Exercise 2: Gene expression

The Central Dogma, Gene Regulation and Intracellular Protein Sorting

Thomas Bentin

Department of Cellular and Molecular Medicine

Faculty of Health and Medical Sciences

University of Copenhagen

1
RELEVANTE LÆRINGSMÅL FRA FORELÆSNINGERNE

• Beskrive cellens sekretoriske pathway

• Beskrive hvorledes proteiner føres til endoplasmatisk reticulum (ER) ved hjælp af ER signaler, SRP, SRP
receptor og translokations kanal
• Beskrive forskellen på konstitutiv og reguleret sekretion (exocytose)
• Beskrive hvorledes nukleære proteiner efter biosyntese dirigeres til kernen
• Beskrive proteinimport i mitokondrier
• Angive processerne for overførsel af genetisk information med baggrund i det centrale dogme
• Redegøre for begreberne ”gen” og ”transskriptionsenhed”
• Redegøre for begreberne gen og kromosom
• Redegøre for RNA polymerase funktion
• Redegøre for en promoters funktion, herunder TATA-boks og transskriptionsinitiering
• Redegøre for forskelle og ligheder mellem pro- og eukaryot transskription
• Redegøre for rapportørgen
• Redegøre for restriktionsenzymer samt restriktionsanalyse, herunder fortolke et standardresultat
• Redegøre for nukleinsyreanalyse ved gel-elektroforese, herunder fortolke et standardresultat

2
LEX 1: The Central Dogma of Molecular Biology
According to the Central Dogma of molecular biology, there are three “general transfers” of genetic
information flow in the cell: DNA à DNA (replication), DNA à RNA (transcription), and RNA à protein
(translation) (figure 1). Gene expression via these information transfers is conserved in all living organisms.

In this exercise we will use bacteria to exemplify how expression of a gene of interest depends on the
general information transfers stated in the Central Dogma. For this purpose, we will use specific chemical
inhibitors (antibiotics) that specifically block these transfers of information: ciprofloxacin inhibits
replication, rifampicin prevents transcription, and chloramphenicol blocks translation (see figure 1; more
detailed information in the Glossary).

You will set up an experiment designed to measure the impact of these antibiotics on bacterial gene
expression and growth. The obtained results will be used to discuss the Central Dogma. The exercise also
illustrates how many bacterial promoters function.

Ciprofloxacin

DNA
Inducer Rifampicin

RNA
Chloramphenicol

Protein
Figure 1. The Central Dogma of molecular biology with the genetic information transfers targeted by the
indicated antibiotics. The inducer (see below) promotes transcription. Arrows: DNA à DNA (replication),
DNA à RNA (transcription), RNA à protein (translation).

3
The reporter gene: a controlable read-out of bacterial gene expression

As read-out of gene expression, we are using a reporter gene that has been introduced into the bacteria.
Reporter genes are commonly used tools that allow us to study gene expression. They are synthetic DNA
constructs that are introduced into the organism under investigation and require two key elements: a
reporter and a promoter. The reporter is typically a protein not usually present in the organism under study
– in this case we use a protein called GFP (Green Fluorescent Protein). GFP is easy to detect: cells that
express GFP glow green, if stimulated with light of the appropriate wavelength. The promoter regulates
whether the GFP reporter is expressed.

In this case, the reporter gene contains an inducible promoter. This means that we can experimentally
regulate whether the promoter is active or not. The promoter we use is derived from the arabinose operon.
Presence of arabinose (the ‘inducer’) stimulates expression of genes under the control of this promoter.
The reporter gene we utilize therefore expresses GFP protein when you add arabinose to the bacterial
culture (figure 2). The way arabinose regulates the promoter is illustrated in figure 3.

Figure 2. GFP as a reporter gene in bacteria.

w/o inducer + inducer Bacterial strain harbouring the reporter gene
plasmid streaked onto ampicillin-containing LB
agar plates without (w/o; left plate) and with
0.2% arabinose (right plate). The plates were
imaged under GFP excitation. The bacterial
strain growing in the presence of the inducer
glows yellow-green, because the arabinose
promotes expression of the GFP reporter gene.

Figure 3. Schematic drawing of the

reporter gene elements. araC
encodes the araC transcription
factor. araC is constitutively (at all
times) expressed and binds to the
araB promoter (ParaB). In the absence
of arabinose, araC acts as a repressor
and prevents GFP expression.
Arabinose can however bind to araC
– this induces a conformational
change which turns araC into an
transcriptional activator – therefore
arabinose induces GFP expression. Not shown here is that the reporter was cloned into a plasmid, which
was transformed into the bacteria. The plasmid contains an origin of replication and an ampicillin resistance
gene allowing only transformed bacteria to grow in ampicillin-containing media.

4
Experimental design – overview and explanations

In order to perform the experiment, you’ll be provided with a culture of bacteria, which carries the reporter
gene. You will subdivide the culture into experimental groups, which are subjected to the antibiotics or to
control treatments. The experiment is performed in a 96-well plate (a plastic dish which is divided into 96
individual reaction vessels called ‘wells’). In each well, you will combine 225 µl of the bacterial culture with
25 µl of a ‘10x working solution’. Each treatment is performed in quadruplicates – this means, that each
treatments is replicated (repeated) in four individual wells.

You will prepare 11 different 10x working solutions (see tables 1 & 2). Each 10x working solution contains
water, inducer, and an optional drug. Because you combine the 10x working solution with nine volumes of
bacterial culture, the 10x working solutions will be diluted 10-fold thereby reaching the desired 1x working
concentration.

The first 10x working solutions only contains H2O. Treatment of the bacterial culture with just water will
provide you with a baseline – that means a measure of how active the reporter gene is in the absence of
the inducer arabinose.

The second 10x working solution contains H2O and the inducer (2% arabinose). Treatment of the bacterial
culture with this solution will induce expression of the reporter gene.

All other 10x working solutions contain H2O and the same concentration of the inducer – and additionally
one of the antibiotics. By treating the bacterial cultures with these solutions, you can assess to which
extent the antibiotics affect reporter gene expression in comparison to the bacteria only treated with
arabinose. Ultimately, because these antibiotic block these processes, this approach allows you to test
whether replication, transcription and translation are
required for gene expression.

To prepare the 10x working solutions, you will need to

calculate how much of the compounds you need to add in
order to achieve the desired final concentrations. Each
compound is provided as a concentrated stock solution.
figure 4 shows the principle of sample preparation for
your experiment. The blue tubes in the figure contain
concentrated stock solution. You will prepare the red
tubes with the 10x working solutions and dispense them
into the 96-well plate.

Figure 4: flow diagram showing the compound dilution steps.

5
Instructions for the preparation of the 10x working solutions:

Before the lab exercise: First, you need to prepare 10x working solutions. 10x is laboratory slang for “10-
times as concentrated as in the final reaction”. Use the concentrations shown in table 1 below and the
formula 𝑐" ∙ 𝑉" = 𝑐& ∙ 𝑉& to calculate how to prepare the 10x working solutions. An example of how to
perform these calculations is provided below table 1. The final volume for each 10x working solution is 200
µl. Fill in the calculated numbers in table 2 below (* only) and in the mandatory test at Absalon before
the deadline (you will receive information via Absalon).

At the lab exercise: You are given one optimal 1x working solution concentration for the antibiotics (table
1). In addition, you will test the dose-dependence of the antibiotics. For this purpose, you will test the
antibiotics at the concentration provided, and prepare two additional 10x working solutions which contain
less of the antibiotic (but the same amount of the inducer). You are free to choose the additional dilution
(recommended starting points are 4-fold dilutions for ciprofloxacin and rifampicin and 10-fold dilutions for
chloramphenicol). It would be great, if the groups of a bay choose a range of dilutions, so we can compare
the results and discuss the significance of dose-dependence.

concentration of the solutions

compound (blue tubes) stock 10x working 1x working (optimal)
Inducer (L-arabinose) 20% 2% 0.2%
Ciprofloxacin (Cip) 1.25 mg/ml 100 µg/ml 10 µg/ml
Rifampicin (Rif) 1 mg/ml 200 µg/ml 20 µg/ml
Chloramphenicol (Cam) 1 mg/ml 100 µg/ml 10 µg/ml
Table 1: concentrations of the compound stock solutions, and the desired final concentrations of the
compounds after mixing the 10x working solution with the bacterial culture.

Example for the use of the 𝒄𝟏 ∙ 𝑽𝟏 = 𝒄𝟐 ∙ 𝑽𝟐 formula: 10x working solution 2

The 10x working solution 2 should only contain the inducer (see table 2). The final volume you want to
prepare is 200 µl. The arabinose stock solution is 20%. The desired 1x working concentration is 0.2% à the
10x working solution needs to be 2%. With this information you can calculate the volume of arabinose
stock solution you need:
+, ∙-, &%∙&0012
𝑉" = +.
à 𝑉" = &0%
= 20µ𝑙

This means that you will combine 20 µl of the 20% arabinose stock solution with 180 µl of water to get a 2%
10x working solution. Make similar calculations for 10x working solution 3, 6 and 9.

Calculation of the bacterial density.

The formula above is also applied to calculate the optimal density of the bacterial culture. You will be
informed of the optical density (OD) of the culture handed out (OD: measure for the concentration of
bacteria in the culture). You dilute the bacterial culture to an OD=0.5 a density at which bacteria grow
‘exponentially’.

6
Use this table to note the results of your calculations:

µl of µl of Rif µl of Total
µl of Cip H20
10x working arabinose stock Cam vol.
stock (µl)
sol’n no. stock (µl) stock (µl)
1 200
2 20 180 200
3 * * * 200
4 200
5 200
6 * * * 200
7 200
8 200
9 * * * 200
10 200
11 200
Table 2. 10 x working solutions

The GFP standard

Induction of the reporter will lead to the production of GFP. In principle, the more GFP is produced, the
brighter will be the fluorescence of the bacterial culture. However, just looking at the bacteria this way will
not allow you to quantify accurately how many molecules of GFP have been produced.
To make this possible, you will also prepare a GFP standard – that is to say a measurement curve of known
amounts of GFP. You will be handed a purified solution of GFP protein with a known concentration of GFP
molecules. You will use this to prepare a dilution series (a number of solutions which contain known
concentrations of GFP over a certain linear range) – which you will then dispense into the 96-well plate. The
way you use the standard curve is illustrated in figure 5.

Figure 5. The standard curve

Standard curve Experiment shows the relative fluorescence
intensity (unit: RFU) emitted by
GFP fluorescence (RFU)
GFP fluorescence (RFU)

known quantities of GFP

(concentration in mg/ml). This
allows you to take an
experimental measurement and
read on the standard curve, what
(µg/ml) concentration of GFP the RFU
high drug medium w/o
GFP conc. drug drug
measurement corresponds to.
Conc.
Concentration (arbitrary units)
+Arabinose

7
Experimental procedures

1. Recapitulate the volumes calculated in the mandatory pre-test required to prepare the 10x working
solutions.

2. Label eleven 1.5 ml tubes with numbers 1 – 11.

3. Add the calculated amounts of the compounds to each tube according to table 2 (use a fresh pipet tip
for each pipetting step), and add water to 200 µl. GFP standard

4. Vortex each tube for 5 seconds or use the last pipetting step
1 2 3 4 5 6 7 8 9 10 11 12
to mix (when you add the water, just pipet the whole A
solution up and down five times). B 1 1 1 1 2 2 2 2 1x DH

C 3 3 3 3 4 4 4 4 1:2 Tris

5. Pipet 25 µl of each of the eleven 10x working solution into D 5 5 5 5 6 6 6 6 1:4 LBA

the indicated well on the 96 well plates (see figure 6). E 7 7 7 7 8 8 8 8 1:8

F 9 9 9 9 10 10 10 10 1:16

G 11 11 11 11 1:32

Figure 6. Loading pattern of the 96-well plate

6. Based on the OD595 of the provided plasmid containing culture (written on the blackboard), make a
dilution in fresh 37°C LBA to an OD595 = 0.5 in a volume of 20 ml LBA (use formula on page 4).

7. Pour the diluted culture into the solution basin provided.

8. Using the 8 x multi-channel pipetteman, transfer 225 µl diluted culture into each of the 96-well plate
wells B2-G5. Mix by pipetting up and down by a couple of times. Change tips after each operation!

9. Prepare the dilution series for the GFP standard – see figure 7 for clarification.

a. Label five 1.5 ml tubes with 1:2, 1:4, 1:8, 1;16 and 1:32. Transfer 300 µl Tris-HCl solution into
each of the five tubes (NB. do not add Tris-HCl to the GFP stock).
b. Transfer 300 µl of the undiluted GFP standard (50 μg/ml) and pipet it into the tube labeled 1:2
c. Mix by pipetting up and down
five times. Then transfer 300
µl of this mixed solution to
the tube labeled 1:4. Repeat
this step by transferring 300
stock
µl of the 1:4 diluted solution
to the next tube (1:8), etc.

Figure 7. How to prepare the GFP standard

8
10. Load 250 µl GFP standard into the plate as illustrated in figure 6.

11. Label your plate with your group and bay number (or your names) and pass it to the technician.

Operations performed by the technician:

Note: you do not need to perform these steps, but you will discuss later why these steps are necessary.

1. Well B11: 225 µl of the diluted bacterial culture w/o plasmid and 25 µl H2O.

2. Well C11: 225 µl Tris-HCl + 25 µl H2O.

3. Well D11: 225 ul LBA medium and 25 µl H2O.

4. The microtiter is placed into the microtiter plate incubator adjusted to 1000 rpm at 37°C.

5. Incubation for 2 h. The optical density is measured using the OD595 nm absorbance filter and green
fluorescence is measured using the 480 nm excitation/520 nm emission filters.

6. The two data sets are transferred to Excel. The template is set up for automatic background correction
and graphing. This is why it is important that you load the plate exactly as shown in figure 6.

7. You will be provided with the data sheets on day two of the exercise. Analyse the data as specified in
the report section of the manual.

Materials

E. coli strain DH10B O.N. culture

E. coli strain DH10B/p369 O.N. culture
96-well transparent microtiter plates (Nunc)
96-well plate 37°C incubator
LBA medium: Luria Bertani media supplemented with 100 µg/ml ampicillin.
Arabinose (20%)
Ciprofloxacin (1.25 mg/ml)
Rifampicin (1 mg/ml)
Chloramphenicol (1 mg/ml)
Tris-HCl pH 7.5, 10 mM
GFP (50 ug/ml)
1.5 ml Eppendorf tubes
70% ethanol
8 x multi-channel pipetteman
Sterile H20
Solution basin

9
LEX 2: Positive regulation of the lac promoter via cAMP-
CAP

Bacteria regulate the expression of many genes depending on available food sources. Typically, gene
expression is regulated at the level of transcription, and often transcription is regulated in a simple on-off
switch-like manner through the action of transcriptional activators and/or repressors. The lac operon,
which is responsible for lactose metabolism is a well-studied example (see Essential Cell Biology, 4th edition
page 268-269). Operons are serially arranged genes that are jointly regulated and transcribed as a single
mRNA from a common promoter. Usually, operons encode proteins that are acting in the same pathway –
in the case of the lac operon, the enzyme ß-Galactosidase (encoded by the lacZ gene) breaks down lactose
to galactose and glucose, and the transporter protein permease (encoded by the lacY gene) imports lactose
into the cell. The lac operon contains an additional gene, lacA, whose function, if any, in lactose metabolism
is unknown.

Negative regulation

The lac operon promoter integrates two forms of input that regulate gene expression (see figure 1). First,
the operon senses the presence or absence of lactose through the lac repressor. This protein binds to the
lac operon promoter (to a sequence called the operator) only in the absence of lactose and inhibits
transcription. Lactose (actually 1,6 allolactose) binds to the lac repressor – this induces a conformational
change that renders the repressor
unable to bind the promoter.

Positive regulation

The second level of regulation occurs

through an activator protein called CAP
(encoded by the crp gene). CAP is only
active when bound by the cyclic
adenosine-mono-phosphate (cAMP).
cAMP is only produced by the enzyme
adenylate cyclase (encoded by the cya
gene) when cellular glucose levels fall,
and it therefore becomes necessary to
metabolize alternative sugars.
Regulation of the lac operon through
cAMP-CAP is the topic of this exercise.

Figure 1. The lac operon (from ECB).

10
Experimental design – overview and explanations

In this exercise, we shall demonstrate how three cellular components work together to positively regulate
the lac promoter. These components include the genes 1) crp encoding CAP protein, 2) cya encoding
adenylate cyclase, and 3) the CAP binding site in the lac promoter (see sequence below). Concretely, we
will test whether all three elements are important for the positive regulation of the lac-operon. The CAP
protein, in complex with cyclic AMP (CAP-cAMP) binds and orchestrates transcription activation from the
lac promoter. The CAP-cAMP binding site has the consensus sequence:

5’-TGTGANNNNNNTCACA-3’ (N: G, A, T or C)

The CAP-cAMP binding site is usually located 40-80 bp upstream from the transcription start. Note that
cAMP-CAP regulates other genes in addition to lac.

In the exercise we will transform plasmids containing the lac operon into the bacterium E. coli in which the
chromosomal lac operon has been inactivated. The bacteria can therefore only produce b-galactosidase
from the plasmid-borne lac operon. We visualize b-galactosidase expression on so called MacConkey
plates. Bacteria that express b-galactosidase ferment lactose and produce acid in the process. MacConkey
plates contain a pH indicator and bacteria expressing b-galactosidase consequently produce bright red
colonies.

We shall use two plasmids, plac1 and plac2, that contain the lac operon. One contains a functional CAP-
cAMP binding site whereas the other contains a mutant binding site unable to efficiently bind CAP-cAMP.
The two plasmids are transformed into bacteria, which are treated in a way that enables uptake of foreign
DNA. Such bacteria are said to be competent. The strains used and their genotype is shown below:

Strain name genotype Sø928 is the wild type that expresses both adenylate cyclase and CAP protein.
Sø928 cya+,crp+ Sø1420 expresses CAP protein but not adenylate cyclase.
Sø1420 cya-,crp+ Sø2928 expresses adenylate cyclase but not CAP protein.
Sø2928 cya+, crp-

The following DNA/strain combinations will be used for transformations (figure 2):

Figure 2. Transformations in LEX2

11
Experimental procedures (day 1)

1. Transformation on ice. The technician hands out 2 x 3 tubes, each containing 50 μl competent E. coli
strains: Sø928, Sø1420 and Sø2928.

2. To each tube, add 2 μl plac1 or plac2 (see figure 2). Note: Competent cells are fragile so please keep
the tubes on ice and avoid whirly mixing.

3. Place tubes on ice for 30 min. Flip the tubes gently every 5 min.

While waiting, turn your attention to the theoretical exercise/report or set up the transfection in LEX3
(communicate with the teacher on this).

4. Heat shock: Transfer the tubes to 42°C in the water bath for 1 min. Then immediately place the tubes
on ice for 2 min.

5. Transfer the tubes to room temperature and add 500 μl LB medium. Flip over the tubes a few times
and incubate at 37 °C (heating block) for 45 min. This allows the time needed for expression of the bla
(beta lactamase) gene providing ampicillin resistance. Flip over tubes every 10 min.

While waiting, turn your attention to the theoretical exercise/report or set up the transfection in LEX3
(communicate with the teacher on this).

6. Centrifuge the tubes at maximum speed for 1 min and pipet off (discard) 450 µl of the supernatant.
Gently, resuspend the cell pellet by pipetting.

7. Prepare two MacConkey plates and divide each into three zones using a speed marker. Draw on the
bottom of the plates (figure 3). Label the plates with plac1 and plac2, respectively.

8. Pipet 25 μl transformation mixes onto a MacConkey plate as indicated below. Note: plac1 and plac2
transformations are plated on two different plates. Do not bring the bacteria into the sterile hood!

9. Leave the plates to dry without a lid (about 15 min). Then return the lid onto plate, and place the plate
in the 37 °C incubator in an inverted position (so the agar is on top).

Day 2

1. Take the plates out of the incubator and discuss the results.

12
Figure 3. How you should label and plate transformations on your MacConkey plates.

Materials

Container with ice.

Heat cabinet, 30°C; Shaker, 37°C; Heat block; 37°C; water bath, 42°C.
Plasmid DNA plac1 (0.1 µg/µl) and plac2 (0.1 µg/µl).
Competent E. coli strains Sø928, Sø1420, Sø2928 on ice, 50 μl per tube.
LB medium: 1% bactotryptone, 0.5% yeast extract, 1% NaCl, pH 7.5.
MacConkey agar plates with 25 μg/ml ampicillin, 2 plates per team.

MacConkey agar per liter:

Peptone, 17 g.
Proteose peptone, Difco, 3 g.
Lactose, 10 g.
Bile salts No. 3, 1.5 g.
NaCl, 5 g.
Agar, 13.5 g.
Neutral red, 0.03 g
Crystal violet, 0.001 g.

13
LEX 3: The compartmentalized cell:
Intracellular protein sorting

Eukaryotic cells contain intracellular compartments/organelles that perform essential cellular functions
(Figure 1). Each organelle has a specific protein content, which may vary across the cell cycle. Small signal
sequences or signal patches inscribed in the primary amino acid sequence direct sorting of the relevant
proteins at the subcellular level. In this exercise, we will illustrate how signal sequences impact protein
subcellular localization. Protein subcellular localization can sometimes be determined by looking at the
sequence (i.e “by eye”). Alternatively, bioinformatics freeware can be used to predict which organelle a
protein is destined for. Finally, by fusing the gene encoding a protein of interest with a gene encoding a
fluorescent protein such as GFP, we can visualize directly protein subcellular localization using fluorescence
microscopy. We shall use each of these strategies in this exercise. For more details on manual and
bioinformatics sequence analysis, please refer to Kasper Andersen’s Absalon lecture. Please refer to Box 1
for a description of intracellular protein sorting mechanisms and to Box 2 for how to introduce naked DNA
into cells.

Figure 1: Common cellular compartments of eukaryotic cells

14
Box 1.
A series of molecular pathways have evolved to perform intracellular sorting. Organelle targeted
proteins carry specific signals. Typically, the protein contains a ‘signal peptide’ sequence or
“signal patch”. Alternatively a post-translational modification can direct a protein to the correct
organelle. There are four major mechanisms by which proteins can be sorted into different
destinations.

1) Transport through gates/pores. Nuclear proteins are translated in the cytosol and transported
to the nucleus via recognition of their encoded nuclear localization signals (NLS) by a specific
class of intracellular nuclear transport receptors (importins). These receptors interact with the
nuclear pore complexes, which are the gates in and out of the nucleus. GTP hydrolysis drives
nuclear transport through the nuclear pore complex and, importantly, nuclear proteins are
transported through the nuclear pore complexes in their fully folded conformation. Not
surprisingly, nuclear export receptors (exportins) also exist to mediate nuclear export, e.g., of
ribosomes.

2) Transport through translocation channels. Proteins destined for ER, Golgi, the plasma
membrane or secretion from the cell must enter what’s known as the “the secretory pathway”.
Ribosomal translation of these proteins is initiated in the cytosol, after which the ER signal
sequence is recognized by the signal recognition particle (SRP), which is then recruited to the ER
membrane via the SRP-receptor creating what’s known as rough ER. The nascent polypeptide
chain is then transfered to ER via the translocon. ER-destined proteins are initially translocated in
their fully unfolded conformation. ER localized proteins are retained via a retention signal.
Proteins destined for the mitochondria are also translocated from the cytosol into the encoded
organelle in their unfolded conformation.

3) Vesicular transportation. ER-translocated proteins destined for the Golgi, plasma membrane,
or extracellular space is sorted from the ER to the Golgi through vesicular transport. COPII coated
cargo-containing vesicles are pinched of from the ER and fuse with cis-Golgi membranes where
their protein contents is released for further processing. Only fully folded proteins are sorted by
COPII coated vesicular transportation. Furthermore, proteins destined for the plasma membrane or
secretion is sorted from the trans-Golgi network (TGN) in vesicles containing another class of
coat proteins.

4) Post translation modification-mediated targeting. Lysosomal targeting of proteins is

mediated via a specific post-translational modification that is recognized by a specific receptor
residing in the TGN. Proteins targeted to the lysosome are labeled post-translationally by an N-
glycan modification (mannose-6-phosphate), which is recognized by the mannose-6-phosphate
receptor that redirects these lysosomal proteins from the TGN via vesicular transport to the
endosomes and lysosomes. Thus, proteins targeted to lysosomes are sorted in their fully folded
conformation.

15
Box 2. Experimental design – overview and explanations
The aim of the experiment is to visualize protein subcellular localization in cells. To demonstrate this,
human cultured cells are transfected with plasmids that encode fluorescent reporter proteins, which
are fused to protein sequences from specific compartment localized proteins. After 24h, the cells are
then observed under a fluorescent microscope. A schematic drawing representing the plasmids is
shown in the figure below. In the experiment you will choose two plasmids from a collection of five
constructs. Please ensure that all five different plasmids in the collection are used within each group
of eight students.

A schematic drawing of a mRNA encoding a GFP fusion protein targeted to a specific

organelle. Note that the usual plasmid sequences (origin of replication, antibiotic resistance gene) are
omitted for simplicity. The orientation of GFP reporter and signal peptide sequence can be also be
reversed – the GFP could come first, and the peptide sequence could reside in the C-terminus of the
fusion protein.

Many transfection protocols rely on special lipids which are combined with the DNA and then added
to the cells (see figure below). The DNA and the lipids form a complex, which is taken up by the
cells by endocytosis. Once inside the cell, the endosome releases the DNA.

A common transfection technique. DNA-lipid complexes shown to be taken up by eukaryotic cells.

Not shown is that the DNA must enter the nucleus to be transcribed. Protein encoding RNAs must be
exported to the cytoplasm for translation.

16
Experimental procedures (day 1)
Transfection: Choose 2 plasmids/team so that all 5 plasmids will be used in each booth. DNA sequences
encoding signal peptides of the relevant fusion proteins are shown in the table on page 25.

1. Mix 55 µl of OPTI-MEM with 1.1 µl of X-treme GENE HP in a 1.5 ml 1

55 ul OPTI-
tube and dispense 25 µl into two new tubes. MEM
1.1 ul Xtreme-
gene HP

2. Mix 22 µl of OPTI-MEM with 2.8 µl of plasmid DNA (100 ng/µl) in a 25 ul 25 ul

1.5 ml tube for each DNA.

3. Add the total volume of the diluted DNA solution (from step 2) into
25 µl of the diluted X-treme GENE HP solution (step 1), then mix it by 3
all all
pipetting and incubate for at least 10 min at room temperature. Note
the order of addition: Add DNA solution into the X-treme GENE HP 2
22 ul OPTI- 22 ul OPTI-
and not vice versa!!! MEM MEM
2.8 ul 2.8 ul
Plasmid 1 Plasmid 2
4. (Optional): Spin down tubes briefly and only if necessary to collect all
Figure 3: Illustration of trans-
droplets to the bottom, otherwise skip this step.
fection sample preparation

5. Add all the DNA/X-treme GENE HP solution drop-wise to cells.

6. Incubate cells over-night in CO2 incubator.

Experimental procedures (day 2) (Steps 1-5 are carried out by the technician)

1. Add 2 µl of the Hoechst solution to each well.

2. Shake the plate gently.

3. Incubate cells for at least 10 min at room temperature.

4. Fix PFA 10 min (use in the hood!)

5. Wash with PBS (3 x 5 min.).

6. Image samples using the inverted fluorescence microscope together with the teacher

17
Materials:
* X-treme GENE HP DNA Transfection Reagent (cationic lipids for transfection).
* OPTI-MEM (serum-free medium for DNA/lipid dilution).

* Plasmid DNAs at 100 ng/µl.

* HeLa cells in a 24-well plate

* Hoechst solution (1 µg/µl).

18
Report and exercises

Note that there are two theoretical exercises in the LEX 2 section below which you are expected
to work on during the incubation periods of the bacterial transformation in LEX 2.

LEX1
1. Look at the OD and fluorescence data. What does each of these parameters reflect?

2. How does bacterial growth respond to added inhibitor? Explain this!

3. How does GFP fluorescence respond to added inhibitor? Which processes are required for gene
expression?

4. Compare the growth and fluorescence of samples 1-2. Based on you knowledge of transcription
regulation in bacteria, propose how this result came about.

19
5. In the Excel template, the background corrections listed below were made. Discuss why these
corrections are necessary.

• Fluorescence: B2 through G5 minus B11.

• Optical density: B2 through G5 minus D11.
• GFP standard: B10 through G5 minus C11.

6. In this question we shall see that it is possible to make a calculation of the average number of GFP
molecules synthesized per cell per min during the experiment (3 h). For this purpose you need to use
the GFP standard curve.

You will need the following information: 1 OD595/ml corresponds to 109 bacteria, the molecular weight
of GFP is 27 kDa, Avogadros number (the number of molecules in one ‘mole’) is 6.023 x 1023. Start by
taking the reading of the ‘arabinose only’ treated bacterial sample.

7. In the present experiment we made a very simple type of experimental replication (4 replicates per
sample 1-11 in the microtiter plate). What can this type of experimental replication tell us?

8. In principle each team made the same experiment (or close to the same experiment), providing 12
independent experimental repetitions. How might this impact our conclusions?

20
LEX2
1. Were all the transformations successful? (It may be relevant to look at what components the growth
medium contains). Do you observe differences between the different strains?

2. Which transformations give rise to b-Gal expression? Can you explain the pattern of b-Gal expression
with your knowledge of how the lac operon is regulated?

21
Sequence analysis of the lac promoter – theoretical assignment (day 1)
1. Inspect the sequences below and identify the CAP binding site. What is its function?
2. Identify the differences between the wild type and mutant sequences. How do you imagine the
mutations might impact lac expression?
3. Using the restriction enzymes below, suggest an experiment that would allow a simple distinction of
the sequences.

Sequence of the lac promoter:

Sequence of lac promoter carrying mutations:

Some restriction enzymes and their corresponding restriction sites:

Sequences of the wt and mutant lac promoters and of selected restruction sites.

22
Construction of a restriction map – theoretical assignment (day 1)
Below we have a restriction map illustrating plac1 (figure, left). A restriction map is a low resolution all-
encompassing map indicating the localization of known restrictions sites on a DNA sequence. Such a map
can be derived using data from a restriction analysis (figure, right) and it provides the researcher with the
overall structure of the DNA construct. Sequencing of the construct is then used to give detailed
information of selected regions of interest or, more rarely, of the entire plasmid.

Plasmid map (left) and restriction analysis (right) of plac1.

Logic of the double digest explained

Let’s assume we have two hypothetical restriction endonucleases (restriction enzymes), REase1 and
Rease2. We want to determine how many restriction sites there are for each on a given DNA sequence,
and where these restriction sites are located relative to one another. To determine how many
restriction sites there are for each restriction endonuclease, we carry out a restriction digest of a DNA
of interest, separate resulting DNA fragments on a gel, stain with ethidium bromide and determine the
number of resulting bands and their position. If the starting DNA is circular, a gel showing one band that

4.2 kbp
migrates differently from the same undigested DNA, indicates one restriction site for the enzyme, and
the position of the band relative to a marker reflects its size in base pairs. Two bands mean two
restriction sites, and so forth. If we carry out separate analyses for REase1 and REase2, it is therefore
possible to determine how many restriction sites there are for each. But this analysis does not yield
information about the localization of REase1 and REase2 restriction sites relative to one another. To
position REase1 and REase2 restriction sites relative to one another, we carry out a double digest and
analyze the resulting DNA fragments. The fragments generated and hence band position informs us of
the distance between REase1 and REase2 restriction sites.

23
The result of a double digest restriction analysis experiment is shown in the figure above. In this
experiment, plac1 was digested with a combination of restriction enzymes as indicated above each lane,
and the resulting DNA fragments were analyzed by gel-electrophoresis along with two size markers (lane 1
and lane 8). We know the positions of BamHI, ClaI, EcoRI, HindIII, and SmaI. Your job is to position the BglII
site(s) on the plasmid map.

Note: A similar exercise is provided in ECB 4th ed. Page 357 Question 10-11.
Questions:
1. Determine how many BglII sites there are in plac1.

2. Determine the approximate size of DNA fragment(s) resulting from BglII digestion in kbp.

3. Determine the position of the BglII site(s) relative to the other restriction sites in plac 1. Indicate this
with a pen or pencil on the map above and indicate the distance to the nearest neighbor restriction site
in kbp.

24
LEX3
In the Table below, select the two partial DNA sequences that correspond to the plasmids you used for
transfection on day 1. Identify the encoded peptide sequence by translating the two DNA sequences into
protein sequence using the online translate tool at: http://web.expasy.org/translate/ . (NB: All sequences
A-F, encode the N-terminal part of the protein, except sequence E that encodes the C-terminal part of the
protein).

1.
Partial plasmid sequence encoding signal peptides

Signal peptide encoded gene sequence in FASTA format Targeted organelle/Accession

number/Function
>Plasmid A
ATGCCAGAGCCAGCGAAGTCTGCTCCCGCCCCGAAAAAGGGCT
CCAAGAAGGCGGTGACTAAGGCGCAGAAGAAAGGCGGCAAGAA
GCGCAAGCGCAGCCGCAAGGAGAGCTATTCCATCTATGTGTAC
AAGGTTCTGAAGCAGGTCCAC

> Plasmid B
ATGGGCAGCGTGCTGACCCCCCTGCTGCTGCGCGGCCTGACCG
GCAGCGCCCGCCGCCTGCCCGTGCCCCGCGCCAAGATCCACAG
CCTGCCCCCCGAGGGCAAGCTGCTCGAGCTCAAGCTTCGAATT
CTGCAGTCGACGGTACCGCGG

> Plasmid C
ATGGCTCACCTAAAGCGACTAGTAAAATTACACATTAAAAGAC
ATTACCATAAAAAGTTCTGGAAGCTTGGTGCAGTAATTTTTTT
CTTTATAATAGTTTTGGTTTTAATGCAAAGAGAAGTAAGTGTT
CAATATTCCAAAGAGGAATCA

> Plasmid E
GAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAG
AGGACAAGGAGGATGATGAGGACAAAGATGAGGATGAGGAGGA
TGAGGAGGACAAGGAGGAAGATGAGGAGGAAGATGTCCCCGGC
CAGGCCAAGGACGAGCTGTAG

> Plasmid F
GTTATTAAAGAATTTATGCGTTTTAAAGTTCGTATGGAAGGTT
CAGTTAATGGTCATGAATTTGAAATTGAAGGTGAAGGTGAAGG
ACGTCCATATGAAGGTACACAAACAGCAAAATTAAAAGTTACA
AAAGGTGGTCCATTACCAT

2. Subcellular sorting signals can in some cases be readily identified “by eye”. In our case, it is possible to
assign a subcellular localization for the proteins encoded by sequence A and sequence E. Determine in
which organelle those proteins are localized (use the table below).

25
Common localization peptide signals

Protein A:

Protein E:

In other cases, it is not possible to identify a signal sequence or signal patch “by eye”. In such cases a
bioinformatics tools can be helpful. Bioinformatic tools to predict protein localization has been developed.
Here we test one: Target P1.1. Target P1.1 is designed to discriminate between proteins destined for
“chloroplast (C)” (only in plant cells), “mitochondria (M)”, “secretory pathway (S)”, “other (_)” (typical
nuclear or cytosolic), or “don’t know/below cut-off (*)”.

3. Returning to the sequence encoded by your chosen plasmids (A-F), copy the protein sequences into the
“submission box” at the Target P1.1 webserver (http://www.cbs.dtu.dk/services/TargetP/) and
“submit”. (take one protein sequence at a time or do both simultaneously by pasting them into the box
in “FASTA format” (see below)).

The output of Target P1.1 provides the “name” of the sequence in the first column and the target
localization “loc” in the second last column (C, M, N, S, _, or * ). The last column is a score indicating how
good the predicted localization is (1 is the strongest prediction and 5 is the weakest). See also the “Explain”
-link at the out-put page.
FASTA format:
“FASTA format” works in most web based tools to process several sequences of DNA, RNA, or protein
simultaneously. Each input sequence is defined by two lines: one line with the name of the sequence (e.g. A
to F in this exercise) preceded by a “>” and a second line with the actual sequence. A FASTA format file
with two sequences looks as shown below:

>Sequence name 1
sequence 1
>Sequence name 2
sequence 2

26
4. For the two chosen peptide sequences, identify the full length protein that these partial sequences
were derived from? Use NCBI’s BLASTP (http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins) against
“reference proteins” only (for E protein blast use Reference proteins (refseq_protein) and for F protein
blast use non-redundant protein sequences (NR)).

Protein 1:
Protein 2:

5. Based on the fluorescence microscopy results, determine the subcellular localization of the protein
encoded by the chosen plasmids used for transfection.

Protein 1:
Protein 2:

6. You have now used three methods to determine subcellular protein localization. Compare the results
obtained using the “by eye” method (sequence A and E), Target P1.1 and your own transfections.

27
Glossary:

Arabinose operon A genetic element that encodes the enzymes to metabolize the
sugar arabinose. The operon is only expressed in the presence of
arabinose.

𝑐" ∙ 𝑉" = 𝑐& ∙ 𝑉& Formula to calculate a dilution of a concentrated stock solution into
a less concentrated working dilution.

c1: concentration of the stock solution

V1: volume of the stock solution required
c2: desired final concentration of the working solution
V2: desired final volume of the working solution

Usually, the unknown variable is V1

cAMP cyclic adenosine monophosphate is an

important second messenger substance in
biology. In bacteria, it is produced by the
enzyme adenlyate cyclase in response to low
glucose levels. cAMP stimulates expression
of genes that help to cope with low glucose
(e.g. by metabolizing other sugars) by binding to the CAP protein,
which then can act as a transcriptional activator.

Ciprofloxacin Antibiotic that inhibits replication.

Acts by inhibiting Topoisomerase II, which is required for proper

separation of DNA strands following replication.

Chloramphenicol Antibiotic that inhibits translation.

Act by binding the bacterial ribosome and inhibits the formation of

bonds between amino acids during translation (technical term: the
peptidyl transferase activity of the ribosome is blocked).

Dose dependence Many chemicals display dose dependence in regard to the

biological reactions they stimulate. This means that the maximal
effect they have depends on the concentration at which they are
applied. This is particularly important in a medical context: often,
drugs have a beneficial effect at a certain concentration, but no
effect at a too low, and/or toxic effects at a too high concentration.

28
GFP Green Fluorescent protein: a jellyfish protein that emits green light
when stimulated by light of the appropriate wavelength.

The plasmid used contains a GFP variant containing the “enhanced”

S65T mutation as well as several other mutations that improve the
folding inside E. coli. S65T changes the excitation spectrum of GFP
from approximately ~390 nm to ~490 nm, i.e., from UVA to blue
light.

(GFP) standard Generally, a standard is a range of solutions that contain known

amounts of a given substance. Standards are used to establish a
correlation between the units of an arbitrary measurement (for
example absorption or fluorescence) with those known quantities
of the substance measured.

Operator A DNA sequence recognized by the lac repressor protein. When the
operator is bound by the lac repressor, the lac operon cannot be
transcribed.

Operon A cluster of genes coding for multiple proteins, that is transcribed

as a single mRNA under the control of a single promoter. Often,
operons encode proteins that are jointly responsible for a common
process. For example, the tryptophan operon encodes enzymes
necessary to synthesize the amino acid tryptophan.

optical density A measure of the density of a bacterial culture.The higher the

number, the higher the number of bacteria in the culture. the
optical density (the OD595) is obtained by shining light of 595 nm
wavelength on the bacterial sample and measuring how much of
that light had been absorbed by the bacteria in the culture.

Plasmid A circular molecule of DNA, that serves as an extrachromosomal

information carrier in bacteria.

Plasmids are widely used in molecular biology as vehicles for

recombinant DNAs. They contain an origin of replication (allowing
extrachromosomal replication) and often an antibiotic resistance.
The latter allows to eliminate all bacteria that do not carry the
plasmid.

Reporter Gene A synthetic DNA ‘construct’ that allows to visualize and measure
gene expression. Generally, reporter genes make use of a proteins
not normally produced in the organism that is being analysed. In
this case, the fluorescent GFP protein serves as reporter.
Transcription is initiated under the control of the arabinose
promoter.

RFU Relative Fluorescence Units – RFU is usually quantified in RFU. Since

RFU is an arbitrary number, it is important to use a standard to
correlate RFUs to the actual concentration of the molecule you
measure.

29
Rifampicin Antibiotic that inhibits transcriptions.

Binds to RNA polymerase and blocks transcription initiation.

Signal peptide A short amino acid sequence found in the primary sequence of a
protein that targets it to its subcellular localization or
compartment.

Signal peptides are recognized by specific receptor proteins which

bind to the signal peptide and then mediate correct localization of
the targeted protein.

Transfection Technique(s) that force eukaryotic cells in culture to take up DNA.

Often, the DNA of interest is incubated with cationic lipids, which
mediate the transfer of the DNA across the cell membrane.

Transformation Technique(s) that force bacterial cells to take up DNA.

30