Name: Harsimran Bhandal

Honors Biology Period 2

11 /01/10
Webquest assignment
1. Tour of the basics
a. What is DNA? DNA are instructions providing all of the information necessary for a living
organism to grow and live reside in the nucleus of every cell.
b. What is the four letter alphabet for DNA and what are the special rules by which the
alphabet pieces bond together? The four letter alphabet for DNA are G for Guanine, A
for Adenine, T for Thymine, and C for Cytosine; the special rules are that A always paris
with T, and C always pairs G.
c. What is a gene? Genes are instruction manuals for our bodies. They are the directions
for building all the proteins that make our bodies function.
d. What are genes made up of? They are made up of DNA
e. How many genes do humans have? 25,000
f. What type of molecule do genes build? They build hemoglobin proteins
g. What is a chromosome? A compact unit in which DNA is packaged into
h. How many chromosomes does a human cell hold? A human cell holds 46 chromosomes
i. How are human sex chromosomes labeled? They are labeled X and Y.
j. Why do scientists use computer programs to model structure and function? They use
computer programs to model structure and function because proteins are very small
and even with an ecectron microscope it would be hard to see them.
k. What is hereditary? Hereditary is the passing of traits from parents to child; it means
something can be inherited from one generation to another
l. Why aren’t children identicial to either one of their parents? They aren’t completely
identical to each other their parents because a mix with their mother and their father; it
is not homozygous
m. In humans, how many chromosomes does each parent pass to their offspring? 23
chromosomes are passed from each parent to each of their offspring.
n. What is a trait? A notable feature or quality in a person.
o. Give an example of how environment can influence a trait. The sun can change the color
of our hair
2. DNA to Protein
a. Write the sequence of DNA nucleotides – ATTACGATCTGCACAAGATCCT
b. Write the sequence of RNA nucleotides here UAAUGCUAGACGUGUUCUAGGA
c. Write the sequence of amino acids here – Met – Leu- Asp – Val – Phen – stop
3. DNA to protein
a. The way the fire flies produce light is that the molecules of DNA are taken into a RNA
molecule where it is copied and taken to ribosome who translates the code and makes it
into amino acids; the new enzyme goes to luciferase and forms a chemical reaction that
makes light.
4. We are all Mutants
a. Describe a silent mutation – A silent mutation is a mutation that is neutral or harmless
b. What are some of the causes of mutations - Some causes of mutation are mistakes
made in copying the DNA before the cell divides or through mutagenic agnets
c. What types of mutations may be passed to offspring – Types of mutations that could be
passed to offspring are mutations that happen in egg or sperm cells.
d. List the four types of point mutations along with the definition of each
 i. NOTE – Healthy protein
ii. VOTE – Mutation though substitution
iii. NOX? – Mutation through deletion
iv. NOPK? – Mutation through addition
e. List the four types of chromosomes mutations along with the
drawing of each. Include the arrows.
i. Deletion
ii. Inversion
iii. Duplication
iv. Translocation
f. Check out genome mutations. What is the cause of down
Syndrome.
i. The cause of down syndrome is that all the chromosomes are the not the same,
but very small.
ii. What is cancer? What are some causes of cancer?
1. Cancer is the diseases where cells grow out of control and invade and
damage normal tissue. Some of the causes of cancer are exposition to
radiation, to certain kinds of chemicals, and certain types of viruses.
5. Might Mutation Maker
a. In the Space below list the name you typed in. Under it write the codons.
b. Your Name – H A R S I M R A N
c. Codons - CAC GCA AGA AGC AtA Atg AGA GCA AAC
6. Hist the buttons for each of the mutations. Give an explanation for each type of mutation below.
Some mutations may not change your name. Make sure to identify these and describe why they
don’t make a difference.
a. Missense - This changes one mutation of one nucleotide in a codon, which results in a
completely different amino acid
b. Nonsense – The Nonsense mutation changes the codon sequence for one amino acid to
a stop codon.
c. Silent – Changes codon sequence for one amino to another codon of the same amino
acid
d. Insertion – Adds a nucleotide to the DNA sequence; changes how rest of the code will be
read
e. Deletion – Removes a more of the DNA sequence