISSN 1064-3745 ISSN 1940-6029 (electronic)

© Springer Science+Business Media, LLC, part of Springer Nature 2019

Cellular senescence is a state of irreversible growth arrest. Originally described as the

Groningen, Groningen, NL Marco Demaria

1 Detecting Cellular Senescence in Reprogramming . . . . . . . . . . . . . . . . . . . . . . . . . . 1

14 Quantification of Autophagy During Senescence . . . . . . . . . . . . . . . . . . . . . . . . . . . 149

Heidelberg, Germany; Deutsches Konsortium für Translationale Krebsforschung (German

PETROS SFIKAKIS  First Department of Propaedeutic Internal Medicine and Rheumatology

Detecting Cellular Senescence in Reprogramming

Key words Cellular senescence, Reprogramming, Cellular plasticity, SA-β-Gal

Cellular senescence is a stable cell cycle arrest caused by stresses

Taken together, the emerging data highlights the importance

2.1 Generation 1. Mouse Embryonic Fibroblasts (MEFs) [14].

2.2 In Vitro 1. Reprogramming medium: Dulbecco’s modified Eagle Medium

2.3 SA-β-Gal 1. SA-β-Gal fixation solution: 2% formaldehyde and 0.2% glutar-

6. 3,30 -diaminobenzidine (DAB) dilution: dilute the 3,30 -diamino-

2.5 NANOG Staining 1. PFA fixation solution: PBS containing 4% paraformaldehyde.

2.6 In Vivo 1. Reprogrammable mouse model [8].

5. γ-Irradiation induced senescence (Optional): After step 1, cells

3.1.3 In Vitro 1. Generating senescence conditional Medium (CM): Incubate

6. Day 6: Seed the infected MEFs onto 35-mm plates in MEF

5. Counterstain with 0.2% eosin at RT. Immerse the slides in the

6. Visualization: add 100 μL of DAB previously diluted (see Note

1. The citric acid–phosphate buffer can be stored at 4 C. Adjust-

5. Eosin solution can be kept at RT and reused after filtering if

1. Baker DJ, Wijshake T, Tchkonia T, LeBrasseur 2. Munoz-Espin D, Canamero M, Maraver A,

DNA Damage In Situ Ligation Followed by Proximity

Genomes are constantly subjected to a plethora of stimuli that can

Despite the importance of DNA damage, the well-established

Cell fixation and

DNA ends blunting

using an antibody recognizing the biotin and a partner antibody

[13]. Interestingly, besides probing for the presence of physical

Prepare all solutions using pure, deionized water and molecular

2.1 Solutions 1. Fixing solution: paraformaldehyde (PFA), 4% in Dulbecco’s

5. DI-PLA Linker: DNA oligonucleotide diluted in water with

2.4 Dedicated 1. 24-well plastic multiwells.

Carry out all procedures at room temperature (RT), unless other-

3.4 Proximity 1. Coverslips are washed twice in PBG for 5 min.

n dots per nuc leus

9. Coverslips are washed in DPBS.

3.5 Imaging Analysis 1. Perform image acquisition with a fluorescent microscope, at a

1. Prepare a stock solution of 10% Triton X-100 diluted in pure

combination of Duolink In situ PLA probes PLUS and MINUS

“MY PRIDE WARRED AGAINST MY BETTER FEELINGS”

“Well, gentlemen, Ingomar being merely my stage name because I played

THE AGREEMENT DRAWN UP AND SIGNED

‘The flag that braved a thousand years

‘In the lexicon of youth which fate reserves

You might also like

PETROS SFIKAKIS First Department of Propaedeutic Internal Medicine and Rheumatology