Aakash

® EJ
+i JcE 13

Corporate Office: Aakash Tower, a, Pusa Road, New Delhi-110005, Phone: 011-47623456

MM: 720
FORTNIGHTLY TEST SERIES Time : 3 hrs. 20 min

(tor NEET-2023)
Test-7
Topics covered :
Physics
Moving Charges and Magnetism, Magnetism and Matter, Electromagnetic Induction ·
..
Chemistry: Alcohols, Phenols and Ethers, Ald.ehydes, Ketones and Carboxylic Acids, Amines (Organic
Compound containing Nitrogen)
Botariy
Principles of lnh~ritance & Variation, Molecular Basis of lnh~ritance
Zoology · Reproduction in Organisms, Human Reproduction

Instructions :
(i) There are two sections in each subject, i.e. Section-A & Section-B. You have to attempt all 35 questions from
Section-A & only 1Oquestions from Section-B out of 15. , ·
(ii) Each question carries 4 marks. For every wrong response 1 mark shall be deducted from the total score.
Unanswered / unattempted questions will be given no marks.
(iii) Use blue/black ballpoint pen only to darken the appropriate circle.
(iv) Mark should be dark and completely fill the circle.
(v) Dark only one circle for each entry.
(vi) Dark the circle in the space provided only.
(vii) Rough work must not be done on the Answer sheet and do not use white-fluid or any other rubbing material
on the Answer sheet.
1

PHYSICS)
Choose the correct answer :
,. . ,.•·. SECTJON .I'A\ \:-•"'~".''"0 -~~=::,_ '
(2)1L
~, ' ' ,, .s '!ft -.• ,ii<. i"

1. A thin current carrying long conductor is bent as

shown in the figure given below. The magnetic
field at the centre of the circular arc is
r-+,

(1) Zero
- -- 0

(2) µo/
2r
--
(3)1~ (4)1D
f-+ r-+,
3. The magnetic field at a distance r from a long
(3) µo/ (4) µo2/
4r r current carrying wire is 0.6 tesla. The magnetic
field at a distance 2r from the wire will be
2. The com~ct variation of magnetic field B with
distance frqm a long current carrying conductor is (1) 1.2T (2) 0.3 T
given by: (3) 0.2 T (4) 1.8 T

(1)
 far Medical-2023
ReQU : c - - - - ~ -
. ductors of equal
Fortnightly Test-7 (RM GJ_Code-C ) .
C are Ion g parallel
s shoW in the figure. If
co~
4. The dimensional formula or th e mag netic field is 1 o. A. B and Ing current a th exerted by B on A
length carf'Y er unit Ien~ .
(1) (MLT-2A- 1J -F1 .is the force P .
er uni1 length exerted by c
(2) [MT- 2A- 1J
and
F2 is the force P
se the co
rrect option .
C
(3) [Ml2A-2J A then chOO 'B
2
(4) [M L T-2A-'J of charged
5. .In a cycoI Iron the angular frequency' 8
particle is independent of 2/
oo , I ~ '
(1) Mass
(2) Speed X
(3) Charge

6.
(4) Magneticjield . . . · (1) Fi= 2F2
A proton carrying kinetic energy 1 ~eV is m~vrng
in a circular path of radius R in a uniform (3) ,=; = F2 (4) i=; = -F
2
magnetic field. The energy of an a.-particle to 11. An electron and a proton •having same kinetic
describe a circle of equal radius in the same field energy enter into a uniform magnetic field
will be perp~ndicular to it, then
(1) 2 MeV (2) 1 Me\/ (1) The path of electron is less curved
1 (2) The path of proton is less curved
(3) MeV
2 (4) 4 MeV (3) Path of both will·be equally curved
7. (4) Path of both particles are straight line
The magnetic moment of a current carrying
circular coil of radius r and number of turns N is 12. An electron is travelling with
velocity
M. ·If radius of the coil is doubled keeping number ii= (21 + 3]) mis in a magnetic
of turns unchanged, then magnetic moment field
becomes (Assume current is constant) B= ( 7i + 3]) T . Magnetic force acting on the
(1) M (2) 2M electron will be along
(1) Positive z-axis
. (3) 4M (2) Negative z-axis
(4) M (3) Negative y-axis
.. 4 (4) Negative x-axis
8. 13. The flux through a circular conducting coil of
Correct expression for Lorentz force among the
given option is resistance 20 Q is varying with time (t) as
2

<1) i= = q <E +ax v) $ = 5t Wb. The magnitude of induced cu~rent in

the loop at time t = 1 sis ·
(1) 0.5 A
(2) F = q (E + ii -B) · (2) 1 A
(3) 0.25 A
(3) F = q (E + ii x B) (4) 10 A
14. If a_ square conducting loop is taken out from a
(4) F=q(ExB+ii) region ?f uniform . magnetic field With s eed v as
shown 1n figure Th d' . . P .
9. in the 1oop WIll
. be· en irection of induced current
A charged particle is released from rest in a - .
region of steady uniform electric and magnetic
fields which are parallel to · each other. The
7f
particle will move in a

(1) Straight line x x

(1) Clockwise
·(2) Circle (2) An\cloekwise

(3) Heli~ (3) Depending on sp

I 'd_ _ _ _ _ _ _ _ _ _ _ _{2)---:--
- -~(~4~)__:C:_:y~c_o_, ._
(4) No _ w··11.
current 1 induce
eed of loop
(2)
Regular Medical-2023 Fortnightly Test-? (RMG3_Code-C)

15. . An emf of 8 V is induced across the ends of an 21. If the ratio of horizontal component of earth's
inductor, when the current through it changes
magnetic field to the net magnetic fie Id·,s J3
2 at
from 5 A to 1 A, uniformly in 2 milliseconds. The
value of self-inductance is a place on the earth. The dip angle at that place
·(1) Zero (2) 4 H is
(3) 4 mH (4) 4000 H (1) 30° (2) 60°
16. If a change in current of 0.05 A in one coil·causes (3) 450 . (4) oo
a change in magnetic flux of 0.1 weber in the
22. A bar m~gnet while suspended freely becomes
other coil. The mutual inductance between the
vertical at a place on the earth surface. That
two coils (in henry) is
place must be located
(1) 0 (2) 1
(1) At equator of earth
(3) 2 (4) 3
(2) At poles of earth
17. A 10 mH coil carries a current of 0.1 ampere. The
energy stored in the coil is (3) In northern hemisphere of earth

(1)5x1Q-5 J (2) 10 X 10-s J (4) In southern hemisphere of earth

(3)1x10-5 J · (4} 0.5 J 23. The sl unit of intensity of magnetization is
18 . . A branch of a circuit is as shown in figur~. If (1) Am (2) A m-1
current at the instant is 1 A which is decreasing at (3) A m2 (4) A m-2
the rate of 1000 A s- 1, then potential difference
24. A uniform magnetic field gets modified as shown
between A and B is
below, when two specimens X and Y are placed
1A · 1 mH
A• > WNlt• l1-'111T4B in it.
10 n
5V
(1) 5 V (2) 15 V
(3) 14 V (4) 7 V X
19. Consider the following two statements.
A : Lenz's law is based on conservation of
energy.
B : Direction of induced current, in
electromagnetic induction, is obtained by
Fleming's left hand rule.
The correct option is
(1 )· Only A is correct
(2) Only B is correct
Identify the two specimens X _
and Y.
(3) Both A and Bare correct
(1) Xis paramagnetic, Y is ferromagnetic
(4) Neither A nor Bare correct
(2) Xis diamagnetic, Y is pa ramagnetic
20. A bar magnet of pole strength m and length I is
cut into two equal p·arts perpendicular to its
(3) Xis ferromagnetic, Y is paramagnetic
length, then the magnitude of magnetic moment (4) Xis diamagnetic, Y is diamagnetic
of each part will be
25. The true value of dip at a place is 45°. If the dip
(1) ml ml circle is turned by _60° from magnetic meridian,
(2) 2 then apparent dip is

(3) 2ml ml (1) (2) tan- 1(

(4). 4
(3) 0° (4) tan- 1(2)

(3)
 Regular MedicaI-2
Fortnightly T . -~,;...._-..;:,::'_- 023
est-7 (RM O
,,nd having resistanee r
26. The s G3_COde-C) I s".. d h
f rad u
ssoo .usceptlbill
Th
-:-~----------
ty of a •-
nnealed · · A circular
100P O ,.,agn
etic fiel as s own .1
f
nlforrfl '" the IooP as a unction of
11
saturar Permeability iron at saturation. is 33. I g In u t in
ion is of annealed iron at is rotat n curren
(1) 6 •9 >c 1()-3 H fi re The
the Igu . ·
. ....
.. . .. •· · ·ff::: 80
(3 ) 5.3 >c 10-1 H~m (2) 8.9·>< 10-1 H/m time twil~~~····b( ..... •··· ··••"·
27. !he dimensional~ (4) 6.6>< 10-SH/m ...c@·U,-•·: ··············
,s_ ormula of relative permeability ::::·.:J:ff·:::::::::::::~:r
(1) [MLTO] ....... ~· · ~~!?i.s.WJr.;.e. .-:.
(3) [MLT-2] (2) [M 0Loro1 ~··· . ..
28· Two identical sh (4) [MLT] · ::: :::::\ ... •···· ··· .. ~~ roBc/
2
ort mag t· (2)
moment M each ne 1c dipole p and O of 1tRZwt 2r
th . ' Placed at
e,r axis parallel t a separation 2d, with (1) ·r
fields midway ·(A"' bo each other. The magnetic 2 ( t) (4) zero
f ,v,, etween th d'
o them is turned abo t e ipole is Bo. If one (3) r . co·,Is of radius 1O cm and
field at M is u centre by 90°, magnetic . • circular f
r;:; 34 _ Two concentric d in same plane. I current / is
1) B 20 cm are. place . . opposite direction then the
( 2· o (2)· . both coils 1n .
4 8o flowing in . t the centre is .
magnetic field a . 3
(3) 280
.
(4)
o (1) -µ 0/
5. . (2) -µol
. 2
5 2
29. Magnet_ ic flux changes from 2 Wb t (4 ) ~ µ0/
·1 . o 8 Wb from a 5 1_ 5
co, having resistance 3 n then th • (3) - µo
3
.
, e net charge
pas_sed through the coil is . fi Id t the centre of a circu 1ar current
35 If magnetic Ie a . .
(1) 1 C ( ) C
2 2
a
· loop of radius R is 1 and magnetic field on its
.axial point of distance from its centre is 82.
(4) ~c . . B
2 Then --1 is equal to
30. An electron is moving on a circular path of radius B2 .
r with speed v in a transverse magnetic field B. (1) 2 (2) 4.
elm for it wili be · (3) 8 (4) 16
V SECTION - 8
B
(1) Br
(2)
rv 36 . . In a region of uniform electric and magnetic field
vr both along x-axis, a. charged particle Q is
(3) Bvr _(4) B projected towards the y-direction ·with velocity v.
31.
'
If the input voltage .of a transformer is 3500 volts Then the time in which K.E. of pa·rticle
and the ratio of number of turns in the primary become twice is (m = mass_of charged particle
coil to that in secondary coil is 50 : . 1, then the
'. .
E =electric field, 8 =magnetic field)
voltage in secondary coil is . . (1) t = mv (2) t = qv
(1) 35 V (2) 70 V qE mE
(3) 60'\/ (4J 55 V
(3) t = vE (4) t = BE':"__
32. In the•given ·figure direction of indticed current in qm qm
circular loop is (t -:t. 0) 3i
. . io l 0·1oop If the number of turns per unit' length as welf as
~he length of a ·solenoid are doubled, . the self·
inductance of solenoid will .
1=71 (1) Remain unchanged
(2) Become eight times
( ) Clockwise (2) Anticlockwise (3) Become double
1
. (3) No induced current (4) None of these (4) Become four times

(4)
Regular Medical-2023 Fortnightly Test-7 (RMG3_Code-C)
38. An electric cu·rrent passes through a long straight A short bar magnet has points A and B along its
wire. At a distance 5 cm from the wire, the 43. axis at .distances of 15 cm and 30 cm on the
magnetic field is B. The field at 20 cm from the opposite sides. Ratio of magnetic fields at these
wire would be: points will be
(1) B/6
(2) B/3
A •--~1r-:S-·-+,-i---N7-I- - - - •- B
E )
(3) 8/4 15 cm 30 cm
(4) B/2 (1) 4': 1 (2) 1 :

39. A moving coil galvanometer has N number of ·
turns in a coil of effective area A, it carries a
current /. The magnetic !ield B is radial. The
torque acting on the coil is
(1) NA2B 2 /
(2) N2ABI
(3) 8: 1. ' (4) 3 : 1 '.
44. A bar magnet is hung by a thin cotton th~e~d in a
uniform horizontal magnetic field and is .in t~:
· stable equilibrium state. The energy requi_red
rotate it by 500 is W. Now the torque required to
. keep the magnet in this new position is:

(3) NAB/2 w (2)

(1)
(4) NAB/

40. If all linear dimensions of an inductor are (3) 2W

(4) -
quadrupled, then self-inductance will become 2
(keeping the total number ·of turns per unit length 45. Above curie temperature: ,
constant)
(1) A ferromagnetic substance becomes
(1) 128 times· paramagnetic.
(2) 25 times (2) A paramagnetic substance becom~s
(3) 64 times diamagnetic.
(4) 312 times (3) A diamagnetic substance becomes
paramagnetic. .
41 . A copper ring is held horizontally and a bar
(4) A · paramagnetic substance
magnet is dropped through the ring with its length becomes
ferromagnetic.
along the axis of the ring. Then, the acceleration ·
of the falling magnet while it, is passing through 46. If apparent value of dip at a place in two
the ring is (neglect air resistance) · perpendicular vertical planes ~re 30° . a.nd 45°,
then the true ar:igle of dip at ttiat place ls
(1) Equal to accelera.tion due to gravity ' .
1
(2) Less than acceler,ation due to gravity (1) cot- (2) (2) tan-1 (2)
1
(3) More than acceleration due to gravity (3) cot- (4) cot-1 (.Js)
(4) Depends on the diameter of the ·ring and the 47. A circular loop has a radius of 10 cm and it is
length of the ·magnet carrying current of 0.1 A, its _magnetic moment is
3
42. A length of wire carries a steady current. It is bent (1) nx1Q- Am 2 (2) 4nx10-4Am 2
first to_form a circular plane coil of one turn . The
(3) 25n x 10-4 A m2 (4) 25n x 10-2 A m2
same length is now bent more sharply to give a
double loop of smaller radius. The magnetic 'field 48. For the part of a circuit shown in figure, if current
at the centre caused by the same current is is varying as / = (t2 + 2) A, then potential
diffe~ence between Pl?int A and B at t = 2 s is
. (1) A quarter of its first value
(2) Unaltered
I 2Q L = 0.5 H 3Q
.A•) Wi',W 'Jffil' WNH •B
(3) Four times of its first value r= 2 .n
(1) 44 V (2) 22 V
(4) Half of it~ first value
(3) 12 V (4) 58 V
(5)
Fortnlghu T
49 . The ti....est-7 (RMG3
_Cocte-C) . u"'ber onurns per
n co .. ,e consta
. nt of an . - : - - - - - - - -- - - - ·ng the n ,,. ·
0 J_

the t· nnecting a res1·st inductance coil is 4 ms I ·noid keePI gth is halved and
in,e or of 60 n . . 50. For a so e t its 1en
induct constant is in series with it ·1 length constan, . doubled, then the
ance reduced to 1 , um ction is
respectively and resistance of th ms_- The radius of cross sel noid is· increased by:
( 1) 20 . . e coil are f the so e
lllH, 40 n inductance o (2) 200%
(3 ) ao mH, 20 n (2) 80 mH, 40 n (1) 100% (4) 400%
(4) 40 mH, 20 n (3) 300%

lCHEMISTRYJ
51. In the react·

CHl-6-H
CH 3
ions
SECTION • A
'
"·i'"~•i'~ .~ . compounds,

©
Band Care
o,
-----+A H
~B+c
'
.
(I)
NO
(
11) i
CH3
(Ill)
th .
The correct order of acidic streng is
. (2) II> I> Ill
(1) Benzene (1) I> Ill> II
and propan-2-ol
(3) 11>11l>I ._ (4)_111>1>11 ..
(2) Phenol and propane
_ The electrophile in Riemer Tiemann reaction 1s
(3) Benzene and 57
acetone ( ) Ell (2) : CCl2
1
(4) Phenol and acetone , CHCl 2
(4) : CHCI
52. Th . (3) EB
. e most reactive alcohol CCl 3
1s towards Lucas reagent
58. Boiling point will be highest for . .

(1) OOH (1) A

(3) / ' (
0
A ( ) ~OH
2

(4) / ~
0

OH
(3) CH3QH
53. The colour given by 10
(4 ) ·(CH3)3C - OH
59. Consider the reaction, CH 3MgBr (i) V
(ii) H20
A
'
alcohol in the Victor
Meyer's test is Ais
(1) Blue (1) CH3COCH3 (2) CH3CH2CHO
(2) Green
(3) CH3CH2CH20H (4) CH 3-CH-CH
(3) Yellow . (4) Red -1 3
OH
54. ~ethyl phenyl ether on heating ~ith cone. HCI OH
gives

( 1) Phenol and chloromethane 60. "'""'"'

(2) Chlorobenzene and Methanol · Major product p is
OH OH

1§:l
(3) Chlorobenzene an~ Methane
Br*Br
(4) Methanol and Benzene. (1)
(2)
55. Anisole can be obtained by heating a mixture of Br Br
. ( Br
(1) Methyl chloride and Sodium phenoxide

(4)0
OH OH
(2) Ethyl chloride and potassium phenoxide
(3) Chl9 robenzene and Sodium ethoxide
1,1@__
Br YBr
(4) Chlorobenzene and Sodium Methoxide Br
(6)
 Regular Medical-2023 Fortnightly Test-7 (RMG3 Code-C)
. 61. In the reaction, 66. Among the following, the compound which is
A + Br2 + 4NaOH CH3CH2CH2NH2 + Na2CO3 most reactive · towards nucleophilic addition
+ 2NaB,r + 2H2O reaction is
Compound A is 0
II
(1) CH3CH2CH2CH2NH2 (1) CH 3 -C-CH 3 - (2) HCHO

0 0
II II
(2) CH3CH 2CH 2 - C- NH2 (3) CH 3CH 2 C- CH 3 (4) CH3CHO

0 67. The compound which is most acidic is

II (1) NC - CH2COOH (2) HCOOH
(3) CH3CH 2CH2 - C- OH
(3) CF3COOH (4) CsHsCOOH
0 68. In the reaction,
II 0 0
(4) CH3CH 2 -C-NH 2
A(i) o,
(ii) Zn/H 20 ) +
62. In the reaction,

0- N =NCI+ H--o-NH2 A
Ais
(1) 2, 3-dimethyl pent-2-ene
(2) 2, 4-dfmethyl pent-2-ene ,,
The cc;,lour of the compound A is (3) 3- ethyl pent-2-ene
(1) Orange (2) Yellow (4) 2, 3-dimethyl pentane
(3) Green (4) Blue 69. The structure of the compound with IUPAC .
63. The IUPAC nomenclature of the given compound nomenclature N, N-diethylbutan-1-amine is

0 (1) C2Hs-NH-CH2CH2CH2CH:i .
II (2) C2H5 - N - CH 2 CH 2 CH 2 CH 3
CH 3 -CH= CH-CH 2 -C-OH is I
. CzHs
(1) But-2-ene-1-carboxylic acid ·
(3) C2Hs-NH-C2Hs
(2) Pentanoic acid
CH2CH3
(3) Pent-3-enoic acid I
(4) Pent-2-enoic acid (4) CH 3 CH- CH -CH 2 -NH 2
I .
64. The correct order of boiling points is CH2CH3
(1) CH 3CH 2CH 2CH 2OH > CH 3CH 2-O-CH 2CH 3 >
70. Among the following the most basic compound in
CH 3CH 2CH 2CHO > CH 3CH 2CH 2CH 3 aqueous medium is
(2) CH 3CH 2CH 2CHO > CH 3CH 2CH 2CH 2OH > · (1) (C2Hs)2NH . (2) (C2Hs)3N
CH 3CH 2-O-CH 2CH 3 > CH 3CH 2CH 2CH 3 (3) C2HsNH2 (4) NH3
. CH 3
(3) CH 3CH 2CH 2CH 2OH > CH 3CH 2CH 2CHO >
CH 3CH 2-O-CH 2CH 3 > CH 3 CH 2CH 2CH 3 71 . The product obtained when~ cro,ci, ·,s
(4) CH 3CH 2-O-CH 2CH 3 > CH 3CH 2CH 2CHO >
ly (i)
(ii)H,O' '

CH 3CH 2CH 2CH 3 > CH 3 CH 2CH 2CH 2OH NO2

$OH
CHO
65. In the reaction
dilNaOH
t:,
B , B is
(1) $ ( )
2

NO2 NO2
(1) Prop-2-enal
CHpH COOH
(2) Ethanoic acid
(3) But-3-enal
(4) But-2-enal
(3)~ (4) $
NH 2 NH 2

(7)
Fortnightly Test-7 (RMG3 Cod Regular Medical-2023
- 8-C)
72. Which of the follow· . ---.....:...___ _ _ _ ·ng aryl amines undergo
mg 1s • h foiloWI es
substitution reaction? not an_electrophilic 75. Which of_t :ost readily? .
NH . diazotizat1on
A 2
NH2 · /J\-NH2
ll)- + 3B.i,~•,IHe_ ~ B ,
·y (
(1) (1) NO,"'\d

2) Cl-o-NH2
COOH Br g\_

6
coo (3) CH3-0 NH2
(2) I + ~CHN03+ A,~-
u H.
(
6 ·~
,..,;;; Conct-1 2s0~ 4) F-o-NH2
o~,......c1 o NO2 76. When ethylbenzene ,is reacted with alkaline or
( ) ~.,....0H acidic KMnO4 majorly gives.

6
3 (1) 2-phenylethanol
· , + H20 I: . (2) 2-phenylethanoic acid
(3) Benzoic acid

(0-: :
0 0 (4) Benzaldehyde
II II
V
Anhyd
4) +R-c~c,_A1c1, · ~c, 77. Which of the following compounds will not give
/4 R Fehling's test?

o-~ -?
73. Consiger the. reaction . /4 (1) CH3CHO (2) H-COOH

(3) H-CHO (4) Q c H o

RMgX (i)_ CO2
(u) H o· CH-C-OH
' - . I 78. Consider the reaction
CH 3
R_ CH COOH (ii X2/Red Phosphorus
Identify R 2 lii)H,O R-9H-COOH

(1)0- The above reaction is known as

X

. lH3 (1) Kolbe electrolysis

0-
(2) I/_~ CH-
(2) HVZ reaction

o-CH
(3) Etard reaction
(4) Stephen reaction
(3) 2-
79. The primary alcohol among the following is
~CH2-0H
(4) o - C H2 -CH 2- (1)v

6
. NH 2
(2) 0CH2 -9H -OH
74: CH,-1'/H, aad cao be d;,1;og,;shed by
V CH3
CH 3
I
using
(3) 0f-OH
(1) Brz/H20 VcH 3 ·

(4)6
(2) Carbylamine test OH
(3) Hinsberg's reagent
(4) Tollen's reagent
(8)
Regular Medlcal-2023
Fortnightly Test-7 (RMG3 Code-C)
80. Match compounds given in List-I with their names 84 . Which among the . following amine _can be
in List-II.
prep~red by Gabriel phthalimide synthesis? ·
List-I List-II (1) CH3CH2NH2

Q
a. (i) (2) CH 3 - CH 2 .- NH - CH 3
Glycerol
. NH 2

OH
(3)@
CH 3 -N-CH 3
b.

¢
OH (ii) Cresol
(4) @
85 . • Consider the following reacUon sequence.
OH (CH 3CO)i0 Br2 B
Aniline --'-.......;~ A ~ - - ~
C. OH (iii) Catechol Pyridine Acetic acid
Identify B_

&sr
&OH
/4
NHCOCH3

d. OH OH OH (iv)
~Q Br
Quinol (1)l8) (2)l8)
I I I
CH 2 -CH-CH 2
I NHCOCH 3 NH 2
(1) a(iv), b(ii), c(iii), d(i) (2) a(ii), b(i), c(iv), d(iii)
(3) a(ii), b(iv), c(iii), d(i) (4) a(i), b(iv), c(ii), d(iii)
81. Which among the following compounds can give
(3) l$J
Br
(4) $ Br
iodoform test?
SECTION - B
· ~COCH 2CH 3 .
. (1) (2) CH3CH2CHO · 86. Statement I: Alcohols are Bronsted acids .
Statement II: Alcohols are stronger acids than
(3) CH3CH2OH (4) PHCOOH phenol.

82. The · most suitable reagent for the following In the light of above statements, select the
correct option.
conversion is
( 1) Both statements I and II are correct
CH 3 ~CH=CH-CHO CH 3 -CH=CH-CH 2 OH
(2) Both statements I and II are incorrect
(1) PCC (2) H2/Ni
(3) Stat~ment I is incorrect but statement II is
(3) KMnQ4/H+ (4) NaBH4 correct
83. The product P in the following reaction is (4) Statement I is correct but statement II is
. (i) CH 3CN dry ether p
CH 3 -CH-CH 2 -MgCI • incorrect
I (ii) H,O
87. The correct order of acidic strength is given by

(a)$
CH 3
OH OH
(1) CH 3 - CH - CH 2CH 2NHOH
I
CH 3
.

(2) CH 3 - CH - CH 2COCH 3
(bl@
• I

$
NO2
Cf:i3·
OH
I
(3) CH 3 - C - CH 2CN (c) (d) C2HsOH
I
CH 3
CH 3
(4) CH 3 - CH - CH 2 CHif,jH 2 (1) a<b<c<d · (2) d < c < b < a
I
CH 3 (3) a< d < c < b (4) d < b < c < a

(9)
Fortnightly Test-7 (RMG3 C Regular Medi"'I
_ Ode-C) """<0<3
88. The major Product . . d when a carbonyl comp
t obtalne . Cuna
The produc 'th NH20H ,s
93.
&~H •(CH::::~~= "•ctlon O
react w1
is made to (2) Schiffs base
(1) !mine (4) Hydrazone
·me
COOH (3) ox, , roduct formed in the follow·
(1) &C0CH 3
COOH . 94. Ident·ty
1
the maior P ing

0
II
(2)
6
,'!:
0COCH 3 reaction

CH3-CH2-
0
II
CHO+ NH1-C-NH-NH2 ~
0
•
-
C-ococH OH

(3) &OH ' (4) o~H t-NH-C-NH 2

(1) CH3-CH2- H .
11

89. The product obt . 0

II
treated w·th
1 ained When tert-butyl alcohol is C = N _ C - NH - NH 2
· copper at 573 K is (2) CH3-CH2- 0 .
(1) Butanone ( ) OH
2 8 utanal 11
(3) 2-methyi prope H -t-NH-C-NH-NH 2
Th ne (4) 2-methyl propane (3) CH 3 -C 2 H
90. e Products A and B respectively are 0
· H,so, II .
43 (4) CH 3 - H
C 2 -C=N..:.NH -
-C-NH 2
CH3CH 20H ~ K A
H,so; 95 Which of the following reagent is most suitable for
B
413K · conversion
. of carboxylic acid to acyl chloride?
( 1) CH2 :: CH2 and CH3~H20CH2CH3 (1) Cl2,AICb (2) SOCl2
(2) CH = CH and CH2 = CH2 (4) PCls
(3) PCb
3
( ) CH 3CHQ and CHJCOOH
96. Consider the following reaction sequence and
OH identify the product B.
4 I
( ) CH = CH and CH 3CH - CH _ COOH NaCN A B
91 2 CH3 - CH2 - Cl CzHsOH
· · The major pr~duct obtained when
HC =CH Hg' ' , H,so, (1) CH3 - CH2 - CH2 - NH20H
(2) CH3CH2 -NH20H
(1) CH2 = CHOH
(2) CH3CH20H (3) CH3 - CH2 - CH2 - NH2
(3) CH3COOH
(4) CHJCHO .
(4) CHJ-CH2- NH2
92 .
Statement I: Methanal is a gas whereas ethanal . 97.
is a volatile liquid at room temperature. Which among ·the following give alkali soluble
product in Heinsberg reagent?
Statement II: Lower members of aldehydes and
keton~s are immiscible with water. (1)
I NH
/'v 2
In the .light of above statements, select the
correct option . (2)
(1) Both statements I and II are correct
(
(2) Both statements I and II are incorrect (3) ........,t
(3) Statement I is correct but statement II is
incorrect NH_/
(4) Statement I is incorrect but statement 11 is
correct
(4)@
(10)
 Regular Medical-2023 Fortnightly Test-7 (RMG3 Code-C)
98. . Which among the f0 II . . . N02 OH
test? owing can give carbylamine

(3)@and@ (4)@and@
CH 3
I
(1) CH3-C-NH 100. The final product B in the following reaction
I 2
· sequence is
CH 3
(2) CsHs - NH - _C2Hs
(3) CHJ - CH2 - NH - CH 3

(4) (C6H5 \N
.$"' "'NO2
A
Sn/HCI

99.@---b:
OCH 3 3
N~CI" Ho
~ Br
(1)0
y-1--sr (2)y

NH2 NH 2

.(3)0
The product A and B respectively are OCH 3 OCH 3
OH NO 2 NH 2 OH
l•l
(1)@ and@ (2)@ and @ y-1--sr
NO2
~Br

N02

[ BOTANY l
SECTION -:A , ,, (3) Genetic variation in a population arises due
101. Which of the given diseases is caused by to mutation only.
muta! ion of the gene controlling ~-chain of (4) Phenotype of an · organism is the result of
haemoglobin? genotype and environment interaction .

(2) Sickle-cell anaemia 104. Select the correct option w.r.t. labels P, Q, Rand
(1) Colour blindness
S in the given flow of genetic information.
(3) Phenylketonuria (4) Haemophilia
Pr;:;-~
~A 7
Q
mRNA
R
Protein
102. Study the pedigree chart given below.
p Q R s
Reverse
(1) Replication Transcription Translation
trans cription

Reverse
(2) Replication Translation Transcription
transcription
The trait traced in above pedigree chart is
Reverse
(1) Dominant X-linked (3) Transcription Replication Translation
tran scription

(2) Y-linked Reverse

(4) Transcription Translation Replication
transcription
(3) Autosomal dominant
105. Mating between relatives is represented by
(4) ALltosomal recessive
103. Select the • incorrect statement from the (1)0-0
following. (2) D==O
(1) Phenylketonuria is an inborn error of
metabolism.
(2) Test cross involves crossing between F1
hybrids and recessive genotype of parent. l•l°r
(11)
 Regular Medi
Fortnightly Test-7 (RMG 3_Code-C) -------- ~
~~.:..:.:::..:....i:~~~~---------- ,
:1:06
· ~olour blindness is a/an 113 Read the 10
llowing statements and choos
e the
1 . . for the correct one(s).
( ) X-linked recessive disorder option k d

(2) X-linked dominant disorder (a)

1
;N:
rokaryotes, the pac .age structure
is called nucleoid or genophore. Of
(3) Autosomal recessive disorder k ryotes DNA is found in cytoplas
(b) In pro a ' rn in
(4) ~utosomal dominant disorder super coiled stage.
107. The disease in h' h . . DNA packaging in prokaryotes requires n
. w ic a simple cut results in (c) . on.
continuous .bleeding for a very long lime is histone proteins.
(1) Haemophilia (2) a Th • (1) (a) only
• a1assemIa
(3) Phenylketonuria (4· (2) (b) only
) P· Thalassemia
108. Select the.correctly matched pair. .(3) (c) only
(Organisms) (G . (4) All (a), (b), (c)
enome size) 114. A colour blind man marries a woman who is the
(1) x 174 48502 bp carrier for haemophilia. What is the probability of
bacteriophage their offspring having alleles for both color
(2) "' phage blindness and haemophilia?
5386 bases
(3) E.coli (1) 3/4 (2) 118
4.6 X 106 bp
(4) Human (3) 1/2 (4) 1/4
3.3 X 106bp
109. a-thalassemia is due to mutation in the 1.15. The unequivocal proof that DNA is• the genetic
m~terial came from the experiment of
(1) Gene HBB on chromosome-16 only
(1) Fniderick Griffith
(2) Genes HBA1 and HBA2 o~ chromosome 16 (2) _Oswald Avery, Colin Macleod & McCarty
(3) Gene HBB on chromosome 11 (3) Alfred Hershey and Martha Chase_
4
( ) Genes HBA1 and HBA2 on chromosome 11 (4) Matthew Meselson and Franklin Stahl
110
· Name th e pheno~enon which results in an 116. Who first carried out crosses in Drosophila to
. increase in a whole set of chromosome ·in an study genes that were sex linked?
organism due to failure of cytokinesis after (1) T. H. Morgan
lelophase stage of cell division.
(2) Walter Sutton
{1) Polyploidy (2) Aneuploidy (3) G. J. Mendel
(3) Haploidy (4) Heterozygosity (4) Bateson
111. A sterile female with rudimentary ovaries and lack 117. In a population of honey bees, drones
of other secondary sexual characters are the (1) Are sterile
characteristics of
(2) Are diploid individual
(1) Down's syndrome
(3) Have 16 chromosomes
(2) Sickle cell anaemia (4) Are developed after fertilisation
0

(3) Klinefelter's syndrome 118. In a Mendelian dihybrid cross out of 16

(4) Turner's syndrome individuals in F2 generation, how ~any were of
non-parental phenotypic combination?
112. To determine .the structure of DNA, the fine X- (1) Nine
Ray diffraction data was produced by
(2) Ten
(1) F. Miescher (2) Wilkins and Franklin
_(3) Six
(3) Erwin Chargaff (4) Frederick Griffith (4) Four
(12)
Regular Medical-2023 Fortnightly Test-7 (RMG3 Code-C)
t
119. The disease sickle cell anaemia is caused due to (3) 50% daughters would be carrier for colour
substitution of blindness .
(1) Glutamic acid by valine at the first position of (4) All daughters will be colourblind .
a-globin chain of haemoglobin · 126. DNA as an acidic. substance present in nucleus
(2) Valine by glutamic acid at the first position of was first identified by
~-globin chain of haemoglobin (1) Francis Crick (2) James Watson

(3) Glutamic acid by valine at the sixth position of (3) Friedrich Meischer (4) Rosalind Franklin
~-globin chain of haemoglobin 127. According to Watson and Crick model, the pitch
(4) Valine by glutamic at the sixth position of of a DNA helix is
a-globin chain of haemoglobin (1) 34 nm (2) 3.4 nm

120. Which of the following is an autosomal dominant (3) 0.34 nm (4) 3.4 µm
disprder? 128. In nucleic acid (DNA or RNA), two adjacent
(1) Sickle-cell anaemia nucleotides are linked through
(2) Myotonic dystrophy (1) Peptide bond
(3) Thalassemia (2) · Ionic borid

(4) Colour blindness (3) 3' - 5' Phosphodiester linkage

121. Down's syndrome is dµe to (4) Hydrogen bond
( 1) Loss of X chromosome in female · 129. 5-methyl uracil is found in

(2) The presence of an additional copy of the (1) mRNA (2) DNA
chromosome 21 (3) Proteins (4) Lipids
(3) Gain of an extra X.chromosome in male 130. Which of the following is not related to
(4) Loss of an chromosome in 21 st pair .Klinefelter's syndrome?

122. Monomeric units of both DNA and RNA are · (1) Gynaecomastia

· (1) N.ucleotides (2) Nucleosides (2) Trisomy of autosome

(3) Nitrogenous bas~s (4) Pentose sugars (3) Chromosome complement is 44 + XXY.

123. A nitrogenous base is· linked througti N-glycosidic (4) Sterility

linkage at· · . . of pentose sugar to form 131. Select odd one out w .r.t. stop or terminator
nucleoside. codon .
Fill in the blank with correct option. (1) UAA (2) UGG
(1) 3'C (2) 5'C (3) UAG (4) UGA
(3) 1'C (4) 2'C 132. In '.ac ~pe~on, ~hich gene c_odes for an enzyme
124. Phenylketonur-ia is which is pnmanly responsible for the hydrolysis of
disaccharide, lactose? .
(1) An autosomal recessive disorder
( 1) Y gene (2) a gene
(2) An autosomal dominant disorder
(3) i gene (4) z gene
(3) An X-linked recessive disorder
133. In human genome, which chromosome has most
(4) An X-linked dominant disorder genes?
125. A colourblind man marries a woman whose father (1) X Chromosome (2) Chromosome 1
was colour blind. Choose the correct statement (3) Y Chromosome (4) Chromosome 21
regarding their offsprings.
134. VNTR belongs to a class of sateliite DNA referred
(1) 50% daughters will be colourblind and none to as
of the sons will be affected .
(1) Macro-satellite { 2) cDNA
(2) 50% son wi_
ll be carrier of colour blindness .
(3) STRs (4) Mini-satellite

(13)

J
FortnighUy Test-7 (RMG3_Code-C) Regular,,
"'8d'
135. In an mRNA segment having translation unit, the 142. In which of the following disord '<:a 1-<o<3
untranslated region is individual possesses 45 chromosorn ers affect
es? ed
(1) Part of translational unit (1) Turner's syndrome
(2) Present after start codon (2) Down's syndrome

(3) Present before start codon and after stop (3) Klinefelter's syndrome
codon (4) Haemophilia
(4) Not required for efficient translation 143_Which of the following mRNA has a Iran
. unit that will translate to a polypeptide ch ~lation
SECTIO_
N -B a1n 0
amino acids? 16
136. In a Mendelian monohybrid cross, a cross
(1) 5'AUGUUAAUAGACGAGUAACGAAuu3,
between F, hybrid and a dominant parent gives a
genotypic ratio of ·(2) 5'AUGAUAGAGCAAUAGGACUUAUGAa,

(1) 1 : 1 (2) 1 : 2 (3) 5'AUGAUAUGACAAGACUAACCA3•

(3) 3 : 1 (4) 1 : 4 (4) 5'AUGCCCAACCGUUAUUUAUAGAAa•

137. Mark the incorrect match w .r.t. Mendelian cross. 144. The initiation factor as~ociated with the RNA
polymerase holoenzyme in prokaryotes, is
(1) Monohybrid phenotypic ratio -3 : 1
(2) Dihybrid genotypic ratio -1 : 2: 1 : 2-:° 4: 2: 1 (1) Alpha (2) Beta
:2 :1 (3) Omega (4) Sigma
(3) Monohybrid genotypic ratio -1 : 2: 1 145. Select the correct match.
· (4) Di hybrid phenotypic ratio -3 : 2 : 2 : 1 (1) Alec Jeffrey - Gave clover-leaf
model of !RNA
138. Genotypically, how many types of gametes will
be produced by an individual with AaBBCc (2) Watson and Crick - Coined the term
genotype? genetic code

(1) Four (2) Two (3) Jacob and Monad - Proposed operon
(3) Six (4) Eight model ir) bacteria
139. Who was the first amongst .these to demonstrate (4) Nirenberg - Explained double
the scientific basis of inheritance and variation by helix structure of
conducting hybridisation experiment? DNA
( 1) Hugo de Vries 146. Which of the following is not a part of
(2) Gregor Johann Mendel transcription unit in DNA?
(3) Thomas Hunt Morgan (1) Promoter (2) Ter~inator
(4) Punnet (3) Repressor (4) Structural gene
140. Mendel selected pea plant due to many reasons. 147. Which of the given histone proteins is/are not a
One of those reasons is that part of histone octamer in nucleosomes?
(1 ) It completes its life cyc;le in one season (1) H3andH4
(2) It produces few number of seeds (2) H1 only
• nt for pollination
(3 ) • It require externa 1age (3) H2A and H2B
4 Pea has little nun:iber of alternative traits .
(4) H1 and H•
( ) · enes -responsible for skin
141 . Considering three ghenotypes are possible in 148. In which of the given organisms, Taylor et.al.
colour how many ~her and father both are have proved semicon servative mode of
children when mo chromosome replication by using 3H-thymidine?
mulatto? (1) Vicia faba (2) E. coli
(2) 15
(3) Bacteriophage (4) Streptococcus
(1) 16 (4) 20
(3) 7 (14)

d
~:g~ul:a~rM~e:d:ica~l-2:0~2~3=--=-~ - : - - - - - - - - - - - - - - - - -~F~orl:!!:n~ig~h~tly~T~e~st:-7
:.!.J(~R:::
M:.::G~3=-C-:--
_o_d_e-_C)
149. In eukaryotes, the RNA polymerase II transcribes 150. ln ·eukaryotes, euchromatin region ,
(1) Precursor of mRNA ( ) Is more densely packed
2 1
( ) tRNA, 5S rRNA and SnRNA (2) Stains dark
(3) 28S rRNA (3) Is transcriptionally active
(4) 18S rRN_A and 5'.8S rRNA (4) Is loosely packed but stains dark

(ZOOLOGY)
SECTION -A blastomeres is called
158. Embryo with _ __
151. Select the part of female reproductive tract that morula.
receives sperms/semen during insemination .
Select the option that correctly fills th e blank: .
. (1) Oviducts (2) Cervix
(1) 2-4 (2) 8-16
(3) Vagina (4) Uterus (3) 3-5 (4) 4-6
152. In humans, . fertilisatio!'l occurs in
159. Fate of inner cell mass in humans is to form
region of fallopian tubes.
(1) Germ layers
Choose the option that correctly fills ttie blank.
(2) Trophoblast
(1) lnfundibulum (2) Fundus
(3) Morula
(3). Fimbrae (4) Ampulla
(4) Blastocyst
. 153. Which among the following is a diploid structure?
.. . 160. In human, embedding of blastocyst in the
(1) Ovum (2) 1st polar body endometrium of uterus is called
nd
(3) 2 polar body (4) Primary oocyte (1) Menstruation (2) Ovulation
154. Cells surrounding zona pellucida layer of the . (3) Implantation (4) Copulation
ovum form 161 . 'X' are finger like projections that appear on the
(1) Corpus luteum trophoblast after imP,lantation.
(2) Semiriiferous~tubul,es Select the option that correctly identifies 'X'.

(3) Gqr?na .radiata (1) Flagella (2) Cilia

(4) Uterine muscle (3) Chorionic villi (4) Microyilli

155. Choose the correct .statement. 162. Increased levels of estrogen, progesterone,
cortisol, prolactin and thyroxine are observed
(1) All copulations lead to.fertilisatioq.
during
(2) Ovum is released by uterus. ._
(1) Pregnancy
(3) Generally, only on_e sperm rfertilises,an ovum.
(2) Sper~,iogenesis
· (4) Sperm can · fuse with .second polar body to
(3) Fertilisation
yiel9 a viable zy_
gote.
(4) Oogenesis
156. Sex of a huma11 baby is determined b,y
r 163. First movement of foetus is usually observed
(1) Size of ovum during which month of pregnancy?
(2) Siz_e of sperm (1) 51h month . (2) 81h month
(3') Sex chromosom·e of ovu~ (3) _2 nd
month (4) 181 month
(4) Sex chromosome of sperm 164. Process of delivery/expulsion of the foetus from
157. Cleavage in zygote usually starts in the uterus is termed
(1) Fallopian tube (2) Ovary (1) Insemination . (2) Lactation
(3) Endometrium (4) Birth canal (3) Parturition (4) Micturition
(15)
 ~ \.\
.:.F...:o;.:..rtn
::..c.,ig'-'-h--=ll.,_
y...:T...:e:.::
s..:...
t-..:...
7i(R :....:.:..:.
M:..:G:..:3:::-...:C:..:od
:..::.::e_-C
c:...)< - - - - - - - - - - -- ;---:-=-::-=--:---:-::--=--- - - - -----.'.R~e:.lgtu!_l_laar Me . \r
165. Choose the correct match w.r.t. hormones 170. Rupture of Graaffian follicle is mainl . diea1.i0< \
· Ymdu 3
involved in the given processes. (1) Estrogen ced by

( 1) Parturition Cortisol, estrogen, (2) Prolactin

oxy'tocin · (3) Luteinizing hormone

(2) Menstrual cycle Relaxin, hCG (4) Follicle stimulating hormone

171. Primary spermatocyte is
(3) Lactation Testosterone, LH similar
spermatogonium in to
(4) Spermatogenesis - Estrogen, FSH (a) DNA content
(b) Location
166. All of the given .s tatements are true w.r.t. follicular
ph1:1se of menstrual cycle except · (c) Number of chromosomes
(1) The menstrual phase is followed· by the Select the option with correct set.
follicular phase . (1) aonly (2) a,bandc
(2) Primary follicles grow t~ become a fully (3) band c only (4) only c
mature Graafian folli.cle.
172. Bulbourethral giands secrete a substance wh·
• . ICh
(3) Secretion of LH and FSH deer.eases (1) Nourishes the sperms
. gradually during the phase.
(2) Makes semen acidic
(4) Estrogen is produced by growing follicles in
(3) Kills pathogens
this phase.
(4) Lubricates the penis
167. In a human female, menstruation can be deferred
by the administration of 173. Choose the incorrect statement w.r.t. uterine
wall. _
(1) Only FSH
(1) It is highly distensible.
(2) Only LH
(2) Perimetrium is the outermost layer.
(3) Combination of LH and FSH
(3) Myomefrium consists of skeletal muscles.
(4) Combination of estrogen and progesterone
(4) Endometrium undergoes cyclical changes
168. Select the incorrect statement w .r.t. during menstruation.
implantation. , ·
174. Choose the mismatch w.r.t. approximate life
( 1) It is the · attachment of blastocyst stage of span .
embryo.
(1) Crocodile - 180 years
(2) It leads to p~egnancy. · (2) Crow - 15 years ·
(3) Formation of placenta for nutrient enrichment (3) Parro~ - 140 years
of foetus takes place·.
(4) Tortoise - 110 years
(4) Blastocyst in the region of embryonal knob
175.. Simple binary fission is seen in
adheres to the myometrium. ·
(1) Amoeba (2) Planaria
169. Choose the incorrect statement regarding
menstrual phase of menstrual cycle under normal (3) Euglena (4) Paramecium
conditions. ' 176. Animal which reproduces by gemmule formation ·
is
(1) It lasts for 3-5 days.
(1) Hydra (2) Obelia
(2) LH and progesterone decreases but estrogen
increases during this time. _ (3) Spongil/a (4) Paramoecium
(3) About 30-40 ml of blood is lost 177. Choose the odd one w .r.t. seasonal breeders.
(4) Occurs due to breakdown of endometrial (1) Sheep (2) Cow
lining (3) Dog (4) Human

(16)
 Regu la1rr- ,M~e::;d::.:lca;;;;;l~-Z_O_ZJ_~~----------------___!F:_!:o~rtn~i~h~ll'f_~Te::::s~l-:,_7,l.'..(R~M::,:G:::.:3:a:-.;;C~od_e_·C
.....)
:,.;:;.:::----
_ Chromosome num beri n meIocyte
· .of fruit fly is SECTION •
178 8
2 12
(1) 46 ( ) 186. Which of the following events does not occur
(3) 8 (4) 16 during embryogenesis?

179 _Select the bisexual animal. · (1) Cell differentiation

(1) Human (2) Earthworm (2) Cell divisi<?n
(3) Cockroach (4) Frog . (3) Cell modification

180. Menstrual cycle is not seen in (4) Syngamy

(1) Rat 187. All of the following hormones are produced only
(2) Human during pregnancy, except
(1) Relaxin
3
( ) Ape (2) hCG
(4) Old world monkey
(3) hPL
18 1. Choose the event that does not takes place
under favourable conditions in Amoeba. (4) Proge sterone
(1) Production of pseudopodiospores 188. The male sex accessory ducts include all of the
given structures except
(2) Withdrawal of pseudopodia ( ) Rete testis
1
(3) Sporulation (2) Vasa efferentia
(4) Binary fission (3) Epididymis
182. Complete the analogy by selecting the correct (4) Fimbriae

option. 189. Select the incorrect statement w.r.t. female

Corpus luteum : Progesterone : .: lnterstitiai cells : reproductive system.

(1) Each fallopian tube is about 10-12 crri long.

(1) FSH (2) LH
(2) Fimbriae helps in the collectlon of sperm after
(3) Androgens (4) GnRH insemination.
183. The process of release of sperms from the (3) Female reproductive system consists of a
seminiferous tubules i\'> called pair of ovaries.
(1) Spermiogenesis (4) Each ovary is' about 2 to _4 cm i_~ length.
(2) Spermiation 190. During oogenesis, first polar body is formed
(3) Spermatogenesis within

(4) Spe'rmateliosis (1) Primary follicle

184. The signals for parturition originate from (2) Secondary follicle
. • • J
(3) Mature graafian follicle
(1) Fully developed foetus and placenta
(4) Tertiary follicle
(2) Birth.canal
191. If the life span of crocodile is 'A' and of parrot is
(3) Developed ovaries
'B' then select the correct relationship among the
(4) Only placenta following.
185. Breast feed.ing ·is highly recommended by the (1) A=2B+10
doctors becaus,e Jhe colostrum is enriched in
(2) B = 3A-40
(1) lmmunoglobulin A
(3) A= 2B
(2) Growth hormones 2
(3) Prolactin
(4) B = 2A
(4) Macrophages 2
(17)
!F~ort:!!:n~ig~ht~ly_]:T_!
es~t-!._
7J! ~G~3~_C
(R~M ~od
~e-~Cl_)- -- -----:----=--:---::---:::;:::=:~===-~= Re:_g::
gular Med·
2 R of aca1·ioi3
1
19 . ead the statements care fuII y an d se1ec . t the 197. In the following question, a statement
correct option. (A) is followed by a statement of reason (;sertion
Statement I: Zygote is diploid in nature in
'd .
A : Zona pe II uci a is a non-cellular
).
1
humans. surrounds an ovum. ayer lhat
Statement II: It is formed by the fusion of haploid R : Zygote undergoes repeated meiotic divi .
nucleus of-sperm and that of ovum. to form the blastocyst in humans. 81 0ns

(1) Both statements I and II are true and Choose the correct option.
statement II is correct explanation of (1) Both assertion and reason are true and
statement I. reason is the correct explanation f lhe
(2) Both statements I and ll are incorrect. assertion ° lhe

(3) Only statement I is correct. (2) Both assertion and reason are true but
(4) Only statement II is correct. reason is not the correct explanation of th e
193. At the end of meiosis, only one set of . .
assertion the

chromosomes gets incorporated into each (3) Assertion is true statement but reason is f
. 1
a¾
(1} Primary spermatocyte (4) Both assertion and reason are false
(2) Primary oocyte statements

(3) Male germ cell 198. Select the odd one w.r.t. animals exhibiting
(4) Gamete internal fertilisation .
194. Certain cells of inner cell mass have the potency (1} Bony fishes
to give rise to all the tissues and organs are (2) Reptiles
named as
(3) Birds
(1} Stem cells (2) Meiocytes
(4) Mammals
(3) Chorionic cells (4) Polar bodies
195. Select the incorrect statement w.r.t. human 199. Read the following statements. Choose the
reproduction. correct option.

(1} Relaxin is secreted by the ovary. . Statement A: The period from birth to the
natural death of an organism is called life span.
(2) Corpus luteum and placenta acts as an
temporary endocrine gland . Statement B: Maximum life span is the
characteristic of species.
(3) The stroma of ovary .is divided into two zones
namely an inner cortex and a peripheral (1) Both statements are incor~ect
medulla. (2) Both statements are correct
(4) Cyclic menstruatior:, is an indicator of normal (3) Statement A is correct but B is incorrect
reproductive phase.
(4} Statement B is correct but A is incorrect
196. · Identify the incorrect match.
200. Which one is not the feature of asexual
(1) Acrosome - Assist in fertilisation of reproduction w.r.t sexual reproduction?
the ovum.
(1} it is more complex than sexual reproduction.
(2) Lactiferous duct - Milk is sucked out
(2) It is uniparental.
(3) Clitoris · - Lies at the junction of
(3) The young ones are exact. replicas of the
two labia majora parent.
(4) Alveoli Secrete and store milk
(4) It is a rapid mode of reproduction .

D D

(18)